WO2004072264A2 - Determination de la destinee par hes1 dans des cellules souches et progenitrices hematopoietiques et utilisation - Google Patents

Determination de la destinee par hes1 dans des cellules souches et progenitrices hematopoietiques et utilisation Download PDF

Info

Publication number
WO2004072264A2
WO2004072264A2 PCT/US2004/004085 US2004004085W WO2004072264A2 WO 2004072264 A2 WO2004072264 A2 WO 2004072264A2 US 2004004085 W US2004004085 W US 2004004085W WO 2004072264 A2 WO2004072264 A2 WO 2004072264A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
hematopoietic stem
hesl
stem cell
Prior art date
Application number
PCT/US2004/004085
Other languages
English (en)
Other versions
WO2004072264A3 (fr
Inventor
Curt I. Civin
Xiaobing Yu
Original Assignee
Johns Hopkins University School Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University School Of Medicine filed Critical Johns Hopkins University School Of Medicine
Publication of WO2004072264A2 publication Critical patent/WO2004072264A2/fr
Publication of WO2004072264A3 publication Critical patent/WO2004072264A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/125—Stem cell factor [SCF], c-kit ligand [KL]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/145—Thrombopoietin [TPO]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/26—Flt-3 ligand (CD135L, flk-2 ligand)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • embryonic stem cells embryonic germ cells, adult stem cells or other committed stem cells or progenitor cells are known.
  • the cells may be used in cell therapy that involves producing a desired effect in a host by administering to a host either autologous, allogenic or xenogenic cells, all of which may have been manipulated or processed ex vivo.
  • These cells are important for the treatment of a wide variety of disorders, including malignancies, inborn errors of metabolism, hemoglobinopafhies, and immunodeficiences. It would be highly advantageous to have a source of more embryonic stem cells but procurement of these cells from embryos or fetal tissue, including abortuses, has raised religious and ethical concerns.
  • HSCs hematopoietic stem cells
  • Another area for which cell therapy could be particularly useful is in the mammalian nervous system because it is a highly diversified neural network of cells that form intricate intercellular connections. Once these neural cells are damaged, they do not typically regenerate. Accordingly, treatment of neurological disorders, such as neurodegenerative diseases and neurotrauma, has focused on replacing damaged neural cells with healthy cells.
  • a major obstacle in the field of neural cell therapy is the inadequacy of donor material.
  • cell therapy has been performed using human fetal tissue as the donor substrate.
  • human fetal tissue As the donor substrate.
  • the recipient may immunologically reject the fetal tissue after it is in the body.
  • using fresh fetal tissue in cell therapy may result in the transmission of infectious diseases.
  • certain infections, such as HIV may not yet be present at clinically significant levels and may go undetected during the screening process.
  • neural cells Because of the significant obstacles inherent to fetal tissue cell therapy, alternative sources of neural cells, especially cells that can be used for autologous cell therapy, would be a breakthrough in the field of neuroscience and neurology. A renewable source of normal human neural cells would be an indispensable tool in clinical studies of neurotrauma and neurodegenerative diseases. Further, the use of such cells may eliminate the need for fetal human tissue in cell therapy aimed at restoring neurological function.
  • NSCs neural stem cells
  • HSCs HSCs
  • Multipotent stem cells are present in the entire ventricular neuraxis of the adult mammalian central nervous system, including the spinal cord (Morshead and van der Kooy, J. Neurosci., vol. 12:249-256 (1992); Reynolds and Weiss, Science 255:1707-1710 (1992); Lois and Alvarez-buylla, Proc. Natl Acad. Sci.
  • HSCs vascular endothelial growth factor
  • bFGF basic fibroblast growth factor
  • LIF leukemia inhibitory factor
  • ICN translocates to the nucleus and forms a complex with CBFl/RBP-J/ (Qi et al, Science 283:91-94 (1999); Schroeter et al, Nature 393:382-386 (1998)), which up-regulates transcription of several Notch effector genes, prominently including the Hairy and
  • Notch signaling plays an important role in neural development (Ross et al, Neuron 39:13-25 (2003)).
  • Notch signaling may play an instructive role, promoting differentiation.
  • gain-of-function studies showed that constitutively active Notch signaling induced glial differentiation in mammals (Furukawa et al, Neuron 26:383-394 (2000); Gaiano et al, Neuron 26, 395-404 (2000); Morrison et al, Cell 101 :499-510 (2000)).
  • Notch signaling may be involved not only in the decisions of whether neural stem-progenitor cells differentiate, but also in favoring the differentiation of certain lineages and stages of neural cells.
  • Notch signaling involving Notch ligands or activated Notch receptors
  • BM bone marrow
  • Notchl is essential for early intrathymic T cell development (Radtke et al, Immunity 10:547-558 (1999)).
  • immature B cells accumulated in the thymi of Notchl -inactivated mice.
  • HSCs BM hematopoietic stem-progenitor cells
  • Notch signaling is important in T/B lymphoid commitment decisions.
  • Hesl is a basic helix-loop-helix (bHLH) transcription factor that is a key downstream effector of Notch signaling (Kageyama et al, Crit. Rev. Neurohiol. 9:177-188 (1995)).
  • bHLH transcription factors Over 100 bHLH transcription factors have been identified, and many play essential roles in mammalian neurogenesis (Artavanis-Tsakonas et al, supra (1999); Ross et al, supra), myo genesis (Kageyama et al, supra), angiogenesis (Visvader et al, Genes Dev.
  • Hesl is expressed in many tissues, often in early developmental stages. Persistent expression of Hesl inhibited neural differentiation (Ishibashi et al, EMBO J. 13:1799-1805 (1994)). Loss of Hesl expression caused premature differentiation and defects in many mouse tissues, including the brain, eye, pancreas, and thymus, with brain necrosis and death at about embryonic day 14 (Ishibashi et al, supra (1995), ; Jensen et al, Nat. Genet.
  • RAG2 knockout mice that received fetal liver cells from Hesl knockout mice, thymi were absent or severely hypoplastic, and T cell development was blocked at an early stage, whereas B lymphopoiesis and erythro-myelopoiesis were normal (Tomita et al, Genes Dev. 13:1203-1210 (1999)). This T cell defect was very similar to that of
  • the invention features a vector, such as a lentiviral vector, comprising a cDNA encoding Hesl polypeptide.
  • the vector may further comprise a cDNA insertion site.
  • the insertion may be occupied by a cDNA encoding a reporter gene.
  • the reporter gene may be any easily detected polypeptide, such as green fluorescent protein, red fluorescent protein, chloramphenicol acetyltransferase or luciferase.
  • the vector may comprise cDNA encoding Hesl polypeptide and the cDNA encoding the reporter gene transcribed from separate promoters.
  • the insertion site may be occupied by a cDNA encoding a polypeptide that modifies or amplifies the differentiation promoting effect of Hesl .
  • the invention also provides for a modified CD34 + hematopoietic stem cell comprising the vector, preferably a lentiviral vector, as described.
  • the stem cell may be isolated from the group consisting of bone marrow, umbilical cord blood, mobilized peripheral blood or non-mobilized blood cells.
  • the invention features a method for promoting monocyte- macrophage cell differentiation, comprising modifying a CD34 hematopoietic stem cell to increase expression of a Hesl polypeptide and culturing the modified CD34 + hematopoietic stem cell in monocyte-macrophage differentiation promoting conditions until a monocyte- macrophage phenotype emerges.
  • Monocyte-macrophage differentiation promoting conditions may comprise incubating the HSCs with Kit ligand, thrombopoietin (TPO), Fms-like tyrosine kinase-3 (FLT3), granulocyte-monocyte colony stimulating factor (GM-
  • the CD34 + hematopoietic stem cell may be isolated from bone marrow, umbilical cord blood, or mobilized peripheral blood cells and may be a mammalian CD34 + hematopoietic stem cell or may be a human CD34 + hematopoietic stem cell.
  • the monocyte-macrophage phenotype may comprise CD 14, CD45, CD 13 or CD33 cell surface markers.
  • the invention also provides for a composition comprising a monocyte-macrophage produced as described and a physiologically acceptable carrier.
  • the carrier may be an isotonic solution, biocompatible matrix or gel.
  • the invention features a method for promoting dendritic cell differentiation, comprising modifying a CD34 + hematopoietic stem cell to increase expression of a Hesl polypeptide and culturing the modified CD34 hematopoietic stem cell in dendritic cell differentiation promoting conditions until a dendritic cell phenotype emerges.
  • Dendritic cell differentiation promoting conditions may comprise incubating the HSCs with thrombopoietin (TPO), Fms-like tyrosine kinase-3 (FLT3), Kit ligand, granulocyte-monocyte colony stimulating factor (GM-CSF) and interleukin-4 (IL-4).
  • the CD34 hematopoietic stem cell may be isolated from bone marrow, umbilical cord blood, mobilized peripheral blood or nonmobilized blood cells.
  • the CD34 + hematopoietic stem cell may be a mammalian CD34 + hematopoietic stem cell or a human CD34 + hematopoietic stem cell.
  • the dendritic cell phenotype may comprise presence of HLA-DR and CD la cell surface markers and absence of CD 14 cell surface marker.
  • the invention also provides for a composition comprising a dendritic cell produced as described and a physiologically acceptable carrier.
  • the carrier may be an isotonic solution, biocompatible matrix or gel.
  • the invention also features a method of promoting pathogen immunity and a method of promoting cancer immunity, each comprising administering the composition comprising a dendritic cell produced as described and a physiologically acceptable carrier to a subject in need thereof.
  • the invention also features an assay for evaluating whether a compound is an antagonist or an agonist of Hesl comprising culturing cells containing the vector comprising a cDNA encoding Hesl polypeptide and a reporter polypeptide, and assaying for evidence of transcription of the reporter gene in the cells.
  • the cells may be mammalian cells.
  • the assay may comprise assaying for mRNA transcribed from the reporter gene.
  • the assay may comprise assaying for induction of transcription of the reporter gene in the cells.
  • the reporter gene may be contained in a reporter plasmid, wherein the non- endogenous DNA which expresses the Hesl protein(s) or functional modified forms thereof is contained in an expression plasmid, wherein the reporter and expression plasmids also contain a selectable marker.
  • the reporter gene may be operatively linked to a Hesl response element.
  • the Hesl response element may be the PU.l promoter.
  • the cells may be hematopoietic stem cells or neural stem cells.
  • the invention features a method for promoting neural cell differentiation, comprising modifying a CD34 + hematopoietic stem cell to increase or decrease expression of a Hesl polypeptide and culturing the modified CD34 + hematopoietic stem cell in neural cell differentiation promoting conditions until the neural cell phenotype emerges.
  • Neural cell differentiation promoting conditions may comprise incubating HSCs with nerve growth factor or brain-derived growth factor until the neural cell phenotype emerges, which may be the expression of neuron-specific enolase.
  • neural cell differentiation promoting conditions may comprise incubating the HSCs with basic fibroblast growth factor, platelet-derived growth factor or epidermal growth factor until the neural cell phenotype emerges, which may be, in one embodiment, the expression of oligodendrocyte marker 4 or, in another embodiment, glial fibrillary acid protein.
  • the expression of Hesl may be decreased by contacting a CD34 + hematopoietic stem cell with either (a) a Hesl siRNA of SEQ ID NO: 21 or (b) with a Hesl anti-sense RNA as designated in SEQ ID NO: 24.
  • the CD34 + hematopoietic stem cell may be isolated from bone marrow, umbilical cord blood, mobilized peripheral blood or nonmobilized peripheral blood cells.
  • the CD34 + hematopoietic stem cell may be a mammalian CD34 + hematopoietic stem cell or a human CD34 hematopoietic stem cell.
  • the invention also provides for a composition comprising a neural cell produced as described and a physiologically acceptable carrier.
  • the carrier may be an isotonic solution, biocompatible matrix or gel.
  • the invention also features compositions comprising siRNA capable of suppressing expression of an endogenous Hesl gene in HSCs or other stem cells.
  • the siRNA has a sequence comprising SEQ ID NO: 21.
  • the invention features compositions comprising anti-sense RNA capable of suppressing expression of an endogenous Hesl gene in HSCs or other stem cells.
  • the anti-sense RNA has a sequence comprising SEQ ID NO: 24.
  • Suppression of Hesl expression may also discourage the emergence of glial and/or oligodendrocyte phenotypes.
  • Figure 1A is a schematic representation of the dual promoter Hesl and parental control GFP lentiviral vectors (ATCC Deposit JHU-55). Transcripts from these lentivectors are denoted by arrows. Repeat (R) and U5 regions of the lentiviral LTR, human elongation factor Ice promoter (PE F I O ) and cytomegalovirus promoter (P CMV ) are depicted in the schematic.
  • Figure IB is a fluorescent micrograph showing few adherent cells at day 7 ex vivo of BM CD34 + cells that were transduced parental GFP lentivector (original magnification
  • Figure 1C is a fluorescent micrograph showing a majority of adherent cells at day 7 ex vivo of BM CD34 cells that were transduced with the mouse Hesl GFP lentivector (original magnification 20x).
  • Figure ID is a fluorescent micrograph showing that at day 7 ex vivo of the BM
  • Figure IE is a fluorescent micrograph showing that at day 7 ex vivo of the BM CD34 + cells that were transduced Hesl GFP lentivector most were GFP + .
  • Figure IF is a plot of FACS analysis of GFP cells showing 5% of control- transduced cells were CD 14 CD45 . Boxed regions were determined based on staining with isotype control.
  • Figure 1G is a plot of FACS analysis of GFP+ cells showing 79% of the mHesl- transduced cultures were CD 14 CD45 . Boxed regions were determined based on staining with isotype control.
  • Figure 1H is a plot of FACS analysis of GFP " cells showing that few cells were CD14 + CD45 + . Boxed regions were determined based on staining with isotype control.
  • Figure II is a plot of FACS analysis of GFP " cells showing that 3% of the of the mHesl -transduced cells were CD14 + CD45 + . Boxed regions were determined based on staining with isotype control.
  • Figure 2 A is a graph showing that after transduction with mHesl or control lentivirus on days 0 and 1, Hesl -transduced cells (solid line, circles) underwent reduced cell proliferation, compared to control vector-transduced cells (dotted line, triangles) on day 3 as measured by FACS sorting for GFP cells. Cells were enumerated by using a digital camera image of a microscopic field of each entire well.
  • Figure 2B is fluorescent photomicrograph of CB CD34 + cells in Figure 6 C that were stained with anti-BrdU antibody, then Alexa fluo594-labeled secondary antibody
  • Figure 2C is a histogram showing that the percent of BrdU " CB CD34 + cells at day 3 after culturing the cells overnight in QBSF-60 containing FTK and permeabilized and labeled with BrdU.
  • Figure 2D is a graph showing the viability of FACS-gated GFP + or GFP " (filled and open symbols, respectively) and mHesl- or control-transduced (circles, solid lines or triangles, dotted line, respectively) by measuring Annexin V expression and Viaprobe (7- AAD)-binding on days 3-6.
  • Figure 3A is a plot of FACS analysis of GFP + cells from PBSC CD34 + CD38 " Lin " starting cells that were transduced with control lentivirus, which shows that 42% of CD34 + and CD45 + cells were GFP + .
  • Figure 3B is a plot of FACS analysis of GFP + cells from PBSC CD34 + CD38 " Lin " starting cells that were transduced with mHesl lentivirus, which shows that 6% of CD34 + and CD45 + cells were GFP + .
  • Figure 3C is a plot of FACS analysis of GFP + cells from PBSC CD34 + CD38 " Lin " starting cells that were transduced with control lentivirus, which shows that 3% of C14 + and CD45 + cells were GFP + .
  • Figure 3D is a plot of FACS analysis of GFP + cells from PBSC CD34 + CD38 " Lin " starting cells that were transduced with mHesl lentivirus, which shows that 24% of CD14 + and CD45 + cells were GFP + .
  • Figure 4A is a plot of FACS analysis of GFP + BM CD34 + cells that were transduced with the either mHesl- or control-vector, which shows that 31% of control- vector transduced cells were CD 14 and CD45 and that 95 % of Hesl -vector transduced cells were CD14 + and CD45 + .
  • Figure 4B is a plot of FACS analysis of GFP + BM CD34 + cells that were transduced with the either mHesl- or control- vector, which shows that upon exposure to erythropoietin (EPO; 5 IU/mL) 12% of control-vector transduced cells were CD14 + and CD71 and that in the absence of EPO 1% of control-vector transduced cells were CD14 + and CD71 . In the presence of EPO, 0.1% of mHesl -vector transduced cells were CD14 + and CD71 + .
  • EPO erythropoietin
  • Figure 5A is a histogram showing that Hesl over-expression blocked hematopoietic colony formation in CB, BM or PBSC CD34 cells that were transduced with mHesl or control lentiviral vector on days 0 and 1 and on day 3, cells were sorted into GFP + and GFP " subpopulations, and plated for colony forming cells CFC-GM (a cell type committed to the development into granulocytes and macrophages). After two weeks, colonies were examined under fluorescence microscopy, and green fluorescent (filled bars) vs. non- fluorescent colonies were scored separately. Total colonies were represented by open bars. Asterisks (*) represent 0 colony.
  • Figure 5B is a histogram showing that Hesl over-expression blocked hematopoietic colony formation in CB, BM or PBSC CD34 + cells that were transduced with mHesl or control lentiviral vector on days 0 and 1 and on day 3, cells were sorted into GFP + and GFP " subpopulations, and plated for Colony forming cells mix (CFC-mix -a human multipotential hematopoietic progenitor cell type which gives rise to colonies containing all types of mature myeloid cell types). After two weeks, colonies were examined under fluorescence microscopy, and green fluorescent (filled bars) vs. non-fluorescent colonies were scored separately. Total colonies were represented by open bars. Asterisks (*) represent 0 colony.
  • Figure 5C is a histogram showing that Hesl over-expression blocked hematopoietic colony formation in CB, BM or PBSC CD34 + cells that were transduced with mHesl or control lentiviral vector on days 0 and 1 and on day 3, cells were sorted into GFP + and GFP " subpopulations, and plated for BFU-E (refers to the earliest known erythroid precursor cell that eventually differentiates into erythrocyte). After two weeks, colonies were examined under fluorescence microscopy, and green fluorescent (filled bars) vs. non-fluorescent colonies were scored separately. Total colonies were represented by open bars. Asterisks
  • Figure 5D is a histogram showing that Hesl over-expression blocked hematopoietic colony formation in CB, BM or PBSC CD34 + cells that were transduced with mHesl or control lentiviral vector on days 0 and 1 and on day 3, cells were sorted into GFP + and GFP " subpopulations, and plated for high proliferative potential (HPP)-CFC colonies (CFC-
  • Figure 6A is a histogram showing that 9 weeks after transplantation of non- adherent cells, BM cells were harvested from the transplanted mice, and donor-derived cells (CD45.1 + ) were quantified by immunostaining for CD45.1.
  • the %CD45.1 + donor-derived cells in the mock-transduced and parental control vector-transduced control groups were 20%) and 18%, respectively, whereas there were only 1.2% CD45.1 + donor-derived cells in the mHesl-transduced group.
  • Figure 6B is a plot of FACS analysis of BM cells that were harvested in Figure 6 A.
  • the GFP + cells comprised 32% of the CD45.1 donor-derived cells in the parental vector- transduced control group, but no GFP + cells were detected in the mHesl-transduced group. Boxed regions were determined based on staining with isotype control monoclonal antibodies.
  • Figure 7A is a histogram showing that in the GFP + mHesl-transduced cells, there was a high level of mHesl expression (filled bar, as indicated by the left Y-axis scale), and PU. 1 gene expression (open bar, as indicated by the right Y-axis scale) was 2-fold up- regulated. The mHesl transgene was not detected in the cells transduced with the control vector (indicated by *).
  • Figure 7B is a histogram showing that PU.l (filled bar) and Hesl (open bar) expression levels in CD34 + cells treated with Hesl anti-sense oligonucleotides.
  • Figure 7C is a histogram showing Idl (filled bar) and Id2 (open bar) expression levels in GFP + cells transduced with control or Hesl lentiviral vectors.
  • Figure TD is a histogram showing CFC-GM generation of CB CD34 + cells were transduced with either Hesl or Idl.
  • Figure 7E is a histogram showing CFC-GM generation of CB CD34 cells were transduced with various constructs of Hes and Idl .
  • This invention is based in part on the surprising discovery that overexpression of a transcription factor, Hesl promotes the differentiation of hematopoietic stem cells (HSCs) to various cell types, including but not limited to monocyte-macrophages and dendritic cells. Additionally, modulating the expression of Hesl so that Hesl is over- or under- expressed appears to promote the differentiation of HSCs to neurons or glial cells, respectively.
  • HSCs hematopoietic stem cells
  • the present invention features methods of differentiating isolated hematopoietic stem cells, that were isolated from either bone marrow(BM), cord blood
  • CB peripheral blood
  • PBSC peripheral blood
  • non-mobilized blood so that a variety of cell types can be obtained including but not limited to monocyte-macrophages, dendritic and neural cells.
  • over-expression of Hesl can be used to (1) induce monocyte-macrophage differentiation, in part by activating PU.l expression, and (2) inhibit the proliferation of HSCs.
  • the interaction of Hesl protein with other bHLH transcription factors and/or Id family proteins may also be involved in mediating these monocyte-macrophage fate-determining and anti-HSC proliferative effects of Hesl.
  • the present invention also features using endogenous and modified HSCs to restore function in diseased tissues, for example via cell therapy, and to study metabolism and toxicity of compounds in drug discovery efforts.
  • an element means one element or more than one element.
  • Anti-sense nucleic acid refers to oligonucleotides or polynucleotides which specifically hybridize (e.g., bind) under cellular conditions with a gene sequence, such as at the cellular mRNA and/or genomic DNA level, so as to inhibit expression of that gene, e.g., by inhibiting transcription and/or translation.
  • the binding may be by conventional base pair complementarily, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • “basic helix-loop-helix” or "bHLH” refers to a family of transcription factors that interact with DNA to modulate transcription. Hesl is a member of the bHLH family.
  • bHLHs are considered to play a role in development and differentiation, but there may be a role for bHLHs in mature cells as well.
  • CD34 refers to a glycoprotein found on immature hematopoietic cells and endothelial cells (Krause et al., (1996) Blood 87:1). CD34 may also be known as gp 105- 120 or as My- 10 antigen.
  • CD38 refers to a cell surface protein expressed on activated T-cells, terminally differentiated B-cells, early B- cells, monocytes, multiple myelomas, most cases of Acute Lymphoblastic leukemia (ALL) (both T and B lineage), and some Acute Myeloid Leukemia (AML).
  • ALL Acute Lymphoblastic leukemia
  • AML Acute Myeloid Leukemia
  • CD38 is a single-chain Type II transmembrane protein and may sometimes be refened to as T10 (Jackson et al, (1990) J. Immun. 144: 2811-2815).
  • dendritic cell refers to interdigitating reticular cells, found in T-cell areas of lymphoid tissues. They have a branched or dendritic morphology and are the most potent stimulators of T-cell responses. Non-lymphoid tissues also contain dendritic cells but these do not appear to stimulate T-cell responses until they are activated and migrate to lymphoid tissues. The dendritic cell derives from bone marrow precursors. It is distinct from the follicular dendritic cell that presents antigen to B cells. Dendritic cells have a role in immune surveillance in which lymphocytes travel tlirough the body to detect any altered self material, for example mutant cells, and thus participate in prevention of the growth of tumor cells.
  • dendritic cells are efficient antigen presenting cells and initiate specific immune responses to novel antigens. Dendritic cells may also present antigen in a tolerogenic rather than an immunogenic fashion under some circumstances (Steinman et al, Pathol Biol 51:59-60 (2003)).
  • embryonic stem cells refer to pluripotent cells derived from pre- embryonic, embryonic, or fetal tissue of the stated mammal species at any time after gestation, which have the characteristic of being capable under the right conditions of producing progeny of several different cell types.
  • Embryonic stem cells are operationally defined by their ability (a) to differentiate into cells of multiple lineages in multiple regional and developmental contexts (i.e., be multipotent); (b) to self-renew (i.e., also give rise to new embryonic stems cells with similar potential) and (c) to populate developing and/or degenerating regions of various tissues.
  • Preferred embryonic stem cells are those capable of producing progeny that are derivatives of all of the three germinal layers: endoderm, mesoderm, and ectoderm, and capable of undergoing proliferation in the absence of feeder cells, as described in this disclosure.
  • Non-limiting exemplars of embryonic stem cells are rhesus and marmoset embryonic stem cells, as described by Thompson et al., (1995) Proc. Natl. Acad. Sci. U.S.A. 92:7844, human embryonic stem (hES) cells, as described by Thomson et al., (1998) Science 282:1145; human embryonic germ (hEG) cells, described in Shamblott et al., (1998) Proc. Natl Acad. Sci. U.S.A. 95:13726 and mouse embryonic stem
  • mES Embryonic Stem Cells
  • Other types of non-malignant pluripotent cells are included in the term. Specifically, any cells that are fully pluripotent (that is, they are those capable of producing progeny that are derivatives of all of the three germinal layers) are included, regardless of whether they were derived from embryonic tissue, fetal tissue, or adult tissue.
  • hematopoietic cells refers to cells which produce blood cells.
  • HSCs Hematopoietic stem cells
  • HSCs are operationally defined by their ability (a) to differentiate into both lymphoid and myeloid cells (i.e., be multipotent); (b) to self-renew
  • hematopoietic cells include hematopoietic stem cells, primordial stem cells, early progenitor cells, CD34+ cells, early lineage cells of the mesenchymal, myeloid, lymphoid and erythroid lineages, bone marrow cells, blood cells, umbilical cord blood cells, stromal cells, and other hematopoietic precursor cells that are l ⁇ iown to those of ordinary skill in the art.
  • Bone marrow cells contain totipotent stem cells which give rise to hematopoietic cells of all lineages including the lymphoid, myeloid and erythroid lineages. Stem cells have the ability to renew themselves as well as to differentiate into progenitor cells of all hematopoietic lineages. Progenitor cells retain the ability to proliferate and give rise to differentiated cells of all lineages. Differentiated cells lose the ability to proliferate and exhibit morphological characteristics specific for their lineages (such as macrophages, granulocytes, platelets, red blood cells, T cells and B cells).
  • morphological characteristics specific for their lineages such as macrophages, granulocytes, platelets, red blood cells, T cells and B cells).
  • Bone marrow includes stem cells as well as progenitor cells of the lymphoid (T and B cells), myeloid (e.g., granulocytes, macrophages) and erythroid (red blood cells) lineages.
  • T and B cells lymphoid cells
  • myeloid e.g., granulocytes, macrophages
  • erythroid red blood cells
  • modified hematopoietic stem cells or "modified HSCs” as used herein refers to HSCs that have been engineered to over- or under-express endogenous or exogenous genes, such as Hesl, using techniques that are known in the art and include, but are not limited to gene activation, transgenic, deletion mutations, knock-in, RNAi, anti- sense RNA, or HSCs that have been treated with agonists or antagonists of Hesl.
  • “Modified HSCs” may also over- or under-express more than one endogenous or exogenous gene by directing the techniques to more than one gene. For instance, cells may contain a transgene for more than one gene or anti-sense RNA's that reduce the expression of more than one gene.
  • Hesl refers to a basic helix-loop-helix (bHLH) transcription factor that is a key downstream effector of Notch signaling (Kageyama et al, Crit. Rev.
  • Exemplary nucleotide and amino acid sequences of mouse Hesl are GenBank Accession Numbers NM_008235 and NP_032261.
  • Exemplary nucleotide and amino acid sequences of human Hesl are GenBank Accession Numbers NM 305524.2 and NP_005515 (SEQ ID NOs. 3-6).
  • “Ids” as used herein refer to a family of basic helix-loop-helix (bHLH) proteins that lack DNA-binding motifs, and can heterodimerize with many bHLH monomers and prevent those bHLHs from binding to DNA.
  • Id-1, Id-2, Id-3, and Id-4 bind the widely expressed E proteins (Engel & Murre, Nat. Rev. Immunol 1:193-9 (2001); Quong et al, Annu. Rev. Immunol 20:301-22 (2002)) and many of the cell-lineage restricted bHLH transcription factors. All are found expressed in undifferentiated mouse embryonic stem cells. Id-1, Id-3 and Id-4 mRNA are rapidly down-regulated during in vitro hematopoietic differentiation of mouse embryonic stem cells while Id-2 levels are maintained (Engel et al, supra; Sikder et al, Cancer Cell 3:525-530 (2003); Nogueira et al, Biochem. Biophys. Res. Commun.,
  • Id-1, Id-2, Id-3 and Id-4 are examples of inhibitors of Hesl that can be evaluated as therapeutic candidates for the suppression of endogenous Hesl.
  • Lin refers to lineage markers expressed in differentiated cells such as CD3 (T lymphoid cells), CD5 (T lymphoid cells), CD 10 (lymphoid progenitor cells), CD 13 (mature and progenitor-precursor macrophage/monocytic and granulocytic cells), CD 14 (monocyte/macrophages), CD 16 (granulocytes, NK cells, monocyte/macrophages), CD 19 (mature and early B lymphoid cells), CD33 (mature and progenitor-precursor macrophage/monocytic and granulocytic cells), CD41a (mature and progenitor-precursor platelets, megakaryocytic cells), CD45RA (B lymphoid cells, some T lymphoid cells, some mono/granulocytic progenitor-precursor cells), CD66B (granulocytic cells), CD71 (erythroid progenitor-precursor
  • mobilized peripheral blood stem-progenitor cell or "mobilized PBSC” is used herein to refer the cells that are stimulated to leave bone marrow and enter the bloodstream after exposing the host to stimulatory agents, such as filgrastim.
  • non-mobilized blood cell is used herein to refer to cells that have not been stimulated with stimulatory agents, such as filgrastim.
  • macrophage refers to a relatively long lived phagocytic cell of mammalian tissues, differentiated from a blood monocyte. These are large mononuclear phagocytic cells important in innate immunity, in early non-adaptive phases of host defense, as antigen-presenting cells, and as effector cells in humoral and cell- mediated immunity. They are migratory cells deriving from bone marrow precursors, and are found in most tissues of the body. Macrophages from different sites have distinctly different properties. Main types of macrophages are peritoneal and alveolar macrophages, tissue macrophages (histiocytes), Kupffer cells of the liver and osteoclasts.
  • Macrophages In response to foreign materials macrophages may become stimulated or activated. Macrophages play an important role in killing of some bacteria, protozoa and tumor cells, and release substances that stimulate other cells of the immune system and are involved in antigen presentation. Macrophages may further differentiate within chronic inflammatory lesions to epithelioid cells or may fuse to form foreign body giant cells or Langhans giant cells.
  • monocyte refers to a mononuclear phagocyte circulating in blood that is capable of emigrating into tissue and differentiating into a macrophage.
  • neural stem cells refers to the relatively primordial, uncommitted cells that exist in the developing and even adult nervous system and are responsible for giving rise to the array of more specialized cells of the nervous system, including both the central nervous system and the peripheral nervous system. NSCs are operationally defined by their ability (a) to differentiate into cells of all neural lineages
  • a "patient”, “subject” or “host” may mean any mammal, but preferably a human.
  • expression plasmid refers to any plasmid capable of expressing a gene in a suitable host cell.
  • a preferred gene to be expressed from an expression plasmid is Hesl or a mutant thereof.
  • reporter plasmid is defined to be any plasmid which contains a responsive promoter/enhancer element for a particular gene that is functionally linked to an operative reporter gene.
  • a preferred responsive promoter/enhancer element is the Hesl responsive promoter/enhancer element.
  • Hesl response promoter/enhancer elements include but are not limited to the E-box (CACCTG; SEQ ID NO: 7) and N-box (CTTGTG; SEQ ID NO: 8).
  • reporter genes include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, chloramphenicol acetyltransferase (CAT) or any nucleic acid sequences encoding easily assayed proteins.
  • treating encompasses all detectable beneficial effects on a disorder or disease.
  • Beneficial effects that can be detected clinically by a physician's assessment or through the use of clinical laboratory tests are preferred.
  • the beneficial effects can impact on one or more signs or symptoms of a disorder or disease, or on biological, metabolic, inflammatory or pathological processes arising from or producing the disease or disorders.
  • Preferred beneficial effects include curing as well as ameliorating at least one sign or symptom of the condition or disease, by which is meant that manifestations of that sign or symptom are partially up to completely restored to the normal physiological state.
  • viral vector refers to a virus that is used to deliver a DNA sequence to a cell and includes but is not limited to recombinant retrovirus, adenovirus, adeno-associated virus, and herpes simplex virus-1.
  • a preferred viral vector includes "lentiviral vector” or “lentivector.”
  • “Lentivector” is especially useful with nondividing or terminally differentiated cells such as neurons, macrophages, hematopoietic stem cells, retinal photoreceptors, and muscle and liver cells, cell types for which previous gene therapy methods might not be suitable.
  • methods of isolating stem cells and progenitor cells include isolation from other cells in hematopoietic tissue of the body and particularly bone marrow.
  • Stem cells and progenitor cells from bone marrow constitute only a small percentage of the total number of hematopoietic cells.
  • Stem cells appear to be in the range of about 0.01 to about 0.1 % of the bone marrow cells.
  • Bone marrow cells may be obtained from ilium, sternum, tibiae, femora, spine and other bone cavities.
  • Other non-limiting sources of hematopoietic stem cells include embryonic yolk sac, fetal liver fetal and adult spleen, blood including adult peripheral blood and umbilical cord blood (To et al., (1997)
  • an appropriate solution may be used to flush the bone, including but not limited to salt solution, supplemented with fetal calf serum or other naturally occurring factors in conjunction with an acceptable buffer at low concentration, generally about 5 to 25 mM.
  • Buffers include but are not limited to HEPES, phosphate and lactate buffers. Bone marrow can also be aspirated from the bone in accordance with conventional techniques.
  • selective cytapheresis can be used to produce a cell suspension from human bone marrow or blood containing pluripotent lymphohematopoietic stem cells.
  • marrow can be harvested from a donor (the patient in the case of an autologous cell therapy; a donor in the case of an allogenic cell therapy) by any appropriate means.
  • the marrow can be processed as desired, depending mainly upon the use intended for the recovered cells.
  • the suspension of marrow cells is allowed to physically contact, for example, a solid phase-linked monoclonal antibody that recognizes an antigen on the desired cells.
  • the solid phase-linking can comprise, for instance, adsorbing the antibodies to a plastic, nitrocellulose or other surface.
  • the antibodies can also be adsorbed on to the walls of the large pores (sufficiently large to permit flow-through of cells) of a hollow fiber membrane.
  • the antibodies can be covalently linked to a surface or bead, such as Pharmacia Sepharose 6MB macrobeadsTM.
  • a surface or bead such as Pharmacia Sepharose 6MB macrobeadsTM.
  • the exact conditions and duration of incubation for the solid phase-linked antibodies with the marrow cell suspension will depend upon several factors specific to the system employed. The selection of appropriate conditions, however, is well within the skill of the art.
  • One of the most useful differentiation antigens for isolating human hematopoietic stem cells is the cell surface antigen known as CD34.
  • CD34 is expressed by about 1% to 5% of normal human adult marrow cells in a developmentally, stage-specific manner (Civin et al., (1984) J. Immunol, 133:157-165).
  • CD34+ cells are a mixture of immature blastic cells and a small percentage of mature, lineage-committed cells of the myeloid, erythroid and lymphoid series. Perhaps 1% of CD34+ cells are true HSC with the remaining number being committed to a particular lineage. Results in humans have demonstrated that CD34+ cells isolated from peripheral blood or marrow can reconstitute the entire hematopoietic system for a lifetime. Therefore, CD34 is a marker for HSC and hematopoietic progenitor cells.
  • cells may be enriched for hematopoietic stem cells by negative selection using CD38 marker and the following lineage markers (collectively known as Lin markers): CD3 (expressed on T lymphoid cells), CD5 (expressed on T lymphoid cells), CD 10 (expressed on lymphoid progenitor cells), CD 13 (expressed on mature and progenitor-precursor macrophage/monocytic and granulocytic cells), CD 14 (expressed on monocyte/macrophages), CD 16 (expressed on granulocytes, natural killer cells, monocyte/macrophages), CD 19 (expressed on mature and early B lymphoid cells),
  • CD33 expressed on mature and progenitor-precursor macrophage/monocytic and granulocytic cells
  • CD41a expressed on mature and progenitor-precursor platelets, megakaryocytic cells
  • CD45RA expressed on B lymphoid cells, some T lymphoid cells, some mono/granulocytic progenitor-precursor cells
  • CD66B expressed on granulocytic cells
  • CD71 expressed on erythroid progenitor-precursor cells, activated lymphoid cells
  • glycophorin A also known as CD235A, expressed on eryfhrocytes.
  • cells may be further enriched for hematopoietic stem cells by negative selection using the CD52 marker.
  • FACS fluorescence activated cell sorters
  • the eluted, enriched fraction of cells may then be washed with a buffer by centrifugation and either cryopreserved in a viable state for later use according to conventional technology or immediately infused intravenously into the recipient following appropriate testing to ensure that the desired separation of a purified population of stem cells has been achieved.
  • stem cells may be recovered directly from blood using essentially the above methodology.
  • blood can be withdrawn directly from the circulatory system of a donor and percolated continuously through a device (e.g., a column) containing the solid phase-linked monoclonal antibody to stem cells and the stem cell- depleted blood can be returned immediately to the donor's circulatory system using, for example, a conventional hemapheresis machine.
  • a device e.g., a column
  • the stem cell- depleted blood can be returned immediately to the donor's circulatory system using, for example, a conventional hemapheresis machine.
  • Such a method is extremely desirable because it allows rare peripheral blood stem cells to be harvested from a very large volume of blood, sparing the donor the expense and pain of harvesting bone marrow and the associated risks of anesthesia, analgesia, blood transfusion, and infection.
  • the duration of aplasia for the recipient following the marrow cell transfer can also be shortened since, theoretically, unlimited numbers of blood stem cells could be collected without significant risk to the donor.
  • neonatal hematopoietic stem and progenitor cells can be obtained from umbilical cord blood and/or hematopoietic blood.
  • cord or hematopoietic blood as a source of cells to repopulate the hematopoietic system provides numerous advantages.
  • Cord blood can be obtained easily and without trauma to the donor.
  • Cord blood cells can be used for autologous cell therapy, when and if needed, and the usual hematological and immunological problems associated with the use of allogeneic cells, matched only partially at the major histocompatibility complex or matched fully at the major, but only partially at the minor complexes, are alleviated. Collections should be made under sterile conditions.
  • the neonatal blood can preferably be obtained by direct drainage from the cord and/or by needle aspiration from the delivered placenta at the root and at distended veins (see U.S. Pat. Nos. 5,004,681 and 5,192,553).
  • Fetal blood can be obtained, e.g., by taking it from the fetal circulation at the hematopoietic root with the use of a needle guided by ultrasound (Daffos et al., (1985) Am. J. Obstet. Gynecol, 153:655-660; Daffos et al., (1983) Am. J. Obstet, Gynecol, 146:985), by placentocentesis (Valenti (1973) Am. J. Obstet. Gynecol., 115:851; Cao et al., (1982) J.
  • the cord blood may be mixed with an anticoagulent.
  • an anti-coagulent can be any known in the art, including but not limited to CPD
  • the above methods of manipulating marrow or blood cell suspensions produce a suspension of human cells that contains pluripotent lympho-hematopoietic stem cells that are substantially free of mature lymphoid and myeloid cells.
  • the cell suspension also contains substantially only cells that express the My-10 antigen (CD34) and can restore the production of lymphoid and hematopoietic cells to a human patient who has lost the ability to produce such cells because of, for example, radiation treatment.
  • a cell population that can restore the production of hematopoietic and lymphoid cells contains pluripotent "lympho-hematopoietic stem cells".
  • Hematopoietic stem cells may be potentially multiplied in culture, before or after cryopreservation, thus expanding the number of stem cells available for therapy.
  • the cells may be cultured in a suitable medium comprising a combination of growth factors that are sufficient to maintain growth.
  • the term "culturing” refers to the propagation of cells on or in media of various kinds. It is understood that the descendants of a cell grown in culture may not be completely identical (either morphologically, genetically or phenotypically) to the parent cell. Methods for culturing stem cells and hematopoietic cells are well known to those skilled in the art, and some of these methods are briefly mentioned herein.
  • the seeding level is not critical, and it will depend on the type of cells used. In general, the seeding level will be at least 10 cells per ml, more usually at least about 100 cells per ml and generally not more than 10 6 cells per ml.
  • Various culture media can be used and non-limiting examples include Iscove's modified Dulbecco's medium (IMDM), X-vivo 15 and RPMI-1640. These are commercially available from various vendors.
  • IMDM Iscove's modified Dulbecco's medium
  • X-vivo 15 and RPMI-1640 are commercially available from various vendors.
  • the formulations may be supplemented with a variety of different nutrients, growth factors, such as cytokines and the like.
  • cytokine refers to any one of the numerous factors that exert a variety of effects on cells, such as inducing growth and proliferation.
  • the cytokines may be human in origin or may be derived from other species when active on the cells of interest.
  • molecules having similar biological activity to wild type or purified cytokines for example produced by recombinant means, and molecules which bind to a cytokine factor receptor and which elicit a similar cellular response as the native cytokine factor.
  • the medium can be serum free or supplemented with suitable amounts of serum such as fetal calf serum, autologous serum or plasma. If cells or cellular products are to be used in humans, the medium will preferably be serum free or supplemented with autologous serum or plasma.
  • Non-limiting examples of growth factors and/or differentiation factors which may be used to supplement the culture medium are thrombopoietin (TPO), Flt3 ligand (FL), c- kit ligand (KL, also known as stem cell factor (SCF) or Stl), Interleukin (IL) such as, IL-1, IL-2, IL-3, IL-6, (soluble IL-6 receptor), IL-11, and IL-12, granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), leukemia inhibitory factor (LIF), MIP-1 alpha, and erythropoietin (EPO).
  • TPO thrombopoietin
  • FL Flt3 ligand
  • KL also known as stem cell factor (SCF) or Stl
  • IL Interleukin
  • G-CSF granulocyte-colony stimulating factor
  • GM-CSF granulocyte macrophage-
  • a preferred non- limiting medium includes mIL-3, mIL-6 and mSCF.
  • appropriate HSC- maintaining conditions could be used to expand HSCs in culture so that they do not lose their HSC phenotype.
  • using another combination of particular growth factors would promote differentiation of HSCs into a particular kind of cell, as described further below.
  • TPO concentration range of these compounds in cultures. While not meant to limit the invention, a general preferred range of TPO is from about 0.1 ng/n L to about 500 ⁇ g/mL, more preferred is from about 1.0 ng/mL to about
  • 1000 ng/mL even more preferred is from about 5.0 ng/mL to about 300 ng/mL.
  • a preferred concentration range for each of FL and KL is from about 0.1 ng/mL to about 1000 ng/mL, more preferred is from about 1.0 ng/mL to about 500 ng/mL.
  • IL-6 is a preferred factor to be included in the culture, and a preferred concentration range is from about 0.1 ng/mL to about 500 ng/mL and more preferred in from about 1.0 ng/mL to about 100 ng/mL.
  • IL-6 a covalent complex of IL-6 and IL-6 receptor may also be used in the culture.
  • fibronectin refers to a glycoprotein that is found throughout the body, and its concentration is particularly high in connective tissues where it forms a complex with collagen.
  • Expression vectors for use in the methods described herein generally are replicable polynucleotide constructs that contain a polynucleotide encoding Hesl or a portion thereof, linked to a carrier protein or a portion thereof, if applicable.
  • Hesl as described herein is operatively linked to suitable transcriptional controlling elements, such as promoters, enhancers and terminators.
  • suitable transcriptional controlling elements such as promoters, enhancers and terminators.
  • one or more translational controlling elements are also usually required, such as ribosome binding sites, translation initiation sites, and stop codons.
  • These controlling elements transcriptional and translational
  • a polynucleotide sequence encoding a signal peptide can also be included to allow the polypeptide to cross or lodge in cell membranes or be secreted from the cell.
  • a number of expression vectors suitable for expression in eukaryotic cells are known in the art.
  • One example of an expression vector is pcDNA3 (Invitrogen, San Diego, Calif), in which transcription is driven by the cytomegalovirus (CMV) early promoter/enhancer. This vector also contains recognition sites for multiple restriction enzymes for insertion of the Hesl.
  • Suitable cloning and expression vectors include any known in the art, e.g., those for use in bacterial, mammalian, yeast and insect expression systems. Specific vectors and suitable host cells are known in the art and need not be described in detail herein. For example, see Gacesa and Ramji (1994) Vectors, John Wiley & Sons.
  • Cloning and expression vectors typically contain a selectable marker (for example, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector), although such a marker gene can be carried on another polynucleotide sequence co-introduced into the host cell. Only those host cells into which a selectable gene has been introduced will grow under selective conditions. Typical selection genes either: (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate; (b) complement auxotrophic deficiencies; or (c) supply critical nutrients not available from complex media. The choice of the proper marker gene will depend on the host cell, and appropriate genes for different hosts are known in the art. Cloning and expression vectors typically contain a replication system recognized by the host.
  • Suitable viral vector systems for producing stem cells with stable genetic alterations may also be based on adenoviruses, lentiviruses, retroviruses and other viruses, and may be prepared using commercially available virus components.
  • a prefered embodiment of the invention is a lentivirus containing cDNA encoding for Hesl polypeptide.
  • Increased expression of an endogenous gene may be achieved by introducing into a cell a new transcription unit, or gene activation construct, that comprises an exogenous regulatory sequence, an exogenous exon, and a splice site, operably linlced to the second exon of an endogenous gene, wherein the cell comprises the exogenous exon in addition to exons present in the endogenous gene (see, for example, U.S. Patent Nos: 5,641,670; 5,773,746; 5,733,761; 5,968,502; 6,702,989; and 6,565,844).
  • nucleic acids can be in the same or separate vectors. If the nucleic acids are in the same vectors, the nucleic acids may share the same transcriptional/translational control signals or may have separate transcriptional/translational control signals. See, for example, the techniques described in
  • lipid/DNA complexes such as those described in
  • Suitable reagents include lipofectamine, a 3:1 (w/w) liposome formulation of the poly-cationic lipid 2,3-dioleyloxy-N-[2(sperminecarbox-amido)ethyl]-N,N-dimethyl-l- propanaminium trifluoroacetate (DOSPA) (Chemical Abstracts Registry name: N-[2-(2,5- bis[(3-aminopropyl)amino]-l-oxpentyl)amino)ethyl]-N,N-dimethyl-2,3-bis(9- octadecenyloxy)-l-propanamin-trifluoroacetate), and the neutral lipid dioleoyl phosphatidylethanolamine (DOPE)
  • DOSPA poly-cationic lipid 2,3-dioleyloxy-N-[2(sperminecarbox-amido)ethyl]-N,N-dimethyl-l
  • Exemplary is the formulation Lipofectamine 2000TM (available from Gibco/Life Technologies # 11668019).
  • Other reagents include: FuGENETM 6 Transfection Reagent (a blend of lipids in non- liposomal form and other compounds in 80% ethanol, obtainable from Roche Diagnostics Corp. # 1814443); and LipoTAXITM transfection reagent (a lipid formulation from Invitrogen Corp., produce the desired biologically active protein. #204110).
  • Transfection of hematopoietic stem cells can be performed by electroporation, e.g., as described in Roach and McNeish (Methods in Mol. Biol. 185:1 (2002)).
  • An exemplary method of expressing Hesl in hematopoietic stem cells may involve transducing hematopoietic stem cells with the lentiviral vector as described in Example 1.
  • a cell is "transduced” with a selected nucleic acid when the nucleic acid is translocated into the cell.
  • a cell is "stably transduced” with a selected nucleic acid when the selected nucleic acid is replicated and passed on to progeny cells.
  • Hematopoietic stem cells can be differentiated into monocytes-macrophages by overexpressing Hesl in hematopoietic stem cells and further culturing such cells under appropriate conditions and for a sufficient period of time.
  • monocyte-macrophages differentiation-promoting conditions refers to culturing hematopoietic stem cells until the desired phenotype emerges.
  • HSCs may be cultured in serum free media that contains monocyte-macrophage differentiation factors such as Kit ligand, thrombopoietin (TPO), Fms-like tyrosine kinase-3 (FLT3) in concentrations ranging from about 0.1 to 10,000 ng/mL or from about 10-100 ng/ml.
  • monocyte-macrophage differentiation factors such as Kit ligand, thrombopoietin (TPO), Fms-like tyrosine kinase-3 (FLT3) in concentrations ranging from about 0.1 to 10,000 ng/mL or from about 10-100 ng/ml.
  • TPO thrombopoietin
  • FLT3 Fms-like tyrosine kinase-3
  • Monocyte-macrophages are cells that express markers such as CDl la/LFA-1, CDwl2, CD14, CD15, CD16, CDwl7, CD25, CD26, CD31, CD32, CD33, CD25, CD36, CD39, CD40, CD45RO, CD45RA, CD45RB, CD49a, CD49b, CD49e, CD49f, CD50, CD52, CD60, CD61, CD62L, CD63, CD64, CD68, CD69, CD70, CD74, CDw84, CD85, CD86, CD87, CD88, CD89, CD91, CDw92, CD93,
  • CD14,CD13, CD33 and CD45 are used herein to characterize monocyte-macrophage cells obtained by the methods of the invention.
  • the detection of any one or combination of markers as described above by any conventional means, may be used to define monocyte-macrophage phenotype.
  • Hematopoietic stem cells can be differentiated into dendritic cells by overexpressing Hesl in hematopoietic stem cells and further culturing such cells under appropriate conditions and for a sufficient period of time.
  • dendritic cell differentiation promoting conditions refers to culturing hematopoietic stem cells until the desired phenotype emerges.
  • HSCs may be cultured in serum free media that contains dendritic cell differentiation factors such as Kit ligand, thrombopoietin (TPO), Fms-like tyrosine kinase-3 (FLT3), granulocyte-monocyte colony stimulating factor (GM- CSF), tumor necrosis factor alpha (TNFalpha), extracellular matrix proteins such as fibronectin, stem cell factor (SCF), interferon alpha (IFNalpha) interleukin-4 (IL-4), IL-12, IL-2 in concentrations ranging from about 0.1 to 10,000 ng/mL or from about 10-100 ng/ml.
  • the time required for the desired phenotype to emerge may range from approximately 4-10 days.
  • Dendritic cells are characterized by their expression of particular markers such as but not limited to HLA-DR, CDla, CD21 (follicular dc), CD39, CD40,
  • Dendritic cells are also characterized by their lack of expression of other markers such as but not limited to CD3, CD 14, CD 16, CD 19, CD20, CD56 and CD57.
  • the presence of HLA-DR and CDla cell surface markers and absence of CD 14 cell surface markers are used herein to characterize dendritic cells obtained by the methods of the invention.
  • the detection of any one or combination of markers as described above by any conventional means may be used to define dendritic cell phenotype.
  • Hematopoietic stem cells can be differentiated into neural cells by culturing the cells under appropriate conditions and for a sufficient period of time.
  • neural cell differentiation promoting conditions means culturing hematopoietic stem cells until the desired phenotype emerges.
  • HSCs may be cultured in media that include a neural cell differentiation factor such as erythropoietin (EPO), all trans retinoic acid, epidermal growth factor (EGF) (0.1-lOOng/ml), dexamethasone (0.1-100 ⁇ M), hepatocyte growth factor (HGF) (0.1-100ng/ml), insulin (0.1-100 ⁇ g/ml)-transferrin (0.1- 100, ⁇ g/ml)-selenium (0.1-100ng/ml) (ITS), ethanolamine (0.1-100 ⁇ g/ml) and, in particular, with fibroblast growth factor 4 (FGF-4), preferably in the range of lOng/ml, nerve growth factor (NGF), transforming growth factor-alpha (TGF-alpha), brain-derived neurotrophic factor (BDNF), glial-derived neurotrophic factor (GDNF), acidic fibroblast growth factor (aFGF of FGF-1), basic fibroblast growth factor (bFGF or F
  • neural cells refer to cells that exhibit essential functions of neurons, and glial cells (astrocytes and oligodendrocytes).
  • Preferred neural cells express at least one neural cell specific marker such as nestin, neuron specific enolase
  • neuronal cells express at least one neuronal cell specific marker such as neuron-specific nuclear protein, tyrosine hydroxylase, microtubule associated protein, nestin and calbindin.
  • Differentiated cells derived from hematopoietic stem cells may be detected and/or enriched by the detection of tissue-specific markers by immunological techniques, such as flow immunocytochemistry for cell-surface markers, immunohistochemistry (for example, of fixed cells or tissue sections) for intracellular or cell-surface markers, Western blot analysis of cellular extracts, and enzyme-linked immunoassay, for cellular extracts or products secreted into the medium.
  • tissue-specific gene products can also be detected at the mRNA level by Northern blot analysis, dot-blot hybridization analysis, or by reverse transcriptase initiated polymerase chain reaction (RT-PCR) using sequence-specific primers in standard amplification methods.
  • differentiated cells may be detected using selection markers.
  • hematopoietic stem cells can be stably transfected with a marker that is under the control of a tissue-specific regulatory region as an example, such that during differentiation, the marker is selectively expressed in the specific cells, thereby allowing selection of the specific cells relative to the cells that do not express the marker.
  • the marker can be, e.g., a cell surface protein or other detectable marker, or a marker that can make cells resistant to conditions in which they die in the absence of the marker, such as an antibiotic resistance gene (see e.g., in U.S. Patent No. 6,015,671).
  • the hematopoietic stem cells may be induced to over-express the Hesl transcription factor and/or contacted with various growth factors (termed differentiation factors) that influence differentiation of such stem cells into particular cell types such as monocytes- macrophages, dendritic cells or glial cells for a sufficient period of time.
  • growth factors such as monocytes- macrophages, dendritic cells or glial cells for a sufficient period of time.
  • such cells may also be treated with inhibitors or antagonists of Hesl to promote the differentiation of hematopoietic stem cells into neurons (Ross et al, Neuron 39:13-25 (2003)).
  • embryonic stem cells may be used in place of hematopoietic stem cells.
  • compositions comprising hematopoietic stem cells or cells differentiated therefrom may be administered to a subject to provide various cellular or tissue functions.
  • compositions may be formulated in any conventional manner using one or more physiologically acceptable carriers optionally comprising excipients and auxiliaries. Proper formulation is dependent upon the route of administration chosen.
  • the compositions may be packaged with written instructions for use of the cells in tissue regeneration, or restoring a therapeutically important metabolic function.
  • Hematopoietic stem cells may also be administered to the recipient in one or more physiologically acceptable carriers. Carriers for these cells may include, but are not limited to, solutions of phosphate buffered saline (PBS) or lactated Ringer's solution containing a mixture of salts in physiologic concentrations.
  • PBS phosphate buffered saline
  • lactated Ringer's solution containing a mixture of salts in physiologic concentrations.
  • Support matrices into which the hematopoietic stem cells can be incorporated or embedded include matrices which are recipient-compatible and which degrade into products which are not harmful to the recipient. These matrices provide support and protection for hematopoietic stem cells and differentiated cells in vivo and are, therefore, the preferred form in which such cells are transplanted into the recipient subjects.
  • Natural and/or synthetic biodegradable matrices are examples of such matrices.
  • Natural biodegradable matrices include plasma clots, e.g., derived from a mammal, collagen, fibronectin, and laminin matrices.
  • Suitable synthetic material for a cell transplantation matrix must be biocompatible to preclude migration and immunological complications, and should be able to support extensive cell growth and differentiated cell function. It must also be resorbable, allowing for a completely natural tissue replacement.
  • the matrix should be configurable into a variety of shapes and should have sufficient strength to prevent collapse upon implantation. Recent studies indicate that the biodegradable polyester polymers made of polyglycolic acid fulfill all of these criteria, as described by Vacanti, et al. J.
  • biodegradable support matrices include synthetic polymers such as polyanhydrides, polyorfhoesters, and polylactic acid. Further examples of synthetic polymers and methods of incorporating or embedding cells into these matrices are also known in the art. See e.g., U.S. Pat. Nos. 4,298,002 and 5,308,701.
  • Attachment of the cells to the polymer may be enhanced by coating the polymers with compounds such as basement membrane components, agar, agarose, gelatin, gum arabic, collagens types I, II, III, IV and V, fibronectin, laminin, glycosaminoglycans, mixtures thereof, and other materials known to those skilled in the art of cell culture. All polymers for use in the matrix must meet the mechanical and biochemical parameters necessary to provide adequate support for the cells with subsequent growth and proliferation.
  • the polymers can be characterized with respect to mechanical properties such as tensile strength using an Instron tester, for polymer molecular weight by gel permeation chromatography (GPC), glass transition temperature by differential scanning calorimetry (DSC) and bond structure by infrared (IR) spectroscopy, with respect to toxicology by initial screening tests involving Ames assays and in vitro teratogenicity assays, and implantation studies in animals for immunogenicity, inflammation, release and degradation studies.
  • GPC gel permeation chromatography
  • DSC differential scanning calorimetry
  • IR infrared
  • biodegradable polymeric matrix One of the advantages of a biodegradable polymeric matrix is that angiogenic and other bioactive compounds can be incorporated directly into the support matrix so that they are slowly released as the support matrix degrades in vivo. As the cell-polymer structure is vascularized and the structure degrades, hematopoietic stem cells may differentiate according to their inherent characteristics.
  • vascular growth factors including nutrients, growth factors, inducers of differentiation such as Hesl or de-differentiation (i.e., causing differentiated cells to lose characteristics of differentiation and acquire characteristics such as proliferation and more general function), products of secretion, immunomodulators, inhibitors of inflammation, regression factors, biologically active compounds which enhance or allow ingrowth of the lymphatic network or nerve fibers, hyaluronic acid, and drugs, which are known to those skilled in the art and commercially available with instructions as to what constitutes an effective amount, from suppliers such as Collaborative Research, Sigma Chemical Co., vascular growth factors such as vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), and heparin binding epidermal growth factor like growth factor (HB-EGF), could be incorporated into the matrix or provided in conjunction with the matrix.
  • VEGF vascular endothelial growth factor
  • EGF epidermal growth factor
  • HB-EGF heparin binding epidermal growth factor like growth factor
  • polymers containing peptides such as the attachment peptide RGD can be synthesized for use in forming matrices (see e.g. U.S. Patent Nos. 4,988,621, 4,792,525, 5,965,997, 4,879,237 and 4,789,734).
  • the cells may be transplanted in a gel matrix (such as Gelfoam from Upjohn Company) which polymerizes to form a substrate in which the hematopoietic stem cells or differentiated cells can grow.
  • a gel matrix such as Gelfoam from Upjohn Company
  • encapsulation technologies have been developed (e.g. Lacy et al., Science 254:1782-84 (1991); Sullivan et al., Science 252:718-712 (1991); WO 91/10470; WO 91/10425; U.S. Pat. No. 5,837,234; U.S. Pat. No. 5,011,472; U.S. Pat. No. 4,892,538).
  • hematopoietic stem cells During open surgical procedures, involving direct physical access to the damaged tissue and/or organ, all of the described forms of undifferentiated hematopoietic stem cells or differentiated hematopoietic stem cell delivery preparations are available options. These cells can be repeatedly transplanted at intervals until a desired therapeutic effect is achieved. An example of the desired therapeutic effect is the prevention of infection by monocytes-macrophages obtained by differentiation HSCs using the methods of this invention.
  • the present invention also relates to the use of hematopoietic stem cells in three dimensional cell and tissue culture systems to form structures analogous to tissue counterparts in vivo. The resulting tissue will survive for prolonged periods of time, and perform tissue-specific functions following transplantation into the recipient host. Methods for producing such structures are described in US Patent No. 5,624,840 and 6,428,802, which are incorporated herein in their entireties.
  • the three-dimensional matrices to be used are structural matrices that provide a scaffold for the cells, to guide the process of tissue formation.
  • Scaffolds can take forms ranging from fibers, gels, fabrics, sponge-like sheets, and complex 3-D structures with pores and channels fabricated using complex Solid Free Form Fabrication (SFFF) approaches.
  • SFFF Solid Free Form Fabrication
  • Cells cultured on a three-dimensional matrix will grow in multiple layers to develop organotypic structures occurring in three dimensions such as ducts, plates, and spaces between plates that resemble sinusoidal areas, thereby forming new tissue.
  • the present invention provides a three-dimensional framework, multilayer cell and tissue culture system.
  • three-dimensional framework refers to a three-dimensional scaffold composed of any material and/or shape that (a) allows cells to attach to it (or can be modified to allow cells to attach to it); and (b) allows cells to grow in more than one layer.
  • the structure of the framework can include a mesh, a sponge or can be formed from a hydro gel.
  • Examples of such frameworks include a three-dimensional stromal tissue or living stromal matrix which has been inoculated with stromal cells that are grown on a three dimensional support. The extracellular matrix proteins elaborated by the stromal cells are deposited onto the framework, thus forming a living stromal tissue.
  • the living stromal tissue can support the growth of hematopoietic stem cells or differentiated cells later inoculated to form the three-dimensional cell culture. Examples of other three dimensional frameworks are described in US Patent No. 6,372,494.
  • the design and construction of the scaffolding to form a three-dimensional matrix is of primary importance.
  • the matrix should be a pliable, non-toxic, injectable porous template for vascular ingrowth.
  • the pores should allow vascular ingrowth. These are generally interconnected pores in the range of between approximately 100 and 300 microns, i.e., having an interstitial spacing between 100 and 300 microns, although larger openings can be used.
  • the matrix should be shaped to maximize surface area, to allow adequate diffusion of nutrients, gases and growth factors to the cells on the interior of the matrix and to allow the ingrowth of new blood vessels and comiective tissue.
  • a porous structure that is relatively resistant to compression is preferred, although it has been demonstrated that even if one or two of the typically six sides of the matrix are compressed, that the matrix is still effective to yield tissue growth.
  • the polymeric matrix may be made flexible or rigid, depending on the desired final form, structure and function.
  • a flexible fibrous mat is cut to approximate the entire defect, then fitted to the surgically prepared defect as necessary during implantation.
  • An advantage of using the fibrous matrices is the ease in reshaping and rearranging the structures at the time of implantation.
  • a sponge-like structure can also be used to create a three-dimensional framework.
  • the stracture should be an open cell sponge, one containing voids interconnected with the surface of the structure, to allow adequate surfaces of attachment for sufficient hematopoietic stem cells or differentiated cells to form a viable, functional implant.
  • a preferred dose is in the range of at least about 0.25 to at least about l.OxlO 6 cells.
  • Hematopoietic stem cells or differentiated cells can be administered by injection into a target site of a subject, preferably via a delivery device, such as a tube, e.g., catheter.
  • the tube additionally contains a needle, e.g., a syringe, through which the cells can be introduced into the subject at a desired location.
  • a delivery device such as a tube, e.g., catheter.
  • the tube additionally contains a needle, e.g., a syringe, through which the cells can be introduced into the subject at a desired location.
  • a needle e.g., a syringe
  • Specific, non- limiting examples of administering cells to subjects may also include administration by subcutaneous injection, intramuscular injection, or intravenous injection. If administration is intravenous, an injectible liquid suspension of cells can be prepared and administered by a continuous drip or as a bolus.
  • Cells may also be inserted into a delivery device, e.g., a syringe, in different forms.
  • the cells can be suspended in a solution contained in such a delivery device.
  • the term "solution” includes a pharmaceutically acceptable carrier or diluent in which the cells of the invention remain viable.
  • Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents is well known in the art.
  • the solution is preferably sterile and fluid to the extent that easy syringability exists.
  • the solution is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • Solutions of the invention can be prepared by incorporating hematopoietic stem cells or differentiated cells as described herein, in a pharmaceutically acceptable carrier or diluent and, as required, other ingredients enumerated above, followed by filter sterilization.
  • the cells may be administered systemically (for example intravenously) or locally (for example directly into a myocardial defect under echo cardiogram guidance, or by direct application under visualization during surgery).
  • the cells may be in an injectible liquid suspension preparation or in a biocompatible medium which is injectible in liquid fonu and becomes semi-solid at the site of damaged tissue.
  • a conventional intra- cardiac syringe or a controllable endoscopic delivery device can be used so long as the needle lumen or bore is of sufficient diameter (e.g. 30 gauge or larger) that shear forces will not damage the cells being delivered.
  • Cells may be administered in a manner that permits them to graft to the intended tissue site and reconstitute or regenerate the functionally deficient area. Both types of cells can be used in therapy by direct administration, or as part of a bioassist device that provides temporary or permanent organ function.
  • tissue refers to an aggregation of similarly specialized cells united in the performance of a particular function. Tissue is intended to encompass all types of biological tissue including both hard and soft tissue. Soft tissue refers to tissues that connect, support, or surround other structures and organs of the body. Soft tissue includes muscles, tendons (bands of fiber that connect muscles to bones), fibrous tissues, fat, blood vessels, nerves, and synovial tissues (tissues around joints).
  • Hard tissue includes connective tissue (e.g., hard forms such as osseous tissue or bone) as well as other muscular or skeletal tissue. 4)
  • Therapeutic uses of HSCs Hematopoietic stem cells or cells differentiated therefrom may be genetically engineered to produce a particular therapeutic protein.
  • therapeutic protein includes a wide range of biologically active proteins including, but not limited to, growth factors, enzymes, hormones, cytokines, inhibitors of cytokines, blood clotting factors, peptide growth and differentiation factors.
  • Particular differentiated cells may be engineered with a protein that is normally expressed by the particular cell type.
  • neural cells could be engineered to produce one or more neuro transmitters, such as glutamate, acetylcholine, serotonin, norepinephrine, dopamine, glycine, gamma-amino butyric acid and/or histamine.
  • neuro transmitters such as glutamate, acetylcholine, serotonin, norepinephrine, dopamine, glycine, gamma-amino butyric acid and/or histamine.
  • neural cells could be engineered to produce and secrete one or more proteinaceous materials, such as enkephalin, vasoactive intestinal peptide, calcitonin gene-related peptide, substance P, somatostatin, luteinizing hormone- releasing hormone, neurotensin, galanin, neuropeptide Y and/or cholecystokinin.
  • dendritic cells can be engineered to express an immunogenic protein or peptide.
  • the present invention also provides for administration of dendritic cells derived from hematopoietic stem cells for vaccine immunotherapy.
  • Dendritic cells (or dendritic precursor cells) obtained by the methods of the invention may be exposed to anti genie peptide fragments ex vivo (referred to as "antigen pulsing"), or genetically modified ex vivo to express a desired antigen, and subsequently administered to a patient to induce an anti- antigen immune response.
  • the pulsed or genetically modified DCs can be cultured ex vivo with T lymphocytes (e.g., HLA-matched T lymphocytes) to activate those
  • T cells that specific for the selected antigen are T cells that specific for the selected antigen.
  • antigen-laden DC may be used to boost host defense against tumors (see, e.g., Hsu et al, (1996) Nature Med. 2:52-58; Young et al., (1996) J Exp Med. 183:7-11; McArthur et al, (1998) J. Immunother. 21 :41-47; Tuting et al., (1997) Eur. J Immunol. 27:2702-2707; Nair et al, (1997) Int. J. Cancer 70:706-715).
  • the target antigen e.g., target "tumor” antigen
  • the dendritic cells may be fused with whole cancer cells from a subject to create individualized vaccines (Kugler, A., et al. (2000) Nat. Med. 6:332-336 and Kufe, (2000) Nat. Med. 6:252-253).
  • the present invention also provides for administration of dendritic cells derived from hematopoietic stem cells for pathogen immunotherapy.
  • the term "pathogen” refers to any disease producing microorganism.
  • the dendritic cells of the invention may be used to boost host defense against pathogens such as but not limited to, viruses, (e.g., single stranded RNA viruses, single stranded DNA viruses, human immunodeficiency virus (HIV), hepatitis A, B, and C virus, herpes simplex virus (HSV), cytomegalovirus (CMV) Epstein-Barr virus (EBV), human papilloma virus (HPV)), parasites (e.g., protozoan and metazoan pathogens such as Plasmodia species, Leishmania species, Schistosoma species, Trypanosoma species (examples of protozoan and metazoan pathogens include but are not limited to entamoeba histolytica, giardia lambilia, trichomoniasis vaginalis, cryptosporidium,
  • viruses e.g., single
  • tuberculosis Salmonella, Streptococci, E. coli, Staphylococci
  • fungi e.g., Candida species, Aspergillus species
  • Pneumocystis carinii Pneumocystis carinii, prions and helminths
  • tapeworms such as taenia saginata, taenia solium, diphyllobothrium latum, hymenolepsis nana, echinococcosis, trematodes such as schistosomes sp., clonorchiasis sinensis, paragonimiasis westermani, intestinal fluke and roundworms such as ponworm, whipworm, ascaris, hookworm, strongyloides, trichinella spiralis, filiaria).
  • the present embodiment of the invention is particularly useful where the pathogen has an acquired resistance to conventional treatment modalities, such as antibiotics.
  • Hematopoietic stem cells that have been differentiated may be administered or transplanted to a subject to provide various cellular or tissue functions specific to the differentiated cell type.
  • the present invention also provides for administration of neural cells derived from hematopoietic stem cells for treatment of neurological disease.
  • neural disease refers to a disease or condition associated with any defects in the entire integrated system of nervous tissue in the body: the cerebral cortex, cerebellum, thalamus, hypothalamus, midbrain, pons, medulla, brainstem, spinal cord, basal ganglia and peripheral nervous system.
  • Examples include but are not limited to: Parkinson's disease, Huntington's disease, Multiple Sclerosis, Alzheimer's disease, amylotrophic lateral sclerosis (ALS or Lou Gerhig's disease), muscular dystrophy, Pick's disease, Krabbe disease, Guillain-Barre Syndrome, central potine myelinolysis, Alexander's disease, Canavan disease, Cockagne's syndrome, Pelizaeus-Merzbacher's disease, choreic syndrome, dystonic syndrome, post-infection encephalitis, HIV encephalitis, stroke or paralysis.
  • Parkinson's disease Huntington's disease, Multiple Sclerosis
  • Alzheimer's disease Alzheimer's disease
  • amylotrophic lateral sclerosis ALS or Lou Gerhig's disease
  • muscular dystrophy Pick's disease
  • Krabbe disease Guillain-Barre Syndrome
  • central potine myelinolysis Alexander's disease
  • Canavan disease Cockagne's syndrome
  • the hematopoietic stem cells may be used in in vitro priming procedures that result in neural stem cells becoming neurons when grafted into non-neurogenic or neurogenic areas of the nervous system.
  • Transplanted cells further differentiate by acquiring cholinergic, glutamatergic and/or GABAergic phenotypes in a region-specific manner. For example, when transplanted into medial septum or spinal cord, they preferentially differentiate into cholinergic neurons; when transplanted into frontal cortex they preferentially differentiate into glutamatergic neurons; and when transplanted into hippocampus they preferentially differentiate into GABAergic neurons.
  • Neurons when transplanted into medial septum or spinal cord, they preferentially differentiate into cholinergic neurons; when transplanted into frontal cortex they preferentially differentiate into glutamatergic neurons; and when transplanted into hippocampus they preferentially differentiate into GABAergic neurons.
  • hematopoietic stem cells may be used in in vitro priming procedures that result in neural stem cells becoming glial when grafted into various areas of the nervous system. 5) Using HSCs to screen for new research and therapeutic compounds
  • Hematopoietic stem cells can be used to assess the ability of a test agent to elicit or inhibit biological effects.
  • the biological effect that is measured can be triggering of cell death (i.e., cytotoxicity or hepatotoxicity); a cytostatic effect; or a transforming effect on the cell, as determined, e.g., by an effect on the genotype or phenotype of the cells.
  • the cytotoxicity on cells can be determined, e.g., by incubating the cells with a vital stain, such as trypan blue.
  • a vital stain such as trypan blue.
  • the agent may be contacted with the hematopoietic stem cells and differentiation assessed using any means known to one of skill in the art. For example, the morphology can be examined using electron microscopy. Immunohistochemical or immunofluorescence techniques may also be used to assess differentiation. Differentiation may be further assessed by analyzing expression of specific mRNA molecules expressed in specific differentiated cells. Suitable assay systems include, but are not limited to RT-PCR, in situ hybridization, Northern analysis, or RNase protection assays. In a further embodiment the levels of polypeptides expressed in differentiated cell types are assayed. Specific, non-limiting examples of polypeptide assays include Western blot analysis, ELISA assay, or immunofluorescence.
  • Differentiated cells may be used to test whether test agents such as lead drug compounds have a negative biological effect on the cells.
  • dendritic cells may be incubated in the presence or absence of a test agent for a time sufficient to determine whether the test agent may be cytotoxic to cells. Examples of such test agent may be eytotoxins.
  • dendritic cells may be incubated in the presence or absence of a test agent for a time sufficient to determine whether the compound is adaptive or protective to the cells under cytotoxic conditions.
  • dendritic cells may be screened for test compounds that stimulate or inhibit Hesl expression or activity.
  • HSCs neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor, or neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor-derived neurotrophic factor
  • Another use of differentiated cells is to perform toxicity testing before proceeding to animal testing.
  • Differentiated cells can be incubated with various concentrations of a test compound.
  • differentiated cells are plated in the wells of a multi-well plate to which different concentrations of the test compound are added, e.g., 0 ⁇ M; 0.01 ⁇ M; 0.1 ⁇ M; 1 ⁇ M; 10 ⁇ M; 100 ⁇ M; 1 mM; 10 mM and 100 mM.
  • Cells can be incubated for various times, e.g., 1 minute, 10 minutes, 1 hour, 2 hours, 5 hours, 10 hours, 24 hours, 36 hours or more.
  • Differentiated cells derived from hematopoietic stem cells of the invention can also be used for metabolic profiling.
  • cells or a fraction thereof are contacted with a test agent, potentially at different concentrations and for different times, the media is collected and analyzed to detect metabolized forms of the test agent.
  • a control molecule such as bufuralol is also used.
  • Metabolic profiling can be used, e.g., to determine whether a subject metabolizes a particular drug and if so, how the drug is metabolized. 6) Evaluating Hesl activity
  • agents include but are not limited to antagonists (i.e., is capable of promoting the transcription-activation activities of Hesl), agonists (i.e., is capable of blocking the transcription-activation activities) or mimetics of Hesl function.
  • the expression plasmid and the reporter plasmid are cotransfected into suitable host cells such as 293T cells.
  • suitable host cells such as 293T cells.
  • the transfected host cells are then cultured in the presence and absence of a test agent or compound.
  • the transfected and cultured host cells may then be monitored for induction (i.e., the presence) of the product of the reporter gene sequence to determine whether the test agent or compound acts as an antagonist or as agonist of Hesl function.
  • the reporter plasmid which may be any plasmid which contains an operative Hesl responsive promoter/enhancer element, functionally linlced to an operative reporter gene can be transfected into suitable host cells.
  • the transfected and cultured host cells may then be cultured in the presence and absence of a test agent or compound and monitored for induction (i.e., the presence) of the product of the reporter gene sequence to determine whether the test agent or compound acts as mimetic of Hesl function.
  • Example 1 Enforced expression of the Notch pathway target transcription factor, Hesl, induced monocytic differentiation of hematopoietic stem-progenitor cells
  • Human 293T cells were cultured in DMEM medium (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS; Gemini Bioproducts, Woodland, CA).
  • Human U937 monoblastic cells ATCC, Manassas, VA
  • RPMI 1640 medium Invitrogen
  • Normal human CB CD34 + cells were purchased from AllCells (San Mateo, CA).
  • Normal BM and PBSC CD34 + cells were provided from the Hematopoietic Cell Processing Core of National Heart, Lung, and Blood Institute Program of Excellence in Gene Therapy at Fred Hutchison Cancer Center.
  • CD34 + cells were purified by immunomagnetic selection (Miltenyi Biotech, Auburn, CA) and were >90% CD34 + upon re-analysis by FACS.
  • CD34 + cells were cultured in IMDM medium, supplemented with 30% FBS, 50 ng/ml KL, 10 ng/ml IL3, and 5 IU/ml Epo (A gen,
  • the dual promoter lentivirus was constructed by inserting the CMV promoter immediately upstream of GFP in the EF.GFP lentiviral vector to make the intermediate lentiviral vector, EF.v-CMV.GFP, with a unique EcoRV site available to insert a gene of interest under the control of the EF promoter.
  • Recombinant lentivirus were produced by transient transfection of the transducing vector into 293T cells with two packaging vectors: pMD.G, a plasmid expressing the VSV- G envelope gene, and pCMV ⁇ R8.91, a plasmid expressing the HIV-1 gag/pol, tat and rev genes as described in Cui et al, (2002) Blood 99:399-408.
  • the virus supernatants were collected at 24 and 48 hours after transfection. Viral titers were determined by the percentage of GFP+ 293T or TFl cells that had been transduced with serial dilutions of neat or concentrated lentivirus supernatants as described in Cui et al, (2002) Blood 99:399-408.
  • Lentivirus supernatants were concentrated using filtration columns (Centricon Plus -20, molecular weight cutoff 100 kDa: Millipore, Bedfordm MA).
  • CD34 cells were transduced with the lentiviral vector at a multiplicity of infection (MOI) of 5-10, generally on days 0 and 1 (or days 1, 3 and 5) as stipulated in the individual experiments in QBSF-60 medium containing FTK. After each round of transduction (12-16 hours), cells were centrifugally washed with PBS and resuspended in fresh medium. In specified experiments, transduced cells were sorted based on GFP fluorescence using a FACS Vantage SE flow cytometer (Becton Dickinson, San Jose, CA) for further studies.
  • MOI multiplicity of infection
  • RNA isolation and real-time quantitative RT-PCR (qRT-PCR) analysis were performed as described previously (Yu et al, Development 129:505-516 (2002)), which is incorporated by reference.
  • Mouse Hesl primer and TaqMan probe sequences used were as follows: forward primer: 5' CACCGGACAAACCAAAGACG 3' (SEQ ID NO: 9) reverse primer: 5' TTATTCTTGCCCTTCGCCTC 3' (SEQ ID NO: 10) ; and probe: 5' TGAGCACAGAAAGTCAT CAAAGCCTATCATGG 3' (SEQ ID NO:
  • Human PU.l (Spi-1) primers and probe sequences were: forward primer: 5' CCCCTATCTCAGCAGTG ATGG 3' (SEQ ID NO: 18) ; reverse primer: 5' TCGAACTCGCTGTGCACG 3' (SEQ ID NO: 19) ; and probe: 5' AGAGCCATAGCGA CCATTACTGGGACTTCC 3' (SEQ ID NO: 20) .
  • the human /3-actin primer and probe sequences were described previously (Yu et al,
  • FACScan and FACSort flow cytometers were used for FACS analysis (Tanavde et al, Exp. Hematol 30:816-823 (2002); Yu et al, (2003)). Green fluorescence from GFP was detected in the
  • FL1 emission channel (535 ⁇ 30 nm); PE or PKH26 fluorescence was detected in FL2 (578 ⁇ 28 nm) and PerCP fluorescence was detected in FL3 channel (675 ⁇ 20 nm).
  • PE- conjugated anti-human CD34, CD14, CD71; anti-mouse CD45.1; anti-mouse CD l ib; PerCP-conjugated anti-human CD45 and isotype control monoclonal antibodies against leukocyte differentiation antigens were purchased from BectonDickinson. Fluorescence microscopy of GFP expression was performed with a Nikon TE300 microscope. Immunohistochemistry
  • Nonspecific-esterase (NSE) staining was performed in adherent cells using ⁇ - naphthyl acetate esterase staining kit (Sigma Diagnostics, St Louis, MO).
  • Annexin Viaprobe analysis was done as described previously (Yu et al., 2003). Separation of divided arid undivided cells from ex vivo-cultured CD34 cells
  • PKH26-labeled CD34 + cells were then sorted using a FAGS Vantage SE (Becton-Dickinson) cell sorter. The sorted cells PKH26 lg /CD34 + cells were subsequently cultured ex vivo for 7 days. Using the identical width of the initial PKH26 + cell band, cells were then sorted to obtain cells that had divided several times (PKH low ) cells vs. cells that had not divided or had divided only once or twice
  • CFC Colony-forming cell assays
  • transduced CD34 + cells were FACS-sorted into GFP + and GFP " populations after lentiviral transduction.
  • the unsorted, or sorted GFP + or GFP " cells were plated (1000 FACS-sorted cells per 35 mm petri dish) in CFC assays in triplicate (Tanavde et al, (2002)), including for HPP-CFCs (McNiece et al, Exp. Hematol 28:1181- 1186 (2000)).
  • Transduced CB CD34 + cells were FACS-sorted to obtain the GFP + cells, which were allowed to recover during overnight culture in QBSF-60 medium containing FTK.
  • GFP + cells were then transferred into poly-D-lysine (Becton Dickinson) pre-coated 4-well slidechambers (Nalge Nunc International, Naperville, IL) and cultured for 2 hours. Cells were then labeled with 30 ⁇ M BrdU (Sigma Chemical Co., St. Louis, MO) for 15 min at room temperature. After serial treatments following manufacturer's instructions with paraformaldehyde, HCI, and pepsin, cells were incubated with anti-BrdU antibody (Sigma), followed by staining with Alexa fluor 594-labeled secondary antibody (Molecular Probes, Eugene, OR). After DAPI staining (Molecular Probes, Eugene, OR) following manufacturer's instructions, cells were counted and scored for BrdU staining. Plasmid construction, transient transfection, small inhibitory RNA (siRNA)
  • the mPU.l promoter region (-278 to +134) was cloned into the pGL2 -basic luciferase plasmid (Promega, Madison, WI).
  • luciferase assays 293 T cells, plated the day before at 8 x 10 4 cells per well in 6-well plates, were co-transfected with 750ng PU. 1 luciferase reporter plasmid, increasing amounts of the Hesl expression vector (up to 25ng), and 5 ⁇ l Lipofectamine 2000 (Invitrogen). 5ng 3-galactosidase expression vector was used for normalization of transfection efficiency. Luciferase and -gal activity were assessed 48 hours later. 20 ⁇ g PU.
  • Hairpin siRNA oligonucleotides were cloned into pSilencer 2.0 (Ambion, Austin, TX). 800 ng pSilencer vectors was transfected into 8 x 10 4 293T cells, as described above.
  • the anti-hHesl sense sequence was GAAAGATAGCTCGCGGCAT (SEQ ID NO: 21)
  • the anti-human ICN1 (Notchl) sense sequence was GAAGTTCCGGTTCGAGGAGT (SEQ ID NO: 22)
  • the control siRNA sense sequence was CTACCGTTGTTATAGGTG (SEQ ID NO: 23) .
  • Anti-sense oligonucleotide treatment
  • All anti-sense oligonucleotides were purified by reverse-phase HPLC (Qiagen Inc., Valencia, CA). The last three nucleotides at both ends had their inter-nucleotidic linkages phosphorothioated. Scrambled (S) and random (RAN) sequences were used as controls. The Hesl anti-sense oligonucleotides and scrambled oligonucleotides were described before (Kabos et al, J. Biol Chem. 277:8763-8766 (2002)). The sequences of these oligonucleotides were as follows (s indicates a phosphorothioate): anti-Hesl:
  • Anti-sense or control oligonucleotides were added to day 0 CB CD34 + cells at 20 ⁇ M in QBSF60 medium supplemented with FTK. On day 4 of culture, lO ⁇ M (final concentration) oligonucleotides were added again after half of the medium was changed. On day 7, cells were harvested for FACS staining, CFC assay, and qRT-PCR analysis. Electrophoretic mobility shift assay (EMSA)
  • Nuclear extracts were prepared from Hesl-transfected 293T cells.
  • the wild-type and mutant PU. 1 probes employed for gel shift assays were:
  • N-box wild-type: CAGGAACTTGTGCTGGCCCTGC (SEQ ID NO: 26) and N-box mutant: CAGGAAGTCGACCTGGCCCTGC (SEQ ID NO: 27) (wild-type and mutant N-box sites underlined).
  • DNA competition experiments a 100- fold excess of unlabeled double-stranded oligonucleotide was added.
  • the protein involved in the protein-DNA complex was identified in supershift experiments using rabbit anti-Hesl antibody vs. normal rabbit immunoglobulin (Santa Cruz Biotechnology, Santa Cruz, CA). Western blotting was carried out as described (Yu et al, (2002)) using rabbit anti- Hesl (kind gift of Dr.
  • BM cells from B6.SJL (CD45.1 + ) mice were harvested and enriched by immunomagnetic depletion of cells expressing mature hematopoietic lineage (Lin) antigens (Stem Cell Technologies, Vancouver, CA).
  • Lin mouse BM cells were plated in QBSF58 (Quality Biologicals) medium supplemented with mKL (100 ng/ml; Peprotech, Rocky Hill, NJ), FL (50 ng/ml) and TPO (10 ng/ml). Cells were transduced with lentiviral vectors on days 0 and 1 of ex vivo culture.
  • mice On Day 3, cells were collected and intravenously injected via tail vein into sublethally irradiated (650 cGy) recipient C57BL6 (CD45.2 + ) mice (105 input cells per mouse). Mice were sacrificed 9 weeks after transplantation. BM cells were evaluated for frequency and number of donor cells (CD45.1 ) and transduced donor cells (GFP + /CD45.1 + ). Mouse anti-CD45.1 and isotype control antibodies were purchased from
  • Example 1.1 Constitutive expression of Hesl in C 34 cell cultures increased monocyte-macrophages and decreased other cell types, including CD34* Notchl and Notch2 are known to be expressed in human HSCs (Ohishi, et al,
  • Example 1.2 Hesl -transduced HSCs proliferated in vitro, but more slowly than control HSCs; Hesl -transduction did not increase apoptosis.
  • the %CD34 + GFP + cells declined from 95% (day 0) to 13% in the control culture, and to 7% in the Hesl -transduced culture; the %CD14 + CD45 + GFP + cells increased to 38%, compared to 5% in control culture.
  • the total numbers of CD14 + CD45 + cells increased to 3-times the starting cell numbers; this was
  • human CB GFP + CD34 + cells were FACS-sorted on day 3, and cultured at low density (in serum-free medium containing FTK). Each culture well was scanned and photographed daily for 3 subsequent days, and all the cells in each well were counted from the digital images. Nearly all the cells remained GFP + and appeared viable throughout the 3 days. While there were increases in total cell numbers in both groups, cell counts of the control-transduced cultures were 2-fold higher than were those of the Hesl -transduced cells (Fig 2A). There were 3 -fold higher numbers of BrdU 1" (S phase) cells in cultures of control-transduced vs. Hesl -transduced cells (Fig 2B, C).
  • Example 1.3 Hesl expression induced monocyte-macrophage differentiation ofCD34 cell subsets.
  • CD34 + [CD64/CD13/CD33] + [CD71/CD235a] cells (enriched for mono-granulocytic progenitors) from human PBSCs resulted in monocyte-macrophage predominance, similar to the results of Hesl transduction of the (bulk) CD34 cell population described above.
  • CD34 + CD38 Lin
  • PBSC cells known to be enriched in in vivo engrafting stem cells and depleted of progenitor cells) (Civin, et al, Blood 88:4102-4109 (1996); Bhatia et al,
  • Example 1.4 Over-expression of Hesl favored monocyte-macrophage differentiation and suppressed erythroid differentiation
  • Example 1.5 Hesl transduction blocked hematopoietic colony formation by human CD34 + cells.
  • CD34 cells from CB, BM or PBSC were transduced as above on days 0 and 1.
  • GFP + vs. GFP cell populations were isolated by FACS sorting, and then plated in methylcellulose CFC assays.
  • GFP + s. GFP cells that had been FACS-sorted from control - transduced cells generated similar numbers of CFC-GM, BFU-E, CFC-Mix, and HPP-CFC colonies (Fig 5). >90% of the colonies from the GFP FACS-sorted cells were green fluorescent, by bright field and fluorescence microscopy.
  • the numbers, types, and sizes of colonies generated from the FACS-sorted GFP " cells from the mHesl-transduced group were comparable to those from the control-transduced group.
  • the FACS-sorted GFP cells from the same numbers of cells from the Hesl -transduced group contained very few CFCs of any type, and most of these were small ( ⁇ 0.5 mm in diameter, consisting of small numbers of cells per colony) or non- fluorescent colonies. These few colonies in the Hesl -transduced group might have derived from untransduced (or low-level-Hesl- transduced) HSCs, or transient expressers. These observations were made consistently using all 3 tissue-sources of human HSCs.
  • Mouse BM (CD45.1 l + ) ⁇ was enriched for HSCs by immuno-magnetic depletion of Lin " cells 57 (Whartenby, et al, Blood 100:3147-3154 (2002), then transduced with mHesl or control lentivector on days 1 and 2 as above.
  • the non-adherent cells from the same cultures were transplanted into sublethally irradiated congenic C57BL6 mice (CD45.2 + ).
  • 9 weeks after transplantation -20% CD45.1 donor-derived engrafiment was observed in mice transplanted with control vector- or mock-transduced HSCs (Fig 6A).
  • the PU.l transcription factor is essential for monocyte-macrophage differentiation (Scott, et al, Science 265:1573-1577 (1994)) and was recently shown to be induced by Notchl over-expression in an immortalized cell line (Schroeder, et al, J. Immunol. 170:5538-5548 (2003)).
  • human CB CD34 + cells were transduced with mHesl or control lentivector on days 0 and 1, and FACS-sorted on day 3 to isolate GFP and GFP " populations.
  • CD34 + cells were treated with Hesl anti-sense or control oligonucleotides for 7 days of ex vivo culture in serum- free medium containing FTK.
  • Treatment with the anti-Hesl anti- sense oligonucleotide resulted in an -50% reduction of endogenous Hesl expression, as compared to treatment with control (scrambled) oligonucleotide.
  • the PU.1 mRNA level of the anti-Hesl -treated cells was significant lower than that of the control cells (Fig 7B).
  • PU.l expression was altered in association with up- or down-modulation of Hesl expression in HSCs.
  • Id proteins (Idl -4, HLH proteins without DNA-binding domains) form heterodimers with Hesl and thereby inhibit Hesl's DNA binding activity

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention repose en partie sur la découverte que la surexpression d'un facteur de transcription, Hes1, stimule la différenciation des cellules souches hématopoïétiques en différents types de cellules, y compris, de manière non limitative, en monocytes-macrophages et en cellules dendritiques. Il apparaît en outre qu'une modulation de l'expression de Hes1, de façon que Hes1 est surexprimé ou sous-exprimé, stimule la différenciation des cellules souches hématopoïétiques en neurones ou en cellules gliales, respectivement. L'invention se rapporte par conséquent à des procédés permettant la différenciation de cellules souches hématopoïétiques isolées, qui ont été isolées dans de la moelle osseuse, du sang de cordon ombilical, du sang périphérique ou du sang non mobilisé.
PCT/US2004/004085 2003-02-12 2004-02-12 Determination de la destinee par hes1 dans des cellules souches et progenitrices hematopoietiques et utilisation WO2004072264A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US44693903P 2003-02-12 2003-02-12
US60/446,939 2003-02-12
US49873903P 2003-08-28 2003-08-28
US60/498,739 2003-08-28

Publications (2)

Publication Number Publication Date
WO2004072264A2 true WO2004072264A2 (fr) 2004-08-26
WO2004072264A3 WO2004072264A3 (fr) 2005-05-19

Family

ID=32872012

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/004085 WO2004072264A2 (fr) 2003-02-12 2004-02-12 Determination de la destinee par hes1 dans des cellules souches et progenitrices hematopoietiques et utilisation

Country Status (1)

Country Link
WO (1) WO2004072264A2 (fr)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009544290A (ja) * 2006-07-24 2009-12-17 ザ・ユニバーシティ・オブ・クイーンズランド 細胞集団を産生する方法
RU2434636C2 (ru) * 2004-11-17 2011-11-27 Ньюралстем, Инк. Трансплантация нервных клеток для лечения нейродегенеративных состояний
WO2015059674A1 (fr) * 2013-10-24 2015-04-30 Ospedale San Raffaele S.R.L. Méthode
US11608486B2 (en) 2015-07-02 2023-03-21 Terumo Bct, Inc. Cell growth with mechanical stimuli
US11613727B2 (en) 2010-10-08 2023-03-28 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11624046B2 (en) 2017-03-31 2023-04-11 Terumo Bct, Inc. Cell expansion
US11629332B2 (en) 2017-03-31 2023-04-18 Terumo Bct, Inc. Cell expansion
US11634677B2 (en) 2016-06-07 2023-04-25 Terumo Bct, Inc. Coating a bioreactor in a cell expansion system
US11667881B2 (en) 2014-09-26 2023-06-06 Terumo Bct, Inc. Scheduled feed
US11667876B2 (en) 2013-11-16 2023-06-06 Terumo Bct, Inc. Expanding cells in a bioreactor
US11685883B2 (en) 2016-06-07 2023-06-27 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US11795432B2 (en) 2014-03-25 2023-10-24 Terumo Bct, Inc. Passive replacement of media
US11965175B2 (en) 2016-05-25 2024-04-23 Terumo Bct, Inc. Cell expansion

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6159461A (en) * 1992-04-23 2000-12-12 Sloan-Kettering Institute For Cancer Research Use of c-kit ligand with TNF-α and hematopoietic factors for the expansion or differentiation of hematopoietic cells
US20020192665A1 (en) * 1999-06-01 2002-12-19 Zoghbi Huda Y. Compositions and methods for the therapeutic use of an atonal-associated sequence for a gastrointestinal condition

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3962459B2 (ja) * 1997-10-28 2007-08-22 麒麟麦酒株式会社 造血幹細胞の分化・増殖調節方法

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6159461A (en) * 1992-04-23 2000-12-12 Sloan-Kettering Institute For Cancer Research Use of c-kit ligand with TNF-α and hematopoietic factors for the expansion or differentiation of hematopoietic cells
US20020192665A1 (en) * 1999-06-01 2002-12-19 Zoghbi Huda Y. Compositions and methods for the therapeutic use of an atonal-associated sequence for a gastrointestinal condition

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2434636C2 (ru) * 2004-11-17 2011-11-27 Ньюралстем, Инк. Трансплантация нервных клеток для лечения нейродегенеративных состояний
JP2009544290A (ja) * 2006-07-24 2009-12-17 ザ・ユニバーシティ・オブ・クイーンズランド 細胞集団を産生する方法
US11773363B2 (en) 2010-10-08 2023-10-03 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11613727B2 (en) 2010-10-08 2023-03-28 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11746319B2 (en) 2010-10-08 2023-09-05 Terumo Bct, Inc. Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
WO2015059674A1 (fr) * 2013-10-24 2015-04-30 Ospedale San Raffaele S.R.L. Méthode
AU2014338555B2 (en) * 2013-10-24 2019-10-10 Fondazione Telethon Method
EP3613859A1 (fr) * 2013-10-24 2020-02-26 Ospedale San Raffaele S.r.l. Procédé
US10617721B2 (en) 2013-10-24 2020-04-14 Ospedale San Raffaele S.R.L. Methods for genetic modification of stem cells
US11708554B2 (en) 2013-11-16 2023-07-25 Terumo Bct, Inc. Expanding cells in a bioreactor
US11667876B2 (en) 2013-11-16 2023-06-06 Terumo Bct, Inc. Expanding cells in a bioreactor
US11795432B2 (en) 2014-03-25 2023-10-24 Terumo Bct, Inc. Passive replacement of media
US11667881B2 (en) 2014-09-26 2023-06-06 Terumo Bct, Inc. Scheduled feed
US11608486B2 (en) 2015-07-02 2023-03-21 Terumo Bct, Inc. Cell growth with mechanical stimuli
US11965175B2 (en) 2016-05-25 2024-04-23 Terumo Bct, Inc. Cell expansion
US11634677B2 (en) 2016-06-07 2023-04-25 Terumo Bct, Inc. Coating a bioreactor in a cell expansion system
US11685883B2 (en) 2016-06-07 2023-06-27 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US11999929B2 (en) 2016-06-07 2024-06-04 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US11702634B2 (en) 2017-03-31 2023-07-18 Terumo Bct, Inc. Expanding cells in a bioreactor
US11629332B2 (en) 2017-03-31 2023-04-18 Terumo Bct, Inc. Cell expansion
US11624046B2 (en) 2017-03-31 2023-04-11 Terumo Bct, Inc. Cell expansion

Also Published As

Publication number Publication date
WO2004072264A3 (fr) 2005-05-19

Similar Documents

Publication Publication Date Title
JP6920644B2 (ja) 幹細胞の免疫制御作用を調節する方法
RU2691062C2 (ru) Перепрограммирование эндотелия человека в гемопоэтических предшественников множественных линий дифференцировки с использованием определенных факторов
DE69729455T2 (de) Methode und zusammensetzungen zum erlangen reifer dendritischer zellen
JP6086904B2 (ja) γδＴ細胞を含むリンパ球の細胞株、その組成物、及びその製造方法
KR102651433B1 (ko) 혈관 콜로니 형성 세포
JP2015524437A (ja) 間葉系幹細胞による肺動脈性高血圧症の処置
WO2008085221A2 (fr) Utilisation thérapeutique de cellules exprimant cd31
WO2012133948A1 (fr) Composition pour thérapie cellulaire par allogreffe, ladite composition contenant une cellule souche pluripotente positive pour ssea-3 pouvant être isolée de tissu corporel
JP6449148B2 (ja) 免疫抑制細胞作成方法、及び、免疫抑制細胞を含む組成物の使用方法
WO2004072264A2 (fr) Determination de la destinee par hes1 dans des cellules souches et progenitrices hematopoietiques et utilisation
JP2002502617A (ja) 幹細胞および前駆細胞の増殖と分化を制御する方法
WO2003039232A2 (fr) Facteur de croissance hematopoietique derive de cellules endotheliales
JP4695087B2 (ja) 霊長類動物胚性幹細胞から樹状細胞の製造方法
EP0752867A1 (fr) Proliferation cellulaire selective
JPH06508528A (ja) インビトロ由来ヒト好中球前駆体細胞
US20030100107A1 (en) Compositions and methods for generating differentiated human cells
JP2023525391A (ja) Ｎｋ細胞の活性化及び増幅のために遺伝的に操作された細胞株、及びその用途
JP6687246B2 (ja) 改変型免疫細胞、改変型免疫細胞の製造方法、およびこれらの利用
JP2006166918A (ja) 造血幹細胞及び該細胞による眼の血管新生性疾患の治療方法
US20180066253A1 (en) Methods and compositions for modifying endothelial cells
WO2006031467A9 (fr) Cellules souches hematopoietiques de lignees negatives isolees et methodes de traitement associees
JP5089389B2 (ja) 移植における免疫応答の予防および治療のための肝臓間質細胞
KR20060035640A (ko) 림프구 조혈 세포를 포유 동물에게 이식하기 위한 방법
Simon Optimization of engineered T cells for the use in melanoma immunotherapy
Di Ianni et al. Interleukin 7-engineered stromal cells: A new approach for hastening naive T cell recruitment

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
122 Ep: pct application non-entry in european phase