WO2004043978A2 - Composes oligomeres substitues par methoxy en position 2' et compositions a utiliser dans des modulations geniques - Google Patents

Composes oligomeres substitues par methoxy en position 2' et compositions a utiliser dans des modulations geniques Download PDF

Info

Publication number
WO2004043978A2
WO2004043978A2 PCT/US2003/034906 US0334906W WO2004043978A2 WO 2004043978 A2 WO2004043978 A2 WO 2004043978A2 US 0334906 W US0334906 W US 0334906W WO 2004043978 A2 WO2004043978 A2 WO 2004043978A2
Authority
WO
WIPO (PCT)
Prior art keywords
composition
nucleosides
oligomer
type
och
Prior art date
Application number
PCT/US2003/034906
Other languages
English (en)
Other versions
WO2004043978A3 (fr
Inventor
Brenda F. Baker
Ann B. Eldrup
Muthiah Manoharan
Balkrishen Bhat
Richard Griffey
Eric E. Swayze
Stanley T. Crooke
Original Assignee
Isis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Priority to AU2003291682A priority Critical patent/AU2003291682A1/en
Publication of WO2004043978A2 publication Critical patent/WO2004043978A2/fr
Publication of WO2004043978A3 publication Critical patent/WO2004043978A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed

Definitions

  • the present invention provides modified oligomers that modulate gene expression via a RNA interference pathway.
  • the oligomers of the invention include one or more modifications thereon resulting in differences in various physical properties and attributes compared to wild type nucleic acids.
  • the modified oligomers are used alone or in compositions to modulate the targeted nucleic acids.
  • the modifications include a 2' substituent group on at least one sugar moiety of the oliogmer.
  • dsRNA double-stranded RNA
  • Cosuppression has since been found to occur in many species of plants, fungi, and has been particularly well characterized in Neurospora crassa, where it is known as "quelling” (Cogoni and Macino, Genes Dev. 2000, 10, 638- 643; Guru, Nature, 2000, 404, 804-808).
  • Timmons and Fire led Timmons and Fire to explore the limits of the dsRNA effects by feeding nematodes bacteria that had been engineered to express dsRNA homologous to the C. elegans unc-22 gene.
  • these worms developed an unc-22 null-like phenotype (Timmons and Fire, Nature 1998, 395, 854; Timmons et al, Gene, 2001, 263, 103-112).
  • Further work showed that soaking worms in dsRNA was also able to induce silencing (Tabara et al., Science, 1998, 282, 430-431).
  • PCT publication WO 01/48183 discloses methods of inhibiting expression of a target gene in a nematode worm involving feeding to the worm a food organism which is capable of producing a double-stranded RNA structure having a nucleotide sequence substantially identical to a portion of the target gene following ingestion of the food organism by the nematode, or by introducing a DNA capable of producing the double-stranded RNA structure (Bogaert et al., 2001).
  • RNA interference RNA interference
  • dsRNA double-stranded RNA
  • Montgomery et al. suggests that the primary interference affects of dsRNA are post-transcriptional. This conclusion being derived from examination of the primary DNA sequence after dsRNA-mediated interference and a finding of no evidence of alterations, followed by studies involving alteration of an upstream operon having no effect on the activity of its downstream gene. These results argue against an effect on initiation or elongation of transcription.
  • dsRNA-mediated interference produced a substantial, although not complete, reduction in accumulation of nascent transcripts in the nucleus, while cytoplasmic accumulation of transcripts was virtually eliminated.
  • endogenous mRNA is the primary target for interference and suggest a mechanism that degrades the targeted mRNA before translation can occur. It was also found that this mechanism is not dependent on the SMG system, an mRNA surveillance system in C. elegans responsible for targeting and destroying aberrant messages.
  • the authors further suggest a model of how dsRNA might function as a catalytic mechanism to target homologous mRNAs for degradation. (Montgomery et al, Proc. Natl. Acad. Sci.
  • RNAi short interfering RNAs
  • siRNAs short interfering RNAs
  • the Drosophila embryo extract system has been exploited, using green fluorescent protein and luciferase tagged siRNAs, to demonstrate that siRNAs can serve as primers to transform the target mRNA into dsRNA.
  • the nascent dsRNA is degraded to eliminate the incorporated target mRNA while generating new siRNAs in a cycle of dsRNA synthesis and degradation.
  • Evidence is also presented that mRNA-dependent siRNA incorporation to form dsRNA is carried out by an RNA-dependent RNA polymerase activity (RdRP) (Lipardi et al, Cell, 2001, 107, 297-307).
  • RdRP RNA-dependent RNA polymerase activity
  • RNA interference RNA interference
  • Sijen et al revealed a substantial fraction of siRNAs that cannot derive directly from input dsRNA. Instead, a population of siRNAs (termed secondary siRNAs) appeared to derive from the action of the previously reported cellular RNA-directed RNA polymerase (RdRP) on mRNAs that are being targeted by the RNAi mechanism.
  • RdRP RNA-directed RNA polymerase
  • the distribution of secondary siRNAs exhibited a distinct polarity (5'-3'; on the antisense strand), suggesting a cyclic amplification process in which RdRP is primed by existing siRNAs.
  • This amplification mechanism substantially augmented the potency of RNAi-based surveillance, while ensuring that the RNAi machinery will focus on expressed mRNAs (Sijen et al., Cell, 2001, 107, 465-476).
  • RNA oligomers of antisense polarity can be potent inducers of gene silencing.
  • antisense RNAs act independently of the RNAi genes rde-1 and rde-4 but require the mutator/RNAi gene mut-7 and a putative DEAD box RNA helicase, mut- 14.
  • RNA-DNA heteroduplexes did not serve as triggers for RNAi.
  • dsRNA containing 2'-F-2'-deoxynucleosides appeared to be efficient in triggering RNAi response independent of the position (sense or antisense) of the 2'-F-2'- deoxynucleosides.
  • PCT applications have recently been published that relate to the RNAi phenomenon. These include: PCT publication WO 00/44895; PCT publication WO 00/49035; PCT publication WO 00/63364; PCT publication WO 01/36641; PCT publication WO 01/36646; PCT publication WO 99/32619; PCT publication WO 00/44914; PCT publication WO 01/29058; and PCT publication WO 01/75164.
  • the RNA interference pathway for modulation of gene expression is an effective means for modulating the levels of specific gene products and, thus, would be useful in a number of therapeutic, diagnostic, and research applications involving gene silencing.
  • the present invention therefore provides oligomeric compounds useful for modulating gene expression pathways, including those relying on mechanisms of action such as RNA interference and dsRNA enzymes, as well as antisense and non-antisense mechanisms.
  • RNA interference and dsRNA enzymes as well as antisense and non-antisense mechanisms.
  • the invention relates to compositions comprising a first oligomer and a second oligomer, each having linked nucleosidic bases. At least a portion of the first oligomer is capable of hybridizing with at least a portion of the second oligomer, at least a portion of the first oligomer is complementary to and capable of hybridizing to a selected target nucleic acid, and at least one of the first and second oligomers includes at least one sugar moiety having a 2'-OCH substituent group.
  • the first and second oligomers are a complementary pair of siRNA oligomers. In certain embodiments, the first and second oligomers are an antisense/sense pair of oligomers. In some compositons, each of the first and second oligomers has about 0 to about 40 linked nucleosides. In other compositons, each of the first and second oligomers has about 18 to about 30 linked nucleosides. In yet other compositons, each of the first and second oligomers has about 21 to about 24 linked nucleosides.
  • the first oligomer is an antisense oligomer.
  • the second oligomer comprises a sense oligomer.
  • the second oligomer has a plurality of ribose nucleoside units.
  • the first oligomer includes said 2'-OCH 3 substituent group.
  • the first oligomer comprises a 3 ' terminus and a 5' terminus, said 5' terminus comprising a hydroxy terminal group.
  • the 2'-OCH 3 substitutent group extend from the 3' terminus of the first oligomer through the fourth, third, or penultimate nucleoside from the 5' terminus.
  • the first oligomer comprises a 3' terminus and a 5' terminus, wherein the nucleoside at the 5' terminus comprises a 2'-OCH 3 substitutent group.
  • the 5' terminus comprises a 3 '-phosphate terminal group.
  • the first oligomer is a chimeric oligomeric compound.
  • Certain chimeric compositons are a gapmer, an inverted gapmer, a 3'- hemimer, a 5'-hemimer or a blockmer.
  • the chimeric oligomeric compound comprises two tem inal RNA segments having nucleosides of a first type and an internal RNA segment having nucleosides of a second type and where said nucleosides of said first type are different from said nucleosides of said second type.
  • the nucleosides of said first type includes a 2'-OCH 3 substitutent group.
  • the invention is directed to oligonucleomer/protein compositions comprising an oligomer complementary to and capable of hybridizing to a selected target nucleic acid, and at least one protein comprising at least a portion of a RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the oligomer includes at least one nucleoside having a 2'-OCH 3 substituent group on the sugar moiety.
  • compositions comprising any of the above compositions or oligomeric compounds and a pharmaceutically acceptable carrier.
  • Methods for modulating the expression of a target nucleic acid in a cell comprise contacting the cell with any of the above compositions or oligomeric compounds.
  • Methods of treating or preventing a disease or condition associated with a target nucleic acid comprise administering to a patient having or predisposed to the disease or condition a therapeutically effective amount of any of the above compositions or oligomeric compounds.
  • oligomeric compounds of the invention modulate gene expression by hybridizing to a nucleic acid target resulting in loss of normal function of the target nucleic acid.
  • target nucleic acid or “nucleic acid target” is used for convenience to encompass any nucleic acid capable of being targeted including without limitation DNA, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA.
  • modulation of gene expression is effected via modulation of a RNA associated with the particular gene RNA.
  • the invention provides for modulation of a target nucleic acid that is a messenger RNA.
  • the messenger RNA is degraded by the RNA interference mechanism as well as other mechanisms in which double stranded RNA/RNA structures are recognized and degraded, cleaved or otherwise rendered inoperable.
  • RNA to be interfered with can include replication and transcription.
  • Replication and transcription for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
  • the functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
  • modulation and modulation of expression mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • the compounds of the invention include oligomeric compounds that comprise at least one monomeric unit that has a 2'-OCH 3 substituent group on the sugar moiety.
  • 2'-Sugar substituents are described in more detail in U.S. Patent Application Nos. 5,670,633, 5,914,396, 6,005,087, 6,222,025, 6,307,040, 6,531,584 and in U.S. Patent Application No. 10/444,628. The disclosure of each of these patents and applications is incorporated herein by reference in its entirety.
  • one or more sugars may conatain a 2'- subsititutent other than 2'-OCH 3 .
  • these substituent group may be halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; wherein said alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted to C 10 alkyl, C 2 to Cio alkenyl, C 2 to Cio alkynyl, C 5 -C 20 aryl or C 6
  • the 2' substituent may be a halogen.
  • the halogen is F.
  • Certain oligonucleosides that are N3'- >P5' phosphoramidates having 2' fluoro substituents have been shown to have superior acid stability. These compositions can be made by procedures taught is U.S. Patent No. 5,684,143, the disclosure of which is incorporated herein in its entirety.
  • substituents are 2'-O-alkyl substituents. These alkyl groups include lower alkyl groups having from about 1 to about 6 carbon atoms. In some preferred embodiments, the alkyl is a C 2 -C 6 group. Other 2' substituent groups include 2'-methoxyethoxy (MOE, 2'-OCH 2 CH 2 OCH 3 ) and 2'- O-[2-(2-N,N-dimethylaminoethyl)oxyethyl]. These substituents are described in U.S. Patent Nos. 6,043,352 and 6,005,094, the disclosures of which are incorporated herein by reference in their entirety.
  • the 2' substituent is -O-R 26 -thio-R 26 or -C- R -thio-R , wherein said R is independently a compound selected from a group consisting of alkyl, allyl, alkenyl, alkynyl, aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester.
  • R is alkyl, allyl, alkenyl, alkynyl, aryl, alkylaryl, carbocyclic aryl, or heterocyclic aryl.
  • the 2' substituent is 2'-O-methylthiomethyl.
  • the 2' substituent is 2'-O-methylthioethyl. These substituents are described in U.S. Patent Nos. 5,716,824, 5,840,876 and 6,239,272, the disclosures of which are incorporated by reference herein in their entirety. [0041] In certain embodiments, the 2' substituent is cyano, fluoromethyl, thioalkoxyl, fluoroalkoxyl, alkylsulfinyl, alkylsulfonyl, allyloxy or alkeneoxy. In other embodiments, the 2'-substituent is 2'-alkylsulfmyl or alkylsulfonyl.
  • the 2'-substituent is 2'-thioalkoxyl, preferably, a 2'-S-(C ⁇ - C 20 alkyl) substituent.
  • Some 2' substituents useful in the invention are of the formula -X- Y.
  • X is O, S, NR 27 , or CR 27 2 wherein each R is independently H or C ⁇ _ 6 alkyl.
  • Y is a linker moiety, a drug residue optionally attached through a linker moiety, a label optionally attached through a linker moiety, or a property-affecting group optionally attached through a linker moiety.
  • Y is a drug moiety.
  • the drug moiety is selected from the group consisting of netropsin, anthramycin, quinoxaline antibiotics, actinomycin, and pyrrolo (1-4) benzodiazepine.
  • Y is substituted or unsubstituted alkyl (C 2 . 20 ), substituted or unsubstituted alkenyl (C 2 . 2 o), substituted or unsubstituted aryl (C 6 . 20 ), wherein the substituents are selected from the group consisting of a hydroxyl, an amino, a mercaptyl, a carboxy or a keto moiety, ⁇ CH 2 COOH, -CH 2 COONH 2 , ⁇ CH 2 COOEt, -CH 2 CONHCH 2 CH 2 NH 2 and SiR 28 3 wherein R is alkyl (C 2 . 6 ).
  • X is O or S.
  • Certain 2' substituents are of the formula: -G1-G2-G3 where Gl is a bivalent linker, G2 is an aryl or heteroaryl or aryl or heteroaryl containing group and G3 is an RNA cleaving moiety having, for example, general acid/base properties, hi certain further preferred embodiments of the inventions, G3 further includes an electrophilic catalyst.
  • the bivalent liker may be a mono- or polyatomic linker.
  • the bivalent linker is of the formula -G ⁇ -G 12 .
  • G 11 contains a heteroatom and G contains an alkyl, alkenyl or alkynyl group. Preferred heteroatoms include O, S, and N--H or N-alkyl.
  • the linker may be methylene groups-i.e., ⁇ (CH 2 ) n ⁇ or may include heteroatoms and functional groups, e.g., -CH 2 OCH 2 CH 2 O- or -CH 2 O ⁇ CH 2 CH 2 NH- or ⁇ COOCH 2 CH 2 O ⁇ .
  • Gl connects to the internucleoside linkage, i.e. the sugar linking group.
  • G2 preferably is a polycyclic moiety having from 2 to 6 rings, at least 2 of said rings being joined to form an electronically conjugated system.
  • Representative G2 groups include naphthalene, anthracene, phenanthrene, benzonaphthalene, fluorene, carbazole, pyrido[4,3-b]carbazole, acridine, pyrene, anthraquinone, quinoline, phenylquinoline, xanthene or 2,7-diazaanthracene groups. Structures of this type preferably act as intercalators. Other intercalators believed to be useful are described by Denny, Anti-Cancer Drug Design 1989, 4, 241.
  • RNA-cleaving group G3 can be a functionality that has both general acid and general base characteristics. It also can possess electrophilic catalytic characteristics. It can further possess metal ion coordinating characteristics. Such substituents are described in U.S. Patent No. 6,358,931, whose disclosure is incorporated by reference herein in its entirety.
  • the 2' substituent may be of the formula -O-G1-G2-G3 where Gl is alkyl, alkenyl, or alkynyl; G2 is an aryl; and G3 includes at least one imidazole. In some preferred embodiments, G3 is an imidazole or a bis-imidazole moiety. In other embodiments, G1-G2-G3 is an alkynyl moiety.
  • R 29 and R 30 are H, R 33 , R 34 , an amine protecting group or have formula R 33 -N(R 31 )(R 32 ), C(X)— R 33 , C(X)— R 34 -R 33 , C(X)-Q— R 34 -R 33 , or C(X)-Q— R 33 ;
  • R 31 and R 32 are H, R 33 , R 34 , an amine protecting group or.have formula C(X)— R 33 , C(X)— -R 34 -R 33 , C(X)-Q— R 34 — R 33 , or C(X)-Q— R 33 ;
  • R 33 is a steroid molecule, biotin, dinitrophenyl, a fluorescein dye, a lipophilic molecule, a reporter enzyme, a peptide, a protein, includes folic acid, or has formula ⁇ Q-(CH 2 CH 2 ⁇ Q ⁇ ) X -R 35 ;
  • R 34 is alkyl having from 1 to about 10 carbon atoms;
  • X is O or S; each Q is, independently, is NH, O, or S;
  • R 35 is H, R 34 , C(O)OH, C(O)OR 34 , C(O)R 41 , R 34 -N 3 , or R 3 ⁇ NH 2
  • R 41 is CI, Br, I, SO 2 R 42 or has structure:
  • n 2 or 7;
  • R 42 alkyl having 1 to about 10 carbon atoms.
  • R 34 is alkyl having 1 to about 10 carbon atoms, preferably having 6 carbon atoms.
  • R 29 is H and R 30 is R .
  • Some compounds are such that R is H and R is alkyl having 1 to about 10 carbon atoms, preferably 1 or 2 carbon atoms.
  • R 29 and R together, are phthalimido.
  • R is H and R is R - -N(R 31 )(R 32 ).
  • the sugar substituent may be a 2'-aminoalkoxy or a 2'- imidazolylalkoxy substituent, wherein the alkoxy moiety of said substituent is d - C 0 .
  • the substituent is 2'-O-(aminoprop-3-yl) or 2'-O- (aminobut-4-yl).
  • the substituent is 2'-O->(imidazol-l-yl) prop-3-yl or 2'-O->(imidazol-l-yl) but-4-yl. See, for example, U.S. Patent No. 5,872,232, which is incorporated herein by reference in its entirety.
  • N C(R 37 )(R 38 ); and each of R , R and R is, independently, H, Ci -Cio alkyl, and an amino protecting group, or R 37 and R 38 together, are an amino protecting group or wherein R 37 and R 38 are joined in a C 4 -Cio ring structure that can include at least one heteroatom selected from N and O.
  • R 37 and R 38 are independently H or Ci -Cio alkyl.
  • R 37 and R 38 are joined in a C 4 -Cio ring structure that optionally includes one or more heteroatoms selected from N and O.
  • Some compounds of the invention comprise a ring structure that is an imidazolyl ring, a piperidinyl ring, a morpholinyl ring or a substituted piperazinyl ring.
  • Certain piperazine may be optionally substituted with a d -C 12 alkyl.
  • the 2' substituent is of the formula: R 39 — N C(X) O R 40
  • R 39 is alkyl having from 1 to about 10 carbon atoms or (CH ⁇ CH 2 ⁇ Q) X ;
  • R 40 is alkenyl having 2 to about 10 carbon atoms;
  • R and R independently, are H, R , R , an amine protecting group or have formula R 39 -N(R 31 )(R 32 ), C(X)— 33 , C(X)— R 39 — R 33 , C(X)-Q— R 39 -R 33 , or C(X)-Q— R 33 ;
  • R and R independently, are H, R , R , an amine protecting group or have formula C(X)— R 33 , C(X)— R 39 -R 33 , C(X) ⁇ Q— R 39 — R 33 , or C(X)-Q— R 33 ;
  • R is a steroid molecule, a reporter molecule, a lipophilic molecule, a reporter enzyme, a peptide, a protein, includes folic acid, or has formula ⁇ Q ⁇ (CH 2 CH 2 —
  • X is O or S; each Q is, independently, is NH, O, or S; x is 1 to about 200;
  • R 35 is H, R 39 , C(O)OH, C(O)OR 39 , C(O)R 41 , R 39 ⁇ N 3 , or R 39 -NH 2 ;
  • R 41 is CI, Br, I, SO 2 R 42 or has structure: m is 2 or 7; and R 42 is an alkyl having 1 to about 10 carbon atoms. In some embodiments, R is alkyl having 6 carbon atoms. In certain embodiments, R 40 is 2-propenyl. In other embodiments, R 29 is H and R 30 is H. In yet other embodiments, R is H and R is R . In some compositions, R is H and R 30 is alkyl having 1 to about 10 carbon atoms. In certain embodiments, R 29 and R , together, are phthalimido. hi other embodiments, R is H and R is R - -N(R 31 )(R 32 ).
  • R 31 is H and R 32 is R 33 .
  • R 31 is H and R 32 is alkyl having 1 to about 10 carbon atoms.
  • R 30 is H and R 32 is an alkyl having 1 or 2 carbon atoms.
  • R and R together, are phthalimido.
  • each Ei and E 2 is, independently, H, Ci-do alkyl, C 2 -Cio alkenyl, C 2 -
  • nn is an integer from 2 to 4 and nnn is an integer from 2 to 10
  • a polypeptide having from 2 to 10 peptide linked amino acids a folic acid moiety optionally bearing a linking group attaching said folic acid moiety from the ⁇ or ⁇ carboxyl group to the 2'-substituent wherein said linking group is ⁇ N(H) ⁇ (CH 2 ) 6 —
  • R 43 is H
  • Ci -Cio alkyl C -Cio alkenyl, C 2 -Cio alkynyl, C 6 -C ⁇ 4 aryl or a thio protecting group.
  • each Ei and E 2 is independently Ci -Cio alkyl.
  • each Ei and E is, independently, Ci -Cio alkyl, or one of Ei and E 2 is H and the other of Ei and E 2 is ⁇ CH 3 ; or each Ei and E 2 is, independently, H, ⁇ (CH ) m — S — R 43 where m is from 1 to 10, - ⁇ (CH 2 ) nn ⁇ N(H) ⁇ nnn ⁇ (CH 2 ) nn NH 2 where each nn is from 2 to 4 and nnn is from 2 to 10, a polypeptide having from 2 to 10 peptide linked amino acids, a folic acid moiety optionally bearing a linking group attaching said folic acid moiety from the ⁇ or ⁇ carboxyl group to the 2'-substituent wherein said linking group is - -N(H) ⁇ (CH 2 ) 6 — , or a cholesterol moiety optionally bearing a linking group attaching said cholesterol moiety from the hydroxyl group to the
  • Ei is H and E 2 is — (CH 2 ) m — S — R 43 .
  • R 43 is Ci -Cio alkyl. Further embodiments are those where R 43 is methyl.
  • E 2 is ⁇ (CH 2 ) nn ⁇ N(H) ⁇ nnn (CH 2 ) nn NH 2 where each nn is from 2 to 4 and nnn is from 2 to 10.
  • E 2 is -(CH 2 ) 3 -N(H)-(CH 2 ) 4 -N(H)-(CH 2 ) 3 -NH 2 or ⁇ (CH 2 ) 4 -N(H)-(CH 2 ) 3 -NH 2 .
  • E 2 is said polypeptide.
  • the polypeptide is Lys-Tyr-Lys, Lys-Trp-Lys or Lys-Lys-Lys-Lys.
  • E 2 is a linked folic acid or 5-methyl-tefrahydrofolic acid moiety.
  • E 2 is a cholesterol moiety.
  • substituent groups of the invention are of the formula: X (CR 71 R 72 ) n — O S0 2 O " Y + where X is a O, S, or N; R 71 and R 72 are independently H, alkyl, aryl, O-alkyl, O- aryl, carboxylic acid, amide, ester, halogen, trifluoromethyl, or amine; n is an integer from about 2 to about 10; and, Y is H, Li, Na, K, Cs or an amine.
  • X is a O, S, or N
  • R 71 and R 72 are independently H, alkyl, aryl, O-alkyl, O- aryl, carboxylic acid, amide, ester, halogen, trifluoromethyl, or amine
  • n is an integer from about 2 to about 10
  • Y is H, Li, Na, K, Cs or an amine.
  • each Z is, independently, a single bond, O, N or S; each R 46 , R 47 , R 48 , and R 49 is, independently, hydrogen, C(O)R 50 , substituted or unsubstituted Ci -Cio alkyl, substituted or unsubstituted C 2 -Cio alkenyl, substituted or unsubstituted C -Cio alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; or R 46 and R 47 , together, are R 51 ; each R 50 is, independently, substituted or unsubstituted Ci -Cio alkyl, substituted or
  • the 2' modification is of the formula - OR 52 where R 52 is
  • R ,54 i ⁇ s hydrogen, Ci -Cio alkyl, ⁇ CH 2 ⁇ O — R 55 or a radical of formula lb;
  • R is hydrogen, Ci -C 22 alkyl, C 3 -C 2 ⁇ alkenyl, or partially or completely fluorine- substituted Ci -Cio alkyl or ⁇ [(CH 2 ) 2 -O] m -R 56 ;
  • R 56 is hydrogen or Ci -C ⁇ alkyl;
  • Z is -(CH 2 ) p -- or -(CH 2 ⁇ CH 2 ⁇ O) q -CH 2 CH 2 -, it being possible for Z in the case of ⁇ CH 2 ⁇ to be unsubstituted or substituted by one or more identical or different substituents selected from Ci -Cio alkyl, C 5 -C 6 cycloalkyl and unsubstituted or Ci -C 4 alkyl-substituted phenyl; n is an integer from 1 to 12; m is an integer from 1 to 4; p is an integer from 1 to 10; and q is an integer from 1 to 4.
  • Li, L 2 and L 3 form a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 hetero atoms wherein said hetero atoms are oxygen, nitrogen or sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic or heterocyclic;
  • R is OX, SX, N(H)X or NX 2 ;
  • Y is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(H)X, NX 2 , OX, halo, SX or CN; n is 0, 1 or 2; and
  • Z is H or Ci -C 8 alkyl.
  • the ring system is phenyl, pyridyl, cyclopentyl, cyclobutyl, cyclohexyl, cycloheptyl, morpholino, piperidyl or piperazinyl with the proviso that the elected ring system is mono-, di-, or tri- substituted.
  • Li and L 2 are each carbon atoms.
  • Li and L 2 are carbon atoms and the other of Li and L 2 is a heteroatom selected from O, S and N.
  • These ligands may be made by methods taught by U.S. Patent No. 6,271,358, whose disclosure is incorporated herein by reference in its entirety.
  • the 2' position of the sugar ring can have two substituents, Yl and Y2; provided that both Yl and Y2 are not H and that when one of Yl and Y2 is H and the other of Yl and Y2 is OH, the sugar ring is other than a ribose sugar.
  • Yl and Y2 are each independently hydrogen; hydroxyl; halogen; C2-4 alkenyl, C2-4 alkynyl, or Cl_4 alkyl optionally substituted with amino, hydroxy, or 1 to 3 fluorine atoms; Ci-io alkoxy, optionally substituted with Ci-3 alkoxy, Ci_3 thioalkoxy or 1 to 3 fluorine atoms; C2-6 alkenyloxy; Ci-4 alkylthio; C ⁇ _8 alkylcarbonyloxy; aryloxycarbonyl; azido; amino; C1- alkylamino; di(Cl-4 alkyl)amino; or ⁇ 3.
  • ⁇ 3 is a conjugate molecule or a reporter molecule.
  • substituents are described in more detail in commonly owned U.S. Patent Application No. 10/444,628, the disclosure of which is incorporated by reference in its entirety.
  • Yl is C2-4 alkenyl, C2-4 alkynyl, or C ⁇ _4 alkyl, wherein the alkyl is unsubstituted or substituted with hydroxy, amino, C ⁇ _4 alkoxy, Ci-4 alkylthio, or one to three fluorine atoms and Y2 is hydrogen, fluorine, hydroxy, Ci-io alkoxy, or Ci-io alkyl.
  • Yl is alkyl unsubstituted or substituted with hydroxy, amino, C1-.4 alkoxy, C1-.4 alkylthio, or one to three fluorine atoms, particularly where Yl is methyl or trifluoromethyl.
  • Y2 is hydrogen or hydroxyl.
  • hybridization means the pairing of complementary strands of oligomeric compounds.
  • the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
  • nucleobases complementary nucleoside or nucleotide bases
  • adenine and thymine are complementary nucleobases that pair through the foimation of hydrogen bonds.
  • Hybridization can occur under varying circumstances.
  • An oligomeric compound of the invention is believed to specifically hybridize to the target nucleic acid and interfere with its normal function to cause a loss of activity. There is preferably a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • stringent hybridization conditions or “stringent conditions” refers to conditions under which an oligomeric compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will vary with different circumstances and in the context of this invention; “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • Complementary refers to the capacity for precise pairing of two nucleobases regardless of where the two are located. For example, if a nucleobase at a certain position of an oligomeric compoxmd is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligomer and the target nucleic acid is considered to be a complementary position.
  • the oligomeric compound and the target nucleic acid are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases that can hydrogen bond with each other.
  • the sequence of the oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • an oligomeric compoxmd may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
  • the oligomeric compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise 90% sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted.
  • an oligomeric compound in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an oligomeric compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • Targeting an oligomeric compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated.
  • This target nucleic acid may be, for example, a mRNA transcribed from a cellular gene whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
  • the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the interaction to occur such that the desired effect, e.g., modulation of expression, will result.
  • region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • segments Within regions of target nucleic acids are segments.
  • Segments are defined as smaller or sub-portions of regions within a target nucleic acid.
  • Sites as used in the present invention, are defined as positions within a target nucleic acid.
  • region, segment, and site can also be used to describe an oligomeric compound of the invention such as for example a gapped oligomeric compound having 3 separate segments.
  • the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”.
  • a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
  • translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding a nucleic acid target, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. Consequently, the "start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense oligomeric compounds of the present invention.
  • a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
  • 5'UTR 5' untranslated region
  • 3'UTR 3' untranslated region
  • the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5'-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
  • introns regions which are excised from a transcript before it is translated.
  • exons regions which are excised from a transcript before it is translated.
  • targeting splice sites i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites.
  • fusion transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using oligomeric compounds targeted to, for example, pre-mRNA.
  • RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequences.
  • pre-mRNA variants Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon.
  • Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
  • Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre- mRNA or rnRNA.
  • One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
  • the types of variants described herein are also preferred target nucleic acids.
  • preferred target segments are locations on the target nucleic acid to which preferred compounds and compositions of the invention hybridize.
  • preferred target segment is defined as at least an 8-nucleobase portion of a target region to which an active antisense oligomeric compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid that are accessible for hybridization.
  • oligomeric compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • a series of nucleic acid duplexes comprising the antisense strand oligomeric compounds of the present invention and their respective complement sense strand compounds can be designed for a specific target or targets.
  • the ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
  • the sense strand of the duplex is designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus.
  • both strands of the duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
  • the combination of an antisense strand and a sense strand each of can be of a specified length, for example from 18 to 29 nucleotides long, is identified as a complementary pair of siRNA oligomers.
  • This complementary pair of siRNA oligomers can include additional nucleotides on either of their 5' or 3' ends. Further they can include other molecules or molecular structures on their 3' or 5' ends such as a phosphate group on the 5' end.
  • a preferred group of compounds of the invention include a phosphate group on the 5' end of the antisense strand compound. Other preferred compounds also include a phosphate group on the 5' end of the sense strand compound. An even further preferred compounds would include additional nucleotides such as a two base overhang on the 3' end.
  • a preferred siRNA complementary pair of oligomers comprise an antisense strand oligomeric compound having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO:l) and having a two-nucleobase overhang of deoxythymidine(dT) and its complement sense strand.
  • These oligomers would have the following structure:
  • a single oligomer having both the antisense portion as a first region in the oligomer and the sense portion as a second region in the oligomer is selected.
  • the first and second regions are linked together by either a nucleotide linker (a string of one or more nucleotides that are linked together in a sequence) or by a non-nucleotide linker region or by a combination of both a nucleotide and non-nucleotide structure.
  • the oligomer when folded back on itself, would be complementary at least between the first region, the antisense portion, and the second region, the sense portion.
  • the oligomer would have a palindrome within it structure wherein the first region, the antisense portion in the 5' to 3' direction, is complementary to the second region, the sense portion in the V to 5' direction.
  • the invention includes oligomer/protein compositions.
  • Such compositions have both an oligomer component and a protein component.
  • the oligomer component comprises at least one oligomer, either the antisense or the sense oligomer but preferably the antisense oligomer (the ohgomer that is antisense to the target nucleic acid).
  • the oligomer component can also comprise both the antisense and the sense strand oligomers.
  • the protein component of the composition comprises at least one protein that forms a portion of the RNA-induced silencing complex, i.e., the RISC complex.
  • RISC is a ribonucleoprotein complex that contains an oligomer component and proteins of the Argonaute family of proteins, among others. While we do not wish to be bound by theory, the Argonaute proteins make up a highly conserved family whose members have been implicated in RNA interference and the regulation of related phenomena. Members of this family have been shown to possess the canonical PAZ and Piwi domains, thought to be a region of protein-protein interaction. Other proteins containing these domains have been shown to effect target cleavage, including the RNAse, Dicer.
  • the Argonaute family of proteins includes, but depending on species, are not necessary limited to, elF2Cl and elF2C2.
  • elF2C2 is also known as human GERp95. While we do not wish to be bound by theory, at least the antisense oligomer strand is bound to the protein component of the RISC complex. Additional, the complex might also include the sense strand oligomer. Carmell et al, Genes and Development 2002, 16, 2733-2742.
  • the RISC complex may interact with one or more of the translation machinery components.
  • Translation machinery components include but are not limited to proteins that effect or aid in the translation of an RNA into protein including the ribosomes or polyribosome complex. Therefore, in a further embodiment of the invention, the oligomer component of the invention is associated with a RISC protein component and further associates with the translation machinery of a cell. Such interaction with the translation machinery of the cell would include interaction with structural and enzymatic proteins of the translation machinery including but not limited to the polyribosome and ribosomal subunits.
  • the oligomer of the invention is associated with cellular factors such as transporters or chaperones.
  • cellular factors can be protein, lipid or carbohydrate based and can have structural or enzymatic functions that may or may not require the complexation of one or more metal ions.
  • the oligomer of the invention itself may have one or more moieties which are bound to the oligomer which facilitate the active or passive transport, localization or compartmentalization of the oligomer.
  • Cellular localization includes, but is not limited to, localization to within the nucleus, the nucleolus or the cytoplasm.
  • Compartmentalization includes, but is not limited to, any directed movement of the oligomers of the invention to a cellular compartment including the nucleus, nucleolus, mitochondrion, or imbedding into a cellular membrane surrounding a compartment or the cell itself.
  • the oligomer of the invention is associated with cellular factors that affect gene expression, more specifically those involved in RNA modifications. These modifications include, but are not limited to posttrascriptional modifications such as methylation. Furthermore, the oligomer of the invention itself may have one or more moieties which are bound to the oligomer which facilitate the posttranscriptional modification.
  • the oligomeric compounds of the invention may be used in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops.
  • the oligomeric compounds of the invention may interact with or elicit the action of one or more enzymes or may interact with one or more structural proteins to effect modification of the target nucleic acid.
  • One non-limiting example of such an interaction is the RISC complex.
  • Use of the RISC complex to effect cleavage of RNA targets thereby greatly enhances the efficiency of oligomer-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
  • oligomeric compoxmd of the invention include a single-stranded antisense oligomer that binds in a RISC complex, a double stranded antisense/sense pair of oligomer or a single strand oligomer that includes both an antisense portion and a sense portion.
  • dsRNA double-stranded RNA
  • the compounds and compositions of the invention are used to modulate the expression of a target nucleic acid.
  • “Modulators” are those oligomeric compounds that decrease or increase the expression of a nucleic acid molecule encoding a target and which comprise at least an 8-nucleobase portion that is complementary to a preferred target segment.
  • the screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding a target with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a target. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g.
  • the modulator may then be employed in further investigative studies of the function of a target, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • oligomeric compound refers to a polymeric structure capable of hybridizing a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and combinations of these. Oligomeric compounds routinely prepared linearly but can be joined or otherwise prepared to be circular and may also include branching. Oligomeric compounds can hybridized to form double stranded compounds that can be blunt ended or may include overhangs. In general an oligomeric compound comprises a backbone of linked momeric subunits where each linked momeric subunit is directly or indirectly attached to a heterocyclic base moiety.
  • linkages joining the monomeric subunits, the sugar moieties or surrogates and the heterocyclic base moieties can be independently modified giving rise to a plurality of motifs for the resulting oligomeric compounds including hemimers, gapmers and chimeras.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base moiety.
  • the two most common classes of such heterocyclic bases are purines and pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • this linear polymeric structure can be joined to form a circular structure by hybridization or by formation of a covalent bond, however, open linear stractures are generally preferred.
  • the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligomer.
  • the normal internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside linkages.
  • oligonucleotide analog refers to oligonucleotides that have one or more non- naturally occurring portions which function in a similar manner to oligonulceotides. Such non-naturally occurring oligonucleotides are often preferred the naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • oligonucleoside refers to nucleosides that are joined by internucleoside linkages that do not have phosphorus atoms. Internucleoside linkages of this type include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic and one or more short chain heterocyclic.
  • internucleoside linkages include but are not limited to siloxane, sulfide, sulfoxide, sulfone, acetal, formacetal, thioformacetal, methylene formacetal, thioformacetal, alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide and others having mixed N, O, S and CH component parts.
  • nucleosides of the oligomeric compounds of the invention can have a variety of other modification so long as these other modifications either alone or in combination with other nucleosides enhance one or more of the desired properties described above.
  • these nucleotides can have sugar portions that correspond to naturally-occurring sugars or modified sugars.
  • Representative modified sugars include carbocyclic or acyclic sugars, sugars having substituent groups at one or more of their 2', 3' or 4' positions and sugars having substituents in place of one or more hydrogen atoms of the sugar. Additional nucleosides amenable to the present invention having altered base moieties and or altered sugar moieties are disclosed in United States Patent 3,687,808 and PCT application PCT/US89/02323.
  • Altered base moieties or altered sugar moieties also include other modifications consistent with the spirit of this invention.
  • Such oligomers are best described as being structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic wild type oligonucleotides. All such oligomers are comprehended by this invention so long as they function effectively to mimic the structure of a desired RNA or DNA strand.
  • a class of representative base modifications include tricyclic cytosine analog, termed "G clamp” (Lin, et al, J. Am. Chem. Soc. 1998, 120, 8531). This analog makes four hydrogen bonds to a complementary guanine (G) within a helix by simultaneously recognizing the Watson-Crick and Hoogsteen faces of the targeted G.
  • the oligomers of the invention also can include phenoxazine-substituted bases of the type disclosed by Flanagan, et al, Nat. Biotechnol 1999, 17(1), 48-52.
  • the oligomeric compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides).
  • nucleobases i.e. from about 8 to about 80 linked nucleosides.
  • the invention embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
  • the oligomeric compounds of the invention are 12 to 50 nucleobases in length.
  • this embodies oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
  • the oligomeric compounds of the invention are 15 to 30 nucleobases in length.
  • One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
  • oligomeric compounds are oligomers from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
  • Oligomerization of modified and unmodified nucleosides is performed according to literature procedures for DNA like compounds (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or RNA like compounds (Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA:Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713) synthesis as appropriate. In addition specific protocols for the synthesis of oligomeric compounds of the invention are illustrated in the examples below.
  • RNA oligomers can be synthesized by methods disclosed herein or purchased from various RNA synthesis companies such as for example Dharmacon Research Inc., (Lafayette, CO).
  • the oligomeric compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.
  • the complementary strands preferably are annealed.
  • the single strands are aliquoted and diluted to a concentration of 50 uM.
  • 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer.
  • the final concentration of the buffer is 100 mM potassium acetate, 30 mM HEPES-KOH • pH 7.4, and 2mM magnesium acetate.
  • the final volume is 75 uL.
  • This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
  • the final concentration of the dsRNA compound is 20 uM. This solution can be stored frozen (-20°C) and freeze-thawed up to 5 times.
  • the desired synthetic duplexes are evaluated for their ability to modulate target expression.
  • they are treated with synthetic duplexes comprising at least one oligomeric compound of the invention.
  • synthetic duplexes comprising at least one oligomeric compound of the invention.
  • For cells grown in 96-well plates, wells are washed once with 200 ⁇ L OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 ⁇ L of OPTI-MEM-1 containing 12 ⁇ g/mL LIPOFECTIN (Gibco BRL) and the desired dsRNA compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • linear compounds are generally preferred.
  • linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound.
  • the phosphate groups are commonly refened to as forming the internucleoside linkage or in conjunction with the sugar ring the backbone of the oligomer.
  • the normal internucleoside linkage that makes up the backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligomers having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom.
  • modified oligomers that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligomer backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more intemucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2'
  • Preferred oligomers having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most intemucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • the MMI type internucleoside linkages are disclosed in the above referenced U.S. patent 5,489,677.
  • Preferred amide internucleoside linkages are disclosed in the above referenced U.S.
  • Preferred modified oligomer backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetal and thioformacetal backbones methylene formacetal and thioformacetal backbones
  • riboacetal backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • oligonucleotide mimetics Another preferred group of oligomeric compounds amenable to the present invention includes oligonucleotide mimetics.
  • mimetic as it is applied to oligonucleotides is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the intemucleotide linkage are replaced with novel groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate.
  • the heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid.
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA oligomeric compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA oligomeric compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
  • PNA peptide nucleic acids
  • the backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone.
  • the heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
  • PNA has been modified to incorporate numerous modifications since the basic PNA structure was first prepared.
  • the basic structure is shown below:
  • Bx is a heterocyclic base moiety
  • T 4 is hydrogen, an amino protecting group, -C(O)R 5 , substituted or unsubstituted Ci-Cio allcyl, substituted or unsubstituted C 2 -C ⁇ o alkenyl, substituted or unsubstituted C 2 -C ⁇ o alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a conjugate group, a D or L ⁇ -amino acid linked via the ⁇ -carboxyl group or optionally through the ⁇ -carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, ary
  • T 5 is -OH, -N(Z ⁇ )Z 2 , R 5 , D or L ⁇ -amino acid linked via the ⁇ -amino group or optionally through the ⁇ -amino group when the amino acid is lysine or ornithine or a peptide derived from D, L or mixed D and L amino acids linked through an amino group, a chemical functional group, a reporter group or a conjugate group;
  • Zi is hydrogen, C ⁇ -C 6 alkyl, or an amino protecting group
  • R 5 is a carbonyl protecting group; and n is from 2 to about 50.
  • Another class of oligonucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring.
  • a number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid.
  • a preferred class of linking groups have been selected to give a non-ionic oligomeric compound.
  • the non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins.
  • Morpholino- based oligomeric compounds are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A.
  • Morpholino-based oligomeric compoxmds are disclosed in United States Patent 5,034,506, issued July 23, 1991.
  • the mo ⁇ holino class of oligomeric compounds have been prepared having a variety of different linking groups joining the monomeric subunits.
  • Morpholino nucleic acids have been prepared having a variety of different linking groups (L 2 ) joining the monomeric subunits.
  • the basic formula is shown below:
  • Ti is hydroxyl or a protected hydroxyl
  • T 5 is hydrogen or a phosphate or phosphate derivative
  • L 2 is a linking group; and n is from 2 to about 50.
  • CeNA cyclohexenyl nucleic acids
  • the furanose ring normally present in an DNA/RNA molecule is replaced with a cyclohenyl ring.
  • CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry.
  • Fully modified CeNA oligomeric compounds and oligomers having specific positions modified with CeNA have been prepared and studied (see Wang et al, J. Am. Chem. Soc, 2000, 122, 8595-8602). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA/RNA hybrid.
  • CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes.
  • the study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation. Furthermore the incorporation of CeNA into a sequence targeting RNA was stable to serum and able to activate E. Coli RNase resulting in cleavage of the target RNA strand.
  • each Bx is a heterocyclic base moiety
  • Ti is hydroxyl or a protected hydroxyl
  • T2 is hydroxyl or a protected hydroxyl.
  • oligomeric compounds amenable to the present invention includes oligonucleotide mimetics.
  • mimetic as it is applied to oligomers is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the intemucleotide linkage are replaced with novel groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate.
  • the heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid.
  • oligonucleotide mimetic anhydrohexitol nucleic acid
  • anhydrohexitol nucleic acid can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett., 1999, 9, 1563-1566) and would have the general formula:
  • a further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety.
  • the linkage is preferably a methylene (-CH 2 -) n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al, Chem. Commun., 1998, 4, 455-456).
  • Tm +3 to +10 C
  • LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimickiiig character of LNA was established at the duplex level.
  • Tm +15/+11) toward DNA complements.
  • Tm +15/+11
  • LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities.
  • Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA duplex.
  • Nuclear magnetic resonance (NMR) examination of an LNA:DNA duplex confirmed the 3'-endo conformation of an LNA monomer. Recognition of double-stranded DNA has also been demonstrated suggesting strand invasion by LNA.
  • Studies of mismatched sequences show that LNAs obey the Watson-Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference strands.
  • Novel types of LNA-oligomeric compounds, as well as the LNAs, are useful in a wide range of diagnostic and therapeutic applications. Among these are antisense applications, PCR applications, strand-displacement oligomers, substrates for nucleic acid polymerases and generally as nucleotide based drugs.
  • LNA/DNA copolymers were not degraded readily in blood serum and cell extracts. LNA/DNA copolymers exhibited potent antisense activity in assay systems as disparate as G-protein-coupled receptor signaling in living rat brain and detection of reporter genes in Escherichia coli. Lipofectin-mediated efficient delivery of LNA into living human breast cancer cells has also been accomplished.
  • LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). LNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • oligonucleotide mimetics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown):
  • oligonucleotide mimetic incorporate a phosphorus group in a backbone the backbone.
  • This class of olignucleotide mimetic is reported to have useful physical and biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.
  • Oligomeric compoxmds may also include nucleobase (often referred to in the art simply as “base” or “heterocyclic base moiety”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases also refereed herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C- CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in J7ze Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.
  • oligomeric compounds are prepared having polycyclic heterocyclic compoxmds in place of one or more heterocyclic base moieties.
  • a number of tricyclic heterocyclic compoxmds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand. The most studied modifications are targeted to guanosines hence they have been termed G-clamps or cytidine analogs. Many of these polycyclic heterocyclic compoxmds have the general formula:
  • the gain in helical stability does not compromise the specificity of the oligomers.
  • the T m data indicate an even greater discrimination between the perfect match and mismatched sequences compared to dC5 me .
  • the tethered amino group serves as an additional hydrogen bond donor to interact with the Hoogsteen face, namely the 06, of a complementary guanine thereby forming 4 hydrogen bonds. This means that the increased affinity of G-clamp is mediated by the combination of extended base stacking and additional specific hydrogen bonding.
  • a further prefened substitution that can be appended to the oligomeric compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds.
  • such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups.
  • Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides,,poly- ethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence- specific hybridization with RNA.
  • Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed October 23, 1992 the entire disclosure of which is inco ⁇ orated herein by reference.
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem.
  • lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060
  • the oligomeric compoxmds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbuta- zone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, ca ⁇ rofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in United States Patent Application 09/334,130 (filed June 15, 1999) which is inco ⁇ orated herein by reference in its entirety.
  • oligomeric compounds which are chimeric oligomeric compoxmds.
  • Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression.
  • RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric oligomeric compounds of the invention may be formed as composite stractures of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and/or oligonucleotide mimetics as described above. Such oligomeric compounds have also been refened to in the art as hybrids hemimers, gapmers or inverted gapmers.
  • Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein inco ⁇ orated by reference in its entirety.
  • oligomeric compounds include nucleosides synthetically modified to induce a 3'-endo sugar conformation.
  • a nucleoside can inco ⁇ orate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3'-endo sugar conformation.
  • These modified nucleosides are used to mimic RNA like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 3'-endo conformational geometry.
  • RNA type duplex A form helix, predominantly 3'-endo
  • RNA interference which is supported in part by the fact that duplexes composed of 2'-deoxy-2'-F- nucleosides appears efficient in triggering RNAi response in the C. elegans system.
  • Properties that are enhanced by using more stable 3'-endo nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, abso ⁇ tion and clearance; modulation of nuclease stability as well as chemical stability; modulation of the binding affinity and specificity of the oligomer (affinity and specificity for enzymes as well as for complementary sequences); and increasing efficacy of RNA cleavage.
  • the present invention provides oligomeric triggers of RNAi having one or more nucleosides modified in such a way as to favor a C3'-endo type conformation.
  • Nucleoside conformation is influenced by various factors including substitution at the 2', 3' or 4'-positions of the pentofuranosyl sugar. Electronegative substituents generally prefer the axial positions, while sterically demanding substituents generally prefer the equatorial positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.) Modification of the 2' position to favor the 3'-endo conformation can be achieved while maintaining the 2'-OH as a recognition element, as illustrated in Figure 2, below (Gallo et al., Tetrahedron (2001), 57, 5707-5713. Harry-O'kuru et al., J. Org.
  • preference for the 3'-endo conformation can be achieved by deletion of the 2'-OH as exemplified by 2'deoxy-2'F-nucleosides (Kawasaki et al., J. Med. Chem. (1993), 36, 831-841), which adopts the 3'-endo conformation positioning the electronegative fluorine atom in the axial position.
  • oligomeric triggers of RNAi response might be composed of one or more nucleosides modified in such a way that conformation is locked into a C3'-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem. Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters (2002), 12, 73-76.)
  • LNA Locked Nucleic Acid
  • ENA ethylene bridged Nucleic Acids
  • modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and CD measurements. Hence, modifications predicted to induce RNA like conformations, A-form duplex geometry in an oligomeric context, are selected for use in the modified oligomers of the present invention.
  • the synthesis of numerous of the modified nucleosides amenable to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988, Plenum press., and the examples section below.) Nucleosides known to be inhibitors/substrates for RNA dependent RNA polymerases (for example HCV NS5B
  • the present invention is directed to oligomers that are prepared having enhanced properties compared to native RNA against nucleic acid targets.
  • a target is identified and an oligomer is selected having an effective length and sequence that is complementary to a portion of the target sequence.
  • Each nucleoside of the selected sequence is scrutinized for possible enhancing modifications.
  • a preferred modification would be the replacement of one or more RNA nucleosides with nucleosides that have the same 3'-endo conformational geometry.
  • Such modifications can enhance chemical and nuclease stability relative to native RNA while at the same time being much cheaper and easier to synthesize and/or inco ⁇ orate into an oligomer.
  • the selected sequence can be further divided into regions and the nucleosides of each region evaluated for enhancing modifications that can be the result of a chimeric configuration. Consideration is also given to the 5' and 3'-termini as there are often advantageous modifications that can be made to one or more of the terminal nucleosides.
  • the oligomeric compounds of the present invention include at least one 5 '-modified phosphate group on a single strand or on at least one 5'-position of a double stranded sequence or sequences. Further modifications are also considered such as internucleoside linkages, conjugate groups, substitute sugars or bases, substitution of one or more nucleosides with nucleoside mimetics and any other modification that can enhance the selected sequence for its intended target.
  • RNA and DNA duplexes are "A Form” for RNA and "B Form” for DNA.
  • the respective conformational geometry for RNA and DNA duplexes was determined from X-ray diffraction analysis of nucleic acid fibers (Arnott and Hxxkins, Biochem. Biophys. Res.
  • RNA:RNA duplexes are more stable and have higher melting temperatures (Tm's) than DNA:DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer- Verlag; New York, NY.; Lesnik et al, Biochemistry, 1995, 34, 10807-10815; Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634).
  • Tm's melting temperatures
  • RNA biases the sugar toward a C3' endo pucker, i.e., also designated as Northern pucker, which causes the duplex to favor the A-form geometry.
  • a C3' endo pucker i.e., also designated as Northern pucker
  • the 2' hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489- 8494).
  • deoxy nucleic acids prefer a C2' endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B- form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer- Verlag, New York, NY).
  • B-form geometry is inclusive of both C2'-endo pucker and O4'-endo pucker. This is consistent with Berger, et. al, Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that in considering the furanose conformations which give rise to B-form duplexes consideration should also be given to a O4'-endo pucker contribution.
  • DNA:RNA hybrid duplexes are usually less stable than pure RNA:RNA duplexes, and depending on their sequence may be either more or less stable than DNA:DNA duplexes (Searle et al, Nucleic Acids Res., 1993, 21, 2051-2056).
  • the structure of a hybrid duplex is intermediate between A- and B- form geometries, which may result in poor stacking interactions (Lane et al, Eur. J. Biochem., 1993, 215, 297-306; Fedoroff et al, J. Mol. Biol, 1993, 233, 509- 523; Gonzalez et al, Biochemistry, 1995, 34, 4969-4982; Horton et al, J.
  • the stability of the duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligomer strand to an RNA target strand.
  • therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligomer strand to an RNA target strand.
  • antisense effective inhibition of the mRNA requires that the antisense DNA have a very high binding affinity with the mRNA. Otherwise the desired interaction between the synthetic oligomer strand and target mRNA strand will occur infrequently, resulting in decreased efficacy.
  • One routinely used method of modifying the sugar puckering is the substitution of the sugar at the 2'-position with a substituent group that influences the sugar geometry.
  • the influence on ring conformation is dependant on the nature of the substituent at the 2'-position.
  • a number of different substituents have been studied to determine their sugar puckering effect. For example, 2'-halogens have been studied showing that the 2'-fluoro derivative exhibits the largest population (65%) of the C3'-endo form, and the 2'-iodo exhibits the lowest population (7%).
  • the populations of adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%, respectively.
  • the relative duplex stability can be enhanced by replacement of 2'-OH groups with 2'-F groups thereby increasing the C3'-endo population. It is assumed that the highly polar nature of the 2'-F bond and the extreme preference for C3'-endo puckering may stabilize the stacked conformation in an A-form duplex. Data from UV hypochromicity, circular dichroism, and 1H NMR also indicate that the degree of stacking decreases as the electronegativity of the halo substituent decreases. Furthermore, steric bulk at the 2'-position of the sugar moiety is better accommodated in an A-form duplex than a B-form duplex.
  • a 2'-substituent on the 3'-terminus of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the molecular size, electronegativity, and hydrophobicity of the substituent. Melting temperatures of complementary strands is also increased with the 2'-substituted adenosine diphosphates. It is not clear whether the 3 '-endo preference of the conformation or the presence of the substituent is responsible for the increased binding.
  • Oligonucleotides having the 2'-O-methoxyethyl substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim. Ada, 1995, 78, 486-504; Altmann et al, Chimia, 1996, 50, 168-176; Altmann et al, Biochem. Soc Trans., 1996, 24, 630-637; and Altmann et al, Nucleosides Nucleotides, 1997, 16, 917-926). Relative to DNA, the oligomers having the 2'-MOE modification displayed improved RNA affinity and higher nuclease resistance.
  • Chimeric oligomers having 2'-MOE substituents in the wing nucleosides and an internal region of deoxy-phosphorothioate nucleotides have shown effective reduction in the growth of tumors in animal models at low doses.
  • 2'-MOE substituted oligomers have also shown outstanding promise as antisense agents in several disease states.
  • One such MOE substituted oligomer is presently being investigated in clinical trials for the treatment of CMV retinitis.
  • alkyl means C ⁇ -C ⁇ 2 , preferably C ⁇ -C 8 , and more preferably C ⁇ -C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl.
  • heteroalkyl means C ⁇ -C ⁇ 2 , preferably C ⁇ -C 8 , and more preferably C ⁇ -C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl containing at least one, and preferably about 1 to about 3, hetero atoms in the chain, including the terminal portion of the chain.
  • Preferred heteroatoms include N, O and S.
  • cycloalkyl means C 3 -C ⁇ 2 , preferably C 3 -C 8 , and more preferably C 3 -C 6 , aliphatic hydrocarbyl ring.
  • alkenyl means C 2 -C ⁇ 2 , preferably C 2 -C 8 , and more preferably C -C 6 alkenyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon double bond.
  • alkynyl means C 2 -C 12 , preferably C -Cg, and more preferably C 2 -C 6 alkynyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon triple bond.
  • heterocycloalkyl means a ring moiety containing at least three ring members, at least one of which is carbon, and of which 1, 2 or three ring members are other than carbon.
  • the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8.
  • Preferred ring heteroatoms are N, O and S.
  • Preferred heterocycloalkyl groups include mo ⁇ holino, thiomo ⁇ holino, piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl, homomo ⁇ holino, homothiomo ⁇ holino, pynolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and tefrahydroisothiazolyl.
  • aryl means any hydrocarbon ring structure containing at least one aryl ring. Prefened aryl rings have about 6 to about 20 ring carbons. Especially preferred aryl rings include phenyl, napthyl, anthracenyl, and phenanthrenyl.
  • hetaryl means a ring moiety containing at least one fully unsaturated ring, the ring consisting of carbon and non-carbon atoms.
  • the ring system contains about 1 to about 4 rings.
  • the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8.
  • Preferred ring heteroatoms are N, O and S.
  • Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc.
  • haloalkyl is defined as an alkyl containing one or more halogen atoms.
  • the alkyl is fully halogenated.
  • the haloalkyl may be trifluoromethyl.
  • haloalkoxy is defined as an alkoxy group where the alkyl group is a haloalkyl.
  • the haloalkoxy may be trifluoroalkoxy.
  • a moiety is defined as a compound moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl), etc.
  • each of the sub-moieties is as defined herein.
  • an electron withdrawing group is a group, such as the cyano or isocyanato group that draws electronic charge away from the carbon to which it is attached.
  • Other electron withdrawing groups of note include those whose electronegativities exceed that of carbon, for example halogen, nitro, or phenyl substituted in the ortho- or para-position with one or more cyano, isothiocyanato, nitro or halo groups.
  • halogen and halo have their ordinary meanings.
  • Prefened halo (halogen) substituents are CI, Br, and I.
  • the aforementioned optional substituents are, unless otherwise herein defined, suitable substituents depending upon desired properties. Included are halogens (CI, Br, I), alkyl, alkenyl, and alkynyl moieties, NO 2 , NH 3 (substituted and unsubstituted), acid moieties (e.g. -CO H, -OSO 3 H , etc.), heterocycloalkyl moieties, hetaryl moieties, aryl moieties, etc.
  • the squiggle ( ⁇ ) indicates a bond to an oxygen or sulfur of the 5 '-phosphate.
  • Phosphate protecting groups include those described in US Patents Nos. 5,760,209, 5,614,621, 6,051,699, 6,020,475, 6,326,478, 6,169,177, 6,121,437, 6,465,628 each of which is expressly inco ⁇ orated herein by reference in its entirety.
  • Phosphotioate groups include those described in U.S. Patent Nos. 3,687,808, 5,188,897, 5,278,302, 5,286,717, 5,405,939, 5,453,496, and 5,587,361.
  • Alkylphosphoroamidate groups include those described in U.S. Patent No. 5,536,821 and 5,541,306,
  • alkoxy is defined as -O-alkyl where alkyl is as defined above.
  • alkylthio is defined as -S-alkyl where alkyl is as defined above.
  • alkyl, heteroalkyl, cycloalkyl, alkenyl, alkynyl, heterocycloalkyl, aryl, and hetaryl include moieties that are optionally substituted.
  • Sitable substituents are well known to those skilled in the art.
  • substituents include C ⁇ -C 2 o alkyl, C 2 -C 2 o alkenyl, C 2 -C 2 o alkynyl, C 5 -C 2 o aryl, -O- alkyl, -O-alkenyl, -O-alkynyl, -O-alkylamino, -O-alkylalkoxy, -O-alkylamino- alkyl, -O-alkyl imidazole, - ⁇ H, -SH, -S-alkyl, -S-alkenyl, -S-alkynyl, -N(H)-alkyl, -N(H)-alkenyl, -N(H)-alkynyl, -N(alkyl) 2 , -O-aryl, -S-aryl, -NH-aryl, - ⁇ N ⁇ 2 , -O- aralkyl, -S-
  • a blockmer has at least one block or segment of at least two consecutively located nucleotide or nucleoside subunits of a first type positioned adjacent to at least one nucleotide or nucleoside of a second type.
  • nucleotides or nucleosides of the first type are represented by "X” and those of the second type are represented by “Y” and if"
  • nucleotides or nucleosides other that the X or Y type nucleotides or the absence of any nucleotides then the following structures ...XXY..; ...XXYXX...; ...XXYXXY...; ...XXYXXYXX... on so on for higher homologs are possible where each X containing segment includes two members and each Y containing segment includes only one member.
  • each X containing segment includes two members and each Y subunit also includes two members
  • other representational blockmers include ...XXYY...; ...XXYYXX...; ...XXYYXXYY... ; ...XXYYXXYYXX... and so on for high homologs.
  • These can be extended to other representative stractures having more X and/or Y members in the blocks or segments, as for instances the structures YXXXYYYXXXY; YYXXXYYXXXXYY; and YYYYXXXXYYYYXXX.
  • a block or segment of the first type of nucleotides or nucleoside resides at the 5' or the 3' terminus and all of the remaining nucleotides or nucleosides of the oligomer are of the second type, then that blockmer is also a hemimer.
  • the representations XXXXXYYYY and YYYYYXXX represent, respectively, 5' and 3' hemimers.
  • gapmers a block or segment of one type of nucleotides or nucleosides is interspaced between first and second blocks of the second type.
  • XXXXYYYYXXX represents a gapmer
  • YYYYXXXXYYYY represents an invertered gapmer.
  • the compounds and compositions of the invention are used to modulate the expression of a selected protein.
  • “Modulators” are those oligomeric compounds and compositions that decrease or increase the expression of a nucleic acid molecule encoding a protein and which comprise at least an 8-nucleobase portion which is complementary to a prefened target segment.
  • the screening method comprises the steps of contacting a prefened target segment of a nucleic acid molecule encoding a protein with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a protein. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g.
  • the modulator may then be employed in fiirther investigative studies of the function of the peptide, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • oligomeric compounds of invention can be used combined with their respective complementary strand oligomeric compound to form stabilized double-stranded (duplexed) oligomers.
  • Double stranded oligomer moieties have been shown to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism.
  • double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al, Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev.
  • oligomeric compounds of the present invention are used to elucidate relationships that exist between proteins and a disease state, phenotype, or condition. These methods include detecting or modulating a target peptide comprising contacting a sample, tissue, cell, or organism with the oligomeric compounds and compositions of the present invention, measuring the nucleic acid or protein level of the target and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further oligomeric compound of the invention.
  • kits Research Reagents, Diagnostics, and Therapeutics
  • the oligomeric compoxmds and compositions of the present invention can additionally be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Such uses allows for those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
  • the oligomeric compounds and compositions of the present invention can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • expression patterns within cells or tissues treated with one or more compounds or compositions of the invention are compared to control cells or tissues not treated with the compoxmds or compositions and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds that affect expression patterns.
  • Examples of methods of gene expression analysis known in the art include DNA anays or microareays (Brazma and Vilo, FEBS Lett, 2000, 480, 17-24; Celis, et al, FEBS Lett, 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al, DrugDiscov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol, 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al, Proc. Natl. Acad. Sci. U. S.
  • the compounds and compositions of the invention are useful for research and diagnostics, because these compounds and compositions hybridize to nucleic acids encoding proteins.
  • Hybridization of the compounds and compositions of the invention with a nucleic acid can be detected by means known in the art. Such means may include conjugation of an enzyme to the compound or composition, radiolabelling or any other suitable detection means. Kits using such detection means for detecting the level of selected proteins in a sample may also be prepared.
  • oligomeric compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans.
  • Antisense oligomer drugs, including ribozymes have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligomeric compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • an animal preferably a human, suspected of having a disease or disorder that can be treated by modulating the expression of a selected protein is treated by administering the compounds and compositions.
  • the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a protein inhibitor.
  • the protein inhibitors of the present invention effectively inhibit the activity of the protein or inhibit the expression of the protein.
  • the activity or expression of a protein in an animal is inhibited by about 10%.
  • the activity or expression of a protein in an animal is inhibited by about 30%. More preferably, the activity or expression of a protein in an animal is inhibited by 50% or more.
  • the reduction of the expression of a protein may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
  • the cells contained within the fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding a protein and/or the protein itself.
  • compositions of the invention can be utilized in pharmaceutical compositions by adding an effective amount of the compound or composition to a suitable pharmaceutically acceptable diluent or carrier.
  • a suitable pharmaceutically acceptable diluent or carrier Use of the oligomeric compoxmds and methods of the invention may also be useful prophylactically.
  • compositions of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or abso ⁇ tion.
  • Representative United States patents that teach the preparation of such uptake, distribution and/or abso ⁇ tion- assisting formulations include, but are not limited to, U.S.: 5,108,921; 5,354,844;
  • the compounds and compositions of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the oligomeric compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligomers of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al, published December 9, 1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds and compositions of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • pharmaceutically acceptable salts include oligomers, prefened examples of pharmaceutically acceptable salts and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • the present invention also includes pharmaceutical compositions and formulations that include the compounds and compositions of the invention.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by xmiformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
  • Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations.
  • the pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug that may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • Formulations of the present invention include liposomal formulations.
  • liposome means a vesicle composed of amphiphilic lipids ananged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
  • Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when inco ⁇ orated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • compositions of the present invention may also include surfactants.
  • surfactants used in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligomers.
  • penetration enhancers In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
  • Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non- chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • Prefened formulations for topical administration include those in which the oligomers of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Prefened lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • neutral e.g.
  • compounds and compositions of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, they may be complexed to lipids, in particular to cationic lipids.
  • Prefened fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is inco ⁇ orated herein by reference in its entirety.
  • compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Prefened oral formulations are those in which oligomers of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators.
  • Prefened surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
  • Prefened bile acids/salts and fatty acids and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
  • prefened are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts.
  • a particularly prefened combination is the sodium salt of lauric acid, capric acid and UDCA.
  • Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
  • Compoxmds and compositions of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Complexing agents and their uses are further described in U.S.
  • Patent 6,287,860 which is inco ⁇ orated herein in its entirety.
  • Certain oral formulations for oligomers and their preparation are described in detail in United States applications 09/108,673 (filed July 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed February 8, 2002, each of which is inco ⁇ orated herein by reference in their entirety.
  • compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • Certain embodiments of the invention provide pharmaceutical compositions containing one or more of the compounds and compositions of the invention and one or more other chemotherapeutic agents that function by a non- antisense mechanism.
  • chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorabicin, epirabicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcycl
  • chemotherapeutic agents When used with the oligomeric compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligomer), sequentially (e.g., 5-FU and oligomer for a period of time followed by MTX and oligomer), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligomer, or 5-FU, radiotherapy and oligomer).
  • Anti-inflammatory drags including but not limited to nonsteroidal anti- inflammatory drugs and corticosteroids, and antiviral drags, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
  • Combinations of compounds and compositions of the invention and other drags are also within the scope of this invention.
  • Two or more combined compounds such as two oligomeric compoxmds or one oligomeric compoxmd combined with further compounds may be used together or sequentially.
  • compositions of the invention may contain one or more of the compounds and compositions of the invention targeted to a first nucleic acid and one or more additional compounds such as antisense oligomeric compounds targeted to a second nucleic acid target.
  • additional compounds such as antisense oligomeric compounds targeted to a second nucleic acid target.
  • antisense oligomeric compounds are known in the art.
  • compositions of the invention may contain two or more oligomeric compoxmds and compositions targeted to different regions of the same nucleic acid target. Two or more combined compounds may be used together or sequentially
  • compositions of the invention are believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drag accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC 5 os found to be effective in in vitro and in vivo animal models.
  • dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drag in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recunence of the disease state, wherein the oligomer is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH 4 OAc solution.
  • Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein inco ⁇ orated by reference.
  • Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein inco ⁇ orated by reference.
  • 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein inco ⁇ orated by reference.
  • Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein inco ⁇ orated by reference.
  • Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein inco ⁇ orated by reference.
  • 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein inco ⁇ orated by reference.
  • Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein inco ⁇ orated by reference.
  • Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein inco ⁇ orated by reference.
  • Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein inco ⁇ orated by reference.
  • RNA synthesis chemistry is based on the selective inco ⁇ oration of various protecting groups at strategic intermediary reactions.
  • a useful class of protecting groups includes silyl ethers.
  • bulky silyl ethers are used to protect the 5 '-hydroxyl in combination with an acid-labile orthoester protecting group on the 2 '-hydroxyl.
  • This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps.
  • the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2' hydroxyl.
  • RNA oligonucleotides were synthesized.
  • RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3 '- to 5 '-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3 '-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5 '- end of the first nucleoside. The support is washed and any unreacted 5 '-hydroxyl groups are capped with acetic anhydride to yield 5 '-acetyl moieties.
  • the linkage is then oxidized to the more stable and ultimately desired P(V) linkage.
  • the 5 '-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
  • the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2- cyanoethylene-l,l-dithiolate trihydrate (S 2 Na 2 ) in DMF.
  • the deprotection solution is washed from the solid support-bound oligonucleotide using water.
  • the support is then treated with 40% methylamine in water for 10 minutes at 55 °C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2'- groups.
  • the oligonucleotides can be analyzed by anion exchange HPLC at this stage.
  • the 2 '-orthoester groups are the last protecting groups to be removed.
  • the resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor.
  • the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
  • Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers" or "wingmers”.
  • Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy- 5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxy- trityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings.
  • the standard synthesis cycle is modified by inco ⁇ orating coupling steps with increased reaction times for the 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite.
  • the fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH OH) for 12-16 hr at 55°C.
  • the deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • [0238] [2'-O-(2-methoxyethyl)] ⁇ [2'-deoxy]-[-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2 '-O-methyl chimeric oligonucleotide, with the substitution of 2 5 -O- (methoxy ethyl) amidites for the 2 '-O-methyl amidites.
  • [2'-O-(2-methoxyethyl phosphodiester] -[2'-deoxy phosphorothioate]-- [2'-O-(methoxyethyl) phosphodiester] cliimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the 2'- O-methyl amidites, oxidation with iodine to generate the phosphodiester intemucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate intemucleotide linkages for the center gap.
  • 2'-Deoxy-2'-fluoro modified oligonucleotides may be prepared by methods taught in U.S. Patent No. 6,531,584.
  • 2'-Deoxy-2'-O-alkyl modified oligonucleotides may be prepared by methods taught in U.S. Patent No. 6,531,584.
  • 5'-O-Dimethoxytrityl-2'-O-methyl-3'-O-(N,N-diisopro ⁇ ylamino-O- .beta.-cyano ethylphosphine)-N-benzoyladenosine may be prepared by methods taught in U.S. Patent No. 6,005,094.
  • 5'-O-Dimethoxytrityl-2'-O-methylthiomethyl-nucleotides may be prepared by methods taught in U.S. Patent No. 6,239,272.
  • 2'-Deoxy-2'-(vinyloxy) modified oligonucleotides may be prepared by methods taught in U.S. Patent No. 5,859,221.
  • 2'-OCH 2 COOEt modified oligonucleotides may be prepared by methods taught in U.S. Patent No. 5,792,847.
  • 9-(2-(O-2-Propynyloxy)- ⁇ -D-ribofuranosyl) adenine may be prepared by methods taught in U.S. Patent No. 5,514,786. )
  • 3'-O-(N-Allyloxycarbonyl-6-aminohexyl)-5'-O-dimethoxytrityl- uridine may be prepared by methods taught in U.S. Patent No. 6,111,085.
  • 2'-O-(N-phthalimido) prop-3-yl adenosine may be prepared by methods taught in U.S. Patent No. 5,872,232.
  • 5'-O-Dimethoxytrityl-2'-O-(carbonylaminohexyl aminocarbonyloxy cholesteryl)-N4 -benzolyl chloride may be prepared by methods taught in U.S. Patent No. 6,166,188.
  • oligonucleotides may be prepared by methods taught in U.S. Patent No. 5,969,116.
  • a series of nucleic acid duplexes comprising the antisense oligomeric compounds of the present invention and their complements can be designed to target a target.
  • the ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
  • the sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either tenninus.
  • both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
  • a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO:l) and having a two- nucleobase overhang of deoxythymidine(dT) would have the following structure:
  • RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate.
  • the final volume is 75 uL. This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation. The final concentration ofthe dsRNA duplex is 20 uM. This solution can be stored frozen (-20°C) and freeze-thawed up to 5 times.
  • duplexed antisense oligomeric compounds are evaluated for their ability to modulate a target expression.
  • oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH 4 OAc with >3 volumes of ethanol.
  • Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material.
  • the relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of conect molecular weight relative to the -16 a u product (+/-32 +/-48).
  • oligonucleotides were purified by HPLC, as described by Chiang et al, J. Biol. Chem. 1991, 266, 18162- 18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format.
  • Phosphodiester intemucleotide linkages were afforded by oxidation with aqueous iodine.
  • Phosphorothioate intemucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
  • Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g.
  • Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta- cyanoethyldiisopropyl phosphoramidites.
  • Oligonucleotides were cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • oligonucleotide concentration was assessed by dilution of samples and UV abso ⁇ tion spectroscopy.
  • the full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270).
  • Base and backbone composition was confirmed by mass analysis of the oligomeric compoxmds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the oligomeric compounds on the plate were at least 85% full length.
  • oligomeric compoxmds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative pu ⁇ oses, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR. T-24 cells:
  • the human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Invitrogen Co ⁇ oration, Carlsbad, CA) supplemented with 10% fetal calf serum (invitrogen Co ⁇ oration, Carlsbad, CA), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (invitrogen Co ⁇ oration, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.
  • ATCC American Type Culture Collection
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • A549 cells A549 cells:
  • the human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells were routinely cultured in DMEM basal media (Invitrogen Co ⁇ oration, Carlsbad, CA) supplemented with 10% fetal calf serum (Invitrogen Co ⁇ oration, Carlsbad, CA), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Co ⁇ oration, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. NHDF cells:
  • NHDF Human neonatal dermal fibroblast
  • HEK Human embryonic keratinocytes
  • Clonetics Co ⁇ oration Walkersville, MD
  • HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Co ⁇ oration, Walkersville, MD) formulated as recommended by the supplier.
  • Cells were routinely maintained for up to 10 passages as recommended by the supplier.
  • the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 4) which is targeted to human H-ras, or ISIS 18078,
  • the concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inliibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments.
  • concentrations of antisense oligonucleotides used herein are
  • Modulation of a target expression can be assayed in a variety of ways known in the art.
  • a target mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or realtime PCR (RT-PCR).
  • Real-time quantitative PCR is presently prefened.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA.
  • the prefened method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art.
  • Northern blot analysis is also routine in the art.
  • Realtime quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Protein levels of a target can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immxmoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence- activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Co ⁇ oration, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
  • the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.
  • Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of a target in health and disease.
  • Representative phenotypic assays which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkiiiElmer, Boston, MA), protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma- Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Teme
  • cells determined to be appropriate for a particular phenotypic assay are treated with a target inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above.
  • treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
  • Phenotypic endpoints include changes in cell mo ⁇ hology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
  • the individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.
  • the clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study.
  • Volunteers receive either the a target inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment), end (after the final treatment), and at regular intervals during the study period.
  • Such measurements include the levels of nucleic acid molecules encoding a target or a target protein levels in body fluids, tissues or organs compared to pretreatment levels.
  • Other measurements include, but are not limited to, indices of the disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (abso ⁇ tion, distribution, metabolism and excretion) measurements.
  • Information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes/no), motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.
  • Volunteers taking part in this study are healthy adults (age 18 to 65 years) and roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and a target inhibitor treatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the target inhibitor show positive trends in their disease state or condition index at the conclusion of the study.
  • Poly(A)+ mRNA was isolated according to Miura et al, (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ⁇ L cold PBS. 60 ⁇ L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes.
  • lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex
  • elution buffer 5 mM Tris-HCl pH 7.6
  • elution buffer 5 mM Tris-HCl pH 7.6
  • the repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transfened to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Quantitation of a target mRNA levels was accomplished by realtime quantitative PCR using the ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
  • ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System PE-Applied Biosystems, Foster City, CA
  • This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time.
  • PCR polymerase chain reaction
  • products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
  • a reporter dye e.g., FAM or JOE, obtained from either PE- Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
  • a quencher dye e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
  • TAMRA obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
  • annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'- exonuclease activity of Taq polymerase.
  • cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
  • additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM Sequence Detection System.
  • a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction.
  • multiplexing both the target gene and the internal standard gene GAPDH are amplified concunently in a single sample.
  • mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing).
  • standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples.
  • the primer-probe set specific for that target is deemed multiplexable.
  • Other methods of PCR are also known in the art.
  • PCR reagents were obtained from Invitrogen Co ⁇ oration, (Carlsbad, CA). RT-PCR reactions were carried out by adding 20 ⁇ L PCR cocktail (2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30 ⁇ L total RNA solution (20-200 ng).
  • PCR cocktail 2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe
  • the RT reaction was carried out by incubation for 30 minutes at 48°C. Following a 10 minute incubation at 95°C to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension) .
  • Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR).
  • GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately.
  • Total RNA is quantified using RiboGreenTM RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). Methods of RNA quantification by RiboGreenTM are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • RiboGreenTM working reagent 170 ⁇ L of RiboGreenTM working reagent (RiboGreenTM reagent diluted 1:350 in lOmM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 ⁇ L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and emission at 530nm.
  • CytoFluor 4000 PE Applied Biosystems
  • Probes and primers are designed to hybridize to a human a target sequence, using published sequence information.
  • RNAZOLTM TEL-TEST "B” Inc., Friendswood, TX. Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH).
  • a human a target specific primer probe set is prepared by PCR To normalize for variations in loading and transfer efficiency membranes are stripped and probed for human glyceraldehyde-3- phosphate dehydrogenase (GAPDH) R ⁇ A (Clontech, Palo Alto, CA).
  • GPDH glyceraldehyde-3- phosphate dehydrogenase
  • Hybridized membranes were visualized and quantitated using a PHOSPHOPJMAGERTM and IMAGEQUA ⁇ TTM Software V3.3 (Molecular Dynamics, Sunnyvale, CA). Data was normalized to GAPDH levels in untreated controls.
  • oligomeric compounds are designed to target different regions of the human target R ⁇ A.
  • the oligomeric compounds are analyzed for their effect on human target mR ⁇ A levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments.
  • the target regions to which these prefened sequences are complementary are herein refened to as "prefened target segments” and are therefore prefened for targeting by oligomeric compounds of the present invention.
  • the sequences represent the reverse complement of the prefened antisense oligomeric compounds.
  • antisense oligomeric compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds that hybridize to at least a portion of the target nucleic acid.
  • GCS external guide sequence
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all internucleoside linkages are phosphodiester.
  • siRNA's having 5, 2'-O-methyl groups at least 2 positions removed from the 5'-end of the antisense strand reduced PTEN mRNA levels to from 25 to 35% of untreated control.
  • the remaining 2 constructs increased PTEN mRNA levels above untreated control.
  • antisense strands listed below having SEQ ID NO:9 were individually duplexed with the sense strand having SEQ ID NO:7 and the activity was measxxred to determine the relative effect of adding either 9 or 14, 2'-O- methyl modified nucleosides at the 3'-end of the resulting siRNA's.
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all internucleoside linkages are phosphodiester.
  • siRNA having 9, 2'-O-methyl nucleosides reduced PTEN mRNA levels to about 40% of untreated control whereas the construct having 14, 2'-O-methyl nucleosides only reduced PTEN mRNA levels to about 98% of control.
  • a series of blockmers were prepared as duplexed siRNA's and also as single strand asRNA's.
  • the antisense strands were identical for the siRNA's and the asRNA's.
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
  • the constructs were assayed for activity for measuring the levels of PTEN mRNA in T24 cells against untreated control levels. All of the asRNA's and siRNA's showed activity with the asRNA's having the best activity in each case. A clear dose response was seen for all the siRNA constructs (20, 40, 80 and 150 nm doses). There was a good dose response for the asRNA's for 50, 100 and 200 nm doses. In general the siRNA's were more active in this system at lower doses than the asRNA's and at the 150 nm dose was able to reduce PTEN mRNA levels to from 15 to 40% of untreated control. The unmodified siRNA 303912 reduced PTEN mRNA levels to about 19% of the untreated control.
  • Blunt and overhanging siRNA constructs were prepared having a block of 5, 2'-O-methyl nucleosides at the 3'-terminus.
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
  • the construct having overhangs was able to reduce PTEN mRNA levels to about 36% of untreated control whereas the blunt ended construct was able to reduce the PTEN mRNA levels to about 27% of untreated control.
  • siRNA hemimer constructs were prepared and examined in a PTEN assay.
  • the hemimer constructs had 7, 2'-O-methyl nucleosides at the 3 '-end.
  • the hemimer was put in the sense strand only, the antisense strand only and in both strands to compare the effects.
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
  • the construct having the 7, 2'-O-methyl nucleosides only in the antisense strand reduced PTEN mRNA levels to about 23% of untreated confrol.
  • the construct having the 7, 2'-O-methyl nucleosides in both strands reduced the PTEN mRNA levels to about 25% of untreated control.
  • Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the intemucleoside linkages for the S strand are phosphodiester.
  • Percent mRNA is relative to untreated control in PTEN assay.
  • antisense strands of siRNA's were hybridized to the complementary full phosphodiester sense strand. Where the antisense strand has a TT 3'-terminus the conesponding sense strand also has a 3'-TT (deoxyT's) SEQ ID NO./ISIS NO.
  • siRNA's prepared having 2'-F and 2'-OCH 3 monomers

Abstract

L'invention concerne des compositions comprenant un premier oligomère et un second oligomère, dans lesquelles au moins une partie du premier oligomère peut être hybridée avec au moins une partie du second oligomère, au moins une partie du premier oligomère étant complémentaire à une hybridation et permettant une hybridation avec un acide nucléique cible sélectionné, et au moins un de ces oligomères comprenant un sucre modifié et/ou une modification de squelette. Dans certains modes de réalisation, la modification est un groupe substituant 2'-OCH3 sur une fraction de sucre. L'invention concerne également des compositions oligomères/protéiniques comprenant également un oligomère complémentaire à une hybridation et permettant une hybridation avec un acide nucléique cible sélectionné, et au moins une protéine comprenant au moins une partie d'un complexe de silençage induit par ARN (RISC), au moins un nucléotide de l'oligomère présentant un sucre modifié et/ou une modification de squelette.
PCT/US2003/034906 2002-11-05 2003-11-04 Composes oligomeres substitues par methoxy en position 2' et compositions a utiliser dans des modulations geniques WO2004043978A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003291682A AU2003291682A1 (en) 2002-11-05 2003-11-04 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US42376002P 2002-11-05 2002-11-05
US60/423,760 2002-11-05
US50352103P 2003-09-16 2003-09-16
US60/503,521 2003-09-16

Publications (2)

Publication Number Publication Date
WO2004043978A2 true WO2004043978A2 (fr) 2004-05-27
WO2004043978A3 WO2004043978A3 (fr) 2005-04-07

Family

ID=32314503

Family Applications (3)

Application Number Title Priority Date Filing Date
PCT/US2003/034905 WO2004043977A2 (fr) 2002-11-05 2003-11-04 Composes oligomeres substitues par fluoro en position 2' et compositions a utiliser dans des modulations geniques
PCT/US2003/034906 WO2004043978A2 (fr) 2002-11-05 2003-11-04 Composes oligomeres substitues par methoxy en position 2' et compositions a utiliser dans des modulations geniques
PCT/US2003/035087 WO2004044140A2 (fr) 2002-11-05 2003-11-04 Composes oligomeres 2'-substitues et compositions destinees a etre utilisees dans des modulations genetiques

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2003/034905 WO2004043977A2 (fr) 2002-11-05 2003-11-04 Composes oligomeres substitues par fluoro en position 2' et compositions a utiliser dans des modulations geniques

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2003/035087 WO2004044140A2 (fr) 2002-11-05 2003-11-04 Composes oligomeres 2'-substitues et compositions destinees a etre utilisees dans des modulations genetiques

Country Status (4)

Country Link
EP (1) EP1563070A4 (fr)
AU (4) AU2003291682A1 (fr)
CA (1) CA2504554A1 (fr)
WO (3) WO2004043977A2 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7695902B2 (en) 1996-06-06 2010-04-13 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US9968628B2 (en) 2000-05-26 2018-05-15 Idenix Pharmaceuticals Llc Methods and compositions for treating flaviviruses and pestiviruses
US10363265B2 (en) 2000-05-23 2019-07-30 Idenix Pharmaceuticals Llc Methods and compositions for treating hepatitis C virus
US10525072B2 (en) 2002-11-15 2020-01-07 Idenix Pharmaceuticals Llc 2′-branched nucleosides and flaviviridae mutation

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026394A1 (en) 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US7109165B2 (en) 2001-05-18 2006-09-19 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
GB2406568B (en) * 2002-02-20 2005-09-28 Sirna Therapeutics Inc RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
GB2413557B (en) * 2002-02-20 2006-08-16 Sirna Therapeutics Inc RNA interference mediated inhibtion of gene expression using chemically modified short interfering nucleic acid (siNA)
US7151089B2 (en) 2003-10-27 2006-12-19 Genelabs Technologies, Inc. Nucleoside compounds for treating viral infections
WO2005042556A1 (fr) 2003-10-27 2005-05-12 Genelabs Technologies, Inc. Composes nucleosides permettant de traiter des infections virales
US7244713B2 (en) 2003-10-27 2007-07-17 Genelabs Technologies, Inc. Nucleoside compounds for treating viral infections
US7169918B2 (en) 2003-10-27 2007-01-30 Genelabs Technologies, Inc. Methods for preparing 7-(2′-substituted-β-D-ribofuranosyl)-4-(NR2R3)-5-(substituted ethyn-1-yl)-pyrrolo[2,3-d]pyrimidine derivatives
US7202223B2 (en) 2003-10-27 2007-04-10 Genelabs Technologies, Inc. Nucleoside compounds for treating viral infections
CA2554212A1 (fr) 2004-02-10 2005-08-25 Sirna Therapeutics, Inc. Inhibition induite par l'interference arn de l'expression genetique, a l'aide d'un acide nucleique interferant court multifonctionnel (sina multifonctionnel)
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
CN101133074B (zh) * 2004-09-24 2012-05-30 阿尔尼拉姆医药品有限公司 APOB的RNAi调节及其用途
EP1855694B1 (fr) 2005-02-09 2020-12-02 Sarepta Therapeutics, Inc. Composition antisens permettant de traiter une atrophie musculaire
KR20130137160A (ko) 2010-08-24 2013-12-16 머크 샤프 앤드 돔 코포레이션 내부의 비－핵산 스페이서를 함유하는 단일－가닥 ＲＮＡｉ 작용제
EP2632472B1 (fr) 2010-10-29 2017-12-13 Sirna Therapeutics, Inc. Inhibition facilitée par l'interférence d'arn de l'expression d'un gène au moyen d'acides nucléiques interférents courts (sina)
US20130085139A1 (en) 2011-10-04 2013-04-04 Royal Holloway And Bedford New College Oligomers
MA41795A (fr) 2015-03-18 2018-01-23 Sarepta Therapeutics Inc Exclusion d'un exon induite par des composés antisens dans la myostatine
US10849917B2 (en) 2015-06-01 2020-12-01 Sarepta Therapeutics, Inc. Antisense-induced exon exclusion in type VII collagen
EP3858993A1 (fr) 2015-10-09 2021-08-04 Sarepta Therapeutics, Inc. Compositions et procédés pour le traitement de la dystrophie musculaire de duchenne et de troubles apparentés
SG11201808964PA (en) 2016-04-18 2018-11-29 Sarepta Therapeutics Inc Antisense oligomers and methods of using the same for treating diseases associated with the acid alpha-glucosidase gene
NZ747685A (en) 2016-04-29 2023-05-26 Sarepta Therapeutics Inc Oligonucleotide analogues targeting human lmna
CN109311920B (zh) 2016-05-24 2021-11-09 萨勒普塔医疗公司 制备磷酸二酰胺吗啉代寡聚物的方法
MA45362A (fr) 2016-05-24 2019-04-10 Sarepta Therapeutics Inc Procédés de préparation d'oligomères morpholino de phosphorodiamidate
MX2021008539A (es) 2016-05-24 2022-10-18 Sarepta Therapeutics Inc Procesos para preparar oligomeros.
US11472824B2 (en) 2016-05-24 2022-10-18 Sarepta Therapeutics, Inc. Processes for preparing phosphorodiamidate morpholino oligomers
AU2017290231A1 (en) 2016-06-30 2019-02-07 Sarepta Therapeutics, Inc. Exon skipping oligomers for muscular dystrophy
MX2019006989A (es) 2016-12-19 2019-08-16 Sarepta Therapeutics Inc Conjugados de oligomeros de omision de exon para distrofia muscular.
BR112019012664A2 (pt) 2016-12-19 2020-01-21 Sarepta Therapeutics Inc conjugados de oligômero de salto de éxon para distrofia muscular
MD3554553T2 (ro) 2016-12-19 2022-10-31 Sarepta Therapeutics Inc Conjugați de oligomeri de omitere a exonului, pentru distrofie musculară
EA201991450A1 (ru) 2017-09-22 2019-12-30 Сарепта Терапьютикс, Инк. Конъюгаты олигомеров для пропуска экзона при мышечной дистрофии
US20200254002A1 (en) 2017-09-28 2020-08-13 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
JP2020536060A (ja) 2017-09-28 2020-12-10 サレプタ セラピューティクス， インコーポレイテッド 筋ジストロフィーを処置するための併用療法
US20210145852A1 (en) 2017-09-28 2021-05-20 Sarepta Therapeutics, Inc. Combination Therapies for Treating Muscular Dystrophy
US11555189B2 (en) 2017-10-18 2023-01-17 Sarepta Therapeutics, Inc. Antisense oligomer compounds
US10765760B2 (en) 2018-05-29 2020-09-08 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
EP3806868A4 (fr) 2018-06-13 2022-06-22 Sarepta Therapeutics, Inc. Oligomères induisant un saut d'exon pour la dystrophie musculaire
TW202020153A (zh) 2018-07-27 2020-06-01 美商薩羅塔治療公司 用於肌肉萎縮症之外顯子跳躍寡聚物
EA202191601A1 (ru) 2018-12-13 2022-01-19 Сарепта Терапьютикс, Инк. Конъюгаты олигомеров для пропуска экзона при мышечной дистрофии
US20220193246A1 (en) 2019-04-18 2022-06-23 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
CA3233242A1 (fr) 2021-09-30 2023-04-06 Sarepta Therapeutics, Inc. Oligonucleotides antisens ayant une ou plusieurs unites abasiques
WO2023070086A1 (fr) 2021-10-22 2023-04-27 Sarepta Therapeutics, Inc. Oligomères morpholino pour le traitement de maladies liées à la protéine 22 de myéline périphérique
WO2024064237A2 (fr) 2022-09-21 2024-03-28 Sarepta Therapeutics, Inc. Efficacité du saut d'exon médié par un oligonucléotide antisens dans le traitement de la dmd

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5760209A (en) * 1997-03-03 1998-06-02 Isis Pharmaceuticals, Inc. Protecting group for synthesizing oligonucleotide analogs
US5955443A (en) * 1998-03-19 1999-09-21 Isis Pharmaceuticals Inc. Antisense modulation of PECAM-1
WO2002044321A2 (fr) * 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Petites molecules d'arn mediant l'interference arn
US20040018999A1 (en) * 2000-03-16 2004-01-29 David Beach Methods and compositions for RNA interference

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US20070026394A1 (en) * 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
WO2003070918A2 (fr) * 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Inhibition mediee par interference arn d'une expression genique faisant appel a des acides nucleiques interferants courts chimiquement modifies (sina)

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5760209A (en) * 1997-03-03 1998-06-02 Isis Pharmaceuticals, Inc. Protecting group for synthesizing oligonucleotide analogs
US5955443A (en) * 1998-03-19 1999-09-21 Isis Pharmaceuticals Inc. Antisense modulation of PECAM-1
US20040018999A1 (en) * 2000-03-16 2004-01-29 David Beach Methods and compositions for RNA interference
WO2002044321A2 (fr) * 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Petites molecules d'arn mediant l'interference arn

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ELBASHIR ET AL.: 'Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate' EMBO JOURNAL vol. 20, no. 23, 2001, pages 6877 - 6888, XP002225998 *
PARRISH ET AL.: 'Functional anatomy of a dsRNA trigger: differential requirement for the two trigger strands in RNA interference' MOLECULAR CELL vol. 6, November 2000, pages 1077 - 1087, XP002226298 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7695902B2 (en) 1996-06-06 2010-04-13 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US10363265B2 (en) 2000-05-23 2019-07-30 Idenix Pharmaceuticals Llc Methods and compositions for treating hepatitis C virus
US10758557B2 (en) 2000-05-23 2020-09-01 Idenix Pharmaceuticals Llc Methods and compositions for treating hepatitis C virus
US9968628B2 (en) 2000-05-26 2018-05-15 Idenix Pharmaceuticals Llc Methods and compositions for treating flaviviruses and pestiviruses
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US10525072B2 (en) 2002-11-15 2020-01-07 Idenix Pharmaceuticals Llc 2′-branched nucleosides and flaviviridae mutation
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays

Also Published As

Publication number Publication date
AU2003295388A1 (en) 2004-06-03
WO2004043978A3 (fr) 2005-04-07
EP1563070A2 (fr) 2005-08-17
AU2003287464A8 (en) 2004-06-03
AU2010201712B2 (en) 2012-05-31
WO2004043977A2 (fr) 2004-05-27
EP1563070A4 (fr) 2008-05-28
AU2003291682A8 (en) 2004-06-03
AU2003291682A1 (en) 2004-06-03
WO2004044140A3 (fr) 2005-04-14
WO2004043977A3 (fr) 2005-01-20
WO2004044140A2 (fr) 2004-05-27
AU2003287464A1 (en) 2004-06-03
CA2504554A1 (fr) 2004-05-27
AU2010201712A1 (en) 2010-05-20

Similar Documents

Publication Publication Date Title
AU2010201712B2 (en) 2'-substituted oligomeric compounds and compositions for use in gene modulations
AU2003290596B2 (en) Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7919612B2 (en) 2′-substituted oligomeric compounds and compositions for use in gene modulations
EP1765074B1 (fr) PRODUITS DE SYNTHESE D'ARNsi MODIFIES EN POSITION
US20040161844A1 (en) Sugar and backbone-surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004041889A2 (fr) Composes oligomeres renfermant un substitut de sucre polycyclique et compositions intervenant dans la modulation genique
US20040147022A1 (en) 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations
US20220288100A1 (en) 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations
CA2504720C (fr) Composes oligomere chimeres et leur utilisation dans la modulation genique
WO2004041924A2 (fr) Composes oligomeres a liaison non phosphore et leur utilisation pour la modulation genique
US20040171031A1 (en) Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004044134A2 (fr) Composes oligomeriques lies par phosphore et utilisation dans la modulation de gene
US20040171032A1 (en) Non-phosphorous-linked oligomeric compounds and their use in gene modulation
WO2004044131A2 (fr) Composes oligomeres reticules et leur utilisation dans la modulation des genes
WO2004044135A2 (fr) Motifs structurels, composes oligomeriques et utilisation de ceux-ci dans la modulation de gene
WO2004044137A2 (fr) Composes et compositions oligomeriques contenant un substitut de sucre et de squelette destines a la modulation de gene
US7812149B2 (en) 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US20040254358A1 (en) Phosphorous-linked oligomeric compounds and their use in gene modulation
AU2011203091B2 (en) Chimeric oligomeric compounds and their use in gene modulation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP