WO2004035813A2 - Criblage de molecules a activite anti-prion : kits, methodes et molecules criblees - Google Patents
Criblage de molecules a activite anti-prion : kits, methodes et molecules criblees Download PDFInfo
- Publication number
- WO2004035813A2 WO2004035813A2 PCT/FR2003/003101 FR0303101W WO2004035813A2 WO 2004035813 A2 WO2004035813 A2 WO 2004035813A2 FR 0303101 W FR0303101 W FR 0303101W WO 2004035813 A2 WO2004035813 A2 WO 2004035813A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- prion
- yeast
- molecules
- gene
- screening
- Prior art date
Links
- 0 *C=Ic1c(C=C)nc(*)c2c1cccc2 Chemical compound *C=Ic1c(C=C)nc(*)c2c1cccc2 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
Definitions
- the present invention relates to the screening of molecules with anti-prion activity. It relates more particularly to screening kits for molecules with anti-prion activity, screening methods, and a family of molecules with anti-prion activity demonstrated using the screen according to the invention.
- Prions are infectious proteins responsible in mammals for certain neurodegenerative diseases of the spongiform encephalopathy type, such as Creutzfeldt-Jakob disease in humans or the so-called “mad cow” diseases in cattle or “scrapie”. In sheep. These different diseases are caused by unconventional infectious agents: unlike traditional infectious agents (bacteria, viruses for example), they do not contain nucleic acids.
- Professor Stanley Prusiner formulated the "protein alone” hypothesis, according to which the infectious agent would consist only of a protein. This protein exists naturally in cells in a “normal” form (or PrP c ), that is to say soluble, essentially in the form of a helix and not aggregated therefore functional.
- this protein can transform into a prion form (or PrP sc ).
- PrP sc prion form
- the protein forms insoluble aggregates, essentially in the form of ⁇ sheets.
- the infectious nature of this PrP ⁇ C prion conformation would come from the fact that, in addition to the characteristics indicated above, the protein in prion form also gains the capacity to catalyze the passage from the normal cellular form PrP c to the prion form PrP s in a mechanism of "snowball" type.
- Saccharo yces cerevisiae baker's yeast contains several proteins behaving like prions (Fernandez-Bellot and Cullin, 2001). As early as the 1960s, two unconventional genetic mechanisms were described.
- the corresponding phenotypes [PSI +] and [URE3] were proposed as resulting from the auto-catalytic inactivation of the proteins Sup35p and Ure2p respectively.
- These prion proteins therefore have a priori a mechanistic analogy with mammalian systems harmful to public health.
- the “normal” Sup35p protein changes from a soluble state to an insoluble and aggregated state as soon as the protein is in contact with another Sup35p protein in the prion form. This aggregated state is verified both by centrifugation experiments and by intracellular localization experiments.
- the yeast prions can be eliminated ("cure") by a large dose (1 to 5 mM) of guanidium chloride.
- the protein aggregates generated by the presence of prions disappear and the protein in question (Sup35p, for example) is found in a normal, soluble, functional form. but having retained the susceptibility to be converted into a prion form if it were again to come into contact with another Sup35p protein in such a state.
- the Sup35p protein in a heterodimeric complex with the Sup45p protein, forms a translation termination factor.
- This factor recognizes opal stop codons (UGA).
- UAA opal stop codons
- Sup35p in combination with Sup45p effectively terminates translation at these opal codons.
- Sup35p in prion form, it is mainly present in the form of aggregates insoluble. Unable to bind to Sup45p, it is thus non-functional in the termination of the translation.
- This enzyme catalyzes the formation of 4- (N-succinocarboxamide) -5-aminoimidazole ribonucleotide (SAICAR) from 4-carboxy-5-aminoimidazole ribonucleotide (CAIR).
- SAICAR 4-(N-succinocarboxamide) -5-aminoimidazole ribonucleotide
- CAIR 4-carboxy-5-aminoimidazole ribonucleotide
- the adel -14 allele contains an opal codon for reading the ADE1 gene.
- Sup35p in association with Sup45p will therefore stop the translation of the ADE1 gene at this stop codon.
- the adel-14p protein thus translated will be truncated and therefore non-functional.
- the substrates upstream of the Adelp enzyme will accumulate, in particular 5-aminoimidazole ribonucleotide (AIR).
- AIR 5-aminoimidazole ribonucleotide
- AIR is oxidized to a red colored compound, the colonies formed by cells [psi -] will be red in color. In addition, these cells will be auxotrophic for adenine.
- the protein Sup35 ⁇ is essentially present in the form of aggregates, therefore unable to associate with Sup45p to stop translation at the level of the opal codon of the adel -14 allele of the ADE1 gene. . Consequently, the ribosomes will pause at this stop codon before resuming their translation activity (translecture).
- a certain amount of functional Adelp protein will therefore be synthesized, cells will be autotrophic for adenine and will form white to dew colonies.
- Application WO 98/30909 also describes a method for screening molecules with anti-prion activity carried out on rodents infected with an unconventional transmissible agent. This screening method has the same limitations as the method described in P.N.A.S.
- the work of the inventors led them to produce a high throughput screening system for detecting molecules having anti-prion activity, based on the colorimetric reporter system of the Sup35p protein, described above.
- the present invention therefore relates to a kit for screening molecules with anti-prion activity, characterized in that it comprises, in combination, a yeast of phenotype [PSI +], an antibiogram and an agent for prion cleaning at sub-effective doses. , said yeast having the adel -14 allele of the ADE1 gene as well as an inactivated ERG6 gene.
- the kit according to the invention makes it possible to isolate molecules active against prions of mammals.
- Example 7 below shows that the most active molecules isolated by Pr. Prusiner also exhibit activity in the screen according to the invention.
- yeast prions there are many differences between yeast prions and mammalian prions. In an article in the journal "Cellular and Molecular Life Sciences", Professor C. Cullin even suggests, in view of these differences, to distinguish yeast prions from those of mammals by using the term "propagons".
- the "prions" mimals
- the "propagons” yeast
- antibiogram lozenges which allow the diffusion of the product by creating a concentration gradient, also makes it possible to test in a single experiment a multiplicity of concentrations, unlike conventional tests, in which only one concentration is tested.
- the use of the antibiogram also makes it possible to have information on the toxicity of the product as well as on the activity / concentration ratio, and thus determine the best effective concentration.
- the strain [PSI +] used in the kit according to the invention carries an inactivation of the ERG6 gene.
- yeasts are naturally not very permeable.
- Saccharomyces cerevisiae is impermeable such that carrying out a screening proves to be particularly ineffective without this inactivation.
- the screen analysis method according to the invention is visual thanks to the use of the adel -14 allele.
- the cell colonies will have a red, pink or white coloration.
- the choice of the yeast strain can improve the contrast between the colonies. Indeed, certain so-called “Strong” strains facilitate visual analysis of the screen. Such strains have a high level of aggregation of prion forms. Conversely, the strain will be called “Weak”.
- the preferred strains for implementing the invention are therefore strains of the "Strong" type.
- yeasts can also be used. Examples that may be mentioned are: Kluyveromyces lactis, Pichia methanolica, Saccharomyces ludwigii, Kluyveromyces marxianus, Pichia pastoris, Zygosaccharomyces rouxi, Schizosaccharomyces pombe.
- the ERG6 gene can be deleted using the TRP1 gene as a deletion marker.
- the kit also comprises an agent for cleaning prions in sub-effective doses.
- a cleaning agent for the prion can be hydrogen peroxide or preferably, guanidium chloride.
- sub-effective doses are meant doses which used alone would not be enough to cure the prions of yeasts.
- the values of such doses are given, in the examples which follow, for guanidium chloride.
- the kit according to the invention can be used in a method for screening molecules with anti-prion activity.
- This screening method also targeted by the invention, is characterized in that it uses a phenotype yeast [PSI +] having the adel -14 allele of the ADE1 gene as well as an inactivated ERG6 gene and comprises the steps following: a. production of a cell mat in vitro on a medium supplemented with a sub-effective dose of a prion cleaning agent, b. deposit of the compounds to be tested according to the antibiogram method, c. incubation for approximately 2-4 days at approximately 20-25 ° C, and, d. analysis of the coloration of the cell colonies.
- PSI + phenotype yeast
- This method has advantages similar to those of the kit according to the invention. It is a visual test, very easy to analyze. Its implementation is very simple and inexpensive. The safety precautions are those of a conventional molecular biology laboratory. It allows massive screening: a single person can manually screen more than 400 products per day. Very high throughput screening would be possible by automating the method. The result of the screen is revealed after 7 days, without the need for heavy manipulations between D-day and D-day + 7 (possibly a change in temperature of the incubator). Finally, this method is particularly economical.
- One of the preferred yeasts for the implementation of this method is Saccharomyces cerevisiae.
- the cleaning agent from step a. is guanidium chloride.
- the method can also include the following steps: e. incubation for approximately 2-4 days at approximately 2-6 ° C, and / or, f. performing a secondary screening test.
- the secondary screening test may include the following steps: construction of a yeast strain in which the ADE2 gene is under the control of the promoter of the DAL5 gene carrying out steps a. to e. of the methods described above.
- the invention also covers the molecules isolated by the screening method according to the invention.
- the screening method made it possible to isolate anti-prion agents having the following formula (I):
- R ' is a group H, NH 2 , NHR 2 , where R 2 is an alkyl or alkylaminoalkyl chain of 1 to 10 carbons, branched or not, X represents F, Cl, Br, I, CF 3 , SR 3 , OR 3 , OH, NO 2 , COR 3 , CONH 2 , COOH, COOR 3 , where R 3 is an alkyl group of 1 to 4 carbons, preferably CH 3 . p and n, identical or different, equal 0, 1 or
- the invention covers in particular the anti-prion agents of formula (III):
- R ' represents a group H, NH 2 , NH- (CH 2 ) 3 - N (CH 3 ) _, NH-CH (CH 3 ) - (CH 2 ) 3-N (CH 2 -CH 3 ) 2 ,
- X represents F, Cl, CF 3 , p and n, identical or different, equal 0, 1 or 2.
- This family of molecules called “Kastellpaolitines” by the inventors, has to a greater or lesser degree the desired anti-prion activity.
- the chlorinated derivatives of this family are particularly effective. The best efficiencies are obtained when the chlorine is placed in position 2, 3, 4, preferably in position 4 (see KP1 in the examples which follow).
- the invention relates more particularly to the compounds of formula (II):
- R represents a group H, NH 2 , NH- (CH 2 ) 3 - N (CH 3 ) 2 , NH-CH (CH 3 ) - (CH 2 ) 3 -N (CH 2 -CH 3 ) 2 ,
- X represents F, Cl, CF 3 , p and n, identical or different, equal 0, 1 or 2, for use as a medicament, and in particular, as an anti-prion agent.
- compositions comprising a therapeutically effective amount of at least one compound of formula (II) in which:
- R ' represents a group H, NH 2 , NH- (CH 2 ) 3 -N (CH 3 ) 2 ,
- X represents F, Cl, CF 3 / p and n, identical or different, equal 0, 1 or 2, in combination with at least one pharmaceutically acceptable vehicle.
- Certain compounds of this family are particularly active. These are phenanthridine and 6-aminophenanthridine, as well as their chlorinated derivatives, in particular when the chlorine is placed in position 8, 9, 10, preferably in position 10 (see in the examples which follow) .
- R ' represents NH 2 .
- a very good activity of the molecules has been observed when R 'represents NH 2 .
- the invention also provides a method of treating neurodegenerative diseases involving protein aggregates, comprising a step of administration to an animal or to a patient of a therapeutically effective amount of at least one of the compounds of formula (I), ( II) or (III) according to the invention.
- the anti-prion agents according to the invention are particularly useful for obtaining a medicament intended for preventing and / or treating neurodegenerative diseases, in particular of the protein aggregation type, such as spongiform encephalopathies, diseases of 'Alzheimer's (tau), Parkinson's (synuclein ⁇ ) and Huntington's (huntingtin) ...
- neurodegenerative diseases in particular of the protein aggregation type, such as spongiform encephalopathies, diseases of 'Alzheimer's (tau), Parkinson's (synuclein ⁇ ) and Huntington's (huntingtin) ...
- These drugs can be for human or veterinary use, in particular for domestic animals (cows, sheep, ...) or wild animals (lynx, deer such as hinds, elks, ...)
- FIG. 1 relates to the feasibility of the screen
- FIG. 2 illustrates the screening protocol
- FIG. 3 relates to the isolation of
- Figure 4 relates to the determination of the activity of phenanthridine derivatives
- Figure 5 shows the results of the liquid cure tests
- Figure 6 relates to the screen • secondary based on the prion [URE3]
- Figure 7 demonstrates the validation of the test with chlorpromazine, quinacrine and verapamil
- Figure 8 presents the results of the effect of KP1 on the mammalian prion in an in vi model tro
- et
- Figure 9 relates to a structure / activity study carried out on the molecule of general formula (II).
- Example 1 Realization of the screen.
- Organisms Sacharomyces cerevisiae and culture media
- the haploid yeast strain [PSI +] 74-D694 (Mat a, adel -14, trpl -289, his3 - ⁇ 200, ura3 -52, leu2-3, 112) was used in the development of the screening method .
- the strain used is called "Strong” as it has a well defined phenotype when the termination factor 'translation Sup35p is in a prion or aggregate form.
- the inventors genetically modified this strain by introducing into it a mutation of the ERG6 gene.
- This gene is involved in the biosynthesis of ergosterol, a component of the yeast cell wall.
- the mutation was carried out by insertion at the ERG 6 gene chromosomal site of a "deletion cassette" corresponding to the TRP1 marker gene flanked by DNA sequences located upstream and downstream of the coding phase of the ERG6 gene.
- This cassette was produced by PCR using the plasmid pFA6a-kanMX6 as template and the oligonucleotides 0BMIO6O (5 ') and 0BMIO6I (3') as primers.
- yeast cells 74-D694 "Strong" having integrated the deletion cassette are those which develop on minimum media lacking in tryptophan
- the Aerg6:: TRP1 mutation was then verified by PCR using the genomic DNA of the STRg6 strain as a template and the oligonucleotides OBM1030 (5 ') and OBM1063 (3') as primers.
- PCR primers used have the following nucleotide sequences:
- yeast strains are cultivated at 30 ° C. in rich medium (YPD ⁇ ) or in minimum medium.
- YPD ⁇ rich medium
- the agar form is obtained by adding 2% agar.
- YPD ⁇ 1% yeast extract (FISHER®), 2% peptone (GIBCO®) and 2% glucose;
- Minimum medium 0.175% yeast ni trogen base wi thout amino acid and ammonium sulfate (DIFCO®), 0.75% ammonium sulfate and 2% glucose. This medium is brought to pH 6. In order to compensate for any auxotrophies, this medium can be supplemented, after sterilization, by adding amino acids
- the screening method developed is based on the principle of the antibiogram. Indeed, the compounds to be tested are deposited on a sterile filter paper disc, itself deposited on a box of solid YPD ⁇ medium containing 0.2 mM guanidium chloride previously seeded with approximately 5.10 th cells of the STRg6 strain in order to make a yeast mat. This quantity of seeded cells (from 10 e to 10 7 ) has been optimized so that each cell can divide at least 6 times (number of generations required to have an effective curing effect with 3 mM GuHCl).
- FIG. 2 illustrates the protocol of the screening method: (1) Culture of the STRg ⁇ strain; (2) Deposit and spread with sterile glass beads 3 & 4 mm in diameter, approximately 10 6 cells in exponential growth phase on a box of YPD ⁇ solid medium containing 0.2 mM guanidium chloride
- the 11-aminodibenzo [b, f] [1, 4] thiazepines also called Kastellpaolitins, can be prepared in a single step. The synthesis of these products has already been described in the publication of Mettey et al., 1997.
- Guanidium chloride the only known product " to effectively cure prions in the yeast Saccharomyces cerevisiae, served not only as a positive control throughout the screening, but also to study the feasibility of the method as well as to develop it Guanidium chloride effectively cures the various yeast prions at a dose of between 1 and 5 mM (Fernandez-Bellot and Cullin, 2001). Under these conditions, the cure requires a constant presence of this product for six to ten generations in exponential growth phase compromising the feasibility of the box screen as the inventors wanted to achieve.
- Figure 1 shows the feasibility of the screen.
- a strain [PSI +] is cultured for 48 hours in the presence of guanidium chloride at 5 mM (with 0.2% final DMSO) or, as a control with only 0.2% final DMSO.
- T 0 then every 24 hours, a drop of 10 ⁇ L (approximately 10 4 cells) is deposited on a dish of rich medium.
- the cure with guanidium chloride begins to have an effect after 24 hours of treatment, that is to say after approximately 6 generations (a pink coloration begins to appear).
- the drop of cells presents a clearly red coloration, sign of a complete cure of the cells [PSJ +].
- the first step therefore consisted in determining if guanidium chloride could have a viewable effect on dishes on [PSI +] cells with the antibiogram tablet system. Once this step has been carried out, the inventors have developed the optimal conditions of temperature, medium, density and also the cell type to be used.
- the strain with the best sensitivity is the STRg ⁇ strain cultivated at 23.5 ° C. and in the presence of 200 ⁇ M of guanidium chloride. Indeed, the introduction of a sub-effective dose of guanidium chloride into the medium makes it possible to increase the sensitivity of the test. Screening of a chemotherapist
- Example 2 Identification of Kastellpaoli tines and phenanthridine.
- Panel 3A shows a comparative analysis of the size of the red halos obtained respectively with all of these molecules
- the different molecules are classified there from the least active to the most active and their respective formulas indicated. All are tri-cyclic, the central cycle containing in all cases a nitrogen in double bond with an adjacent carbon.
- the carbon of the central cycle which is in double bond with this nitrogen carries an amino group, which is not the case for phenanthridine. This observation led the inventors to want to test 6-aminophenanthridine.
- 6-Aminophenanthridine can be prepared according to the procedure developed by Kessar et al, 1969.
- the ⁇ -aminophenanthridine was therefore screened according to the invention, in comparison with Kastellpaolitins 1 (KP1) and 5 (KP5) as well as with phenanthridine.
- KP1 and 5 Kastellpaolitins 1
- KP5 Kastellpaolitins 5
- phenanthridine 6-aminophenanthridine is even more active than Kastellpaolitines and than phenanthridine.
- Figure 4 illustrates the results of this comparison: the activity of 6-aminophenanthridine was determined on a dish and compared with that of phenanthridine. For all molecules, the same amount is deposited (10 ⁇ l of a 10 mM solution). In the case of the positive control (guanidium chloride), the solution used was 300 mM.
- the inventors then wanted to determine whether the red halos observed in the yeast test corresponded effectively to the prion cure [PSI +] and not to an artifact (for example these red halos could be due to a direct inhibition of the biosynthesis chain of adenine by these molecules, which would lead to an accumulation of AIR). If these molecules effectively cure the prion [PSI +], treatment in liquid culture of cells [PSI +] followed by washing of said cells must allow them to form red colonies on an agar medium no longer containing the molecules. These tests were carried out with 6-aminophenanthridine on the wild "strong" strain 74-D694.
- the curing conditions in liquid medium are as follows: a strain [PSI +] is cultivated for 5 days in liquid medium in the presence of the indicated quantities of the various products (see FIG. 5). Every 24 hours, an aliquot fraction is washed in a medium free of any product and deposited on a solid agar medium (also free of any product) which is then treated as indicated in FIG. 2.
- 6-aminophenanthridine is able to partially cure the [PST +] prion in a significant number of cells.
- the curing efficiency can be significantly increased by adding a sub-effective dose (100 ⁇ M) of guanidium chloride to the culture medium.
- a sub-effective dose 100 ⁇ M
- guanidium chloride 100 ⁇ M
- Example 5 Development and use of a secondary colorimetric screen based on the use of [URE3], another yeast prion
- the haploid strain used is CC34 (Mat a, trpl -1, ade2 -l, leu2-3, 112, his3 -ll, 15, ura2:: HIS3).
- the T34 strain which was used for the secondary screen was constructed from CC34, strain in which the coding phase of the DAL5 gene was replaced by that of the ADE2 gene using the same method as that used for the construction of the STRg ⁇ strain. .
- a deletion cassette corresponding to the ADE2 gene flanked by DNA sequences located upstream and downstream of the coding phase of the DAL5 gene was produced by PCR using genomic DNA from the haploid strain BY4742 (Mat ⁇ , his3 ⁇ l, leu ⁇ O, lys2 ⁇ Q, ura3 ⁇ 0) as matrix and the oligonucleotides:
- ATAGTCTCTGCTCATAG (SEQ ID N ° 7) (5 '), and, GCTTACAGAAATTCTAC (SEQ ID N ° 8) (3') as primers.
- the strain NT34 (Mat a, trpl -1, ade2-l, leu2-3, 112, his3 -ll, 15, ura2:: HIS3, dal5:: ADE2) was deposited at the CNCM on October 10, 2002 under the number 1-2942.
- This screen is based on the same color system as the primary screen.
- the ADE2 gene is no longer under the control of its own promoter, but under that of the DAL5 gene.
- the protein Ure2p is in prion form ([URE3])
- transcription from the promoter of the DAL5 gene is activated, therefore the ADE2 gene is expressed, therefore the strains are white and autotrophic for adenine.
- the protein Ure2p is in normal form ([ure3 -0])
- transcription from the DAL5 gene promoter is suppressed so the ADE2 gene is not expressed, so the strains are red and auxotrophic for adenine.
- the coding sequence of the ERG6 gene has also been replaced by that of the TRP1 gene.
- the transcription of ADE2 therefore depends on the state of Ure2p: if Ure2p is inactivated by a prionic mechanism (cells [URE3]), the ADE2 gene is actively transcribed while in cells [ure3-0 ], it is not.
- the cells [UR ⁇ 3] of the strain SB34 will form white colonies while the cells [ure3-0] will form red colonies. Since this strain still contains the ade2-1 allele, it has been envisaged that this strain could be [PSI +], so the red coloration could be due to the removal of [PSI +] rather than [URE3.
- the SB34 strain was constructed by replacing the ERG6 gene in CC34 by PCR amplification of the TRP1 marker and by replacing the coding region of the DAL5 gene with the ADE2 gene using a method based on PCR by deletion of the ERG6 gene with the primers (5 '-ACAACAAAACAAGGATAATCAAATAGTGTAAAAAAA AAAATTCAAGATGGATTCTAGAACAGTTGG-3') (SEQ ID n ° 9) and 342 (5'- TATATTCTTCTCTGATAACAATAATGTCAGTGTATCTCACCACTATTATTACTTGTTTCTAG ATAAG-3) This gene replacement was then confirmed by growth on SD-Ade medium, in the absence of growth on USA medium (as expected for a strain da25__) and by analytical PCR on genomic DNA.
- the phenotype [URE3] of this strain was verified by cytoduction: among 30 cytoducers, 26 were able to grow in the USA medium, showing that it was [URE3].
- the NT35 strain was constructed by replacing the ade2-1 gene in the SB34 strain with the KanMX marker amplified by PCR and verifying the successful replacement of the gene by analytical PCR on genomic DNA.
- 6-aminophenanthridine is able to cure the prion [URE3] significantly and, as for the prion [PSI +], this effect is accentuated by a low dose of guanidium chloride (200 ⁇ M).
- Example 7 Validation of the screen with two molecules active on the prion of PrP mammals: chlorpromazine and quinacrine
- Certain molecules such as quinacrine in particular (used as an anti-malarial for a long time) or chlorpromazine (an anti-depressant) have notable activity in their system.
- chlorpromazine an anti-depressant
- the inventors therefore tested chlorpromazine and quinacrine in their yeast system. As shown in Figure 7, these two molecules have some activity against the [PSJ +] prion. However, it should be noted that their activities are much lower than that of 6-aminophenanthridine.
- chlorpromazine and quinacrine like all of the molecules highlighted by the invention, exhibit a strong synergy of action with guanidium chloride (In FIG. 7, the medium used contains 200 ⁇ M guanidium chloride).
- the inventors determined the activity, in the test according to the invention, of other molecules isolated by means of the test based on mouse neuroblastomas, developed by Pr. Prusiner.
- a good correlation has been found between the results obtained in the two systems: acepromazine, which has been found to be slightly active in the mammalian system, has also shown low activity in the test according to the invention and the inactive molecules in the The analysis on mammals such as carbamazepine, imipramine, haloperidol, chloroprothixene or methylene blue were also inactive in the test.
- Quinacrine has also been described as an inhibitor of multiple drug resistance (MDR).
- MDR multiple drug resistance
- Neuroblastoma cells from mice infected with scrapie prion were used.
- the cells were cultured in 25 cm 2 flasks in the presence or absence of the compounds for several days.
- the proteins were extracted from ScN2a-22L cells by cell lysis in 500 ⁇ l of lysis buffer (50 mM Tris HC1 pH 7.5; 150 mM NaCl, 0.5% sodium deoxycholate; 0.5 % of Triton X100).
- lysis buffer 50 mM Tris HC1 pH 7.5; 150 mM NaCl, 0.5% sodium deoxycholate; 0.5 % of Triton X100.
- the adjusted amounts of cell lysates were digested with proteinase K at 20 ⁇ g / ml (Eurobio) for 40 min at 37 ° C.
- the lysates were then centrifuged for 90 min at 20,000 xg and the pellet was resuspended in 25 ⁇ l of denaturing buffer (1 X Tris-Glycine; 4% SDS, 2% ⁇ -mercaptoethanol; 5% sucrose and bromophenol blue) and heated for 5 min at 100 ° C. before analysis by Western blot according to the standard protocol using the anti-PrP SAF83 mouse monoclonal antibody
- KPl and 6AP Two of the selected compounds (KPl and 6AP) were tested in this mammalian system. As shown in Figure 8, KPl was able to induce a significant decrease in mammalian prion accumulation at a dose similar to that used for chlorpromazine (5 ⁇ M). After 7 days of treatment, 70% of the proteinase K-resistant PrP sc has disappeared (wells 1 to 3) compared to the untreated cells (wells 4 and 5). This significant effect was probably underestimated since the cells treated with the solvent for the compounds alone (DMSO 0.01%) showed a significant and reproducible increase in PrP sc resistant to proteinase K (well 6). The same effect on the elimination of PrP sc was obtained with 6AP at 2 and 4 ⁇ M.
- the inventors carried out a structure / activity study on the 6-aminophenanthridine molecule.
- the molecules of 2-fluoro-6-aminophenanthridine (2F-6AP), 2-fluoro-6-amino-8-chlorophenanthridine (2f-6A-8ClP) and ⁇ -amino-7-chlorophenanthridine (6A-7C1P) have thus obtained by chemical synthesis and their anti-prion activity was determined using the test O 2004/035813
- results obtained are shown in FIG. 9.
- the diameters of the red halos obtained being proportional to the anti-prion activity. of the molecules deposited, the results indicate that the presence of a halogen-type substituent at positions 7 or 8 increases the anti-prion activity of the molecules of formulas (II) while the same type of substituent in position 2 tends to decrease it.
- Fernandez-Bellot et al. "The protein-only theory and the yeast Saccharomyces cerevisiae: the prions and the propagons", CMLS, 2001, 58: 1857-1878.
- Kessar S.V. et al. Tetrahedron Letters, 1969, 1151.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Psychology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Other In-Based Heterocyclic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE60310744T DE60310744T2 (de) | 2002-10-18 | 2003-10-20 | Reihentestverfahren auf moleküle mit anti-prionaktivität: kits, methoden und moleküle |
CA2502544A CA2502544C (fr) | 2002-10-18 | 2003-10-20 | Criblage de molecules a activite anti-prion: kits, methodes et molecules criblees |
US10/531,594 US8129402B2 (en) | 2002-10-18 | 2003-10-20 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
JP2005501302A JP4529030B2 (ja) | 2002-10-18 | 2003-10-20 | 抗プリオン活性を有する分子のスクリーニングキットおよび抗プリオン活性を有する分子のスクリーニング方法およびスクリーニングされた分子 |
AU2003285413A AU2003285413A1 (en) | 2002-10-18 | 2003-10-20 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
EP03778411A EP1551992B1 (fr) | 2002-10-18 | 2003-10-20 | Criblage de molecules a activite anti-prion : kits, methodes et molecules criblees |
US11/483,822 US20070031821A1 (en) | 2002-10-18 | 2006-07-11 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
US12/858,235 US20110092483A1 (en) | 2002-10-18 | 2010-08-17 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
US13/328,611 US20120122916A1 (en) | 2002-10-18 | 2011-12-16 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0213022A FR2846008B1 (fr) | 2002-10-18 | 2002-10-18 | Criblage de molecules a activite anti-prion:kits, methodes et molecules criblees |
FR02/13022 | 2002-10-18 | ||
FR0308289A FR2846009B1 (fr) | 2002-10-18 | 2003-07-07 | Criblage de molecules a activite anti-prion:kits, methodes et molecules criblees |
FR03/08289 | 2003-07-07 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/483,822 Continuation-In-Part US20070031821A1 (en) | 2002-10-18 | 2006-07-11 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
US13/328,611 Continuation US20120122916A1 (en) | 2002-10-18 | 2011-12-16 | Screening molecules with anti-prion activity: kits, methods and screened molecules |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004035813A2 true WO2004035813A2 (fr) | 2004-04-29 |
WO2004035813A3 WO2004035813A3 (fr) | 2004-07-15 |
Family
ID=32071174
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2003/003101 WO2004035813A2 (fr) | 2002-10-18 | 2003-10-20 | Criblage de molecules a activite anti-prion : kits, methodes et molecules criblees |
Country Status (10)
Country | Link |
---|---|
US (4) | US8129402B2 (fr) |
EP (1) | EP1551992B1 (fr) |
JP (1) | JP4529030B2 (fr) |
AT (1) | ATE349550T1 (fr) |
AU (1) | AU2003285413A1 (fr) |
CA (1) | CA2502544C (fr) |
DE (1) | DE60310744T2 (fr) |
ES (1) | ES2279975T3 (fr) |
FR (1) | FR2846009B1 (fr) |
WO (1) | WO2004035813A2 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008041134A2 (fr) * | 2006-10-04 | 2008-04-10 | Centre National De La Recherche Scientifique (Cnrs) | Utilisation de derives de guanabenz de chlore dans le traitement des maladies a prions |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101481729B (zh) * | 2009-01-21 | 2014-04-16 | 辽宁大学 | 一种高灵敏度的利用基因突变酵母细胞筛选抗朊病毒药物的方法 |
WO2018073321A1 (fr) | 2016-10-18 | 2018-04-26 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Dérivés de produits naturels pour l'inhibition de la nécroptose cellulaire, de la ferroptose et de l'oxytosis |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3758479A (en) * | 1967-03-22 | 1973-09-11 | Sandoz Ag | Nitro and sulphamoyl substituted dibenzodiazepines |
US4024242A (en) * | 1974-06-25 | 1977-05-17 | Hoechst Aktiengesellschaft | Substance having immunological activity and process for its manufacture |
US5695782A (en) * | 1993-09-08 | 1997-12-09 | Ciba Geigy Corporation | Double-layered oxcarbazepine tablets |
WO1999029891A1 (fr) * | 1997-12-09 | 1999-06-17 | Arch Development Corporation | Procedes d'identification de facteurs regulant l'agregation de proteines d'amyloide de differentes origines |
WO2002065136A2 (fr) * | 2001-02-15 | 2002-08-22 | University Of Chicago | Cribles a base de levure pour le traitement de maladies humaines |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH0262826A (ja) * | 1988-08-30 | 1990-03-02 | Sawai Seiyaku Kk | 成人t細胞白血病治療剤 |
EP0565491A1 (fr) * | 1992-04-10 | 1993-10-13 | Dornag Ag | Dispositif d'accouplement, spécialement à fixer un porte-outil à une broche |
CN1189175C (zh) * | 1998-10-08 | 2005-02-16 | 高新研究公司 | 用于预防和治疗原虫病的组合物和方法 |
US6200771B1 (en) * | 1998-10-15 | 2001-03-13 | Cell Pathways, Inc. | Method of using a novel phosphodiesterase in pharmaceutical screeing to identify compounds for treatment of neoplasia |
US6479504B1 (en) * | 1999-06-16 | 2002-11-12 | The University Of Iowa Research Foundation | Antagonism of immunostimulatory CpG-oligonucleotides by 4-aminoquinolines and other weak bases |
-
2003
- 2003-07-07 FR FR0308289A patent/FR2846009B1/fr not_active Expired - Fee Related
- 2003-10-20 AU AU2003285413A patent/AU2003285413A1/en not_active Abandoned
- 2003-10-20 EP EP03778411A patent/EP1551992B1/fr not_active Expired - Lifetime
- 2003-10-20 AT AT03778411T patent/ATE349550T1/de not_active IP Right Cessation
- 2003-10-20 WO PCT/FR2003/003101 patent/WO2004035813A2/fr active IP Right Grant
- 2003-10-20 JP JP2005501302A patent/JP4529030B2/ja not_active Expired - Fee Related
- 2003-10-20 ES ES03778411T patent/ES2279975T3/es not_active Expired - Lifetime
- 2003-10-20 DE DE60310744T patent/DE60310744T2/de not_active Expired - Lifetime
- 2003-10-20 US US10/531,594 patent/US8129402B2/en not_active Expired - Fee Related
- 2003-10-20 CA CA2502544A patent/CA2502544C/fr not_active Expired - Fee Related
-
2006
- 2006-07-11 US US11/483,822 patent/US20070031821A1/en not_active Abandoned
-
2010
- 2010-08-17 US US12/858,235 patent/US20110092483A1/en not_active Abandoned
-
2011
- 2011-12-16 US US13/328,611 patent/US20120122916A1/en not_active Abandoned
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3758479A (en) * | 1967-03-22 | 1973-09-11 | Sandoz Ag | Nitro and sulphamoyl substituted dibenzodiazepines |
US4024242A (en) * | 1974-06-25 | 1977-05-17 | Hoechst Aktiengesellschaft | Substance having immunological activity and process for its manufacture |
US5695782A (en) * | 1993-09-08 | 1997-12-09 | Ciba Geigy Corporation | Double-layered oxcarbazepine tablets |
WO1999029891A1 (fr) * | 1997-12-09 | 1999-06-17 | Arch Development Corporation | Procedes d'identification de facteurs regulant l'agregation de proteines d'amyloide de differentes origines |
WO2002065136A2 (fr) * | 2001-02-15 | 2002-08-22 | University Of Chicago | Cribles a base de levure pour le traitement de maladies humaines |
Non-Patent Citations (8)
Title |
---|
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; juin 2000 (2000-06), TALLOCZY ZSOLT ET AL: "The (KIL-d) element specifically regulates viral gene expression in yeast." XP002237388 Database accession no. PREV200000387721 & GENETICS, vol. 155, no. 2, juin 2000 (2000-06), pages 601-609, ISSN: 0016-6731 * |
DATABASE EMBASE [Online] ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL; 1984, CROWLEY J C ET AL: "Molecular cloning of chromosome I DNA from Saccharomyces cerevisiae: Isolation of the ADE1 gene" XP002273243 Database accession no. EMB-1984159946 & JOURNAL OF BACTERIOLOGY 1984 UNITED STATES, vol. 159, no. 1, 1984, pages 413-417, * |
EMTER ROGER ET AL: "ERG6 and PDR5 regulate small lipophilic drug accumulation in yeast cells via distinct mechanisms." FEBS LETTERS, vol. 521, no. 1-3, 2002, pages 57-61, XP002237387 19 June, 2002 ISSN: 0014-5793 * |
KORTH CARSTEN ET AL: "Acridine and phenothiazine derivatives as pharmacotherapeutics for prion disease." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 98, no. 17, 14 août 2001 (2001-08-14), pages 9836-9841, XP002237386 August 14, 2001 ISSN: 0027-8424 cité dans la demande * |
METTEY Y ET AL.: "Synthesis of 11-AminodibenzoÄb,fÜthiazepines and Fluoro Derivatives" HETEROCYCLIC CHEM, vol. 34, 1997, pages 465-467, XP009008912 * |
S.V. KESSAR ET AL: "New Routes to Condensed Polynuclear Compounds, II Direct Benzyne Cyclisation of N-Chlorobenzylidene Arylamines" TETRAHEDRON LETTERS, 1969, pages 1155-1156, XP009009071 cité dans la demande * |
WEISSMAN J ET AL: "Mechanism of amyloid formation and propagation: Lessons from a yeast prion." BIOPHYSICAL JOURNAL, vol. 80, no. 1 Part 2, janvier 2001 (2001-01), page 329a, XP002237383 45th Annual Meeting of the Biophysical Society;Boston, Massachusetts, USA; February 17-21, 2001 ISSN: 0006-3495 * |
WICKNER R B ET AL: "Prions of yeast, ÄPSIÜ and ÄURE3Ü, as models for neurodegenerative diseases" COLD SPRING HARBOR SYMPOSIA ON QUANTITATIVE BIOLOGY 1996 UNITED STATES, vol. 61, 1996, pages 541-550, XP001098910 ISSN: 0091-7451 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008041134A2 (fr) * | 2006-10-04 | 2008-04-10 | Centre National De La Recherche Scientifique (Cnrs) | Utilisation de derives de guanabenz de chlore dans le traitement des maladies a prions |
WO2008041134A3 (fr) * | 2006-10-04 | 2008-06-19 | Centre Nat Rech Scient | Utilisation de derives de guanabenz de chlore dans le traitement des maladies a prions |
Also Published As
Publication number | Publication date |
---|---|
CA2502544C (fr) | 2012-11-20 |
FR2846009A1 (fr) | 2004-04-23 |
US20070031821A1 (en) | 2007-02-08 |
US20060172337A1 (en) | 2006-08-03 |
US20120122916A1 (en) | 2012-05-17 |
CA2502544A1 (fr) | 2004-04-29 |
FR2846009B1 (fr) | 2007-10-12 |
AU2003285413A8 (en) | 2004-05-04 |
EP1551992B1 (fr) | 2006-12-27 |
AU2003285413A1 (en) | 2004-05-04 |
ATE349550T1 (de) | 2007-01-15 |
JP2006502745A (ja) | 2006-01-26 |
JP4529030B2 (ja) | 2010-08-25 |
US20110092483A1 (en) | 2011-04-21 |
DE60310744D1 (de) | 2007-02-08 |
US8129402B2 (en) | 2012-03-06 |
DE60310744T2 (de) | 2007-10-11 |
ES2279975T3 (es) | 2007-09-01 |
WO2004035813A3 (fr) | 2004-07-15 |
EP1551992A2 (fr) | 2005-07-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Silao et al. | Mitochondrial proline catabolism activates Ras1/cAMP/PKA-induced filamentation in Candida albicans | |
O’Meara et al. | Global analysis of fungal morphology exposes mechanisms of host cell escape | |
Camargo et al. | Serial daptomycin selection generates daptomycin-nonsusceptible Staphylococcus aureus strains with a heterogeneous vancomycin-intermediate phenotype | |
Isaac et al. | Macrophage cell death and transcriptional response are actively triggered by the fungal virulence factor C bp1 during H. capsulatum infection | |
Bojsen et al. | A common mechanism involving the TORC1 pathway can lead to amphotericin B-persistence in biofilm and planktonic Saccharomyces cerevisiae populations | |
Moily et al. | Transcriptional profiles for distinct aggregation states of mutant Huntingtin exon 1 protein unmask new Huntington's disease pathways | |
Xu et al. | The Toll pathway mediates Drosophila resilience to Aspergillus mycotoxins through specific Bomanins | |
Chowdhury et al. | Loss of outer membrane protein A (OmpA) impairs the survival of Salmonella Typhimurium by inducing membrane damage in the presence of ceftazidime and meropenem | |
Commandeur et al. | Zebrafish embryo model for assessment of drug efficacy on mycobacterial persisters | |
EP1551992B1 (fr) | Criblage de molecules a activite anti-prion : kits, methodes et molecules criblees | |
EP3268463B1 (fr) | Milieu et procede de culture des mycobacteries comprenant du serum d'agneau | |
Brauer et al. | Preferential catabolism of l‐vs d‐serine by Proteus mirabilis contributes to pathogenesis and catheter‐associated urinary tract infection | |
FR2846008A1 (fr) | Criblage de molecules a activite anti-prion:kits, methodes et molecules criblees | |
EP3044569B1 (fr) | Procédé fluorimétrique simplifié pour évaluer l'influence d'une condition sur un échantillon biologique et ses applications | |
Wallinga et al. | MDMA-induced serotonergic neurotoxicity enhances aggressiveness in low-but not high-aggressive rats | |
Zheng et al. | Antiviral discovery in toxic cyanobacteria: Low hanging fruit in the age of pandemics | |
Kaczanowski et al. | Formation and degradation of large extrusion bodies in Tetrahymena thermophila: the role of intramacronuclear microtubules in chromatin segregation | |
Ennis | Genetic regulation of antifungal drug resistance in Candida albicans and Candida auris | |
Romo | Towards the Development of Anti-virulence Approaches for Candidiasis: A Novel Series of Small Molecule Inhibitors of Candida albicans Filamentation and Biofilm Formation | |
Harrouard | Phenotypic diversity of Brettanomyces bruxellensis and adaptation to fermentation processes | |
Chen et al. | Comparative Transcriptome Analysis of T. rubrum, T. mentagrophytes and M. gypseum Dermatophyte Biofilms in Response to Photodynamic Therapy | |
Rajasenan | Analysis of Sterol Regulatory Element Binding Protein (SREBP) dependent regulation of gaseous signaling and cell biology during fungal biofilm development in Aspergillus nidulans | |
Barré | Natural variations in yeast aging reveal genetic and environmental factors | |
Wang et al. | Starvation Elicits PspA-Dependent Phenotypic Antibiotic Tolerance in Escherichia Coli | |
JP2003009899A (ja) | 化合物のスクリーニング方法 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2502544 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005501302 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003778411 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2003778411 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2006172337 Country of ref document: US Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10531594 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10531594 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 10531594 Country of ref document: US |
|
WWG | Wipo information: grant in national office |
Ref document number: 2003778411 Country of ref document: EP |