WO2004078984A1 - Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo - Google Patents

Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo Download PDF

Info

Publication number
WO2004078984A1
WO2004078984A1 PCT/EP2003/002264 EP0302264W WO2004078984A1 WO 2004078984 A1 WO2004078984 A1 WO 2004078984A1 EP 0302264 W EP0302264 W EP 0302264W WO 2004078984 A1 WO2004078984 A1 WO 2004078984A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
promoter
human animal
cells
compound
Prior art date
Application number
PCT/EP2003/002264
Other languages
English (en)
Inventor
Ann Trudo Josée BELIËN
Janine Arts
Ann Odette Adolf MARIËN
Original Assignee
Janssen Pharmaceutica N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Pharmaceutica N.V. filed Critical Janssen Pharmaceutica N.V.
Priority to PCT/EP2003/002264 priority Critical patent/WO2004078984A1/fr
Priority to JP2006504535A priority patent/JP4545142B2/ja
Priority to CNA2004800058454A priority patent/CN1756846A/zh
Priority to AT04716577T priority patent/ATE516359T1/de
Priority to CN2012102237690A priority patent/CN102766602A/zh
Priority to US10/547,518 priority patent/US7666670B2/en
Priority to AU2004217817A priority patent/AU2004217817B2/en
Priority to PCT/EP2004/002195 priority patent/WO2004078985A1/fr
Priority to ES04716577T priority patent/ES2368328T3/es
Priority to NZ542577A priority patent/NZ542577A/en
Priority to EP04716577A priority patent/EP1601775B1/fr
Priority to CA2516519A priority patent/CA2516519C/fr
Priority to DK04716577.4T priority patent/DK1601775T3/da
Publication of WO2004078984A1 publication Critical patent/WO2004078984A1/fr
Priority to IL170611A priority patent/IL170611A/en
Priority to NO20054554A priority patent/NO334878B1/no

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0271—Chimeric animals, e.g. comprising exogenous cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0393—Animal model comprising a reporter system for screening tests

Definitions

  • This invention relates to an animal model for neoplastic growth, in particular cancerous growth.
  • the animal model allows for the identification of pharmaceutical active compounds in vivo, comprising the use of tumor cells stably transfected with an expression vector comprising a reporter gene operably linked to a promoter that also controls expression of a protein associated with tumor regression, stabilization of tumor growth or inhibition of metastasis.
  • the present in vivo models with which potential anti-neoplastic agents are tested involve implanting tumor cells into a non-human animal, treating the animal with the proposed new anti-neoplastic agent, and then monitoring the animals to determine the effect of treatment on the growth of the tumor.
  • many in vivo models use tumor cells stably transfected with a reporter gene such as the luciferase family and aequorin family of bioluminescent molecules.
  • the tumor cells with a reporter gene which is activated by the amtitumoral agent, are grown in a biocompatible semi-permeable encapsulation device, which is implanted in the non-human animal and removed after exposure of the animal to the compound to be tested.
  • a biocompatible semi-permeable encapsulation device which is implanted in the non-human animal and removed after exposure of the animal to the compound to be tested.
  • the present invention discloses a new animal model that has the ability to truly mimic the pharmacological activity of a proposed anti-neoplastic compound in vivo.
  • the present invention provides a tumor cell line stably transfected with an expression vector containing a reporter gene, preferably a fluorescent protein, operably linked to a promotor that also controls expression of a protein that is associated with tumor regression, characterised in that said cell line is capable to form a tumor when implanted or injected into the non-human animal.
  • a reporter gene preferably a fluorescent protein
  • the present invention differs in that the reporter gene is not constitutively expressed, but only after exposure to a test compound that results in the expression of a protein or enzyme associated with tumor regression. Only when a compound to be tested got into circulation and infiltrated the tumor it may generate the reporter signal, provided it promotes the expression of a protein associated with tumor regression and the promoter of said protein is operably linked to the reporter gene.
  • the model is highly advantageous over prior in vivo models, since the turnover time to test the in vivo pharmaceutical activity of proposed anti-neoplastic compounds is reduced.
  • the traditional in vivo models it typically takes 4 to 5 weeks to obtain a result
  • the present model once the tumor is formed in the non- human animal, it is possible to see the effects of a test compound in a couple of days. Further, in view of the brightness of the fluorescent signal, the tumors can be seen through the skin and measured using an automated whole-body imaging system. As a consequence a lower number of animals is needed to obtain statistical significant effects.
  • the promoter consists of the p21 promoter.
  • the p21 protein acts as an inhibitor of cyclin-dependent kinase activity and effectively stops cell-cycle progression. It has been shown a wide variety of anti-tumoral agents activate the p21 promoter, including DNA damaging agents and histone deacetylase inhibitors that activate the p21 promoter through the p53 responsive element (located at the -4500 bp to -1300 bp region relative to the TATA box) or spl sites (located at the -60 bp to +40 bp region relative to the TATA box), respectively and leading to increased expression of the p21 protein.
  • the p21 promoter consists of a p21 1300 bp promoter fragment characterised in that said promoter fragment, does not comprise the p53 responsive elements and accordingly is non-responsive to DNA damaging agents.
  • the p21 promoter consists of a p21 promoter comprising the p53 responsive elements, said p21 promoter being responsive to DNA damaging agents. Accordingly, based on the promoter used, the present invention provides a model selective for the in vivo pharmacological effects of either DNA damaging agents and or of histone deacetylase inhibitors. Or in general, depending on the neoplastic agents of interest, alternative response elements could be used.
  • the reporter gene is a fluorescent protein and the expression of the reporter gene is measured as the amount of fluorescent light emitted.
  • the in vitro screening method is selective for histone deacetylase inhibitors and comprises tumor cells stably transfected with an expression vector comprising a p21 1300bp promoter fragment characterised in that said promoter fragment does not comprise the p53 responsive elements.
  • the present invention provides non-human animals for screening the pharmaceutical activity of a compound, said animal comprising a stably transformed tumor cell according to the invention.
  • Said tumor cells could be surgically implanted or injected as a tumor cell suspension under the skin of the non-human animal to provide a subcutaneous model, into the organ of tumor origin (for example lung tumor cells into the lungs) to provide an orthotopic model, into the peritoneal cavity of the non-human animal to provide the peritoneal model, or into the blood vessels of the non-human animal to provide the metastasis model.
  • the tumor cells are injected subcutaneously to provide the subcutaneous model.
  • FIG. 1 A Dose response of the p21 promoter construct to DNA damaging agents and histone deacetylase inhibitors (HDACi) of clone 1.
  • Cells are treated for 24h with the indicated compounds, i.e. the DNA damaging agents campthotecin (camp.), bleomycin (bleo) and doxorubicin (dox) and the HDACi compounds TSA, Mitsui, compound X and SAHA.
  • Figure 1 B Dose response of the p21 promoter construct to DNA damaging agents and histone deacetylase inhibitors (HDACi) of clone 5.
  • Cells are treated for 24h with the indicated compounds, i.e. the DNA damaging agents campthotecin (camp.), bleomycin (bleo) and doxorubicin
  • FIG. 1 In vivo visualisation of xenograft fluorescence.
  • Clone 1 was subcutaneous injected (10 7 cells/200 ⁇ l) into the flank of nude mice. From day 12 on, animals were dosed daily during 6 days with Solvent, Mitsui (20 mpk) or compound X (40mpk). Tumors in living mice were evaluated for fluorescence the in house developed Automated Whole Body Imaging System and fluorescence intensity was compared. Induction of ZsGreen was very clear 3 days after administration of the first dose and reached a plateau 5 days after starting the treatment.
  • the present invention relates to a vector comprising a reporter gene operably linked to a promoter that also controls the expression of a protein or enzyme the expression level of which is associated with a physiological condition.
  • Operably linked means functionally fusing a promoter with a gene in the proper frame to express the gene under control of the promoter.
  • reporter gene means a gene encoding a gene product that can be identified using simple, inexpensive methods or reagents and that can be operably linked to the promoter region or an active fragment thereof.
  • Reporter genes such as, for example, a firefly luciferase, ⁇ -galactosidase, alkaline phosphatase, the bacterial chloramphenicol acetyl transferase or a fluorescent protein reporter gene, can be used to determine transcriptional activity in screening assays according to the invention (see, for example, Goeddel (ed.), Methods Enzymol., Vol. 185, San Diego: Academic Press, Inc. (1990); see also Sambrook, supra).
  • the reporter gene is a fluorescent protein, in particular a fluorescent protein selected from the group consisting of EGFP, EYFP, DsRed, ZsGreen, Zs Yellow, HcRed or destabilized fluorescent proteins such as pDsRed, pHcRedl, pd2EGFP or pd2EYFP.
  • Said reporter molecules and the gene sequences thereof are known in the art and are commercially available such as the fluorescent proteins sold by Clontech, San Diego, Califonia.
  • the vectors according to the invention can be chosen or constructed from commercially available vectors such as pCAT3, pGL2, pGL3 or pSV- ⁇ -Galactosidase and typically comprise appropriate regulatory sequences as well as one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector.
  • the vectors of the present invention contain as one of the regulatory sequences a promoter sequence not only compatible with the host cell for which the expression vector is designed but also responsive to compounds, including proteins, peptides, oligonucleotides and small molecules, known to have a desired physiological effect in the respective host cell.
  • the promoter sequence in the expression vectors of the present invention comprise at least one regulatory sequence element, also known as responsive element, characterized in that it regulates expression of the linked reporter gene and is activated due to the binding or release of a transcription factor, wherein the presence or absence of said transcription factor is correlated with the desired physiological condition of the host cell.
  • the promoter sequence may comprises the GC-rich motifs found in the proximal part of the p2l WAF Clpl promoter which are known to be activated upon exposure to p21 activators such as the transcription factors Spl and Sp3 as well as other inducers of cell cycle arrest and cell differentiation such as steroid hormones, nerve growth factor, tumor necrosis factor- ⁇ , phorbol esters, phosphatase inhibitors, intereferon ⁇ , and the Smad tumor suppressor proteins.
  • the promoter as used herein may either be a naturally occuring promoter, such as the p2i WAF"1/ClP1 promoter that also controls the expression of a protein the expression level of which is dependent on the desired physiological condition or fragments thereof having promoter activity such as the p21 1300bp promoter fragment as described in the examples hereinafter.
  • the promoter sequence consists of a recombinant DNA construct comprising one of the aforementioned regulatory sequence elements, such as the p53 responsive elements operably linked to minimal promoter elements such as the minimal interleukin 6 (IL6) promoter (phu.IL6Pluc+ Plaisance et al.
  • IL6 minimal interleukin 6
  • the promoter sequence will be a promoter that also controls expression of a protein that is associated with tumor regression or a fragment thereof having promoter activity.
  • Target cells in another aspect relates to a target cell stably transformed with an expression vector comprising a reporter gene operably linked to a promoter that also controls the expression of a protein or enzyme the expression level of which is associated with a physiological condition.
  • the vector constructs as described above can be introduced into the target cells by means of any known method such as transfection or transduction, preferably using standard transfection methods such as liposomes, calcium phosphate precipitation, electroporation and use of a gene gun.
  • the vectors according to the invention will be introduced in target cells capable to form a tumor when implanted or injected into the non-human animal.
  • suitable cell lines include melanomas, lung tumor lines, renal tumor lines, colon tumor lines, prostate tumor lines, ovarian tumor lines, breast tumor lines, central nervous system tumor lines, leukemic cell lines, etc.
  • the target cells consists of an ovarian tumor cell line, in particular A2780 (ECACC No. 93112520).
  • Further target cells can be selected from various cell lines, which include various mammalian cell lines, especially human cell lines.
  • the target cells as used herein include any of the aforementioned cells, already transformed with an expression system for a selection marker such as neomycin, a therapeutic protein such as methioninase or a reporter gene product.
  • a selection marker such as neomycin
  • a therapeutic protein such as methioninase or a reporter gene product.
  • the target cells capable to form a tumor when administered to a non-human animal are already transformed with an expression system encoding a reporter protein such as firefly lucif erase or a fluorescent protein (see above).
  • These cells may be transformed with an a vector according to the invention, provided the emission wavelengths of the luminescent proteins, i.e. the reporter gene providing the basal colour and the vector according to the invention providing the inducible colour, do not overlap with one another.
  • these cells allow an efficient detection of the whole tumor, for example to establish when the administered tumor cells had sufficient time to form a tumor in said non-human animal, in combination with the inducible system described herein to study the anti-neoplastic activity of a test compound.
  • the compound to be tested enters the tumor via passive diffusion and/or angiogenesis.
  • the choice of the target cell will depend on the physiological condition to be investigated.
  • a stably transformed tumor cell line which has been transfected with an expression vector containing a reporter gene operably linked to a promoter that also controls expression of a protein that is associated with tumor regression.
  • a stably transformed ovarian carcinoma cell line preferably A2780 cells comprising an expression vector containing a nucleic acid sequence encoding a fluorescent protein operably linked to a promoter that is responsive to p21 activators, preferably said promoter comprising the 1300 bp p21 promoter sequence (SEQ ID No.l), even more preferably said promoter sequence consisting of the 1300bp p 21 promoter sequence (SEQ ID No.l).
  • the fluorescent protein is selected from the group consisting of EGFP, EYFP, DsRed, ZsGreen, Zs Yellow, HcRed or destabilized fluorescent proteins such as pDsRed, pHcRedl, pd2EGFP or pd2EYFP and in a specific embodiment the fluorescent protein consists of ZsGreen.
  • the stably transformed cells are selected from the clones deposited at the Belgian Coordinated Collection of Microorganisms (BCCM) on January 20, 2003 as pGL3-basic-ZsGreen- 1300-clone 1 and pGL3-basic-ZsGreen-1300-clone 2 with the respective accession numbers LMBP 5958CB and LMBP 5959CB .
  • Said clones comprise an expression vector derived from the commercially available pGL3 vector and containing a nucleic acid sequence encoding ZsGreen operably linked to a promoter that is responsive to p21 activators, said promoter comprising the 1300 bp p21 promoter sequence (SEQ ID No.l), wherein said clones are characterized in that they have a low basal fluorescence expression which upon induction with known inducers of cell cycle arrest and cell differentiation such as Mitsui (a.k.a. MS-275 - Shering - Registry Number 209783-80- 2), allow detection of the fluorescence by means of an automated whole-body imaging system. In view of these characteristics, i.e.
  • said clones provide an important tool to study the in vivo pharmaceutical activity of proposed anti-neoplastic compounds.
  • PK pharmacokinetics
  • PD pharmacodynamics
  • the cell lines are transformed with an expression vector comprising a promoter sequence consisting of a recombinant DNA construct comprising one of the aforementioned regulatory sequence elements, such as the p53 responsive elements operably linked to minimal promoter elements such as the minimal interleukin 6 (JJ 6) promoter (phu.IL6Pluc+ Plaisance et al. (1997) MCB 17, 3733- 3743), the minimal E1B promoter (pMCSluc commercially available from Stratagene) or the commercially available TK promoter for luciferase (pTKluc Promega).
  • JJ 6 minimal interleukin 6
  • pMCSluc commercially available from Stratagene
  • TKluc Promega commercially available TK promoter for luciferase
  • the invention provides stably transformed tumor cell lines which have been transfected with an expression vector containing a reporter gene operably linked to a promoter sequence consisting of a recombinant DNA construct comprising a regulatory sequence element operably linked to a minimal promoter element, characterized in that said promoter sequence responds to compounds associated with tumor regression.
  • a reporter gene operably linked to a promoter sequence consisting of a recombinant DNA construct comprising a regulatory sequence element operably linked to a minimal promoter element, characterized in that said promoter sequence responds to compounds associated with tumor regression.
  • a promoter sequence consisting of a recombinant DNA construct comprising a regulatory sequence element operably linked to a minimal promoter element, characterized in that said promoter sequence responds to compounds associated with tumor regression.
  • Compounds as used herein includes proteins, peptides, oligonucleotides and small molecules.
  • Pharmaceutically active compounds as used herein refer to compounds capable to activate the promoter sequence present in the expression vector.
  • the stably transformed cells in the aforementioned screening method comprise an expression vector containing a reporter gene operably linked to a promoter sequence that is responsive to compounds associated with tumor regression. It is thus an object of the present invention to provide an in vitro method to identify compounds with anti- neoplastic activity, said method comprising; contacting stably transformed tumor cells according to the invention with the compound to be tested, and measure the expression of the reporter gene.
  • the stably transformed tumor cells consist of stably transformed ovarian carcinoma cells, preferably A2780 cells comprising an expression vector containing a nucleic acid sequence encoding a fluorescent protein operably linked to a promoter that is responsive to p21 activators, preferably said promoter comprising the 1300 bp p21 promoter sequence (SEQ ID No.l), even more preferably said promoter sequence consisting of the 1300bp p 21 promoter sequence (SEQ ID No.l).
  • the fluorescent protein is selected from the group consisting of EGFP, EYFP, DsRed, ZsGreen, Zs Yellow, HcRed or destabilized fluorescent proteins such as pDsRed, pHcRedl, pd2EGFP or pd2EYFP and in a specific embodiment the fluorescent protein consists of ZsGreen or ZsRed.
  • the stably transformed tumor cells used in the in vitro screening method are selected from the clones deposited at BCCM with accession numbers LMBP 5958CB and LMBP 5959CB.
  • the aforementioned assay can be adapted to high throughput screening purposes.
  • the assays wherein anti-neoplastic activity is evaluated by measuring change in fluorescence can be designed around an instrument called a FLuorescence Imaging Plate Reader ((FLIPR®), Molecular Devices Corporation). In its most common configuration, it excites and measures fluorescence emitted by fluorescent compounds. It uses an argon- ion laser to produce high power excitation of a fluorophore, a system of optics to rapidly scan the over the bottom of a 96-/384- well plate and a sensitive, cooled CCD camera to capture the emitted fluorescence.
  • FLIPR® FLuorescence Imaging Plate Reader
  • the FLIPR assay is designed to measure fluorescence signals from populations of cells before, during and after addition of compounds, in real time, from all 96-/384- wells simultaneously.
  • the FLIPR assay may be used to screen for and characterise compounds functionally active in the stably transformed tumor cells according to the invention.
  • a high throughput screening assay specifically usefull to identify p21 activators could consist of a single step arrangement wherein the ovarian carcinoma cells, in particular the A2780 cells stably transformed with an expression vector according to the invention, are incubated with a test compound and after sufficient time to allow interaction (8 - 24 hours, typically 12-24 hours, in particular 24 hours.) the change in relative fluorescence units measured using an automated fluorescence plate reader such as FLIPR or Ascent Fluoroskan ( commercially available from Thermo Labsystems, Brussel, Belgium).
  • an automated fluorescence plate reader such as FLIPR or Ascent Fluoroskan
  • non-human animals comprising a target cell according to the invention.
  • a non-human animal model for neoplastic growth, in particular cancerous growth is also an embodiment of the present invention.
  • the present invention provides a method to prepare a non-human animal model for neoplastic growth, said method comprising administering to said non- human animal an amount of stably transformed tumor cells according to the invention, sufficient to effect production of a tumor in said non-human animal.
  • said non- human animal for use as models are preferably mammalian subjects, most preferably convenient laboratory animals such as guinea pigs, rabbits, rats, and mice and the like.
  • primates could also be used.
  • Particularly useful are subjects susceptible to tumor development, such as subjects with impaired immune systems, typically nude mice or SCID mice. Any appropriate vertebrate subject can be used, the choice being dictated mainly by convenience and similarity to the system of ultimate interest.
  • the non-human animal model is preferably a rodent such as a nude mice and the amount of cells to effect production of a tumor typically ranges from 10 6 to 10 8 cells (see for example US 6,251,384).
  • Preferably such administration is subcutaneous and the tumors are formed as solid masses.
  • the tumor cells administered to said non-human animal consist of stably transformed ovarian carcinoma cells, preferably A2780 cells comprising an expression vector containing a nucleic acid sequence encoding a fluorescent protein operably linked to a promoter that is responsive to p21 activators, preferably said promoter comprising the 1300 bp p21 promoter sequence (SEQ ID No.l), even more preferably said promoter sequence consisting of the 1300bp p 21 promoter sequence (SEQ ID No.l).
  • the fluorescent protein is selected from the group consisting of EGFP, EYFP, DsRed, ZsGreen, Zs Yellow, HcRed or destabilized fluorescent proteins such as pDsRed, pHcRedl, pd2EGFP or pd2EYFP and in a specific embodiment the fluorescent protein consists of ZsGreen or ZsRed.
  • the stably transformed tumor cells used in the in vivo screening method are selected from the clones deposited at BCCM with accession numbers LMBP 5958CB and LMBP 5959CB .
  • the tumor cells used in the in vivo screening method are transformed with an expression vector comprising a promoter sequence consisting of a recombinant DNA construct comprising one of the aforementioned regulatory sequence elements, such as the p53 responsive elements operably linked to minimal promoter elements such as the minimal interleukin 6 (IL6) promoter (phu.IL6Pluc+ Plaisance et al. (1997) MCB 17, 3733-3743), the minimal E1B promoter (pMCSluc commercially available from Stratagene) or the commercially available TK promoter for luciferase (pTKluc Promega).
  • IL6 minimal interleukin 6
  • pMCSluc commercially available from Stratagene
  • TKluc Promega commercially available TK promoter for luciferase
  • the invention provides the use of stably transformed tumor cell lines which have been transfected with an expression vector containing a reporter gene operably linked to a promoter sequence consisting of a recombinant DNA construct comprising a regulatory sequence element operably linked to a minimal promoter element, characterized in that said promoter sequence responds to compounds associated with tumor regression, in an in vivo screening method according to the invention.
  • the stably transformed tumor cells administered to said non-human animal should have had sufficient time to form a tumor in said non-human animal.
  • a tumor and in particular a caliper measurable solid tumor is typically formed 7 - 20 days after the administration of the stably transformed tumor cells to the non-human animal.
  • a caliper measurable tumor is obtained 12 days after the injection of the cells.
  • the present invention provides a method to produce a non-human in vivo animal model to identify compounds with anti-neoplastic activity, said method comprising the steps of; administering tumor cells according to the invention to a non-human animal, wherein the stably transformed tumor cells according to the invention are typically administered as a tumor cell suspension comprising 10 to 10 cells which is injected under the skin of the non-human animal; and allowing the tumor cells sufficient time to form a tumor in said non-human animal, which in the particular embodiment using the ovarian carcinoma cells as outlined above, typically consists of 7-14 days, more preferably 9-12 days and in particular 12 days.
  • the non-human animal model obtainable following the above mentioned method may subsequently be used in an in vivo method to identify compounds with anti-neoplastic activity, said method comprising the steps of ; administering a potentially active compound to a non human animal according to the invention, preferably a nude mice injected with ovarian carcinoma cells as outlined above, wherein the potentially active compound may be administered through all clinically relevant routes of administration including intravenously, orally and intraperitoneally; and evaluate the effect of said potentially active compound on the tumor cells by measuring the expression of the reporter gene.
  • standard methods when used in the context of molecular biology techniques, are to be understood as protocols and procedures found in an ordinary laboratory manual such as: Current Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and Sons, Inc. 1994, or Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989.
  • A2780 cells (ATCC) were cultivated in RPMI 1640 medium supplemented with 10% FCS, 2 mM L-glutamine and gentamycine at 37°C in a humidified incubator with 5%CO 2 . All cell culture solutions are provided by Gibco-BRL (Gaithersburg, MD). Other materials are provided by Nunc.
  • Genomic DNA was extracted from proliferating A2780 cells and used as template for nested PCR isolation of the p21 promoter.
  • the first amplification was performed for 20 cycles at an annealing temperature of 55°C using the oligonucleotide pair GAGGGCGCGGTGCTTGG and TGCCGCCGCTCTCTCACC with the genomic DNA as template.
  • the resulting 4.5 kb fragment containing the -4551 to +88 fragment relative to the TATA box was re-amplified with the oligonucleotides TCGGGTACCGAGGGCGCGGTGCTTGG and ATACTCGAGTGCCGCCGCTCTCTCACC for 20 cycles with annealing at 88°C resulting in a 4.5 kb fragment and subsequently with the oligonucleotide pair TCGGGTACCGGTAGATGGGAGCGGATAGACACATC and ATACTCGAGTGCCGCCGCTCTCTCACC for 20 cycles with annealing at 88°C resulting in a 1.3 kb fragment containing the -1300 to +88 fragment relative to the TATA box.
  • the restriction sites Xhol and Kpnl present in the oligonucleotides were used for subcloning.
  • the lucif erase reporter was removed from the pGL3 -basic and replaced by the ZsGreen reporter (from the pZsGreenl-Nl plasmid) at Kpnl and Xbal restriction sites.
  • pGL3-basic- ZsGreen-1300 was constructed via insertion of the above mentioned 1.3 kb fragment of the human p21 promoter region into pGL3-basic-ZsGreen at the Xhol and Kpnl sites. All restriction enzymes are provided by Boehringer Manheim (Germany).
  • A2780 cells were plated into a 6-well plate at a density of 2xl0 5 cells, incubated for 24 hours, and transfected with 2 ug of pGL3-basic-ZsGreen-1300 and 0.2 ug of pSV2neo vector by using Lipofectamine 2000 (Invitrogen, Brussels, Belgium) as described by manufacturer.
  • the transfected cells were selected for 10 days with G418 (Gibco-BRL, Gaithersburg, MD) and single cell suspensions were grown. After three weeks, 80 single clones were obtained.
  • the A2780 transfected pool and the selected 80 clones were expanded and seeded at 10000 cells per well into 96-well plates. 24 hours after seeding, the cells were treated for an additional 24 hours with targeted compounds (affecting spl sites in the proximal p21 promoter region) or DNA damaging agents (affecting p53 responsive elements). Subsequently, cells were fixed with 4% PFA for 30' and counterstained with Hoechst dye. The p21 promoter activation leading to ZsGreen production and thus fluorescence, was monitored by the Ascent Fluoroskan (Thermo Labsystems, Brussels, Belgium) and by fluorescence microscope (Zeiss).
  • the selected clone was injected subcutaneous (10 7 cells/200 ⁇ l) into the flank of nude mice and a calliper measurable tumor was obtained after 12 days. From day 12 on, animals were orally dosed daily during 6 days with solvent, 20 mpk Mitsui (a.k.a. MS-275 - Shering - Registry Number 209783-80-2) or 40 mpk JNJX (10, 10 and 4 animals respectively).
  • Tumors were evaluated for fluorescence by the in-house developed Automated Whole Body Imaging System (Fluorescent stereomicroscope type Olympus ® SZX12 equipped with a GFP filter and coupled to a CCD camera type JAI ® CV-M90 controlled by a software package based on the LMAQ Vision Software from National Instruments ® ).
  • Automated Whole Body Imaging System Fluorescent stereomicroscope type Olympus ® SZX12 equipped with a GFP filter and coupled to a CCD camera type JAI ® CV-M90 controlled by a software package based on the LMAQ Vision Software from National Instruments ® ).
  • A2780 stable transfected pool and the selected 80 clones were treated with TSA (10 "7 M), Bleomycin (15 mU) and Mitsui (10 ⁇ 6 M) as described in M&M.
  • TSA 10 "7 M
  • Bleomycin 15 mU
  • Mitsui 10 ⁇ 6 M
  • Four of these clones showed such a low basal fluorescence expression that they were not detectable with the Fluoroskan, but could be selected by manual evaluation of ZsGreen production using the fluorescence microscope.
  • the two other clones could be measured and showed a 5 fold induction by TSA (10 7 ) and a 1.2-1.5 fold by Mitsui (10 ⁇ 6 ).
  • mice were injected with clones 1,2,3 and 5 and dosed with compound (solvent, 20 mpk Mitsui or 40 mpk JNJ'99) as described in M&M.
  • Basal ZsGreen expression and induction were too low in clone 2 and 3 to be detected by Automated Whole Body Imaging System. Basal fluorescence of clone 1 and 5 could be measured and induction of ZsGreen was very clear 3 days after administration of the first dose and reached a plateau after 5 days (figure 2).
  • the p53 responsive elements are located more downstream in the ⁇ p21 waf1 ' cipl promoter at regions not present in the 1300 bp promoter fragment. This explains the non-responsivness of the system to DNA damaging agents. From these data we conclude that our reporter system provides a model for investigating the molecular events concerned with histone deacetylation and reveals the specificity of the reporter system in vitro. This concept can also be used to test DNA damaging agents specifically or any other drug by adapting the responsive element.

Abstract

Dans un premier aspect, l'invention concerne une ligne cellulaire tumorale qui est transfectée de manière stable avec un vecteur d'expression contenant un gène rapporteur, de préférence une protéine fluorescente, relié opérationnellement à un promoteur qui contrôle l'expression d'une protéine qui est associée à une régression tumorale, la stabilisation de la croissance tumorale ou l'inhibition de la croissance des métastases, et qui se caractérise par le fait que la ligne cellulaire est capable de former une tumeur lorsqu'elle implantée ou injectée dans un animal non-humain. En comparaison avec les modèles in vivo traditionnels, l'invention se distingue par le fait que le gène rapporteur n'est pas constitutivement exprimé, mais seulement après avoir été exposé à un composé test qui entraîne l'expression d'une protéine ou d'une enzyme associée à la régression tumorale, la stabilisation de la croissance tumorale ou l'inhibition de la croissance de métastases. Un signal rapporteur peut être généré seulement lorsqu'un composé à tester a pénétré et infiltré la tumeur, à condition qu'il promeuve l'expression d'une protéine associée à la régression tumorale et que le promoteur de cette protéine soit relié opérationnellement au gène rapporteur.
PCT/EP2003/002264 2003-03-05 2003-03-05 Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo WO2004078984A1 (fr)

Priority Applications (15)

Application Number Priority Date Filing Date Title
PCT/EP2003/002264 WO2004078984A1 (fr) 2003-03-05 2003-03-05 Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo
PCT/EP2004/002195 WO2004078985A1 (fr) 2003-03-05 2004-03-03 Modele animal pour l'identification rapide de composes pharmaceutiquement actifs in vivo
ES04716577T ES2368328T3 (es) 2003-03-05 2004-03-03 Modelo de roedor para la rápida identificación de compuestos activos farmacéuticos in vivo.
AT04716577T ATE516359T1 (de) 2003-03-05 2004-03-03 Nagetiermodell zur schnellen identifizierung pharmazeutischer wirkstoffe in vivo
CN2012102237690A CN102766602A (zh) 2003-03-05 2004-03-03 用于在体内快速鉴定药物活性化合物的动物模型
US10/547,518 US7666670B2 (en) 2003-03-05 2004-03-03 Animal model for the fast identification of pharmaceutical active compounds in vivo
AU2004217817A AU2004217817B2 (en) 2003-03-05 2004-03-03 Animal model for the fast identification of pharmaceutical active compounds in vivo
JP2006504535A JP4545142B2 (ja) 2003-03-05 2004-03-03 製薬学的活性化合物のｉｎｖｉｖｏでの迅速同定のための動物モデル
CNA2004800058454A CN1756846A (zh) 2003-03-05 2004-03-03 用于在体内快速鉴定药物活性化合物的动物模型
NZ542577A NZ542577A (en) 2003-03-05 2004-03-03 Animal model for the fast identification of pharmaceutical active compounds in vivo
EP04716577A EP1601775B1 (fr) 2003-03-05 2004-03-03 Modele rongeur pour l'identification rapide de composes pharmaceutiquement actifs in vivo
CA2516519A CA2516519C (fr) 2003-03-05 2004-03-03 Modele animal pour l'identification rapide de composes pharmaceutiquement actifs in vivo
DK04716577.4T DK1601775T3 (da) 2003-03-05 2004-03-03 Gnavermodel til hurtig identifikation af farmaceutisk aktive forbindelser in vivo
IL170611A IL170611A (en) 2003-03-05 2005-09-01 A stable transformation rodent cell and a rodent model containing it, methods for preparing and using them to identify compounds
NO20054554A NO334878B1 (no) 2003-03-05 2005-10-04 Dyremodell for rask identifikasjon av farmasøytiske aktive forbindelser in vivo

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2003/002264 WO2004078984A1 (fr) 2003-03-05 2003-03-05 Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo

Publications (1)

Publication Number Publication Date
WO2004078984A1 true WO2004078984A1 (fr) 2004-09-16

Family

ID=32946821

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2003/002264 WO2004078984A1 (fr) 2003-03-05 2003-03-05 Modele animal pour l'identification rapide de composes pharmaceutiques actifs in vivo
PCT/EP2004/002195 WO2004078985A1 (fr) 2003-03-05 2004-03-03 Modele animal pour l'identification rapide de composes pharmaceutiquement actifs in vivo

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/002195 WO2004078985A1 (fr) 2003-03-05 2004-03-03 Modele animal pour l'identification rapide de composes pharmaceutiquement actifs in vivo

Country Status (13)

Country Link
US (1) US7666670B2 (fr)
EP (1) EP1601775B1 (fr)
JP (1) JP4545142B2 (fr)
CN (2) CN1756846A (fr)
AT (1) ATE516359T1 (fr)
AU (1) AU2004217817B2 (fr)
CA (1) CA2516519C (fr)
DK (1) DK1601775T3 (fr)
ES (1) ES2368328T3 (fr)
IL (1) IL170611A (fr)
NO (1) NO334878B1 (fr)
NZ (1) NZ542577A (fr)
WO (2) WO2004078984A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009516553A (ja) * 2005-11-23 2009-04-23 アレヴァ・エンセ 特に厳環境下での使用に適した引込み刃部を備えたナイフ

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1838879A4 (fr) * 2005-01-13 2009-09-23 Senex Biotechnology Inc Criblage a haut rendement pour des medicaments contre le cancer et les maladies liees a l'age
EP2176409B1 (fr) * 2007-07-11 2012-01-04 Yeda Research And Development Co. Ltd. Systèmes de produits de construction d'acide nucléique pouvant diagnostiquer ou traiter un état cellulaire
SI23294A (sl) * 2010-02-25 2011-08-31 Nacionalni inštitut za biologijo Celiäśni sistem za hitro zaznavanje in doloäśanje genotoksiäśnosti
JP2013544600A (ja) * 2010-11-23 2013-12-19 プレサージュ バイオサイエンシズ，インコーポレイテッド 固体デリバリーのための治療方法および組成物
CN114350604A (zh) * 2021-12-30 2022-04-15 华南理工大学 Mc38-n4/ot-i共培养系统筛选方法及其筛选的多糖组方与多糖组合物的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994016080A1 (fr) * 1993-01-08 1994-07-21 Exemplar Corporation Procede in vitro/in vivo d'identification de medicaments anti-neoplasiques
WO1997018841A1 (fr) * 1994-07-01 1997-05-29 The Board Of Trustees Of The Leland Stanford Junior University Localisation non invasive d'un conjugue photoemetteur chez un mammifere
WO2002055742A2 (fr) * 2001-01-09 2002-07-18 Novartis Ag Procede rapide de depistage de composants pour une activite in vivo

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1305412A2 (fr) * 1999-10-14 2003-05-02 Clontech Laboratories Inc. Chromo/fluoro-proteines derivees d'anthozoa et methodes d'utilisation
US20030228627A1 (en) * 2002-03-22 2003-12-11 Emerson Beverly M. Assay for p53 function in cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994016080A1 (fr) * 1993-01-08 1994-07-21 Exemplar Corporation Procede in vitro/in vivo d'identification de medicaments anti-neoplasiques
WO1997018841A1 (fr) * 1994-07-01 1997-05-29 The Board Of Trustees Of The Leland Stanford Junior University Localisation non invasive d'un conjugue photoemetteur chez un mammifere
WO2002055742A2 (fr) * 2001-01-09 2002-07-18 Novartis Ag Procede rapide de depistage de composants pour une activite in vivo

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KHANNA A K ET AL: "Cyclosporine induces the expression of the cyclin inhibitor p21.", TRANSPLANTATION. UNITED STATES 15 MAY 1999, vol. 67, no. 9, 15 May 1999 (1999-05-15), pages 1262 - 1268, XP009012765, ISSN: 0041-1337 *
NIE L ET AL: "A facile and effective screening method for p21WAF1 promoter activators from microbial metabolites.", THE JOURNAL OF ANTIBIOTICS. JAPAN OCT 2001, vol. 54, no. 10, October 2001 (2001-10-01), pages 783 - 788, XP009012689, ISSN: 0021-8820 *
SHINAGAWA YASUHIRO ET AL: "Evaluation of the chemosensitivity of head and neck cancer cells based on the diverse function of mutated-p53.", INTERNATIONAL JOURNAL OF ONCOLOGY. GREECE FEB 2003, vol. 22, no. 2, February 2003 (2003-02-01), pages 383 - 389, XP009012690, ISSN: 1019-6439 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009516553A (ja) * 2005-11-23 2009-04-23 アレヴァ・エンセ 特に厳環境下での使用に適した引込み刃部を備えたナイフ

Also Published As

Publication number Publication date
US7666670B2 (en) 2010-02-23
CA2516519C (fr) 2013-09-17
IL170611A (en) 2013-10-31
NO20054554L (no) 2005-11-17
EP1601775B1 (fr) 2011-07-13
NO334878B1 (no) 2014-06-30
NO20054554D0 (no) 2005-10-04
AU2004217817A1 (en) 2004-09-16
DK1601775T3 (da) 2011-10-31
NZ542577A (en) 2007-12-21
US20060147377A1 (en) 2006-07-06
JP4545142B2 (ja) 2010-09-15
CN102766602A (zh) 2012-11-07
ATE516359T1 (de) 2011-07-15
EP1601775A1 (fr) 2005-12-07
AU2004217817B2 (en) 2009-12-10
WO2004078985A1 (fr) 2004-09-16
CA2516519A1 (fr) 2004-09-16
CN1756846A (zh) 2006-04-05
ES2368328T3 (es) 2011-11-16
JP2007523606A (ja) 2007-08-23

Similar Documents

Publication Publication Date Title
Guenthner et al. Permanent genetic access to transiently active neurons via TRAP: targeted recombination in active populations
US7901686B2 (en) Hedgehog antibodies
Qiu et al. Null mutation of mCOUP-TFI results in defects in morphogenesis of the glossopharyngeal ganglion, axonal projection, and arborization
Dor et al. Conditional switching of VEGF provides new insights into adult neovascularization and pro-angiogenic therapy
Ross et al. An HF-1a/HF-1b/MEF-2 combinatorial element confers cardiac ventricular specificity and establishes an anterior-posterior gradient of expression
US6261786B1 (en) Screening assays for hedgehog agonists and antagonists
US6384192B1 (en) Vertebrate embryonic pattern-inducing proteins
KR100868200B1 (ko) 유전자 발현의 전신 광학 영상화 및 이를 사용하는 방법
US6607913B1 (en) Vertebrate embryonic pattern-inducing proteins and uses related thereto
JPWO2003041496A1 (ja) トランスジェニック動物
Zweigerdt et al. Faithful expression of the Myf-5 gene during mouse myogenesis requires distant control regions: a transgene approach using yeast artificial chromosomes
CN108884472A (zh) 用于体内双重组酶介导的盒式交换(dRMCE)的系统和方法及其疾病模型
IL170611A (en) A stable transformation rodent cell and a rodent model containing it, methods for preparing and using them to identify compounds
Le et al. Positron emission tomography imaging analysis of G2A as a negative modifier of lymphoid leukemogenesis initiated by the BCR-ABL oncogene
DE69832798T2 (de) Regulatorische sequenzen für die in-vivo-expression einer heterologen dns-sequenz in endothelzellen und ihre verwendungen.
US8487087B2 (en) Model animal in which state of disease condition is observable in real time, gene construct for achieving the same and use of the same
US20040143865A1 (en) Transgenic zebrafish models for angiogenesis
Terzi et al. In vivo optical interrogation of neuronal responses to genetic, cell type-specific silencing
Alexander et al. CA2 Neuronal activity controls hippocampal oscillations and social behavior
EP1226752A1 (fr) Mammiferes transgeniques non humains de controle du changement de concentration d'ions calcium dans des cellules
Balu et al. Behavioral and physiological characterization of PKC-dependent phosphorylation in the Grin2a∆ PKC mouse
WO2005090561A1 (fr) Procédé de recherche par criblage d'un inhibiteur d'activation pour cellule macrophage
El-Rass Mutagenic Gene Trapping to Study Novel Genes in Zebrafish Cardiovascular Development
Fomin Transcriptional regulation of MRF4 gene expression during embryonic mouse development
Eva Use of transgenic mice in the study of proto-oncogene functions

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase