WO2004039979A1 - Moyens et methodes permettant de diagnostiquer et de traiter une epilepsie idiopathique generalisee - Google Patents

Moyens et methodes permettant de diagnostiquer et de traiter une epilepsie idiopathique generalisee Download PDF

Info

Publication number
WO2004039979A1
WO2004039979A1 PCT/EP2003/012086 EP0312086W WO2004039979A1 WO 2004039979 A1 WO2004039979 A1 WO 2004039979A1 EP 0312086 W EP0312086 W EP 0312086W WO 2004039979 A1 WO2004039979 A1 WO 2004039979A1
Authority
WO
WIPO (PCT)
Prior art keywords
cic
voltage
wild
nucleic acid
seq
Prior art date
Application number
PCT/EP2003/012086
Other languages
English (en)
Inventor
Armin Heils
Karsten Haug
Original Assignee
Rheinische Friedrich-Wilhelms-Uni Versität Bonn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rheinische Friedrich-Wilhelms-Uni Versität Bonn filed Critical Rheinische Friedrich-Wilhelms-Uni Versität Bonn
Priority to AU2003276217A priority Critical patent/AU2003276217A1/en
Publication of WO2004039979A1 publication Critical patent/WO2004039979A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants

Definitions

  • IGE idiopathic generalized epilepsy
  • the present invention relates to nucleic acid molecules encoding polypeptides which have amino acid sequences of the voltage-gated chloride channel CIC-2, wherein the glycine (Gly) residue corresponding to position 715 of the wild-type voltage-gated chloride channel CIC-2 is replaced by another amino acid residue or wherein amino acids corresponding to positions 74 to 117 of the wild-type voltage- gated chloride channel CIC-2 are deleted or wherein the wild-type translational reading frame of the voltage-gated chloride channel CIC-2 is altered due to an insertion of a nucleotide residue between position 596 and 597 of the corresponding wild-type nucleotide sequence.
  • the invention further relates to polypeptides encoded by said nucleic acids, vectors and hosts comprising said nucleic acid molecules as well as to methods for producing polypeptides encoded by said nucleic acid molecules.
  • the present invention also provides antibodies specifically directed to polypeptides encoded by said nucleic acid molecules.
  • primers for selectively amplifying said nucleic acid molecules are provided in the present invention as well as kits, compositions, particularly diagnostic compositions comprising said nucleic acids, vectors, polypeptides, antibodies and/or primers are provided. Also pharmaceutical compositions comprising nucleic acids encoding a functional voltage-gated chloride channel are provided.
  • the present invention relates to methods of diagnosing neurological diseases associated with the presence of any one of the aforementioned nucleic acids or polypeptides encoded therefrom as well as to uses and methods for treating neurological disorders/diseases employing a functional voltage-gated chloride channel CIC-2. Furthermore, the present invention also relates to methods for identifying molecules which are capable of specifically interacting with or altering the characteristics of the polypeptides of the invention as well as to methods for the production of pharmaceutical compositions.
  • Epilepsy is a condition that has many forms and causes, but always features recurring seizures.
  • An epileptic seizure is a convulsion or transient abnormal event experienced by the subject due to a paroxysmal discharge of cerebral neurones.
  • Epilepsy by definition, is the continuing tendency to have such seizures, even if a long interval separates attacks.
  • a generalized convulsion or grand mal fit is the commonest recognized event.
  • epilepsy is one of the most frequent neurological diseases affecting about 3% of the population worldwide (Hauser (1996), Mayo Clin. Proc. 71 , 576- 586). Some of 3% of the population have two or more seizures during their lives. Around one-quarter of a million people in England take anticonvulsants. In Asia the prevalence is similar to that in Western countries; the condition is said to be over twice as common in Africa.
  • Idiopathic forms are genetically determined and account for about 40% of all epilepsies (Greenberg (1992), Neurology 42, 56-62; Berkovic (1998), Ann. Neurol. 43, 435-445). They are defined by recurrent seizures with characteristic clinical and electroencephalographic features in the absence of any detectable brain lesion.
  • the most frequent idiopathic form of epilepsy is idiopathic generalized epilepsy (IGE).
  • IGE comprises seven clinically delineated syndromes with age-related onset (Commission on Classification and Terminology of the International League against Epilepsy (1989), Epilepsia 30, 389-399).
  • the most common IGE subtypes are childhood and juvenile absence epilepsy (CAE, JAE), juvenile myoclonic epilepsy (JME) and epilepsy with grand mal seizures on awakening (EGMA) (Commission on Classification and Terminology of the International League against Epilepsy, 1989, loc. cit.).
  • Absence seizures are the leading symptom of CAE and JAE. They are characterized by a brief loss of consciousness (usually 10-20 s) and either manifest during childhood (CAE) or adolescence (JAE).
  • JME manifests in adolescence with bilateral myoclonic jerks of arms and shoulders (myoclonic seizures) usually occurring in the early morning without a loss of consciousness.
  • All types of IGE can be associated with generalized tonic-clonic seizures which typically occur on awakening, often provoked by sleep deprivation. When this is the only seizure type, patients are diagnosed with EGMA.
  • typical electroencephalographic features are generalized spike-wave (GSW-EEG) or poly-spike-wave (PSW-EEG) discharges reflecting a state of synchronized neuronal hyperexcitability.
  • GSW-EEG generalized spike-wave
  • PSW-EEG poly-spike-wave
  • ADNFLE Autosomal dominant nocturnal frontal lobe epilepsy
  • CHRNA4, CHRNB2 neuronal nicotinic acetylcholine receptors
  • KCNQ2, KCNQ3 Two voltage-gated potassium channel genes
  • BFNC benign familial neonatal convulsions
  • SCN1 B, SCN1A, SCN2A Three different sodium channel subunits
  • CIC-2 is strongly expressed in brain, in particular in ⁇ -aminobutyric acid (GABA)-inhibited neurons (Smith (1995), J. Neurosci. 15, 4057- 4067; Sik (2000), Neuroscience 101 , 51-65).
  • GABA ⁇ -aminobutyric acid
  • hippocampal pyramidal neurons the best studied model for GABA-ergic synaptic inhibition in the brain (Misgeld (1986), Science 232, 1413-1415; Thompson (1989a), J. Neurophysiol. 61 , 501-511, Thompson (1989b), J. Neurophysiol.
  • 61, 512-523) - are loaded with chloride and when K-CI cotransport is simultaneously blocked by furosemide, a low [Cl " ]j is readjusted by activation of a chloride conductance with the physiological and pharmacological properties of CIC-2 (Staley (1994), J. Neurophysiol. 72, 273-284).
  • CIC-2 is correlated with the existence of a low [Cl " ]j and a hyperpolarizing GABA-ergic response.
  • CA1 and CA3 pyramidal neurons which exhibit a hyperpolarizing inhibitory postsynaptic potential in response to activation of GABAA receptors, express high levels of CIC-2.
  • CIC-2 mRNA is upregulated postnatally in the rat hippocampus in parallel with the developmental switch of the GABA response from excitatory to inhibitory (Mladinic (1999), Proc. R. Soc. Lond. B Biol. Sci. 266, 1207-1213).
  • a passive transport mechanism such as a channel-mediated chloride flux is, however, by itself unable to account for the large transmembrane chloride gradient of many neurons.
  • Primary or secondary active processes are necessary to generate an Eci more negative than the resting membrane potential.
  • an outwardly directed coupled transport of K + and CI " by the neuron-specific KCC2 transporter plays a key role in generating the low [Cl " ]j which is essential for GABA- ergic synaptic inhibition (Misgeld (1986), loc. cit.; Thompson (1989b), loc. cit.; Rivera (1999), Nature 397, 251-255; H ⁇ bner (2001), Neuron 30, 515-524; Woo (2002), Hippocampus 12, 258-268).
  • K-CI cotransport by KCC2 is driven by the transmembrane K + gradient and causes CI " extrusion near the resting potential (Misgeld (1986), loc. cit.; Thompson (1989b), loc. cit.).
  • increases of [K + ] 0 affect the rate and the direction of this transport, i.e. at a low [Cl " ]i and a high [K + ] 0 KCC2 may operate in reverse and accumulate internal chloride (Thompson (1989b), loc. cit.; Payne (1997), Am. J. Physiol. 273, C1516-1525; DeFazio (2000), J. Neurosci. 20, 8069-8076).
  • cortical neurones The spread of electrical activity between cortical neurones is normally restricted. Synchronous discharge of neurones in normal brain takes place in small groups only; these limited discharges are responsible for the normal rhythms of the electro encephalo gram (EEG). During a seizure, large groups of neurones are activated repetitively and "hypersynchronously". There is a failure of inhibitory synaptic contact between neurones. This causes high-voltage spike-and-wave activity on the EEG. Epileptic activity confined to one area of the cortex is associated with specific symptoms and signs (partial seizures). This activity may remain focal or may spread to cause paroxysmal activity in both hemispheres and a generalized convulsion.
  • This spread is called secondary generalization of a partial seizure.
  • the main treatment options for people with epilepsy are medications, surgery, vagus nerve stimulation and a ketogenic diet. It is important to know that the same treatment does not work for every patient because the severity of epilepsy varies from patient to patient. Some patients will manage their epilepsy very well with medication while others will be better served by having surgery or using vagus nerve stimulation.
  • a few medications are currently approved for the treatment of epilepsy. Each of these medications has a unique list of benefits and side effects, and different medications are appropriate for different types of epilepsy. No one medication is proven to be the best treatment for epilepsy. Only a complete evaluation can determine what medication will work best for each individual patient.
  • Patients who have partial seizures that originate in one part of the brain may be candidates for a type of surgery in which that part of the brain is removed. This type of surgery is done only if it does not jeopardize normal function, and the part of the brain from which the seizure originates can be precisely pinpointed.
  • VNS Vagus nerve stimulation
  • the ketogenic diet has been used at some clinics. It is primarily used in childhood epilepsy. The mechanism by which the ketogenic diet works is unknown. The high fat, low-protein, no carbohydrate diet mimics some effects of starvation that seem to inhibit seizures. The diet is very rigid and carefully controlled, and must be supervised by a physician - sometimes in a hospital setting. Ketogenic diets have been used for epileptic children for many years with a success rate of approximately 50 percent. Close collaboration with an experienced dietitian knowledgeable in the implementation of the ketogenic diet, and dedication of the patient and his or her family is essential in order for this form of treatment to work.
  • CLCN2 encodes the voltage-gated chloride channel CIC-2 which is expressed in the brain, in particular in inhibitory neurons where it prevents chloride accumulation and ensures an inhibitory response to GABA.
  • the human CLCN2 gene has been cloned and mapped to chromosome 3q26 (Cid (1995), loc. cit.), however, the gene has never been regarded as a potential candidate for epilepsy.
  • a targeted disruption of CLCN2 in a mouse does not exhibit neuronal hyperexcitability or lead to seizures (B ⁇ sl (2001), EMBO J. 20, 1289-1299) suggesting a species-specific difference in the (patho-) physiological role of this channel.
  • Mouse models often differ from human diseases.
  • transgenic mice with either a knock-out or knock-in of the gene CHRNA4 expected to be an animal model for the human disease of autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) (Berkovic (2001), loc. cit.) were not reported to develop seizures (Ross (2000), J. Neurosci. 20, 6431-6441 ; Labarca (2001), Proc. Natl. Acad. Sci. U. S. A. 98, 2786-2791).
  • Compensatory mechanisms that are distinct in humans and mice as well as characteristic anatomical and physiological properties may account for these phenotypical differences.
  • Idiopathic generalized epilepsy is an inherited neurological disorder affecting about 1 % of the world's population. So far, only several genes encoding neuronal ion channels have been identified in monogenic subtypes of idiopathic epilepsy (Steinlein (2000), loc. cit.; Berkovic (2001), loc. cit.; Lerche (2001), loc. cit.). However, no single epilepsy gene whose mutations can cause the whole spectrum of common idiopathic generalized epilepsy (IGE) subtypes has been identified until to date.
  • IGE idiopathic generalized epilepsy
  • the technical problem underlying the present invention is to provide means and methods for diagnosis and treating idiopathic generalized epilepsy (IGE).
  • IGE idiopathic generalized epilepsy
  • the present invention relates to a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of:
  • a genomic nucleotide sequence encoding a voltage-gated chloride channel CIC-2 and which contains a mutation in intron 2 which leads to an aberrant splicing of the mRNA transcribed by said genomic nucleotide sequence resulting in a fusion of exons 2 and 4 thereby leading to the production of an mRNA lacking exon 3;
  • nucleic acid sequence encoding a polypeptide which has an amino acid sequence of a voltage-gated chloride channel CIC-2, wherein the wild-type translational reading frame of the voltage-gated chloride channel CIC-2 is altered due to an insertion between the nucleotides corresponding to position 596 and position 597 of the corresponding wild-type nucleotide sequence as depicted in SEQ ID NO: 1;
  • a nucleotide sequence which hybridizes to a nucleotide sequence defined in (a) or to the nucleotide sequence depicted in SEQ ID NO: 3 and which encodes a voltage-gated chloride channel CIC-2, in which the glycine (Gly) residue corresponding to position 715 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2 is replaced by another amino acid residue;
  • (h) a nucleotide sequence which hybridizes to a nucleotide sequence defined in (b) or to the nucleotide sequence depicted in SEQ ID NO: 5 and which encodes a voltage-gated chloride channel CIC-2, wherein amino acids corresponding to positions 74 to 117 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2 are deleted;
  • nucleic acid sequence which hybridizes to a nucleotide sequence defined in (d) or to the nucleotide sequence depicted in SEQ ID NO: 7 and which encodes a voltage-gated chloride channel CIC-2, wherein the wild-type translational reading frame of the voltage-gated chloride channel CIC-2 is altered due to an insertion between the nucleotides corresponding to position 596 and position 597 of the corresponding wild type nucleotide sequence as depicted in SEQ ID NO: 1; and (j) a nucleic acid sequence being degenerate as a result of the genetic code to the nucleic acid sequence as defined in any one of (g) to (i).
  • the three mutations described herein above are (i) a single amino acid substitution (G715E) caused by a point mutation in the respective wild-type codon, (ii) an atypical splicing (del74-117) caused by the deletion of an 11-bp fragment within the intron between exons 2 and 3, wherein said deleted 11-bp fragment is located in close proximity to a splice acceptor site and, thus, leads to aberrant splicing leading to skipping of exon 3 which results in an in-frame deletion of 44 amino acids corresponding to amino acids 74 to 117 of SEQ ID NO:2 , and (iii) a premature stop codon (M200fsX231) resulting from the insertion of a nucleotide residue between position 596 and 597 of the corresponding wild-type nucleotide sequence.
  • M200fsX231 and del74-117 cause a loss-of-function of CIC-2 channels, and are expected to decrease the transmembrane chloride gradient essential for GABA-ergic inhibition. Moreover, as demonstrated in the Examples herein below M200fsX231 and del74-117 are dominant-negative, i.e. they cause non-functionality of wild-type voltage-gated chloride channels when being co- expressed with said wild-type chloride channel.
  • G715E causes a gain-of-function of CIC-2 channels, i.e. said G715E mutation results in an alteration of voltage- dependent gating that can cause membrane depolarization and hyperexcitability.
  • nucleic acid sequence means the sequence of bases comprising purine- and pyrimidine bases which are comprised by nucleic acid molecules, whereby said bases represent the primary structure of a nucleic acid molecule.
  • Nucleic acid sequences include DNA, cDNA, genomic DNA, RNA, synthetic forms and mixed polymers, both sense and antisense strands, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • polypeptide means a peptide, a protein, or a polypeptide which encompasses amino acid chains of a given length, wherein the amino acid residues are linked by covalent peptide bonds.
  • peptidomimetics of such proteins/polypeptides wherein amino acid(s) and/or peptide bond(s) have been, replaced by functional analogs are also encompassed by the invention as well as other than the 20 gene-encoded amino acids, such as selenocysteine.
  • Peptides, oligopeptides and proteins may be termed polypeptides.
  • the terms polypeptide and protein are often used interchangeably herein.
  • polypeptide also refers to, and does not exclude, modifications of the polypeptide, e.g., glycosylation, acetylation, phosphorylation and the like. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • voltage-gated chloride channel CIC-2 in accordance with this invention, denotes a polypeptide which has the characteristics of a voltage-gated ion channel CIC-2. Such characteristics include structural and/or functional characteristics. Structural characteristics refer to certain structural features which allow to classify a polypeptide as being a CIC-2 protein. One such feature is the amino acid sequence.
  • a polypeptide is classified as a voltage-gated chloride channel CICI-2 if it shows a certain degree of sequence identity over its own length to the amino acid sequence of the human CIG-2 protein depicted in SEQ ID NO:2.
  • This degree of sequence identity is at least 40%, more preferably at least 50%, even more preferably 60%, at least 70%, at least 80% at least 90% or at least 95%. It is particularly preferred that the degree of sequence identity is at least 65%.
  • structural characteristics of CIC-2 proteins are 10 to 12 transmembrane domains which could be analysed by using the program TMPRED (Hofmann (1993), Biol. Chem. 347, 166) or TMHMM (Krogh (2001), J. Mol. Bio.
  • CIC-2 proteins dimerize and contain conserved domains designated "voltage_CLC” (PFAM Accession number: PF00654) and “CBS” (PFAM Accession number: PF00571), respectively, which can be identified by using the program PFAM (Bateman (2002), Nucl. Acids Res. 30, 276-280).
  • PFAM Accession number: PF00654 PFAM Accession number: PF00654
  • CBS PFAM Accession number: PF00571
  • CIC-2 is a chloride ion channel which allows chloride ions to pass from intracellular solution to extracellular solution, i.e. the efflux of chloride upon electrophysiological stimulation to establish and maintain a high transmembrane chloride gradient which is necessary for an inhibitory GABA response.
  • the voltage-gated chloride channel CIC-2 and forms naturally a dimer. Due to the coupling of channel activation to [Cl " ]j and the slow gating, they are closed under resting conditions as well as during action potentials or isolated excitatory postsynaptic potentials.
  • CIC-2 channels open only with long-lasting changes of the transmembrane CI " gradient when E C ⁇ becomes more positive than the membrane potential, for example when [CP]i is increased after intense GABA- ergic inhibition (Staley (1994), loc. cit.; Thompson (1989a), loc. cit.; Thompson (1989b), loc. cit.).
  • CIC-2 channels remain open and extrude chloride until Eci approaches the resting membrane potential.
  • CIC-2 chloride channels are voltage-dependent and after hyperpolarisation of the membrane they permit efflux of intracellular chloride ions. Additionally, CIC-2 chloride channels permit efflux of chloride ions independent of voltage if the intracellular concentration of chloride ions is physiologically too high.
  • CIC-2 channel proteins can be determined as mentioned, for example, in Jentsch (2002), Physiol Rev 82, 503-568.
  • the term "voltage-gated chloride channels CIC-2" comprises functional and non-functional forms of the voltage-gated chloride channels CIC-2.
  • a functional voltage-gated chloride channel CIC2 is understood to be a CIC-2 protein which has at least one of the above- mentioned functional characteristics which can be measured by methods known in the art and exemplified in the Examples herein.
  • a non-functional voltage-gated chloride channel CIC-2 is a protein which can be classified as a CIC-2 protein due to structural characteristics as described above but which has lost at least one, preferably all, functional characteristics of a CIC-2 protein as described above.
  • Non- functionality of the CIC-2 protein can, e.g., be determined by incubating erythrocytes having a CIC-2 protein in low osmotic solutions. Erythrocytes having a nonfunctional CIC-2 protein will display under these conditions a significant increase in swelling in comparison to erythrocytes expressing a functional CIC-2 protein, e.g., a wild-type CIC-2 protein, since it is assumed that the CIC-2 protein is involved in osmoregulation (Jentsch (2002), loc. cit). Thus, it is possible to determine the occurrence of a mutation in the voltage-gated chloride channel CIC-2 by measuring the chloride efflux of cells in low osmotic solutions. Cells harbouring a mutation in the CLCN2 gene encoding the CIC-2 protein show an altered chlorid efflux in comparison to cells harbouring a wild-type CIC-2 protein.
  • the three mutations described herein are characterized in that they have an amino acid replacement at a certain position, a deletion of a part of the amino acid sequence due to aberrant splicing or a nucleotide insertion at a certain position when compared to the corresponding wild-type human CIC-2 amino acid/nucleotide sequence as shown in SEQ ID NO:2/SEQ ID NO:1.
  • position used in accordance with the present invention means the position of either an amino acid within an amino acid sequence depicted herein or the position of a nucleotide within a nucleic acid sequence depicted herein.
  • SEQ ID NO:1 The position with respect to nucleotide sequences mentioned herein refer to the sequence shown in SEQ ID NO:1.
  • This sequence represents the open reading frame of the assembled exons of the human CLCN2 gene encoding CIC-2.
  • the corresponding genomic sequence including the introns is shown in SEQ ID NO:9. It is possible for the skilled person to identify the position in the genomic sequence corresponding to a position in SEQ ID NO:1 by aligning the sequences. Moreover, the exact locations of the exons and introns in SEQ ID NO:9 are described herein further below.
  • an amino acid residue corresponding to position X of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO:2 has the following meaning:
  • the amino acid residue in question would be located at position X in the sequence of SEQ ID NO:2 if the sequence in which said amino acid residue occurs is compared and aligned with the amino acid sequence of SEQ ID NO:2.
  • the amino acid sequence shown in SEQ ID NO:2 is the sequence of the human CIC-2 gene and is used as a reference sequence in the present invention.
  • a nucleotide residue corresponding to position Y of the wild- type nucleotide sequence as depicted in SEQ ID NO:1 means that a nucleotide residue in a CIC-2 encoding sequence would be located at position Y in SEQ ID NO:1 when the CIC-2 encoding sequence is compared and aligned with the sequence of SEQ ID NO:1.
  • Amino acid and nucleotide sequences of other CIC-2 voltage-gated chloride channels from other organisms are known, e.g. from Cid (1995, loc.cit.) or Thiemann (1992, loc.cit.) and can also be retrieved from electronic data bases, such as GenBank or GenEMBL.
  • BLAST2.0 which stands for Basic Local Alignment Search Tool (Altschul, Nucl. Acids Res. 25 (1997), 3389-3402; Altschul, J. Mol. Evol. 36 (1993), 290-300; Altschul, J. Mol. Biol.
  • BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying similar sequences.
  • the fundamental unit of BLAST algorithm output is the High-scoring Segment Pair (HSP).
  • HSP High-scoring Segment Pair
  • An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user.
  • the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
  • the parameter E establishes the statistically significant threshold for reporting database sequence matches.
  • E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.
  • the first mutant described in the present invention is a nucleic acid sequence which encodes a voltage-gated chloride channel CIC-2 where the glycine (Gly) corresponding to position 715 of the wild-type voltage-gated chloride channel CIC- 2 as depicted in SEQ ID NO:2 is replaced by another amin ⁇ acid residue.
  • This specific glycine residue lies within the intracellularly located C-terminus of the voltage-gated chloride channel CIC-2, and more particularly, it lies between T714 and S716 (as depicted in SEQ ID NO:2).
  • the nucleotide sequence of the wild-type voltage-gated chloride channel CIC-2 is well known in the art and, inter alia, shown in SEQ ID NO. 1 (see also GenBank accession numbers S77770 and NM004366 as well as Cid (1995), loc. cit.).
  • GGU, GGC, GGG, GGA code for glycine (Gly) Due to (a) point mutation(s) caused by, e.g., chemical and/or physical means or inaccuracy of the replication complex followed by a failure of the reparation machinery of a cell, a change of a single codon occur can be achieved.
  • point mutations are transitions, i.e. change of a purine or pyrimidine base for another purine or pyrimidine base, e.g.
  • adenine to guanine or thymidine to cytosine or transversions i.e. change of a purine or pyrimidine base for another pyrimide or purine base, e.g., adenine to thymidine or guanine to cytosine.
  • a point mutation can also be caused by insertion or deletion of one or more nucleotides.
  • the amino acid residue replacing the glycine at position 715 can in principle be any other amino acid residue, in particular a residue which naturally occurs in proteins. It can, e.g. be an aliphatic, aromatic, basic or acidic amino acid residue. Preferably it is an acidic amino acid residue, such as aspartate or glutamate.
  • the mutant described in the Examples a transition from guanine to adenine at position 2144 of the wild-type nucleotide sequence depicted in SEQ ID NO: 1 took place which results in a change of the wild-type codon "GGG” encoding glycine (Gly) to "GAG” encoding glutamate (Glu).
  • SEQ ID NO:3 nucleotide sequence
  • SEQ ID NO:4 amino acid sequence
  • the replacement at position 715 preferably leads to a mutant CIC-2 protein which causes, when expressed in cells, membrane depolarization and hyperexcitability. More preferably the mutant displays the properties as described in Example 10 herein. These properties can be determined as described in Example 5.
  • the second mutation of the CIC-2 polypeptide described herein is a deletion of 44 amino acids corresponding to positions 74 to 117 of the wild-type CIC-2 sequence as depicted in SEQ ID NO: 2.
  • the present invention also relates to nucleic acid sequences encoding a CIC-2 protein in which amino acids corresponding to positions 74 to 117 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2 are deleted. This means, according to the present invention, that a fragment encompassing amino acid positions 74 to 117 of the corresponding wild-type amino acid sequence depicted in SEQ ID NO: 2 is deleted which results in a shortened polypeptide.
  • SEQ ID NO: 6 An example for such a shortened polypeptide is depicted in SEQ ID NO: 6.
  • Said shortened polypeptide is encoded by SEQ ID NO: 5.
  • This type of second mutation as described herein preferably encodes a non-functional voltage-gated chloride channel CIC-2.
  • the deletion of a fragment encompassing amino acids 74 to 117 of the wild-type amino acid sequence depicted in SEQ ID NO: 2 is the result of an atypical splicing event during the maturation of the mRNA of the CLCN2 gene.
  • IVS2-14del11 Due to an 11- bp deletion in intron 2 (IVS2-14del11) in close proximity to the splice acceptor site of the wild-type nucleotide sequence depicted in SEQ ID NO: 9 atypical splicing takes place which leads to fusion of exons 2 and 4 of the wild-type mRNA, whereby exon 3 encoding amino acids 74 to 117 is skipped.
  • the resulting protein (del74-117) depicted in SEQ ID NO: 6 lacks amino acids 74 to 117 of the corresponding wild type amino acid sequence depicted in SEQ ID NO: 2 such that amino acid position 74 of the deleted polypeptide depicted in SEQ ID NO: 5 corresponds to amino acid position 118 of the wild-type amino acid sequence depicted in SEQ ID NO: 2.
  • the nucleic acid sequence of the invention encodes a CIC-2 polypeptide in which exactly amino acids corresponding to positions 74 to 117 of SEQ ID NO:2 are deleted.
  • mutants are comprised in which either more or less amino acids within the CIC-2 amino acid sequence set forth in SEQ ID NO: 2 may be deleted due to, for example, atypical splicing or deletion of nucleotides of the nucleic acid molecule encoding CIC-2 or wrong posttranslational processes, as long as the CIC-2 voltage-gated chloride channel is non-functional.
  • further amino acids preceding amino acid position 74 or amino acids succeeding amino acid position 117 may be deleted or that less amino acids are deleted.
  • At least one, more preferably at least two, even more preferably at least three and most preferably at least 5 amino acid residues are further deleted upstream from the position corresponding to amino acid residue 74 and/or downstream of the position corresponding to amino acid residue 117 of SEQ ID NO:2.
  • not more than 20, preferably not more than 15, even more preferably not more than 10 and most preferably not more than 7 amino acid residues are further deleted upstream of the position corresponding to amino acid residue 74 of SEQ ID NO:2 or downstream of the position corresponding to amino acid residue 117 of SEQ ID NO:2.
  • the present invention also provides a mutation in the gene encoding CIC-2 which is related to IGE and which is characterized in that it is a mutation which occurs in intron 2 of the genomic sequence encoding CIC-2 and leads to an aberrant splicing of the mRNA transcribed from said gene insofar as exons 2 and 4 are fused and exon 3 is skipped. Since exon 3 encodes amino acid residues corresponding to residues 74 to 117 of SEQ ID NO:2, the result is a shortened polypeptide lacking 44 amino acids compared to the wild-type CIC-2 protein.
  • the exon/intron structure of the gene encoding the CIC-2 protein is known to the person skilled in the art.
  • the genomic sequences of CIC-2 encoding genes of human, rat, mouse, guinea pig and rabbit are, e.g. published or available in - Cid (1995), loc. cit.; Chu (1996), Nucl. Acids Res. 24, 3453-3457); Hathaway (1999), direct submission to GenBank at NCBI/NIH; Cid (1998) direct submission to GenBank at NCBI/NIH; Furukawa (1995), FEBS Lett. 375, 56-62 - and available in databases under accession numbers NP004357, NP058833, AAD26466, AAD37113 and S68210.
  • the genomic sequence and exon/intron structure of the human gene encoding CIC-2 is, e.g., evident from data base entry NM004357 at the Human Genome Browser Gateway. There, exons are indicated in upper cases and introns are indicated in lower cases.
  • the genomic sequence of the human gene encoding CIC-2 is also evident from SEQ ID NO:9. The exons and introns are indicated. In particular, exons 2 and 3 and intron 2 are located at the following positions.
  • Table 1 Positions of exons and introns in the wild-type CLCN2 gene as shown in SEQ ID NO: 9
  • a mutation according to the invention which leads to a fusion of exons 2 and 4 of a CIC-2 encoding gene may, e.g., be a mutation which prevents interaction of the splice donor and splice acceptor sites necessary to fuse exons 2 and 3 but which does not prevent fusion of exons 2 and 4.
  • a mutation abolishes the function of the splice acceptor site necessary for the fusion of exons 2 and 3.
  • Even more preferably such a mutation is a sequence alteration in intron 2 close to or in the splice acceptor site. More preferably it is a deletion close to or overlapping the splice acceptor site.
  • a mutation in intron 2 of a CIC-2 encoding gene is the deletion of 11 bp corresponding to nucleotides 2653 to 2663 in SEQ ID NO:9.
  • intron 2 preferably leads to an ORF which, when expressed, leads to the synthesis of a non-functional CIC-2 protein.
  • a further mutation in a CIC-2 encoding polynucleotide found to be correlated with IGE is an insertion between nucleotides corresponding to positions 596 and 597 of the corresponding wild-type sequence shown in SEQ ID NO:1 which leads to a premature stop codon due to a shift in the wild-type translational reading frame.
  • wild-type translational reading frame when used in accordance with the present invention means that only this possibility out of three possibilities to read the nucleotide sequence of the CIC-2 gene beginning with a start codon (ATG) in a triplett pattern results in the amino acid sequence depicted in SEQ ID NO: 2. Accordingly, an alteration of the wild-type translational reading frame changes the reading frame and, thus, the amino acid sequence following the frame shift. These mutations are called frame-shift mutations.
  • the insertion between the nucleotides corresponding to position 596 and 597 of SEQ ID NO: 1 results in a frameshift which has the effect that the nucleotide triplet corresponding to nucleotides 690 to 692 of SEQ ID NO:1 , which constitutes a stop codon, lies in frame, thereby leading to a premature termination of translation.
  • Such an insertion may be an insertion of 1 nucleotide or of (1 + 3 x X) nucleotides with X being an integer >1.
  • the insertion is only one nucleotide so that position 597 of the wild-type nucleotide sequence depicted in SEQ ID NO:1 is then residue 598 in a correspondingly mutated sequence.
  • the inserted nucleotide(s) may be any type of nucleotide, e.g. adenine, guanine, cytidine or thymidine, or analogs or derivatives thereof which can be incorporated into nucleic acid molecules.
  • the nucleotide is preferably a guanine.
  • the nucleotide sequence of an example of such a mutation is set forth in SEQ ID NO:7. This mutation is designated M200fsX231.
  • the insertion of a nucleotide residue between positions 596 and 597 of the wild-type nucleotide sequence depicted in SEQ ID NO: 1 leads to a +1 frame shift mutation.
  • Said mutation results due to the generation a premature stop codon present in the +1 reading frame in comparison to the wild-type amino acid sequence depicted in SEQ ID NO: 2 in a shortened polypeptide depicted in SEQ ID NO: 8.
  • Said shortened polypeptide is non-functional due to the generation of a premature stop codon in the +1 reading frame.
  • the insertion may alternatively also be an insertion of 2 nucleotides or of (2 + 3 x X) nucleotides with X being an integer >1.
  • X is an integer >1.
  • Such a mutation also leads to a premature termination and, thus, a shorter polypeptide due to the fact that the nucleotide triplet at positions 1022 to 1024 of SEQ ID NO:1 , which constitutes a stop codon, comes into frame.
  • the insertion as described herein-above preferably leads to a mutation in the CIC-2 encoding sequence which, when expressed, leads to the synthesis of a nonfunctional CIC-2 protein.
  • the present invention also relates to nucleic acid molecules which hybridize to one of the above described nucleic acid molecules and which encode a CIC-2 protein with one of the above described mutations.
  • hybridizes as used in accordance with the present invention may relate to hybridizations under stringent or non-stringent conditions. If not further specified, the conditions are preferably non-stringent. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, Russell “Molecular Cloning, A Laboratory Manual”, Cold Spring Harbor Laboratory, N.Y. (2001); Ausubel, “Current Protocols in Molecular Biology”, Green Publishing Associates and Wiley Interscience, N.Y. (1989), or Higgins and Hames (Eds) "Nucleic acid hybridization, a practical approach” , IRL Press Oxford, Washington DC, (1985). The setting of conditions is well within the skill of the artisan and can be determined according to protocols described in the art.
  • Non- stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may be set at 6xSSC, 1% SDS at 65°C.
  • the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hydridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • Hybridizing nucleic acid molecules also comprise fragments of the above described molecules. Such fragments may represent nucleic acid sequences which code for a non-functional voltage-gated chloride channel CIC-2 or a nonfunctional fragment thereof, and which have a length of at least 12 nucleotides, preferably at least 15, more preferably at least 18, more preferably of at least 21 nucleotides, more preferably at least 30 nucleotides, even more preferably at least 40 nucleotides and most preferably at least 60 nucleotides.
  • nucleic acid molecules which hybridize with any of the aforementioned nucleic acid molecules also include complementary fragments, derivatives and allelic variants of these molecules.
  • Non-functional fragments of a voltage-gated chloride channel CIC- 2 may be comprised in a fusion and/or chimeric protein.
  • a hybridization complex refers to a complex between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration.
  • a hybridization complex may be formed in solution (e.g.
  • complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
  • sequence "A-G-T” binds to the complementary sequence "T-C-A”.
  • Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between single-stranded molecules.
  • hybridizing sequences preferably refers to sequences which display a sequence identity of at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, particularly preferred at least 80%, more particularly preferred at least 90%, even more particularly preferred at least 95% and most preferably at least 97% identity with a nucleic acid sequence as described above encoding a CIC-2 protein having a described mutation.
  • hybridizing sequences preferably refers to sequences encoding a CIC-2 protein having a sequence identity of at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, particularly preferred at least 80%, more particularly preferred at least 90%, even more particularly preferred at least 95% and most preferably at least 97% identity with an amino acid sequence of a CIC-2 mutant as described herein above.
  • the term "identical” or “percent identity” in the context of two or more nucleic acid or amino acid sequences refers to two or more sequences or subsequences that are the same, or that have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60% or 65% identity, preferably, 70-95% identity, more preferably at least 95% identity), when compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or by manual alignment and visual inspection. Sequences having, for example, 60% to 95% or greater sequence identity are considered to be substantially identical. Such a definition also applies to the complement of a test sequence.
  • the described identity exists over a region that is at least about 15 to 25 amino acids or nucleotides in length, more preferably, over a region that is about 50 to 100 amino acids or nucleotides in length.
  • Those having skill in the art will know how to determine percent identity between/among sequences using, for example, algorithms such as those based on CLUSTALW computer program (Thompson (1994), Nucl. Acids Res. 2, 4673-4680) or FASTDB (Brutlag (1990), Comp. App. Biosci. 6, 237-245), as known in the art.
  • the BLASTP program uses as defaults a wordlength (W) of 3, and an expectation (E) of 10.
  • W wordlength
  • E expectation
  • the present invention also relates to nucleic acid molecules the sequence of which is degenerate in comparison with the sequence of an above-described hybridzing molecule.
  • the term "being degenerate as a result of the genetic code” means that due to the redundancy of the genetic code different nucleotide sequences code for the same amino acid.
  • the nucleic acid molecules according to the invention may be derived from any organism encoding corresponding CIC-2 voltage-gated chloride channels.
  • CIC-2 voltage-gated chloride channels have been reported in various organisms, like in rabbit or guinea pig (see, inter alia, Lam, Nature 396 (1998), 125- 126; Chiu, Molecular Biology and Evolution 16 (1999), 826-838).
  • the nucleic acid molecule of the invention is derived from a vertebrate, preferably from a mammal, even more preferably the nucleic acid molecule is derived from rabbit or guinea pig, and most preferably the nucleic acid is derived from mouse, rat or human.
  • the nucleic acid molecule according to the invention may be any type of nucleic acid, e.g. DNA, RNA or PNA (peptide nucleic acid).
  • the DNA may, for example, be cDNA. In a preferred embodiment it is a genomic DNA.
  • the RNA may be, e.g., mRNA.
  • the nucleic acid molecule may be natural, synthetic or semisynthetic or it may be a derivative, such as peptide nucleic acid (Nielsen, Science 254 (1991), 1497-1500) or phosphorothioates.
  • the nucleic acid molecule may be a recombinantly produced chimeric nucleic acid molecule comprising any of the aforementioned nucleic acid molecules either alone or in combination.
  • the nucleic acid molecule of the present invention is part of a vector. Therefore, the present invention relates in another embodiment to a vector comprising the nucleic acid molecule of this invention.
  • a vector may be, e.g., a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering, and may comprise further genes such as marker genes which allow for the selection of said vector in a suitable host cell and under suitable conditions.
  • the nucleic acid molecules of the present invention may be inserted into several commercially available vectors.
  • Nonlimiting examples include plasmid vectors compatible with mammalian cells, such as pUC, pBluescript (Stratagene), pET (Novagen), pREP (Invitrogen), pCRTopo (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1 neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO- pSV2neo, pBPV-1 , pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pUCTag , plZD35, pLXIN and pSIR (Clontech) and plRES-EGFP (Clontech).
  • plasmid vectors compatible with mammalian cells such as
  • Baculovirus vectors such as pBlueBac, BacPacz Baculovirus Expression System (CLONTECH), and MaxBacTM Baculovirus Expression System, insect cells and protocols (Invitrogen) are available commercially and may also be used to produce high yields of biologically active protein, (see also, Miller (1993), Curr. Op. Genet. Dev., 3, 9; O'Reilly, Baculovirus Expression Vectors: A Laboratory Manual, p. 127).
  • prokaryotic vectors such as pcDNA2; and yeast vectors such as pYes2 are nonlimiting examples of other vectors suitable for use with the present invention.
  • Vectors can contain one or more replication and inheritance systems for cloning or expression, one or more markers for selection in the host, e. g. antibiotic resistance, and one or more expression cassettes.
  • the coding sequences inserted in the vector can be synthesized by standard methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements (e. g., promoters, enhancers, and/or insulators) and/or to other amino acid encoding sequences can be carried out using established methods.
  • transcriptional regulatory elements e. g., promoters, enhancers, and/or insulators
  • the vectors may, in addition to the nucleic acid sequences of the invention, comprise expression control elements, allowing proper expression of the coding regions in suitable hosts.
  • control elements are known to the artisan and may include a promoter, translation initiation codon, translation and insertion site or internal ribosomal entry sites (IRES) (Owens (2001), Proc Natl Acad Sci USA 98,1471-1476) for introducing an insert into the vector.
  • the nucleic acid molecule of the invention is operatively linked to said expression control sequences allowing expression in eukarvotic or prokaryotic cells. Particularly preferred are in this context control sequences which allow for correct expression in neuronal cells and/or cells derived from nervous tissue.
  • Control elements ensuring expression in eukaryotic and prokaryotic cells are well known to those skilled in the art. As mentioned above, they usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally-associated or heterologous promoter regions. Possible regulatory elements permitting expression in for example mammalian host cells comprise the CMV- HSV thymidine kinase promoter, SV40, RSV-promoter (Rous sarcome virus), human elongation factor 1 -promoter, CMV enhancer, CaM-kinase promoter or SV40-enhancer.
  • promoters for example, the tac-lac-promoter, the lacUV ⁇ or the trp promoter, has been described.
  • Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as SV40-poIy-A site or the tk-poly-A site, downstream of the polynucleotide.
  • suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc/CMV, pcDNAI , pcDNA3 (In- Vitrogene, as used, inter alia in the appended examples), pSPORTI (GIBCO BRL) or pGEMHE (Promega), or prokaryotic expression vectors, such as lambda gt11.
  • An expression vector according to this invention is at least capable of directing the replication, and preferably the expression, of the nucleic acids and protein of this invention.
  • Suitable origins of replication include, for example, the Col E1 , the SV40 viral and the M 13 origins of replication.
  • Suitable promoters include, for example, the cytomegalovirus (CMV) promoter, the lacZ promoter, the gal 10 promoter and the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) polyhedral promoter.
  • Suitable termination sequences include, for example, the bovine growth hormone, SV40, lacZ and AcMNPV polyhedral polyadenylation signals. Examples of selectable markers include neomycin, ampicillin, and hygromycin resistance and the like.
  • Specifically-designed vectors allow the shuttling of DNA between different host cells, such as bacteria-yeast, or bacteria-animal cells, or bacteria-fungal cells, or bacteria invertebrate cells.
  • the vector may further comprise nucleic acid sequences encoding for secretion signals.
  • nucleic acid sequences are well known to the person skilled in the art.
  • leader sequences capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the nucleic acid molecules of the invention and are well known in the art.
  • the leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a part thereof, into, inter alia, the extracellular membrane.
  • the heterologous sequence can encode a fusion protein including an C- or N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • the vector Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the proteins, antigenic fragments or fusion proteins of the invention may follow.
  • the vector can also comprise regulatory regions from pathogenic organisms.
  • said vector may also be, besides an expression vector, a gene transfer and/or gene targeting vector.
  • Gene therapy which is based on introducing therapeutic genes (for example for vaccination) into cells by ex-vivo or in-vivo techniques is one of the most important applications of gene transfer.
  • Suitable vectors, vector systems and methods for in-vitro or in-vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. 79 (1996), 911- 919; Anderson, Science 256 (1992), 808-813, Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res.
  • nucleic acid molecules of the invention and vectors as described herein above may be designed for direct introduction or for introduction via liposomes, or viral vectors (e.g. adenoviral, retroviral) into the cell.
  • viral vectors e.g. adenoviral, retroviral
  • baculoviral systems or systems based on vaccinia virus or Semliki Forest Virus can be used as eukaryotic expression system for the nucleic acid molecules of the invention.
  • fragments of the protein, the fusion protein or antigenic fragments of the invention may be produced by direct peptide synthesis using solid- phase techniques (cf Stewart et al. (1969) Solid Phase Peptide Synthesis, WH Freeman Co, San Francisco; Merrifield, J. Am. Chem. Soc.
  • In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer, Foster City CA) in accordance with the instructions provided by the manufacturer. Various fragments may be chemically synthesized separately and combined using chemical methods to produce the full length molecule.
  • the present invention in addition relates to a host transformed with a vector of the present invention or to a host comprising the nucleic acid molecule of the invention.
  • Said host may be produced by introducing said vector or nucleotide sequence into a host cell which upon its presence in the cell mediates the expression of a protein encoded by the nucleotide sequence of the invention or comprising a nucleotide sequence or a vector according to the invention wherein the nucleotide sequence and/or the encoded polypeptide is foreign to the host cell.
  • nucleotide sequence and/or the encoded polypeptide is either heterologous with respect to the host, this means derived from a cell or organism with a different genomic background, or is homologous with respect to the host but located in a different genomic environment than the naturally occurring counterpart of said nucleotide sequence. This means that, if the nucleotide sequence is homologous with respect to the host, it is not located in its natural location in the genome of said host, in particular it is surrounded by different genes. In this case the nucleotide sequence may be either under the control of its own promoter or under the control of a heterologous promoter.
  • the location of the introduced nucleic acid molecule or the vector can be determined by the skilled person by using methods well-known to the person skilled in the art, e.g., Southern Blotting.
  • the vector or nucleotide sequence according to the invention which is present in the host may either be integrated into the genome of the host or it may be maintained in some form extrachromosomally. In this respect, it is also to be understood that the nucleotide sequence of the invention can be used to restore or create a mutant gene via homologous recombination.
  • Said host may be any prokaryotic or eukaryotic cell. Suitable prokaryotic/bacterial cells are those generally used for cloning like E. coli, Salmonella typhimurium, Serratia marcescens or Bacillus subtilis. Said eukaryotic host may be a mammalian cell, an amphibian cell, a fish cell, an insect cell, a fungal cell, a plant cell or a bacterial cell (e.g., E coli strains HB101, DH5a, XL1 Blue, Y1090 and JM101), Eukaryotic recombinant host cells are preferred.
  • eukaryotic host cells include, but are not limited to, yeast, e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis or Pichia pastoris cells, cell lines of human, bovine, porcine, monkey, and rodent origin, as well as insect cells, including but not limited to, Spodoptera frugiperda insect cells and Drosophila- derived insect cells as well as zebra fish cells.
  • yeast e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis or Pichia pastoris cells
  • insect cells including but not limited to, Spodoptera frugiperda insect cells and Drosophila- derived insect cells as well as zebra fish cells.
  • Mammalian species-derived cell lines suitable for use and commercially available include, but are not limited to, L cells, CV-1 cells, COS-1 cells (ATCC CRL 1650), COS-7 cells (ATCC CRL 1651), HeLa cells (ATCC CCL 2), C1271 (ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and MRC- 5 (ATCC CCL 171).
  • said mammalian cell is a neuronal cell and/or a cultured cell like, inter alia, a HEK 293 (human embryonic kidney) cell, a CHO, HeLa, NIH3T3, BHK, PC12 cell or a neuronal stem cell preferably derived from a mammal and more preferably from a human.
  • a HEK 293 human embryonic kidney
  • a CHO, HeLa, NIH3T3, BHK, PC12 cell or a neuronal stem cell preferably derived from a mammal and more preferably from a human.
  • said amphibian cell is an oocyte.
  • said oocyte is a frog oocyte, particularly preferred a Xenopus laevis oocyte.
  • the host according to the invention is a non- human transgenic organism.
  • Said non-human organism may be a mammal, amphibian, a fish, an insect, a fungus or a plant.
  • Particularly preferred non-human transgenic animals are Drosophila species, Caenorhabditis elegans, Xenopus species, zebra fish, Spodoptera frugiperda, Autographa califomica, mice and rats.
  • Transgenic plants comprise, but are not limited to, wheat, tobacco, parsley and Arabidopsis.
  • Transgenic fungi are also well known in the art and comprise, inter alia, yeasts, like S. pombe or S. cerevisae, or Aspergillus, Neurospora or Ustilago species.
  • the present invention relates to a method for producing the polypeptide encoded by a nucleic acid molecule of the invention comprising culturing/raising the host of the invention and isolating the produced polypeptide.
  • the host is a unicellular organism or a mammalian or insect cell, the person skilled in the art can revert to a variety of culture conditions that can be further optimized without an undue burden of work.
  • the produced protein is harvested from the culture medium or from isolated (biological) membranes by established techniques.
  • the produced polypeptide may be directly isolated from the host cell.
  • Said host cell may be part of or derived from a part of a host organism, for example said host cell may be part of the CNS of an animal or the harvestable part of a plant.
  • the produced polypeptide may be isolated from fluids derived from said host, like blood, milk or cerebrospinal fluid.
  • the present invention relates to a polypeptide that is encoded by a nucleic acid molecule of the invention or produced by the method of the invention.
  • the polypeptide of the invention may accordingly be produced by microbiological methods or by transgenic mammals. It is also envisaged that the polypeptide of the invention is recovered from transgenic plants. Alternatively, the polypeptide of the invention may be produced synthetically or semi-synthetically.
  • nucleotide acid sequences comprising all or a portion of any one of the nucleotide sequences according to the invention can be synthesized by PCR, inserted into an expression vector, and a host cell transformed with the expression vector. Thereafter, the host cell is cultured to produce the desired polypeptide, which is isolated and purified.
  • Protein isolation and purification can be achieved by any one of several known techniques; for example and without limitation, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high pressure liquid chromatography (HPLC), reversed phase HPLC, preparative disc gel electrophoresis.
  • cell-free translation systems can be used to produce the polypeptides of the present invention. Suitable cell-free expression systems for use in accordance with the present invention include rabbit reticulocyte lysate, wheat germ extract, canine pancreatic microsomal membranes, E. coli S30 extract, and coupled transcription/translation systems such as the TNT-system (Promega).
  • protein isolation/purification techniques may require modification of the proteins of the present invention using conventional methods. For example, a histidine tag can be added to the protein to allow purification on a nickel column. Other modifications may cause higher or lower activity, permit higher levels of protein production, or simplify purification of the protein.
  • the present invention relates to an antibody specifically directed to a polypeptide of the invention, wherein said antibody specifically reacts with an epitope generated and/or formed by the mutation in the voltage-gated chloride channel CIC-2 selected from the group consisting of:
  • the term “specifically” in this context means that the antibody reacts with the mutant CIC-2 protein but not with a wild-type CIC-2 protein. Preferably this term also means that such an antibody does not bind to other mutant forms of the CIC-2 protein, in particular those described herein. Whether the antibody specifically reacts as defined herein above can easily be tested, inter alia, by comparing the reaction of said antibody with a wild-type voltage-gated chloride channel CIC-2 (or a subunit or a fragment thereof) with the reaction of said antibody with a mutant CIC-2 polypeptide of the invention.
  • the antibody of the present invention can be, for example, polyclonal or monoclonal.
  • the term "antibody” also comprises derivatives or fragments thereof which still retain the binding specificity. Techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane “Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. These antibodies can be used, for example, for the immunoprecipitation and immunolocalization of the polypeptides of the invention as well as for the monitoring of the presence of such polypeptides, for example, in recombinant organisms or in diagnosis. They can also be used for the identification of compounds interacting with the proteins according to the invention (as mentioned herein below).
  • surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies which bind to an epitope of the polypeptide of the invention (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1995), 7-13).
  • the present invention furthermore includes chimeric, single chain and humanized antibodies, as well as antibody fragments, like, inter alia, Fab fragments.
  • Antibody fragments or derivatives further comprise F(ab') 2 , Fv or scFv fragments; see, for example, Harlow and Lane, loc. cit..
  • F(ab') 2 , Fv or scFv fragments see, for example, Harlow and Lane, loc. cit.
  • the (antibody) derivatives can be produced by peptidomimetics.
  • techniques described for the production of single chain antibodies see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies to polypeptide(s) of this invention.
  • transgenic animals may be used to express humanized antibodies to polypeptides of this invention.
  • the antibody of this invention is a monoclonal antibody.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples for such techniques include the hybridoma technique (K ⁇ hler and Milstein (1975), Nature 256, 495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor, Immunology Today 4 (1983), 72) and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985), 77-96). Techniques describing the production of single chain antibodies (e.g., U.S.
  • Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptides as described above.
  • transgenic mice may be used to express humanized antibodies directed against said immunogenic polypeptides.
  • gene therapy approaches are envisaged. Accordingly, in context of the present invention, the term "antibody molecule” relates to full immunoglobulin molecules as well as to parts of such immunoglobulin molecules.
  • antibody molecule also comprises bifunctional antibodies and antibody constructs, like single chain Fvs (scFv) or antibody-fusion proteins. It is also envisaged in context of this invention that the term “antibody” comprises antibody constructs which may be expressed in cells, e.g.
  • antibody constructs which may be transfected and/or transduced via, inter alia, viruses or vectors. It is in particular envisaged that such antibody constructs specifically recognize the polypeptides of the present invention. It is, furthermore, envisaged that said antibody construct is employed in gene therapy approaches.
  • the present invention relates also to an aptamer specifically binding to a polypeptide according to the invention wherein said aptamer reacts with an epitope of a polypeptide of the present invention as well as to an aptamer specifically directed to a corresponding nucleic acid molecule according to the invention.
  • aptamer means nucleic acid molecules that can bind to target molecules. Aptamers commonly comprise RNA, single stranded DNA, modified RNA or modified DNA molecules. The preparation of aptamers is well known in the art and may involve, inter alia, the use of combinatorial RNA libraries to identify binding sides (Gold, Ann. Rev. Biochem 64 (1995), 763-797).
  • the present invention relates to a primer or pair of primers capable of specifically amplifying the nucleic acid molecules of the present invention.
  • primer when used in the present invention means a single-stranded nucleic acid molecule capable of annealing the nucleic acid molecule of the present application and thereby being capable of serving as a starting point for amplification.
  • Said term also comprises oligoribo- or desoxyribonucleotides which are complementary to a region of one of the strands of a nucleic acid molecule of the present invention.
  • primers means a pair of primers that are with respect to a complementary region of a nucleic acid molecule directed in the opposite direction towards each other to enable, for example, amplification by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • amplifying refers to repeated copying of a specified sequence of nucleotides resulting in an increase in the amount of said specified sequence of nucleotides.
  • a primer according to the invention is preferably a primer which binds to a region of a nucleic acid molecule of the invention which is unique for this molecule and which is not present in the wild-type CIC-2 encoding sequence, i.e. the primer binds in a region in which one of the above described mutations occur.
  • primers of the pair In connection with a pair of primers according to the invention it is possible that one of the primers of the pair is specific in the above described meaning or both of the primers of the pair are specific. In both cases, the use of such a pair of primers would allow to specifically amplify a mutant of the invention as described herein-above but not the wild-type CIC-2 encoding sequence.
  • the 3'-OH end of a primer is used by a polymerase to be extended by successive incorporation of nucleotides.
  • the primer or pair of primers of the present invention can be used, for example, in primer extension experiments on template RNA according to methods known by the person skilled in the art.
  • the primer or pair of primers of the present invention are used for amplification reactions on template RNA or template DNA, preferably cDNA or genomic DNA.
  • template DNA or template RNA
  • template RNA refers to DNA or RNA molecules or fragments thereof of any source or nucleotide composition, that comprise a target nucleotide sequence as defined above.
  • the primer or pair of primers can also be used for hybridization experiments as known in the art.
  • the primer or pair of primers are used in polymerase chain reactions to amplify sequences corresponding to a sequence of the nucleic acid molecule of the present invention.
  • the length of a primer results from different parameters (Gillam (1979), Gene 8, 81-97; Innis (1990), PCR Protocols: A guide to methods and applications, Academic Press, San Diego, USA).
  • the primer should only hybridize or bind to a specific region of a target nucleotide sequence.
  • the length of a primer that statistically hybridizes only to one region of a target nucleotide sequence can be calculated by the following formula: (%) x (whereby x is the length of the primer). For example a hepta- or octanucleotide would be sufficient to bind statistically only once on a sequence of 37 kb.
  • the primers of the invention are at least 10 nucleotides in length, more preferred at least 12 nucleotides in length, even more preferred at least 15 nucleotides in length, particularly preferred at least 18 nucleotides in length, even more particularly preferred at least 20 nucleotides in length and most preferably at least 25 nucleotides in length.
  • the invention can also be carried out with primers which are shorter or longer.
  • the primer or pair of primers is labeled.
  • the label may, for example, be a radioactive label, such as 32 P, 33 P or 35 S.
  • the label is a non-radioactive label, for example, digoxigenin, biotin and fluorescence dye or a dye.
  • said primers are selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21
  • the present invention relates to a composition comprising a nucleic acid molecule, a vector, a polypeptide, an antibody, an aptamer and/or a primer or pair of primers of the invention.
  • composition comprises at least one nucleic acid molecule, vector, polypeptide, an antibody and/or primer or pair of primers of this invention. It may, optionally, further molecules capable of altering the characteristics of the polypeptides of the invention or specifically interacting with the polypeptides of the invention thereby, for example, suppressing, blocking, modulating and/or activating their function which have neuroprotective, nootropic and/or antiepileptic properties.
  • the composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a) solution(s) or (an) aerosol(s).
  • the composition according to the invention is a diagnostic composition, optionally further comprising suitable means for detection.
  • the present invention is based on the surprising finding that certain types of mutations in the CIC-2 protein are connected with IGE. Thus, the knowledge of these mutations now allows to diagnose IGE in an easy way.
  • the diagnostic composition comprises at least one of the aforementioned compounds of the invention.
  • the diagnostic composition may be used, inter alia, for methods for determining the presence and/or expression of the nucleic acids and/or polypeptides of the invention.
  • This may be effected by detecting, e.g., the presence of a corresponding gene in the genetic material of an individual or the presence of the corresponding mRNA which comprises isolation of DNA or RNA from a cell derived from said individual, contacting the DNA or RNA so obtained with a nucleic acid probe as described above under hybridizing conditions, and detecting the presence of .mRNAs hybridized to the probe.
  • the diagnostic composition may also be used for detecting the presence of a nucleic acid molecule of the invention by PCR.
  • polypeptides of the invention can be detected with methods known in the art, which comprise, inter alia, immunological methods, like, RIA, FIA, ELISA, FACS or Western blotting.
  • the diagnostic composition of the invention may be useful, inter alia, in detecting the prevalence, the onset or the progress of a disease related to the expression of a polypeptide of the invention. Accordingly, the diagnostic composition of the invention may be used, inter alia, for assessing the prevalence, the onset and/or the disease status of neurological, neurodegenerative and/or neuro- psychiatric disorders, as defined herein above. It is also contemplated that the diagnostic composition of the invention may be useful in discriminating (the) stage(s) of a disease.
  • the diagnostic composition optionally comprises suitable means for detection.
  • the nucleic acid molecule(s), vector(s), host(s), antibody(ies), aptamer(s), polypeptide(s) described above are, for example, suitable for use in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier.
  • examples of well- known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite.
  • the nature of the carrier can be either soluble or insoluble for the purposes of the invention.
  • Solid phase carriers are known to those in the art and may comprise polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, membranes, sheets, duracytes and the walls of wells of a reaction tray, plastic tubes or other test tubes.
  • Suitable methods of immobilizing nucleic acid molecule(s), vector(s), host(s), antibody(ies), aptamer(s), polypeptide(s), etc. on solid phases include but are not limited to ionic, hydrophobic, covalent interactions or (chemical) crosslinking and the like.
  • immunoassays which can utilize said compounds of the invention are competitive and non-competitive immunoassays in either a direct or indirect format.
  • Commonly used detection assays can comprise radioisotopic or non-radioisotopic methods.
  • immunoassays are the radioimmunoassay (RIA), the sandwich (immunometric assay) and the Northern or Southern blot assay.
  • these detection methods comprise, inter alia, IRMA (Immune Radioimmunometric Assay), EIA (Enzyme Immuno Assay), ELISA (Enzyme Linked Immuno Assay), FIA (Fluorescent Immuno Assay), and CLIA (Chemioluminescent Immune Assay).
  • the diagnostic compounds of the present invention may be are employed in techniques like FRET (Fluorescence Resonance Energy Transfer) assays.
  • labels and methods for labeling are known to those of ordinary skill in the art.
  • Examples of the types of labels which can be used in the present invention include inter alia, fluorochromes (like fluorescein, rhodamine, Texas Red, etc.), enzymes (like horse radish peroxidase, ⁇ -galactosidase, alkaline phosphatase), radioactive isotopes (like 32 P, 33 P, 35 S or 125 l), biotin, digoxygenin, colloidal metals, chemi- or bioluminescent compounds (like dioxetanes, luminol or acridiniums).
  • fluorochromes like fluorescein, rhodamine, Texas Red, etc.
  • enzymes like horse radish peroxidase, ⁇ -galactosidase, alkaline phosphatase
  • radioactive isotopes like 32 P, 33 P, 35 S or 125 l
  • biotin dig
  • biomolecules A variety of techniques are available for labeling biomolecules, are well known to the person skilled in the art and are considered to be within the scope of the present invention and comprise, inter alia, covalent coupling of enzymes or biotinyl groups, phosphorylations, biotinylations, random priming, nick-translations, tailing (using terminal transferases).
  • Detection methods comprise, but are not limited to, autoradiography, fluorescence microscopy, direct and indirect enzymatic reactions, etc.
  • Said diagnostic composition may be used for methods for detecting the presence and/or abundance of a nucleic acid molecule of the invention in a biological and/or medical sample and/or for detecting expression of such a nucleic acid molecule (e.g. by determining the mRNA or the expressed polypeptide). Furthermore, said diagnostic composition may also be used in methods of the present invention, inter alia, for the detection of specific antagonists or agonists for CIC-2 voltage-gated chloride channels (see herein below).
  • the present invention relates to diagnostic composition designed for use in a method in which the occurrence of the mutation in the voltage- gated chloride channel CIC-2 gene is determined by PCR, immunological methods and/or electrophysiological methods as described herein below and in the Examples. Additionally, it is possible to determine the occurrence of a mutation in the voltage-gated chloride channel CIC-2 by measuring the chloride efflux of cells in low osmotic solutions. Cells harbouring a mutation in the CLCN2 gene encoding the CIC-2 protein show an altered chlorid efflux in comparison to cells harbouring a wild-type CIC-2 protein (Jentsch (2002), loc. cit.).
  • the present invention relates to the use of a nucleic acid molecule, a vector, a polypeptide, an antibody, aptamer and/or a primer or pair of primers of the present invention for the preparation of a diagnostic composition for the detection of a neurological disease/disorder.
  • the present invention relates to a method of diagnosing a neurological disease or a susceptibility to a neurological disease comprising the step of determining in a sample obtained from an individual whether the CIC-2 protein expressed in the cells of said individual is non-functional or shows an altered voltage-dependent gating in comparison to the wild-type CIC-2 protein.
  • “Nonfunctional” means that the CIC-2 protein has lost at least one functional property displayed by the wild-type CIC-2 protein as described herein above.
  • non-functional means that the CIC-2 protein does no longer function as a channel.
  • Non-functionality may, e.g., be caused by the fact that one allele occurring in an individual codes for a CIC-2 protein which leads to non-functional dimers (dominant negative mutation). Whether a CIC-2 protein in an individual is functional or nonfunctional can be determined as described herein above and in the examples.
  • the term "altered voltage-dependent gating" means that the respective CIC-2 protein reacts in a different way to voltage than the wild-type CIC-2 protein. This can be determined as described in the examples.
  • the CIC-2 protein showing an altered voltage-dependent gating shows properties which result in membrane depolarization and/or hyperexcitability. This can be determined as described in Example 5.
  • the present invention also relates to a method of diagnosing a neurological disease or susceptibility to a neurological disease comprising the step of determining in a sample obtained from an individual whether the voltage-gated chloride channel CIC- 2 protein or gene shows a mutation selected from the group consisting of: (a) a replacement of the glycine (Gly) residue corresponding to position 715 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2 by another residue;
  • a genomic nucleotide sequence encoding a voltage-gated chloride channel CIC-2 and which contains a mutation in intron 2 which leads to an aberrant splicing of the mRNA transcribed by said genomic nucleotide sequence resulting in a fusion of exons 2 and 4 thereby leading to the production of an mRNA lacking exon 3;
  • sample any biological sample obtained from an individual, cell line, tissue culture, or other source containing polynucleotides or polypeptides or portions thereof.
  • biological samples include body fluids (such as blood, sera, plasma, urine, synovial fluid and spinal fluid) and tissue sources found to express the polynucleotides of the present invention. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art.
  • a biological sample which includes genomic DNA, mRNA or proteins is preferred as a source.
  • mutations of the CIC-2 encoding gene CLCN2 can occur on DNA level or on mRNA level and result in CIC-2 voltage-gated chloride channels which show either an altered function or no function when compared to the wild-type CIC-2 voltage-gated chloride channel as described herein.
  • various methods on DNA level, RNA level or protein level exist for determining whether the voltage-gated chloride channel CIC-2 shows a mutation as described herein above. Consequently, mRNA, cDNA, DNA and genomic DNA are the preferred nucleic acid molecules to be used in the below mentioned methods.
  • polypeptides or fragments thereof are preferred if a mutation in the CIC-2 voltage- gated chloride channel as described herein is to be determined.
  • a point mutation leading to the replacement of the glycine (Gly) residue at position 715 of the corresponding wild-type CIC-2 amino acid sequence depicted in SEQ ID NO: 2 by another amino acid can be determined by PCR.
  • Said PCR is followed by a restriction fragment length polymorphism (RFLP) analysis if due to the point mutation a recognition site for a restriction endonuclease is generated which is not present in the wild-type nucleotide sequence or a recognition site for a restriction enzyme is created which does not occur in the wild-type CLCN2.
  • RFLP restriction fragment length polymorphism
  • a recognition site for a restriction endonuclease is lost due to a point mutation in the wild-type CLCN-2 nucleic acid sequence depicted in SEQ ID NO: 1. Accordingly, the primers depicted in SEQ ID NOs: 16 and 17, respectively are used to amplify a fragment comprising at least the nucleotide residues encoding the amino acid residue corresponding to position 715 of SEQ ID NO: 1.
  • the temperature for annealing the primers to the template nucleotide sequence is preferably at least 62°C for preferably 30 sec
  • the temperature for denaturation is preferably at least 95°C for preferably 30 sec
  • the temperature for extension of the annealed primers is preferably at least 72°C for preferably 60 sec.
  • the cycle of denaturation, annealing and extension is preferably carried out for at least 35 times. As is shown in the appended Example infra, the amplification results in a 222 bp fragment irrespective whether the point mutation is present or not.
  • Said 222 bp fragment is preferably subject to treatment with preferably the restriction endonuclease Ital which recognizes the nucleotide sequence GCNGC, wherein N is any nucleotide (G, A, T or C).
  • N is any nucleotide (G, A, T or C).
  • any restriction endonuclease which recognizes said sequence may be used.
  • the 222 bp fragment comprising the wild-type CLCN-2 nucleotide sequence is cleaved in a 117 bp, 88 bp and 17 bp fragment
  • the 222 bp fragment comprising at least the nucleotide residues encoding the amino acid residue corresponding to position 715 of SEQ ID NO: 1 is cleaved in 117 bp and 105 bp fragment.
  • gel electrophoresis on a 10% polyacrylamidegel is performed.
  • said mutation can be determined by PCR using primers and conditions that allow only an amplification of the wild-type nucleotide sequence encoding a glycine at position 715, but not of the nucleotide sequence of a nucleic acid molecule encoding a different amino acid residue at the corresponding position.
  • PCR is performed to determine a mutation using primers and conditions that allow no amplification if the wild-type nucleotide sequence encoding Gly 715 is present, but only if another amino acid residue is encoded at position 715.
  • Said PCR is followed by e.g., sequencing and/or single strand conformation analysis (SSCA).
  • Said fragment is preferably of at least 25 nucleotides in length, more preferred of at least 50 nucleotide in length, even more preferred of at least 75 nucleotides in length, particularly preferred of at least 100 nucleotides in length and more particularly preferred of at least 200 nucleotides in length and most preferred of at least 250 nucleotides in length.
  • Said primers are preferably of at least 12 nucleotides in length, more preferred of at least 15 nucleotides in length, even more preferred of at least 18 nucleotides in length and most preferred of at least 21 nucleotides in length as depicted in SEQ ID NO: 10 and SEQ ID NO: 11.
  • the temperature for annealing said primers is preferably at least 50°C, more preferred at least 55°C and most preferred at least 58°C.
  • the temperature for denaturation is preferably at least 95°C for preferably at least 10 sec, more preferably at least 20 sec, even more preferred at least 30 sec and most preferred at least 60 sec.
  • the temperature for denaturation may be shorter or longer.
  • the temperature for extension of the annealed primers is preferably at least 10 sec, more preferably at least 20 sec, even more preferred at least 30 sec and most preferred at least 60 sec.
  • a PCR reaction comprising the aforementioned conditions is exemplified in the Examples herein below.
  • the subsequent sequencing and/or SSCA is carried out as known in the art.
  • the PCR fragments are separated on a 10% polyacrylamide gel at 4°C or also preferred at room temperature.
  • PCR fragments showing a SSCA band shift are amplified with the primers under conditions as mentioned above and are subsequently sequenced.
  • a direct genomic sequencing approach is, for example, demonstrated for baker's yeast in Horecka (2000), Yeast 16, 967-970.
  • a deletion is determined by using hybridization techniques as known in the art.
  • a primer is designed as mentioned herein above that is capable to only hybridize to wild-type genomic DNA as depicted in SEQ ID NO: 9 but not to a nucleotide sequence comprising a deletion of a fragment between nucleotides 2653 and 2663 of SEQ ID NO:9.
  • FISH fluorescent in situ hybridization
  • a deletion of nucleotide residues as described herein may be determined by using PCR, wherein one primer of a pair of primers is located within the region of genomic DNA comprising said deletion.
  • said deletion is between nucleotide positions 2653 and 2663 as depicted in SEQ ID NO: 9.
  • PCR using primers which are located upstream or downstream of the deletion is performed to determine said deletion.
  • both a fragment of genomic DNA of the wild-type nucleotide sequence as set forth in SEQ ID NO: 1 and a fragment of the nucleotide sequence comprising a deletion of preferably the nucleotides between positions 2653 and 2663 as depicted in SEQ ID NO: 9 will be amplified.
  • the fragment comprising the deletion will be shorter than the corresponding fragment of the wild-type sequence.
  • the primers depicted in SEQ ID NO: 18 and 19, respectively, are used for the aforementioned method.
  • the PCR is carried out by preferably at least 35 times denaturing the template nucleic acid as described above at a temperature of preferably at least 95°C for preferably at least 30 sec, annealing the primers at a temperature of preferably at least 62°C for preferably 30 sec and extending said primers at a temperature of preferably at least 72°C for preferably at least 60 sec.
  • Said PCR is followed by a treatment preferably with the restriction endonuclease Bsgl which recognizes the nucleotide sequences
  • any restriction endonuclease which recognizes said sequence may be used. Due to the deletion of preferably the nucleotides between positions 2653 and 2663 as depicted in SEQ ID NO: 9 the muatant is not cleaved since the nucleotide sequence comprising the Bsgl recognition site is absent. The wild-type sequence, however, is cleaved which results in a 212 bp and a 38 bp restriction fragment. The resulting restriction fragments are preferably separated on a 3% agarose gel.
  • deletion was shown to occur in intron 2 of the nucleotide sequence depicted in SEQ ID NO: 9 it may also be possible to determine said deletion on unspliced mRNA or its corresponding cDNA.
  • a PCR method can be applied using spliced • mRNA or the corresponding cDNA as template.
  • said deletion occurs in intron 2 of the nucleotide sequence as depicted in SEQ ID NO: 9 and leads to aberrant splicing. As a consequence exons 2 and 4 are fused whereby exon 3 is skipped.
  • spliced mRNA or cDNA comprising a wild-type exon1-exon2-exon3-exon4-exon5-24 arranged structure as depicted in SEQ ID NO: 1 not resulting from an aberrant splicing event is used as a template since the mRNA or cDNA (comprising an exon1-exon2-exon4-exon5-24 arranged structure as depicted in SEQ ID NO: 5) resulting from an aberrant splicing event does not comprise exon 3. It is also possible that an oligonucleotide is designed which is only capable to hybridize to mRNA or corresponding cDNA resulting from an aberrant splicing.
  • Such an oligonucleotide may be designed so as to be able to bind to a short region in the 3' end of exon 2 and to a short region in the 5' region of exon 4 and will only bind if exon 2 and 4 are directly fused together.
  • Most preferred is a PCR-based approach using genomic DNA as template and the above mentioned conditions and primers that are preferably of at least 12 nucleotides in length, more preferred of at least 15 nucleotides in length, even more preferred of at least 18 nucleotides in length and most preferred of at least 21 nucleotides in length as depicted in SEQ ID NO: 12 and SEQ ID NO: 13.
  • Said PCR- based approach is e.g. followed by sequencing and/or SSCA as described herein above. Bands showing an alteration in comparison to "wild-type" bands may be reamplified and sequenced to determine whether the amplified nucleic acid sequence has said deletion.
  • an insertion in a nucleic acid sequence as described herein is preferably determined by PCR-based approaches.
  • one of the two primers used in a PCR is designed in a manner that it is either capable to bind only to the wild-type nucleic acid sequence not comprising an insertion between nucleotide position 596 and 597 as depicted in SEQ ID NO: 1 or capable to bind only to a nucleotide sequence comprising an insertion at said positions.
  • no PCR fragment will result if the nucleotide sequence comprises an insertion and in the second case a PCR fragment will result from said nucleotide sequence comprising said insertion.
  • a template nucleic acid molecule either cDNA or genomic DNA is preferred to be used. More preferably, PCR with appropriate primers located upstream and downstream of positions 596 and 597 as depicted in SEQ ID NO: 1 is followed by RFLP analysis to determine whether an insertion has occurred. Said RFLP analysis is possible if due to the insertion an endonuclease restriction site is generated that is not present in the wild- type nucleic acid sequence depicted in SEQ ID NO: 1 or a restriction site is destroyed which occurs in the wild-type sequence. Namely, the primers depicted in SEQ ID NO: 20 and 21 , respectively, are used to amplify a template nucleic acid molecule as described above.
  • PCR conditions are applied: preferably at least 35 cycles of denaturation at a temperature preferably of at least 95°C for preferably at least 30 sec, annealing at a temperature of preferably at least 64°C for preferably at least 30 sec and extension at a temperature of preferably at least 72°C for preferably at lest 60 sec.
  • Said PCR results in the generation of a 255 bp fragment in case of a wild-type nucleic acid template not comprising an insertion between nucleotide position 596 and 597 as depicted in SEQ ID NO: 1 or in a 256 bp fragment in case of a nucleic acid template comprising an insertion between nucleotide position 596 and 597 as depicted in SEQ ID NO: 1.
  • the fragments are treated preferably with the restriction endonuclease Mwol which recognizes the nucleotide sequence GCNNNNNNNGC.
  • any restriction endonuclease which recognizes said sequence may be used.
  • an insertion between nucleotide position 596 and 597 as depicted in SEQ ID NO: 1 results in the generation of a recognition site for Mwol and, accordingly, the 256 bp fragment comprising said insertion will be cleaved in a 115 bp, a 112 bp, a 17 bp and a 12 bp fragment, whereas the 255 bp wild-type fragment will be cleaved in a 115 bp, a 112 bp and 28 bp fragment which are visualized on a 10% polyacrylamidegel by methods known in the art.
  • PCR using genomic DNA as template and the above mentioned conditions followed by SSCA as described herein above is performed to determine whether an insertion between positions 596 and 597 as depicted in SEQ ID NO: 1 has taken place.
  • the primers used for this purpose are preferably of at least 12 nucleotides in length, more preferred of at least 15 nucleotides in length, even more preferred of at least 18 nucleotides in length and most preferred of at least 21 nucleotides in length as depicted in SEQ ID NO: 14 and SEQ ID NO: 15.
  • the mutations of the CIC-2 voltage-gated channel as described herein by using the antibodies of the present invention.
  • Said antibodies specific for said mutations of CIC-2 proteins will be determined by assay techniques such as radioimmunoassays, competitive-binding assays, Western blot analysis and ELISA assay. Also preferred are classical immunohistological methods.
  • the finding, described in the present invention, that certain mutations in the CIC-2 encoding gene and/or the corresponding protein are connected with IGE is indicative that the non- or dysfunction of the CIC-2 protein is responsible for various forms of IGE.
  • the finding of these mutations not only allows the diagnosis of IGE by determining whether the above-described mutations occur in an individual.
  • Such a treatment can, e.g., comprise the introduction of a nucleic acid molecule encoding a functional wild-type CIC-2 protein thereby restoring in said individual the CIC-2 activity.
  • the present invention also relates to a pharmaceutical composition.
  • pharmaceutical composition relates to a composition comprising a nucleic acid molecule comprising a nucleotide sequence which encodes a functional voltage-gated chloride channel CIC-2 and which is selected from the group consisting of:
  • Such pharmaceutical compositions comprise a therapeutically effective amount of a nucleic acid molecule encoding a functional CIC-2 protein and, optionally, a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may be administered with a physiologically acceptable carrier to a patient, as described herein.
  • pharmaceutically acceptable means approved by a regulatory agency or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • Such compositions will contain a therapeutically effective amount of the aforementioned compounds, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilised powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the pharmaceutical composition of the invention can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • In vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the pharmaceutical composition is administered directly or in combination with an adjuvant.
  • the pharmaceutical composition is preferably designed for the application in gene therapy.
  • the technique of gene therapy has already been described above in connection with the nucleic acid molecules of the invention and all what has been said there also applies in connection with the pharmaceutical composition.
  • the nucleic acid molecule in the pharmaceutical composition is preferably in a form which allows its introduction, expression and/or stable integration into cells of an individual to be treated.
  • the present invention relates to a method of treating a neurological disease comprising administering a therapeutically effective amount of the pharmaceutical composition described herein above to a subject suffering from said disease.
  • the term "subject” means an individual in need of a treatment of a neurological disease.
  • the subject is a vertebrate, even more preferred a mammal, particularly preferred a human.
  • administered means administration of a therapeutically effective dose of the aforementioned nucleic acid molecule encoding a functional CIC-2 protein to an individual.
  • therapeutically effective amount is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment and will be ascertainable by one skilled in the art using known techniques.
  • the compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein.
  • the compounds may be formulated in a variety of ways as discussed below.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt %.
  • the agents maybe administered alone or in combination with other treatments.
  • the administration of the pharmaceutical composition can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, intra-arterial, intranodal, intramedullary, intrathecal, intraventricular, intranasally, intrabronchial, transdermally, intranodally, intrarectally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly.
  • the candidate agents may be directly applied as a solution dry spray. The attending physician and clinical factors will determine the dosage regimen.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • a typical dose can be, for example, in the range of 0.001 to 1000 ⁇ g; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors.
  • the dosages are preferably given once a week, however, during progression of the treatment the dosages can be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., daily.
  • the immune response is monitored using herein described methods and further methods known to those skilled in the art and dosages are optimized, e.g., in time, amount and/or composition.
  • Dosages will vary but a preferred dosage for intravenous administration of DNA is from approximately 10 6 to 10 12 copies of the DNA molecule. If the regimen is a continuous infusion, it should also be in the range of 1 ⁇ g to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment.
  • the pharmaceutical composition of the invention may be administered locally or systemically. Administration will preferably be parenterally, e.g., intravenously. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
  • Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. It is also envisaged that the pharmaceutical compositions are employed in co- therapy approaches, i.e. in co-administration with other medicaments or drugs, for example other drugs for preventing, treating or amelioration epilepsy, in particular IGE.
  • the invention also relates to the use of a nucleic acid molecule encoding a functional CIC-2 protein as described herein above in connection with the pharmaceutical composition for the preparation of a pharmaceutical composition for treating a neurological disease.
  • said neurological disease to be treated with the aforementioned pharmaceutical composition is an idiopathic generalized epilepsy (IGE).
  • IGE idiopathic generalized epilepsy
  • said idiopathic generalized epilepsy is selected from the group consisting of childhood absence epilepsy (CAE), juvenile absence epilepsy (JAE), juvenile myoclonic epilepsy (JME) and epilepsy with grand mal seizures on awakening (EGMA).
  • the present invention relates to a kit comprising the nucleic acid molecule, the vector, the host, the polypeptid, the antibody or the aptamer, the primer or pair of primers of the invention or the molecule as identified or characterized in a method herein below of the present invention.
  • the kit of the present invention further comprises, optionally (a) reaction buffer(s), storage solutions and/or remaining reagents or materials required for the conduct of scientific or diagnostic assays or the like.
  • parts of the kit of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units.
  • the kit of the present invention may be advantageously used, inter alia, for carrying out the method of producing a polypeptide of the invention, the method(s) of identification and/or characterization of molecules specifically interacting with CIC-2 voltage-gated chloride channels as described herein below and/or it could be employed in a variety of applications referred herein, e.g., as diagnostic kits, as research tools or therapeutic tools. Additionally, the kit of the invention may contain means for detection suitable for scientific, medical and/or diagnostic purposes. The manufacture of the kits follows preferably standard procedures which are known to the person skilled in the art.
  • the present invention relates to a method for identifying molecules which are capable of specifically interacting with a polypeptide of the present invention, comprising the steps of (a) contacting a polypeptide of the present invention with a molecule to be tested; and (b) determining whether said molecule is capable of specifically interacting with said polypeptide.
  • the polypeptide may be provided directly or by expression of a corresponding nucleic acid molecule or vector of the invention, e.g., in vitro or in a suitable host cell.
  • the present invention relates to a method for the characterization of molecules which are capable of altering characteristics of the polypeptides of the present invention, comprising the steps of (a) contacting a polypeptide of the invention with said molecule; and (b) determining whether the molecule alters a characteristic of said polypeptide.
  • Said identification and/or characterization of molecules which are capable of interacting with or altering characteristics of the polypeptide of this invention may be, inter alia, achieved by transfecting an appropriate host with a nucleic acid molecule of invention.
  • Said hosts comprise, but are not limited to, HEK 293 cells or are injected into frog oocytes, preferably a Xenopus oocyte for functional expression (Goldin (1992), Methods Enzymol. 207, 266).
  • Expressed CIC-2 voltage-gated channels con be examined using standard two-electrode voltage clamp techniques (see Stuhmer (1992), Methods Enzymol. 207, 319; Kohler (1996), Science 273, 1709).
  • membrane currents may be deduced in the absence and/or presence of the molecule to be identified and/or characterized.
  • Methods for the deduction of membrane currents are well known in the art and comprise, e.g., patch clamp methods as described in Hamill, Pfluger's Arch. 391 (1981), 85-100 or two-electrode voltage clamp in oocytes, as described in Methfessel, Pfl ⁇ gers Archive 407 (1986) 577-588.
  • the present invention relates to a method of screening for molecules which are capable of interacting with the polypeptide of this invention, comprising the steps of (a) contacting a polypeptide of the invention with a molecule; and (b) measuring and/or detecting a response; and (c) comparing said response to a standard response as measured in the absence of said candidate molecule.
  • candidate molecules or candidate mixtures of molecules may be, inter alia, substances, compounds or compositions which are of chemical or biological origin, which are naturally occurring and/or which are synthetically, recombinantly and/or chemically produced.
  • candidate molecules may be proteins, protein- fragments, peptides, amino acids and/or derivatives thereof or other compounds, such as ions, which bind to and/or interact with wild-type CIC-2 voltage-gated chloride channels.
  • Such binding and/or interacting candidate compounds may be found employing, inter alia, yeast two-hybrid systems or modified yeast two-hybrid systems as described, for example, in Fields, Nature 340 (1989), 245-246; Gyuris, Cell 75 (1993), 791-801 ; or Zervos, Cell 72 (1993), 223-232.
  • potential candidate molecules may be contacted with a cell, such as an oocyte or a HEK 293 cell, which expresses a polypeptide of the invention or with a membrane patch comprising a polypeptide of the invention and a corresponding response (inter alia, a dose-response response, a current- response, or single current channel response) may be measured in order to elucidate any effect said candidate molecule causes.
  • a cell such as an oocyte or a HEK 293 cell, which expresses a polypeptide of the invention or with a membrane patch comprising a polypeptide of the invention and a corresponding response (inter alia, a dose-response response, a current- response, or single current channel response) may be measured in order to elucidate any effect said candidate molecule causes.
  • the method of the present invention for identification, characterization and/or screening of molecules capable of interacting with CIC-2 voltage-gated chloride channels can, inter alia, employ hosts as defined herein which express the polypeptide of the present invention.
  • Cell-based assays, instrumentation for said assays and/or measurements are well-known in the art and described, inter alia, in Gonzalez, Drug Discovery Today 4 (1999), 431-439 or Ramm, Drug Discovery Today 4 (1999), 401-410. It is also envisaged that the high through put screens described herein are conducted by using, for example cRNA, i.e. synthetic RNA from a cDNA construct) that can be introduced in host cells, such as Xenopus oocytes using routine methods in the art.
  • cRNA i.e. synthetic RNA from a cDNA construct
  • direct nucleic acid injection can be employed, such as the Eppendorf microinjection system (Micromnipulator 5171 and Transjector 5242).
  • the injected/transformed cells can be analyzed for chloride currents about 4 hours later using patch-clamp techniques which are commonly practiced in the art.
  • the present invention relates to a method for the production of a pharmaceutical composition
  • a method for the production of a pharmaceutical composition comprising the steps of a method of the invention for identifying, characterizing and/or screening of molecules which are capable of interacting with CIC-2 voltage-gated chloride channels and further comprising a step, wherein a derivative of said identified, characterized and/or screened molecule is generated.
  • a derivative may be generated by, inter alia, peptidomimetics.
  • the invention furthermore relates to a method for the production of a pharmaceutical composition
  • a method for the production of a pharmaceutical composition comprising the steps of a method of the invention for identifying, characterizing, screening and/or derivatizing of molecules which are capable of interacting with CIC-2 voltage-gated chloride channels and formulating the molecules identified, characterized, screened and/or derivatized in pharmaceutically acceptable form.
  • the present invention relates to a method wherein said molecule(s) comprise(s) (a) neuroprotective, (a) nootropic and/or (a) antiepileptic molecule(s).
  • the present invention relates to a method wherein said molecule(s) are antagonist(s), partial antagonist(s), partial agonist(s) and/or agonist(s) for a voltage-gated chloride channel CIC-2.
  • the term “antagonist” denotes molecules/substances, which are capable of inhibiting and/or reducing an agonistic effect.
  • the term “antagonist” comprises competitive, non-competitive , functional and chemical antagonists as described, inter alia, in Mutschler, "Arzneistoff Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch Wunsch, Stuttgart, Germany.
  • the term “partial antagonist” in accordance with the present invention means a molecule/substance that is capable of incompletely blocking the action of agonists through, inter alia, a non-competitive mechanism.
  • molecules/substances are denoted which have an affinity as well as an intrinsic activity.
  • said intrinsic activity (oc) is defined as being proportional to the quotient of the effect, triggered by said agonist (E A ) and the effect which can be maximally obtained in a given biological system (E max ): therefore, the intrinsic activity can be defined as
  • Agonists with an intrinsic activity of 1 are full agonists, whereas substances/molecules with an intrinsic activity of >0 and ⁇ 1 are partial agonists.
  • Partial agonists show a dualistic effect, i.e. they comprise agonistic as well as antagonistic effects.
  • an identified antagonist of the voltage-gated chloride channel CIC-2 comprising the G715E mutation may be useful to reestablish the electrophysiological properties normally shown by wild-type CIC-2 voltage-gated chloride channels.
  • the altered chloride-dependent gating of the G715E mutation may be reversed.
  • an identified agonist of the voltage-gated chloride channel CIC-2 resulting from either the deletion of amino acids 74 to 117 or the insertion of nucleotides between position 596 and 597 of the corresponding wild-type nucleotide sequence may be useful to reestablish the lost functionality of the CIC- 2 voltage-gated chloride channel.
  • the anagonist(s), partial anatagonist(s), partial agonist(s) and /or agonist(s) for the voltage-gated chlorid channel CIC-2 is preferably selected from aptamers, aptazymes, RNAzymes, antibodies, affybodies, trinectins, anticalins, or the like compounds.
  • the effect of the compounds on the activity of the voltage-gated chlorid channel CIC-2 may be assayed by testing the effect of the compound in an electrophsyiological recording to obtain the voltage dependence of channel activation.
  • a suitable assay is described, e.g., in Example 6. Techniques for the production of suitable compounds are well known in the art.
  • Suitable compounds are e.g., antibodies, described in Harlow and Lane “Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. Suitable compounds are also aptamers. Their preparation is well known in the art, e.g. Gold (1995), Ann. Rev. Biochem. 64: 763-797.
  • suitable compounds are e.g., anticalins, described in EP 1 017 814. Said European patent also describes the process of preparing such anticalins with the ability to bind a specific target.
  • suitable molecules are Trinectins (Phylos Inc., Lexington, Massachusetts, USA, or Xu (2002), Chem. Biol. 9:933).
  • Another kind of suitable molecules are affybodies (see Hansson (1999), Immunotechnology 4:237- 252, or Henning (2002), Hum Gene Ther. 13:1427-1439, and references therein).
  • Figure 1 Segregation analysis of three different CLCN2 mutations in families with common IGE subtypes.
  • G ⁇ A transition (G2144A) (arrow) identified in family 3 results in a non-conservative amino acid exchange (G715E) in the C-terminus of the protein.
  • CIC-2 Membrane topology model of CIC-2 (Thiemann et al., 1992; Cid et al., 1995), based on the high-resolution structure of a CIC channel from S. typhimurium with 18 helical segments (Dutzler et al., 2002).
  • CIC-2 is a 898 amino acid polypeptide which differs from the prokaryotic isoforms in the existence of a 333 amino acid cytoplasmic C-terminus that exhibits two CBS domains (Ponting (1997), J. Mol. Med. 75, 160-163).
  • SSCA single strand conformation analysis
  • PCR is employed. Genomic DNA was extracted from 10 ml aliquots of EDTA-anticoagulated blood samples, using a salting-out method. PCR cycles were performed in a MJ Research thermocycler with the following conditions: 35 cycles of denaturation at 95°C,for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C for 60 sec.
  • Each PCR was done in a final volume of 25 ⁇ l containing 100 ng of genomic DNA, 10 pmol of each the forward and reverse primer as depicted herein below, 200 ⁇ M of each dNTP, 15 mM MgCI 2 , 50 mM KCI, 10 mM Tris-HCI (pH 8.3), and 0.5 U Taq DNA Polymerase.
  • the following primers were used to identify the point mutation in the mutant CLCN2 gene leading to the corresponding G715E mutation in the voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2: 5'-TGTCTTCCTTACCTTTCCTGG-3' (forward primer) (depicted in SEQ ID NO: 10) and 5'- ACTGCAGGGTTAATGACGTGG-3' (reverse primer) (depicted in SEQ ID NO: 11).
  • the following primers were used to identify the mutation leading to an atypical splicing of the CLCN2 mRNA (del74-117) which results in the deletion of the corresponding amino acids 74 to 117 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2: 5'-AATATGGACGGAGCCGTTGCG-3' (forward primer) (depicted in SEQ ID NO: 12) and 5'-AGCTGACCAATGCCATGAGAAG-3' (depicted in SEQ ID NO: 13).
  • the following primers were used to identify an insertion of a nucleotide between positions 596 and 597 of the corresponding wild-type CLCN2 sequence as depicted in SEQ ID NO: 1 leading to a premature stop codon (M200fsX231) within the CLCN2 sequence as depicted in SEQ ID NO: 1 which results in a truncated CIC-2 protein: 5'-TGCATCGAATGCCTCTCCTG-3' (forward primer) (depicted in SEQ ID NO: 14) and 5'-CCACCAGGAGGGACTCCTTC-3' (reverse primer) (depicted in SEQ ID NO: 15).
  • PCR fragments were separated on a 10% polyacrylamide gel at 4°C and at room temperature, respectively. PCR fragments showing a SSCA band shift were amplified again prior to direct sequence analysis, which was carried out on an automated sequence analyser (ABI 377).
  • Example 3 Analysis of mutations in the CIC-2 coding sequence by PCR and restriction endonuclease digestion
  • Genomic DNA was obtained as described in Example 2, supra.
  • the PCR machine used is also described in Example 2, supra.
  • the following primers were used to identify the point mutation in the mutant CLCN2 gene leading to the corresponding G715E mutation in the voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2: 5'- GCACATGCAGGAGCGCAGA -3' (forward primer) (depicted in SEQ ID NO: 16) and 5'- CCTGCCGACTCTGCGCTG - 3' (reverse primer) (depicted in SEQ ID NO: 17).
  • PCR conditions were as follows: 35 cycles of denaturation at 95°C for 30 sec, annealing at 62°C for 30 sec, and extension at 72°C for 60 sec. Each PCR is done in a final volume of 25 ⁇ l containing 100 ng of genomic DNA, 10 pmol of each the forward and reverse primers, 200 ⁇ M of each dNTP, 1.5 mM MgCI 2 , 50 mM KCI, 10 mM Tris-HCI (pH 8.3), and 0.5 U Taq DNA polymerase.
  • PCR product sizes 222 bp (wild type) 222 bp (mutant)
  • PCR is followed by restriction enzyme digest with lta ⁇ . Fragments can be separated on a 10% polyacrylamide gel and visualized by standard silver staining procedure.
  • the following primers were used to identify the mutation leading to an atypical splicing of the CLCN2 mRNA (del74-117) which results in the deletion of the corresponding amino acids 74 to 117 of the wild-type voltage-gated chloride channel CIC-2 as depicted in SEQ ID NO: 2: 5'- CGGGCTGCCCCAGAGCTC -3' (forward primer) (depicted in SEQ ID NO: 18) and 5'- GATACTAGGAACTTGTGGCAG -3' (depicted in SEQ ID NO: 19).
  • PCR-conditions 35 cycles of denaturation at 95°C for 30 sec, annealing at 62°C for 30 sec, and extension at 72°C for 60 sec. Each PCR is done in a final volume of 25 ⁇ l containing 100 ng of genomic DNA, 10 pmol of each the forward and reverse primers, 200 ⁇ M of each dNTP, 1.5 mM MgCI 2 , 50 mM KCI, 10 mM Tris-HCI (pH 8.3), and 0.5 U Taq DNA polymerase.
  • J CR product sizes 250 bp (wild type) 239 bp (mutant)
  • 3 CR is followed by restriction enzyme digest with Bsgl. Fragments can be separated and visualized on a 3% agarose gel
  • the following primers were used to identify an insertion of a nucleotide between )ositions 596 and 597 of the corresponding wild-type CLCN2 sequence as depicted n SEQ ID NO: 1 leading to a premature stop codon (M200fsX231) within the CLCN2 sequence as depicted in SEQ ID NO: 1 which results in a truncated CIC-2 protein: 5'- TGGATGTCCCGGGGCTTGAAC -3' (forward primer) (depicted in SEQ ID NO: 20) and 5'- TCTTTGCCAAGCGGCAATCCC -3' (reverse primer) (depicted in SEQ ID NO: 21).
  • PCR-conditions 35 cycles of denaturation at 95°C for 30 sec, annealing at 64°C for 30 sec, and extension at 72°C for 60 sec. Each PCR is done in a final volume of 25 ⁇ l containing 100 ng of genomic DNA, 10 pmol of each the forward and reverse primers, 200 ⁇ M of each dNTP, 1.5 mM MgCI 2 , 50 mM KCI, 10 mM Tris-HCI (pH 8.3), and 0.5 U Taq DNA polymerase.
  • PCR is followed by restriction enzyme digest with Mwol. Fragments can be separated on a 10% polyacrylamide gel and visualized by standard silver staining procedure.
  • Competitors for mutant and wild-type CIC-2 were generated in the pCR2.1-TOPO vector (Invitrogen). A 91-bp internal deletion was introduced in both competitors by standard recombinant PCR-technologies to produce PCR products of different lengths. For QC-RT-PCR target-specific primer sets binding to either the wild-type cDNA or the mutant CIC-2 cDNA were generated. Serially ten-fold diluted competitor DNAs were added to RT-PCR tubes. One-tube QC-RT-PCR was performed under the following conditions: Reverse transcription at 50°C for 30 minutes, 95°C for 15 minutes, and 23 identical cycles of denaturation (94°C for 30 seconds), annealing (68°C for 20 seconds) and extension (72°C for 1 minute).
  • Concatameric constructs linking two wild-type or one mutant and one wild-type hCIC-2 sequence in a single open reading frame were designed as described previously for CIC-1 (Fahlke (1997b), loc. cit.). Transfection of concatameric wild- type-wild-type constructs in tsA201 cells resulted in peak current amplitudes comparable with monomeric wild-type constructs. Co-transfections of wild-type and mutant CIC-2 were performed in a 1 :1 ratio of transfected cDNA. To examine a possible dominant negative effect of M200fsX231 and del74-117 on the wild-type, cells were transfected on the same day with either wild-type alone or the same amount of wild-type plus the same amount of mutant cDNA.
  • Agar bridges were used to connect the bath solution and, when the intracellular solution contained glutamate, also the pipette solution to the amplifier. Between voltage steps, cells were held to potentials close to the calculated chloride equilibrium potential. Junction potentials calculated using the JPCalc software were used to correct results (Barry (1994), J. Neurosci. Methods 51 , 107-116).
  • the instantaneous current amplitude determined 200 ⁇ s after a voltage step to 75 mV was measured after test pulses to different voltages (V), normalized to its maximum value and plotted versus the test potential. To reach steady-state conditions, the test pulse duration was adjusted to 2.5 s.
  • the genomic organization of the human CLCN2 gene was determined by comparing the published cDNA sequence (GenBank accession number NM_004366) with the genomic clone AC078797. 24 coding exons were identified, and a PCR-based strategy to amplify all coding exons and adjacent splice sites from genomic DNA was established. The CLCN2 gene was screened in index patients of 46 IGE families linked to chromosome 3q26 using single strand conformation analysis (SSCA).
  • SSCA single strand conformation analysis
  • the leading IGE syndrome in family 1 was JME presenting with frequent myoclonic and generalized tonic clonic seizures (Figure 1A).
  • a single nucleotide insertion in bp-position 597 (597insG) ( Figure 2A) was detected within exon 5 of individual IV: 1.
  • the 597insG mutation alters the normal translational reading frame and predicts a premature stop codon (M200fsX231) that severely truncates the protein (Figure 4A).
  • Affected individuals of family 2 experienced rare generalized tonic clonic seizures on awakening (EGMA), except individual IV:4 who exclusively suffered from absence seizures (CAE) ( Figure 1 B).
  • Example 9 Wild-type Human CIC-2 Channels Constitute a Sole Chloride Efflux Pathway
  • wild-type and mutant human CIC-2 (hCIC-2) channels were expressed in tsA201 cells and their functional properties were studied using the whole-cell patch clamp technique. Characteristic current recordings from a cell expressing wild-type hCIC-2 are shown in Figure 3B. The channels were closed at positive potentials and activated slowly upon membrane hyperpolarization. There was no indication for a voltage- and time-dependent inactivation (data not shown). The relative open probability depended not only on the membrane potential, but also on the intracellular chloride concentration ([C! " ]j) ( Figure 3C).
  • Activation gating of CIC-1 is almost independent of [Cl " ]j (Fahlke (1995), Neuron 15, 463-472), and this feature allows the muscle CIC isoform to provide the characteristic large resting conductance of the sarcolemma at a low [Cl " ]j.
  • a naturally occurring mutation that couples CIC-1 gating to [CI-], substantially reduces the resting chloride conductance and causes myotonia congenita, a genetic disease characterized by muscle hyperexcitability (Fahlke (1995, loc. cit.).
  • CIC-2 regulates internal anion composition and does not contribute to the resting conductance. Gating of wild-type CIC-2 critically depends on [Cl " ]i and a genetically induced alteration of the chloride dependence of gating causes neuronal hyperexcitability.
  • the M200fsX231 mutation predicts a truncated channel protein lacking major sequence determinants of the ionic pore (Fahlke (1997a), Nature 390, 529-532; Dutzler (2002), Nature 415, 287-294) (Figure 4A).
  • heterologous expression of M200fsX231 mutant channels did not yield any detectable chloride current ( Figure 4B, C).
  • CIC channels are dimeric proteins (Miller (1982), Philos. Trans. R. Soc. Lond. B Biol. Sci. 299, 401-411 ; Dutzler (2002), loc.
  • channels consisting of one wild-type and one mutant subunit will represent the largest fraction of CIC-2 channels in heterozygous patients if the mutant is able to interact with the wild-type subunit.
  • a concatameric construct that links one wild-type and one mutant allele in a single open reading frame was expressed, and additionally wild-type and mutant co-expression experiments were performed.
  • the quantitative competitive RT-PCR assay predicted a lower expression of the del74-117 splice variant compared to that of wild-type. Therefore, a less pronounced effect of the IVS2-14del11 mutation on chloride current amplitudes is expected than for the 597insG mutation encoding the truncated mutant M200fsX231 (assuming a 50:50 expression of wild-type and mutant alleles in heterozygotes carrying the 597insG mutation).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pain & Pain Management (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette invention a trait à des molécules d'acide nucléique codant des polypeptides ayant des séquences d'acides aminés dont le canal chlorure CIC-2 dépend du potentiel. Le reste de glycine (Gly) correspondant à la position (715) du canal chlorure CIC-2 dépendant du potentiel de type sauvage est remplacé par un autre reste d'acide aminé ou bien les acides aminés correspondant aux positions (74 à 117) du canal chlorure CIC-2 dépendant du potentiel de type sauvage sont délétées ou encore la phase de lecture traductionnelle de type sauvage du canal chlorure CIC-2 dépendant du potentiel est modifiée en raison de l'insertion d'un reste nucléotidique entre les positions 596 et 597 de la séquence nucléotidique correspondante de type sauvage. L'invention porte également sur des polypeptides codés par ces acides nucléiques, ainsi que sur des vecteurs et de hôtes renfermant ces molécules d'acide nucléique et sur des techniques permettant de produire ces polypeptides codés par ces acides nucléiques. L'invention concerne, de surcroît, des anticorps spécifiquement dirigés contre les polypeptides codés par ces molécules d'acide nucléique. Elle porte, en outre, sur des amorces permettant d'amplifier, de manière sélective, ces molécules d'acide nucléique ainsi que sur des trousses, des compostions, notamment des compositions pour diagnostic contenant ces acides nucléiques, sur des vecteurs, des polypeptides, des anticorps et/ou des amorces. Elle concerne également des compositions pharmaceutiques contenant les acides nucléiques codant un canal chlorure fonctionnel dépendant du potentiel. Elle a trait également à des méthodes permettant de diagnostiquer des maladies neurologiques liées à la présence de l'un des acides nucléiques susmentionnés ou des polypeptides codés par ceux-ci ainsi qu'à l'usage qui en est fait et à des méthodes de traitement de troubles neurologiques faisant appel à un canal chlorure fonctionnel CIC-2 dépendant du potentiel. Elle porte, enfin, sur des méthodes, permettant d'identifier des molécules capable d'interagir de manière spécifique avec les polypeptides susmentionnés ou d'en modifier les caractéristiques, ainsi que sur des procédés de production de compositions pharmaceutiques.
PCT/EP2003/012086 2002-10-30 2003-10-30 Moyens et methodes permettant de diagnostiquer et de traiter une epilepsie idiopathique generalisee WO2004039979A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003276217A AU2003276217A1 (en) 2002-10-30 2003-10-30 Means and methods for diagnosing and treating idiopathic generalized epilepsy (ige)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US42210202P 2002-10-30 2002-10-30
US60/422,102 2002-10-30

Publications (1)

Publication Number Publication Date
WO2004039979A1 true WO2004039979A1 (fr) 2004-05-13

Family

ID=32230318

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/012086 WO2004039979A1 (fr) 2002-10-30 2003-10-30 Moyens et methodes permettant de diagnostiquer et de traiter une epilepsie idiopathique generalisee

Country Status (2)

Country Link
AU (1) AU2003276217A1 (fr)
WO (1) WO2004039979A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102154509A (zh) * 2010-12-28 2011-08-17 深圳华大基因科技有限公司 用于检测clcn1基因突变的方法、试剂盒及特异性引物
EP3502277A1 (fr) * 2017-12-22 2019-06-26 Heinrich-Heine-Universität Düsseldorf Diagnostic de l'aldostéronisme primaire

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
AMERICAN JOURNAL OF HUMAN GENETICS, XP002271336, Retrieved from the Internet <URL:http://genetics.faseb.org/genetics/ashg01/f254.htm> [retrieved on 20040224] *
HAUG K ET AL: "A voltage-gated ion channel is a major susceptibility gene in genetically complex epilepsies.", EUROPEAN JOURNAL OF HUMAN GENETICS, vol. 9, no. Supplement 1, 2001, 10th International Congress of Human Genetics;Vienna, Austria; May 15-19, 2001, pages C018, XP008027826, ISSN: 1018-4813 *
HAUG K ET AL: "Mutations of CLCN2, encoding a voltage-gated chloride channel, causing common forms of epilepsy", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 69, no. 4 Supplement, October 2001 (2001-10-01), 51st Annual Meeting of the American Society of Human Genetics;San Diego, California, USA; October 12-16, 2001, pages 226, XP008028586, ISSN: 0002-9297 *
HAUG KARSTEN ET AL: "Mutations in CLNCN2 encoding a voltage-gated chloride channel are associated with idiopathic generalized epilepsies.", NATURE GENETICS, vol. 33, no. 4, April 2003 (2003-04-01), pages 527 - 532, XP002271311, ISSN: 1061-4036 (ISSN print) *
HEILS ARMIN B ET AL: "Mutations of CLCN2, encoding a voltage-gated chloride channel, causing common forms of epilepsy", EPILEPSIA, vol. 42, no. Supplement 7, 2001, pages 22, XP002271312, ISSN: 0013-9580 *
POSTER PRESENTED AT THE ANNUAL MEETING OF THE AMERICAN EPILEPSY SOCIETY, 30 November 2001 (2001-11-30) - 5 December 2001 (2001-12-05), PHILADEPHIA, PA, USA *
SCHEFFER INGRID E ET AL: "The genetics of human epilepsy.", TRENDS IN PHARMACOLOGICAL SCIENCES, vol. 24, no. 8, August 2003 (2003-08-01), pages 428 - 433, XP002271310, ISSN: 0165-6147 *
WARNSTEDT M ET AL: "Functional alterations of human ClC-2 Cl-channels in idiopathic epilepsy", PFLUEGERS ARCHIV EUROPEAN JOURNAL OF PHYSIOLOGY, vol. 443, no. Supplement 1, March 2002 (2002-03-01), 81st Annual Joint Meeting of the Physiological Society, the Scandinavian Physiological Society and t;Tuebingen, Germany; March 15-19, 2002, pages S163, XP008027769, ISSN: 0031-6768 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102154509A (zh) * 2010-12-28 2011-08-17 深圳华大基因科技有限公司 用于检测clcn1基因突变的方法、试剂盒及特异性引物
CN103205503A (zh) * 2010-12-28 2013-07-17 深圳华大基因科技有限公司 用于检测clcn1基因突变的方法、试剂盒及特异性引物
EP3502277A1 (fr) * 2017-12-22 2019-06-26 Heinrich-Heine-Universität Düsseldorf Diagnostic de l'aldostéronisme primaire

Also Published As

Publication number Publication date
AU2003276217A1 (en) 2004-05-25

Similar Documents

Publication Publication Date Title
EP1469072B1 (fr) Dispositifs et méthodes pour le diagnostic et traitement de la maladie affective
US8288096B2 (en) Diagnostic method for epilepsy
AU2002318972B8 (en) Mutations in ion channels
EP1292676B1 (fr) Mutation associée a l&#39;épilepsie
AU767718B2 (en) Novel mutations in the (FREAC3) gene for diagnosis and prognosis of glaucoma and anterior segment dysgenesis
US6353091B1 (en) Human N-type calcium channel isoform
WO2000029571A1 (fr) Gene codant une proteine transmembranaire
JP4324472B2 (ja) アトラスチン
WO2004039979A1 (fr) Moyens et methodes permettant de diagnostiquer et de traiter une epilepsie idiopathique generalisee
JP3517988B2 (ja) ヒトマッカード−ジョセフ病関連蛋白質、その蛋白質をコードするｃＤＮＡおよび遺伝子、そのＤＮＡまたは遺伝子を含むベクター、その発現ベクターで形質転換された宿主細胞、マッカード−ジョセフ病の診断方法および治療剤
EP1664324A1 (fr) Mutations dans les canaux ioniques
NZ522372A (en) Mutation in the beta 2 nicotinic acetylcholine receptor subunit associated with nocturnal frontal lobe epilepsy
WO2005024024A1 (fr) Mutations dans la famille des genes nedd4 impliquees dans l&#39;epilepsie et autres troubles du snc
AU2004200978B2 (en) A diagnostic method for epilepsy
US20030096751A1 (en) G-protein coupled receptor polynucleotides and methods of use thereof
CA2446838A1 (fr) Nouvelle mutation
AU9679998A (en) Methods to modulate blood pressure and diagnose bartter&#39;s syndrome type iii
JP2005505264A (ja) 新規ヒトプロトンゲート調節チャンネル
JP2004504002A (ja) ヒトシャペロンタンパク質
WO2011084772A2 (fr) Troubles alléliques causés par des mutations dans trpv4
MXPA00010172A (en) Novel mutations in the freac3
US20030224423A1 (en) Method of testing for allergic diseases
WO2004053128A1 (fr) Mutations dans le recepteur 1 de gaba-b associe a l&#39;epilepsie
JPWO2003037930A1 (ja) 新規なヒトＮ−ｍｅｔｈｙｌ−Ｄ−ａｓｐａｒｔａｔｅ（ＮＭＤＡ）型グルタミン酸受容体ポリペプチドおよびそれをコードする遺伝子
AU2002252833A1 (en) Novel mutation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP