WO2004031375A2 - Regulation de la pde1c humaine - Google Patents

Regulation de la pde1c humaine Download PDF

Info

Publication number
WO2004031375A2
WO2004031375A2 PCT/EP2003/010833 EP0310833W WO2004031375A2 WO 2004031375 A2 WO2004031375 A2 WO 2004031375A2 EP 0310833 W EP0310833 W EP 0310833W WO 2004031375 A2 WO2004031375 A2 WO 2004031375A2
Authority
WO
WIPO (PCT)
Prior art keywords
pdeic
polypeptide
polynucleotide
activity
human
Prior art date
Application number
PCT/EP2003/010833
Other languages
English (en)
Other versions
WO2004031375A3 (fr
Inventor
Jiing-Ren Liou
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2003276009A priority Critical patent/AU2003276009A1/en
Publication of WO2004031375A2 publication Critical patent/WO2004031375A2/fr
Publication of WO2004031375A3 publication Critical patent/WO2004031375A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)

Definitions

  • the invention relates to the regulation of human phosphodiesterase 1 C (PDEIC).
  • 3 ',5' cyclic nucleotide phosphodiesterases catalyze the hydrolysis of 3 ',5'- cyclic nucleotides to their respective nucleoside 5'-monophosphates. Because of the importance of these enzymes, there is a need in the art to identify additional members of this enzyme family, which can be regulated to provide therapeutic effects.
  • Fig. 1 shows the DNA-sequence encoding a PDEIC Polypeptide (SEQ ID NO: 1).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.l (SEQ ID NO: 2). DETAILED DESCRIPTION OF THE INVENTION
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • amino acid sequences which are at least about 20% identical to the amino acid sequence shown in SEQ ID NO: 2; the amino acid sequence shown in SEQ ID NO: 2;
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a PDEIC polypeptide.
  • the human PDEIC of the invention is a splice variant of the human calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase IC (swissnew
  • the amino acid sequence is shown in SEQ ID NO: 2; its coding sequence is shown in SEQ ID NO: 1. This gene maps to chromosome 7 ⁇ l4.3.
  • SEQ ID NO: 2 is identical to human calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase IC from amino acid position 39 except that it contains extra exons at the N terminus.
  • the almost identical hit (the 8 amino acid difference is from an alternative exon at the very 5' end) to an unnamed ORF (highly similar to calcium calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase IC; tremblnew
  • the 3D structure refers it to a phosphodiesterase 4b fragment: catalytic domain;(pde4b) mutant. It is a 3'5'-cyclic nucleotide phosphodiesterase.
  • a PDEASE region is identified.
  • Related EST (BG719719) is expressed in testis.
  • Human PDEIC of the invention is expected to be useful for the same purposes as previously identified PDEIC enzymes. Human PDEIC is believed to be useful in therapeutic methods to treat disorders such as cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders. Human PDEIC also can be used to screen for human PDEIC activators and inhibitors.
  • One embodiment of the present invention is an expression vector containing any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a host cell containing any expression vector of the present invention.
  • Still another embodiment of the present invention is a substantially purified PDEIC polypeptide encoded by any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a method of producing a PDEIC polypeptide of the present invention, wherein the method comprises the following steps:
  • Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a PDEIC polypeptide in a biological sample comprising the following steps:
  • Yet another embodiment of the present invention is a diagnostic kit for conducting any method of the present invention.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a PDEIC, comprising the steps of:
  • Still another embodiment of the present invention is a method of screening for agents which regulate the activity of a PDEIC, comprising the steps of:
  • a test compound which increases the PDEIC activity is identified as a potential therapeutic agent for increasing the activity of the PDEIC, and wherein a test compound which decreases the PDEIC activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the PDEIC.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a PDEIC, comprising the step of:
  • test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of PDE 1 C .
  • Yet another embodiment of the present invention is a method of reducing the activity of a PDEIC, comprising the step of:
  • Still another embodiment of the present invention is a reagent that modulates the activity of a PDEIC polypeptide or a polynucleotide wherein said reagent is identified by any methods of the present invention.
  • a pharmaceutical composition comprising:
  • an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier is provided.
  • Yet another embodiment of the present invention is the use of an expression vector of the present invention or a reagent of the present invention for modulating the activity of a PDEIC in a disease, preferably cancer, diabetes, a neurological disorder, asthma, obesity or a cardiovascular disorder.
  • the invention thus provides a human PDEIC that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
  • Human PDEIC and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
  • Human PDEIC polypeptides according to the invention comprise at least 6, 10, 15,
  • a PDEIC polypeptide of the invention therefore can be a portion of a PDEIC protein, a full- length PDEIC protein, or a fusion protein comprising all or a portion of a PDEIC protein.
  • Human PDEIC polypeptide variants that are biologically active, e.g., retain enzymatic activity, also are human PDEIC polypeptides.
  • naturally or non-naturally occurring human PDEIC polypeptide variants have amino acid sequences which are at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof.
  • NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 59:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.
  • the "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 55:2444(1988), and by Pearson, Meth. Enzymol 183:63 (1990).
  • the ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score.
  • the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the
  • Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:187 (1974)), which allows for amino acid insertions and deletions.
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • % identity of a first sequence towards a second sequence means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson JD, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human PDEIC polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • the invention additionally, encompasses PDEIC polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phos- phorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the PDEIC polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of PDEIC polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Fusion proteins are useful for generating antibodies against PDEIC polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human PDEIC polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human PDEIC polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, or 314 contiguous amino acids of SEQ ID NO: 2 or of a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full- length PDEIC protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • DBD Lex a DNA binding domain
  • GAL4 DNA binding domain
  • HSV herpes simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the PDEIC polypeptide-encoding sequence and the heterologous protein sequence, so that the PDEIC polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI),
  • Species homologs of human PDEIC polypeptide can be obtained using PDEIC polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of PDEIC polypeptide, and expressing the cDNAs as is known in the art.
  • PDEIC polypeptide polynucleotides described below
  • a human PDEIC polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a PDEIC polypeptide.
  • a coding sequence for human PDEIC is shown in SEQ ID NO: 1.
  • nucleotide sequences encoding human PDEIC polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, prefera- bly about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ
  • PDEIC polynucleotides Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affme gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of PDEIC polynucleotides that encode biologically active PDEIC polypeptides also are PDEIC polynucleotides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are PDEIC polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
  • Variants and homologs of the PDEIC polynucleotides described above also are PDEIC polynucleotides.
  • homologous PDEIC polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known PDEIC polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions ⁇ 2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each— homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the PDEIC polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of PDEIC polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol 81, 123 (1973).
  • Variants of human PDEIC polynucleotides or PDEIC polynucleotides of other species can therefore be identified by hybridizing a putative homologous PDEIC polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to PDEIC polynucleotides or their comple- ments following stringent hybridization and/or wash conditions also are PDEIC polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a PDEIC polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a human PDEIC polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated PDEIC polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise PDEIC nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
  • Human PDEIC cDNA molecules can be made with standard molecular biology techniques, using PDEIC mRNA as a template. Human PDEIC cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template. Alternatively, synthetic chemistry techniques can be used to synthesize PDEIC polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human PDEIC polypeptide having, for example, an amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al, Nucleic Acids Res. 16, 8186, 1988; Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991; Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991).
  • PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA
  • Human PDEIC polypeptides can be obtained, for example, by purification from human cells, by expression of PDEIC polynucleotides, or by direct chemical synthesis.
  • Human PDEIC polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with PDEIC polynucleotides.
  • a purified PDEIC polypeptide is separated from other compounds that normally associate with the PDEIC polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified PDEIC polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding PDEIC polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human PDEIC polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340. Host cells
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed PDEIC polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • CHO, HeLa, MDCK, HEK293, and WI38 Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38) are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein. See WO 01/98340.
  • host cells which contain a human PDEIC polynucleotide and which express a human PDEIC polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding PDEIC polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human PDEIC polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human PDEIC polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained mtracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode PDEIC polypeptides can be designed to contain signal sequences which direct secretion of soluble PDEIC polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound PDEIC polypeptide. See WO 01/98340.
  • Chemical synthesis Sequences encoding a human PDEIC polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a human PDEIC polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154,
  • PDEIC polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons can be advantageous to produce.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter PDEIC polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human PDEIC polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • An antibody which specifically binds to an epitope of a human PDEIC polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immuno- precipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immuno- precipitations, or other immunochemical assays known in the art.
  • Various immuno- assays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human PDEIC polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies that specifically bind to PDEIC polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human PDEIC polypeptide from solution. See WO 01/98340.
  • Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of PDEIC gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol Biol 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
  • Modifications of PDEIC gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the PDEIC gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human PDEIC polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the PDEIC polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). See WO 01/98340.
  • genes whose products interact with human PDEIC may represent genes that are differentially expressed in disorders including, but not limited to, cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human PDEIC gene or gene product may itself be tested for differential expression.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al., Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, N twre 308, 149-53; Lee et al, Proc. Natl Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human PDEIC.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human PDEIC.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human PDEIC gene or gene product are up-regulated or down- regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human PDEIC polypeptide or a human PDEIC polynucleotide.
  • a test compound preferably binds to a human PDEIC polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to PDEIC polypeptides or polynucleotides or to affect PDEIC activity or PDEIC gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates.
  • the wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl Acad. Sci. U.S.A. 19, 1614-18 (1994).
  • the cells are placed under agarose in perri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photoli ker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the PDEIC polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the PDEIC polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the PDEIC polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • binding of a test compound to a human PDEIC polypeptide can be determined without labeling either of the interactants.
  • a micro- physiometer can be used to detect binding of a test compound with a human PDEIC polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • LAPS light- addressable potentiometric sensor
  • Determining the ability of a test compound to bind to a human PDEIC polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345,
  • BiA Bimolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a human PDEIC polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al,
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a human PDEIC polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the PDEIC polypeptide.
  • a reporter gene e.g., LacZ
  • either the PDEIC polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human PDEIC polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the PDEIC polypeptide is a fusion protein comprising a domain that allows the PDEIC polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed PDEIC polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • polynucleotides or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinylation kit Pierce Chemicals, Rockford, 111.
  • streptavidin-coated 96 well plates Piereptavidin-coated 96 well plates
  • antibodies which specifically bind to a PDEIC polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the PDEIC polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • GST-immobilized complexes include immunodetection of complexes using antibodies which specifically bind to the PDEIC polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the PDEIC polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • test compounds which bind to a human PDEIC polypeptide or polynucleotide also can be carried out in an intact cell.
  • Any cell which comprises a PDEIC polypeptide or polynucleotide can be used in a cell-based assay system.
  • a PDEIC polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a
  • PDEIC polypeptide or polynucleotide is determined as described above. Enzymatic activity
  • Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human PDEIC polypeptide. Enzymatic activity can be measured, for example, as described in Example 4.
  • Enzyme assays can be carried out after contacting either a purified PDEIC polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases enzymatic activity of a human PDEIC polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing PDEIC activity.
  • a test compound which increases enzymatic activity of a human PDEIC polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human PDE1 C activity.
  • test compounds that increase or decrease PDEIC gene expression are identified.
  • a PDEIC polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the PDEIC polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • the test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of PDEIC mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human PDEIC polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human PDEIC polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human PDEIC polynucleotide can be used in a cell- based assay system.
  • the PDEIC polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human PDEIC polypeptide, PDEIC polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a PDEIC polypeptide, or mimetics, activators, or inhibitors of a human
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • a filler or binders such as lactose or starches
  • lubricants such as talc or magnesium stearate
  • stabilizers optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human PDEIC can be regulated to treat cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these aberrant physiologies, along with the acquisition of drug- resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
  • proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
  • Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • Phosphodiesterases catalyze the formation of cAMP and cGMP. Inhibitors of phosphodiesterases would result in the increase of intracellular levels of cAMP and / or cGMP. Both cAMP and cGMP regulate many biological processes, including cell proliferation and apoptosis. It has been shown that membrane permeant analogues of cGMP induce cell death in leukemia cell (Bioorganic & Medicinal Chemistry Letters 10, 571-572, 2000). Inhibition of cGMP phosphodiesterase activity results in protein kinase G activation and attenuation of beta-catenin (Cancer research 60, 3338-3342, 2000). In addition, expression of constitutively activated mutants of Protein Kinase G results in the induction of apoptosis (AACR 2001, Abstract # 3450).
  • Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
  • type 1 diabetes juvenile onset
  • type 2 diabetes adult onset
  • Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
  • Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
  • Other agents that induce beta cell proliferation and regeneration also are potential therapies.
  • Type II diabetes is the most common of the two diabetic conditions (6% of the population).
  • the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
  • Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
  • the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
  • Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
  • the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
  • Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
  • Type I and Type II diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
  • agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
  • Central and peripheral nervous system disorders can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
  • Pain that is associated with neurological disorders also can be treated by regulating the activity of human PDEIC. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • central nervous system disorders such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIN/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache, and chronic
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an
  • IgE-dependent or T cell-dependent hypersensitivity reaction can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is though to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a narrowing of the airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • cyclosporin is used as a immuno- suppressant after organ transplantation. While these agents may represent alternatives to steroids in the treatment of asthmatics, they inhibit interleukin-2 dependent T lymphocyte proliferation and potentially critical immune functions associated with homeostasis.
  • Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss. Agents that either increase energy expenditure and/or decrease energy intake, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities. Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
  • This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
  • this gene translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperlipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
  • obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperlipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsu
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right- sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as brady cardie forms of arrhythmias.
  • vascular diseases include primary as well as all kinds of secondary arterial hyper- tension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • Cyclic GMP cGMP
  • cyclic AMP cyclic AMP
  • GPCRs G protein-coupled receptors
  • PDEs 3',5'-cyclic nucleotide phosphodiesterases catalyze the hydrolysis of 3',5'- cyclic nucleotides to their respective nucleoside 5'-monophosphates.
  • Human PDEs are classified into several families. The PDE1 family comprises calcium/calmodulin- activated PDEs. PDE1 isoenzymes are responsible for the degradation of cAMP and cGMP in various tissues.
  • PDE1 isoenzymes are highly expressed in the heart (Loughney et.al, JBC (1996) 271, 796-806). PDE1 has also been detected in vascular smooth muscle cells (Rybalkin et.al, Circ. Res. (2002) 90, 151-157) and in rabbit aorta (Ahn et.al., Biochem. Pharmacol. (1989) 38, 3331-3339). PDE1 inhibitors have been shown to relaxe precontracted rat aortic rings (Schoeffter et.al., Biochem. Pharmacol. (1987) 36, 3965-3972). It is therefore highly likely that PDE1 inhibitors induce vasodilation by reducing the degradation and thereby increasing the intracellular levels of cAMP and cGMP.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human PDEIC polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects PDEIC activity can be administered to a human cell, either in vitro or in vivo, to reduce PDEIC activity.
  • the reagent preferably binds to an expression product of a human PDEIC gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 mol of liposome delivered to about 10 6 cells.
  • a liposome is between about 100 and
  • 500 nm more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al Trends in Biotechnol 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases enzymatic activity relative to the enzymatic activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD50 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED 50 .
  • compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 5 o with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human PDEIC gene or the activity of a PDEIC polypeptide by at least about 10, preferably about 50, more preferably about
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human PDEIC gene or the activity of a human PDEIC polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to PDElC-specific mRNA, quantitative RT-PCR, immunologic detection of a human PDEIC polypeptide, or measurement of enzymatic activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human PDEIC also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding
  • PDEIC in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • mutations can also be detected by in situ analysis.
  • Altered levels of PDEIC also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-PDElC polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and PDEIC assays are performed in duplicate as follows: 0.5-1 ⁇ g of the cell extract is incubated for 15 min at 30°C with appropriate concentrations of either 2,8-[3H]cAMP or 8-[3H]cGMP in a buffer containing 40 mM Tris, pH 7.5, 10 mM MgC12, and 0.1 unit of snake venome nucleotidase.
  • Reactions are terminated by the addition of EDTA, AMP, and cAMP to final concentrations of 10, 1.25, and 1.25 mM, respectively, and transfer to 4°C.
  • Reaction mixtures are applied to AG-1-X8 anion exchange columns (Bio-Rad) and the hydrolyzed products are eluted with 50% ethanol.
  • the 3H content of the eluate is determined using a liquid scintillation counter. Analysis and plotting of kinetic data is performed by using the computer program Kaleidagraph.
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human PDEIC polypeptides in yeast.
  • the PDElC-encoding DNA sequence is derived from SEQ ID NO: 1. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human PDEIC polypeptide is obtained.
  • Purified PDEIC polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human PDEIC polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells.
  • Binding of a test compound to a human PDEIC polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human PDEIC polypeptide.
  • test compound which decreases PDEIC gene expression
  • a test compound is administered to a culture of human cells fransfected with a PDEIC expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been fransfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled PDElC-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
  • a test compound that decreases the PDElC-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of PDEIC gene expression.
  • a test compound is administered to a culture of human cells fransfected with a PDE1A expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been fransfected is incubated for the same time without the test compound to provide a negative control.
  • Enzymatic activity can be measured as described in U.S. Patent 6,350,603.
  • a test compound which decreases the enzymatic activity of the PDEIC relative to the enzymatic activity in the absence of the test compound is identified as an inhibitor of PDEIC activity.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • colon (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
  • PDEIC is involved in the disease process of diabetes
  • the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
  • Human islet cells and an islet cell library also are tested.
  • the expression of PDEIC in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
  • adipose tissue subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
  • tissue fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
  • the following whole body panel is screened to show predominant or relatively high expression in lung or immune tissues: brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung or immune tissues brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung and immune system cells are screened to localize expression to particular cell subsets: lung microvascular endothelial cells, bronchial tracheal epithelial cells, bronchial/- tracheal smooth muscle cells, lung fibroblasts, T cells (T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes), B cells, mononuclear cells (monocytes and macrophages), mast cells, eosinophils, neutrophils, and dendritic cells.
  • T cells T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes
  • B cells mononuclear cells (monocytes and macrophages)
  • mast cells eosinophils, neutrophils, and dendritic cells.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993.
  • the principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
  • RNA extraction and cDNA preparation Total R ⁇ A from the tissues listed above are used for expression quantification.
  • R ⁇ As labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
  • RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l
  • RNase inhibitor PE Applied Biosystems, CA
  • 10 mM Tris-HCl pH 7.9 10 mM Tris-HCl pH 7.9
  • lOmM MgCl 2 50 mM NaCl
  • 1 mM DTT 1 mM DTT
  • RNA is extracted once with 1 volume of phenolxhloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse
  • RNA Transcription Reagents PE Applied Biosystems, CA
  • the final concentration of RNA in the reaction mix is 200 ng/ ⁇ L.
  • Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO 2 atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems
  • oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
  • test oligonucleotide for seven days results in significantly reduced expression of human PDEIC as determined by Western blotting. This effect is not observed with the control oligonucleotide.
  • the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human PDEIC has an anti-proliferative effect on cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c
  • Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • specific readout assay protocol these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micro- pocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10% formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at pre- determined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F- test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0.
  • Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
  • Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05.
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size.
  • Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the confralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment.
  • Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
  • Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves.
  • Significance is p ⁇ 0.05 by a log-rank test compared to the confrol group in the experiment.
  • the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injection of 40 mg kg of streptozotocin while C57BL KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • test compounds which regulate PDEIC are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area- under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin adminisfration.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely consfrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, ETC Inc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, H ⁇ rby, Sweden).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10 °C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
  • test 3 is given for no reaction of movement.
  • the test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP mesencephalic dopaminergic
  • DAergic mesencephalic dopaminergic
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink.
  • the brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C.
  • sledge microtome (mod. 3800-Frigocut, Leica) 25 ⁇ m sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
  • TH free-floating tyrosine hydroxylase
  • Rotarod Test We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod.
  • the system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is tenninated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
  • T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
  • a mouse is put into the start arm at the beginning of training.
  • the guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door.
  • the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed.
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • BALB/c mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11 (purified hamster anti-mouse CD3 ⁇ monoclonal antibodies, PHARMINGEN).
  • a test compound is administered intraperitoneally 60 min prior to the anti-CD3 niAb injection.
  • Blood is collected 90 minutes after the antibody injection.
  • Serum is obtained by centrifugation at 3000 r.p.m. for 10 min.
  • IL-2 and IL-4 levels in the serum are determined by an ELISA.
  • mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered infraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMASA's ELISA kit and their Ig subtypes are done by an Ig ELISA KIT (Rougier Biotech's, Montreal, Canada).
  • mice are injected infraperitoneally with LPS (200 ⁇ g/mouse). Compound is administered infraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- ⁇ concentration in the sample is determined using an ELISA kit.
  • BALB/c mice are injected infradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch.
  • On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
  • IL-5 300 ng/mouse
  • leukocytes in exudate is collected and the number of total cells is counted.
  • the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution.
  • D10.G4.1 cells (1 x 10 7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is admimstered infraperitoneally at -4 and +1 hr after these cells injection.
  • PCA Passive cutaneous anaphylaxis
  • % inhibition ⁇ (mean vehicle value - sample value)/(mean vehicle value - mean control value) ⁇ x 100
  • PIP Pulmonary inflation pressure
  • Animals are orally gavaged (2 ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/- compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO inhalation.
  • the purpose of this protocol is to determine the effect of chronic adminisfration of an unknown compound on body weight of mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks.
  • the body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow.
  • Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight (Brown et al, Br. J. Pharmacol. 132, 1898-1904, 2001; Guerre-Millom et al, J. Biol Chem. 275 (22), 16638-42, 2000; Han et al, Int. J. Obes. Relat. Metab. Disord. 23, 174-9, 1999; Surwit et al, Endocrinology 141 (10), 3630-37, 2000).
  • Mice are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Mice are single housed in shoeboxes. Animals are sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Mice are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar.
  • Animals are orally gavaged (5ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/- compound. At this time, body weight, food and water consumption are measured. Data is analyzed using appropriate statistics following the research design. On the final day, animals are euthanized using CO 2 inhalation.
  • This protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats.
  • the fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects.
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans.
  • the efficacy test The rats are fasted overnight during the dark phase (total of approx. 16-18 hrs). The animal is dosed orally with his assigned treatment (2 mg/ml). One hour after dosing, pre- eighed food jars are returned to the cage. Food intake is recorded 30, 60, 90, 180, 240 minutes post food return. At each time point, spillage is returned to the food jar and then the food jars are weighed. The amount of food consumed is determined for each time point. Difference between treatment group is determined using appropriate statistical analysis. Blavet et al, Gen Pharmacology 13, 293-97, 1982; Grignaschi et al, Br. J. Pharmacol. 127, 1190-94, 1999; McTavish & Heel, Drug. 43, 713-33, 1992; Rowland et al, Life Science 36, 2295- 300, 1985.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Triglyceride-lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in Solutol/Ethanol/saline mixtures) and applied by oral gavage or intravenous injection.
  • Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INFINITYTM triglyceride reagent; Sigma, St. Louis).
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
  • Plasma levels of human apolipoprotein-AI in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • the animals of control groups only receive the vehicle.
  • mean blood pressure and heart rate of treated and untreated control groups are measured.
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer IVH4, M ⁇ nchen, Germany).
  • LCX left coronary artery
  • dP/dt Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA). The maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax). After completion of the instrumentation, an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose. Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
  • RNA contamination For relative quantitation of the mRNA distribution, total RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen,
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 u/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • Forward and reverse primers and probes were designed using the Perkin Elmer ABI Primer ExpressTM software and were synthesized by TibMolBiol (Berlin, Germany). The forward primer sequence was: Primerl ggatcctgatgaaccaccac The reverse primer sequence was Primer2 ggataccaccaccaatcagg.
  • Probe 1 tccaccaagaccaatgctcagattt, labeled with FAM (carboxyfluorescein succinimidyl ester) as the reporter dye and TAMRA (carboxy- tetramethylrhodamine) as the quencher, was used as a probe.
  • FAM carboxyfluorescein succinimidyl ester
  • TAMRA carboxy- tetramethylrhodamine
  • the following reagents were prepared in a total of 25 ⁇ l : lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l AmpliTaq GoldTM, 0.01 U/ ⁇ l AmpErase, and Probe 1 tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 ⁇ 1 of template cDNA.
  • Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95 °C, followed by 40 cycles of melting at 95°C for 15 sec and annealing/extending at 60°C for 1 min. Calculation of corrected CT values
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle correction) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CT H K G - values were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CT/HK G - n -mean value (CT HKGI -value + CT/HKG2-vafue + ... + CTHKG- n -value) / n.
  • CT C D N A-n CT value of the tested gene for the cDNA n
  • CF CDNA - ⁇ correction factor for cDNA n
  • CT CO ⁇ - CDNA - ⁇ corrected CT value for a gene on cDNA n
  • highest CTCO ⁇ -CDNA- ⁇ ⁇ 40 is defined as CT cor - cDN A [high]
  • HUVEC cells 16 fetal brain 8540 brain 13682 alzheimer brain 44762 cerebellum 910 cerebellum (right) 17805 cerebellum (left) 18690 cerebral cortex 60305 alzheimer cerebral cortex 35120 frontal lobe 59475 alzheimer brain frontal lobe 68794 occipital lobe 53602 parietal lobe 50012 temporal lobe 58251 precentral gyrus 46663 postcentral gyrus 1607 tonsilla cerebelli 11505 vermis cerebelli 14263 pons 69755 substantia nigra 100025 cerebral meninges 119 cerebral peduncles 8964 corpus callosum 139509 hippocampus 72717 thalamus 26616 dorsal root ganglia 236 spinal cord 20453 neuroblastoma SK-N-MC cells 18 neuroblastoma SH-SY5Y cells 0 neuroblastoma IMR32 cells 519 glial tumor
  • HeLa cells 19 placenta 917 uterus 3236 uterus tumor 923 ovary 8780 ovary tumor 12246 breast 11037 breast tumor 596
  • MDA MB 231 cells (breast tumor) 89 mammary gland 6794
  • the expression profile shows that human PDEIC is involved in the following diseases and conditions: cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders.
  • Modulators of the human PDEIC can be used to treat cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders.
  • Regulators of the expression of human PDEIC can be used to treat cancer, diabetes, neurological disorders, asthma, obesity, and cardiovascular disorders.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des réactifs qui régulent la PDE1C humaine et des réactifs qui fixent des produits géniques de la PDE1C, pouvant jouer un rôle dans la prévention, le traitement ou la correction de dysfonctions ou de maladies, telles que, sans en exclure d'autres, le cancer, le diabète, les troubles neurologiques, l'asthme, l'obésité et les troubles cardiovasculaires.
PCT/EP2003/010833 2002-10-01 2003-09-30 Regulation de la pde1c humaine WO2004031375A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003276009A AU2003276009A1 (en) 2002-10-01 2003-09-30 Regulation of human 3', 5' cyclic nucleotide phosphodiesterase pde1c

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US41463402P 2002-10-01 2002-10-01
US60/414,634 2002-10-01
US43444402P 2002-12-19 2002-12-19
US60/434,444 2002-12-19

Publications (2)

Publication Number Publication Date
WO2004031375A2 true WO2004031375A2 (fr) 2004-04-15
WO2004031375A3 WO2004031375A3 (fr) 2004-07-15

Family

ID=32073336

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/010833 WO2004031375A2 (fr) 2002-10-01 2003-09-30 Regulation de la pde1c humaine

Country Status (2)

Country Link
AU (1) AU2003276009A1 (fr)
WO (1) WO2004031375A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004080374A2 (fr) * 2003-03-13 2004-09-23 Bayer Healthcare Ag Diagnostics et therapies pour maladies associees a la phosphodi-esterase 1c (pde1c)
WO2006134101A2 (fr) * 2005-06-17 2006-12-21 Nycomed Gmbh Utilisation de pde1c et inhibiteurs de celui-ci
WO2010065617A1 (fr) * 2008-12-02 2010-06-10 University Of Utah Research Foundation Pde1 en tant que cible thérapeutique dans les maladies cardiaques
EP2968338A4 (fr) * 2013-03-15 2016-12-21 Intra-Cellular Therapies Inc Nouvelles utilisations
US10682354B2 (en) 2016-03-28 2020-06-16 Intra-Cellular Therapies, Inc. Compositions and methods
US11291666B2 (en) 2016-09-12 2022-04-05 Intra-Cellular Therapies, Inc. Uses

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5800987A (en) * 1991-04-19 1998-09-01 The Board Of Regents Of The University Of Washington Assay methods using DNA encoding mammalian phosphodiesterases
EP1308459A2 (fr) * 2001-11-05 2003-05-07 Helix Research Institute Séquences d'ADN complementaires pleine longueur

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5800987A (en) * 1991-04-19 1998-09-01 The Board Of Regents Of The University Of Washington Assay methods using DNA encoding mammalian phosphodiesterases
EP1308459A2 (fr) * 2001-11-05 2003-05-07 Helix Research Institute Séquences d'ADN complementaires pleine longueur

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BEAVO J A: "CYCLIC NUCLEOTIDE PHOSPHODIESTERASES: FUNCTIONAL IMPLICATIONS OF MULTIPLE ISOFORMS" PHYSIOLOGICAL REVIEWS, AMERICAN PHYSIOLOGICAL SOCIETY, US, vol. 75, no. 4, 1 October 1995 (1995-10-01), pages 725-748, XP002034532 ISSN: 0031-9333 *
CHEN YAN ET AL: "Molecular cloning and characterization of a calmodulin-dependent phosphodiesterase enriched in olfactory sensory neurons" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 92, no. 21, 10 October 1995 (1995-10-10), pages 9677-9681, XP002139647 ISSN: 0027-8424 *
DATABASE EMBL SEQUENCE LIBRARY [Online] 16 July 2002 (2002-07-16) ISOGAI T., YAMAMOTO J.: " Homo sapiens cDNA FLJ34415 fis, clone HEART2004764, highly similar to CALCIUM/CALMODULIN-DEPENDENT 3',5'-CYCLIC NUCLEOTIDE PHOSPHODIESTERASE 1C (EC 3.1.4.17)" retrieved from HTTP://SRS.EBI.AC.UK Database accession no. AK091734 XP002280868 *
LOUGHNEY KATE ET AL: "Isolation and characterization of cDNAs corresponding to two human calcium, calmodulin-regulated, 3',5'-cyclic nucleotide phosphodiesterases" JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 2, 1996, pages 796-806, XP002280866 ISSN: 0021-9258 cited in the application *
YAN CHEN ET AL: "The calmodulin-dependent phosphodiesterase gene PDE1C encodes several functional different splice variants in a tissue-specific manner" JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 41, 1996, pages 25699-25706, XP002280867 ISSN: 0021-9258 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004080374A2 (fr) * 2003-03-13 2004-09-23 Bayer Healthcare Ag Diagnostics et therapies pour maladies associees a la phosphodi-esterase 1c (pde1c)
WO2004080374A3 (fr) * 2003-03-13 2004-12-16 Bayer Healthcare Ag Diagnostics et therapies pour maladies associees a la phosphodi-esterase 1c (pde1c)
WO2006134101A2 (fr) * 2005-06-17 2006-12-21 Nycomed Gmbh Utilisation de pde1c et inhibiteurs de celui-ci
WO2006134101A3 (fr) * 2005-06-17 2007-03-08 Altana Pharma Ag Utilisation de pde1c et inhibiteurs de celui-ci
WO2010065617A1 (fr) * 2008-12-02 2010-06-10 University Of Utah Research Foundation Pde1 en tant que cible thérapeutique dans les maladies cardiaques
EP2968338A4 (fr) * 2013-03-15 2016-12-21 Intra-Cellular Therapies Inc Nouvelles utilisations
US10183023B2 (en) 2013-03-15 2019-01-22 Intra-Cellular Therapies, Inc. Uses
EP3479825A1 (fr) * 2013-03-15 2019-05-08 Intra-Cellular Therapies, Inc. Inhibiteurs de pde1 utilisés dans le traitement et/ou la prévention de maladies ou de troubles du snc ou du snp
US10682355B2 (en) 2013-03-15 2020-06-16 Intra-Cellular Therapies, Inc. Uses
US11504372B2 (en) 2013-03-15 2022-11-22 Intra-Cellular Therapies, Inc. Uses
US10682354B2 (en) 2016-03-28 2020-06-16 Intra-Cellular Therapies, Inc. Compositions and methods
US11291666B2 (en) 2016-09-12 2022-04-05 Intra-Cellular Therapies, Inc. Uses

Also Published As

Publication number Publication date
AU2003276009A1 (en) 2004-04-23
AU2003276009A8 (en) 2004-04-23
WO2004031375A3 (fr) 2004-07-15

Similar Documents

Publication Publication Date Title
WO2004031375A2 (fr) Regulation de la pde1c humaine
US20040253669A1 (en) Regulation of human dcamkl1-like serine/threonine protein kinase
WO2003064639A1 (fr) Régulation du domaine catalytique humain de la protéine mekk
US7049118B2 (en) Regulation of human serine-threonine protein kinase
US7179629B2 (en) Regulation of human serine/threonine kinase
US7052892B2 (en) Regulation of human wee1-like serine/threonine protein kinase
WO2003052088A2 (fr) Regulation de la sialyltransferase humaine
US20040241796A1 (en) Regulation of human nek-like serine/threonine protein kinase
WO2004020620A1 (fr) Regulation de l'esterase humaine
WO2004029237A1 (fr) Variants d'epissage de la leukotriene a-4 hydrolase humaine
US20050208492A1 (en) Regulation of human serine/threonine kinase
US20040152092A1 (en) Regulation of human phosphatidic acid phosphatase type 2c-like protein
WO2003033708A2 (fr) Regulation de la proteine kinase humaine a serine/threonine
WO2003100046A1 (fr) Regulation de la kinase humaine
US7150976B2 (en) Regulation of human serine-threonine protein kinase
WO2004033495A2 (fr) Regulation de la pde6b humaine
WO2003097822A1 (fr) Regulation de la serine/threonine kinase humaine
WO2004031391A1 (fr) Regulation de la pde1a humaine
WO2004005501A1 (fr) Regulation la caseine kinase humaine i epsilon
WO2003018815A2 (fr) Regulation de la grk humaine
US20050244825A1 (en) Regulation of human bmp-2 inducible kinase
WO2004033678A1 (fr) Variant d'epissage des pde6c humaines
WO2004003191A1 (fr) Regulation de map kinase kinase kinase humaine
WO2004003189A2 (fr) Regulation de phospholipase c humaine
US20040157282A1 (en) Regulation of human dual specificity protein phosphatase 7-like protein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP