WO2004029237A1 - Variants d'epissage de la leukotriene a-4 hydrolase humaine - Google Patents

Variants d'epissage de la leukotriene a-4 hydrolase humaine Download PDF

Info

Publication number
WO2004029237A1
WO2004029237A1 PCT/EP2003/010771 EP0310771W WO2004029237A1 WO 2004029237 A1 WO2004029237 A1 WO 2004029237A1 EP 0310771 W EP0310771 W EP 0310771W WO 2004029237 A1 WO2004029237 A1 WO 2004029237A1
Authority
WO
WIPO (PCT)
Prior art keywords
leukotriene
hydrolase
polynucleotide
polypeptide
activity
Prior art date
Application number
PCT/EP2003/010771
Other languages
English (en)
Inventor
Yonghong Xiao
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2003277917A priority Critical patent/AU2003277917A1/en
Publication of WO2004029237A1 publication Critical patent/WO2004029237A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)

Definitions

  • the invention relates to the regulation of human leukotriene A-4 hydrolase.
  • Leukotriene A-4 hydrolase is involved in inflammation and other disease states. There is a ieed in the art to identify related enzymes that can be regulated to provide therapeutic effects.
  • Fig. 1 shows the DNA-sequence encoding a leukotriene A-4 hydrolase Poly- peptide (SEQ ID NO: 1).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of
  • Fig.l SEQ ID NO: 2.
  • Fig. 3 shows the DNA-sequence encoding the leukotriene A-4 hydrolase
  • Fig. 2 Polypeptide of Fig. 2 (SEQ ID NO: 3).
  • Fig. 4 shows the DNA-sequence encoding a leukotriene A-4 hydrolase Poly- peptide (SEQ ID NO: 4).
  • Fig. 5 shows the amino acid sequence deduced from the DNA-sequence of
  • Fig. 4 (SEQ ID NO: 5).
  • Fig. 6 shows the DNA-sequence encoding the leukotriene A-4 hydrolase
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • amino acid sequences which are at least about 20% identical to the amino acid sequence shown in SEQ ID NO: 2; and 20 the amino acid sequence shown in SEQ ID NO: 2;
  • amino acid sequences which are at least about 20% identical to the amino acid sequence shown in SEQ ID NO: 5; and the amino acid sequence shown in SEQ ID NO: 5.
  • a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a Leukotriene A-4 hydrolase 30 polypeptide; d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a Leukotriene A-4 hydrolase polypeptide; and
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a Leukotriene A-4 hydrolase polypeptide.
  • the invention provides splice variants of human leukotriene A-4 hydrolase com- prising the amino acid sequences shown in SEQ ID NO: 2 and SEQ ID NO: 5, respectively. Coding sequences for these two human leukotriene A-4 hydrolases are shown in SEQ ID NO: 1 and SEQ ID NO: 4, respectively. These sequences are contained within the longer sequence shown in SEQ ID NO: 3 and SEQ ID NO: 6.
  • BM221153; BF018223; BG376221; AA858552 are expressed in a kidney hypernephroma cell line, melanocytes, lung metastatic chondrosarcoma, placenta,
  • RER+ colon tumor grade-2-chondrosarcoma, kidney clear cell type tumors, germinal center B cells, and medulla.
  • Comparison of SEQ ID NO: 2 to "wild-type" human leukotriene A4 hydrolase shows that SEQ ID NO: 2 lacks an exon near C terminal end of the protein. This missing exon causes a frameshift.
  • Comparison of SEQ ID NO: 5 to human leukotriene A4 hydrolase shows that SEQ ID NO: 5 has an extra exon near C terminal end of the protein. This extra exon causes a frameshift.
  • SEQ ID NO: 2 and SEQ ID NO: 5 both have an intact catalytic domain and all the conserved residues. The proteins are closely related to aminopeptidase B, which is the top functional homolog.
  • Human leukotriene A-4 hydrolase of the invention is expected to be useful for the same purposes as previously identified leukotriene A-4 hydrolase enzymes. Human leukotriene A-4 hydrolase is believed to be useful in therapeutic methods to treat disorders such as cardiovascular disorders, atherosclerosis, asthma, COPD, Neurological disorders, cancer, and genitourological disorders. Human leukotriene A-4 hydrolase also can be used to screen for human leukotriene A-4 hydrolase activators and inhibitors.
  • One embodiment of the present invention is an expression vector containing any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a host cell containing any expression vector of the present invention.
  • Still another embodiment of the present invention is a substantially purified Leukotriene A-4 hydrolase polypeptide encoded by any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a method of producing a Leukotriene A-4 hydrolase polypeptide of the present invention, wherein the method . comprises the following steps:
  • Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a Leukotriene A-4 hydrolase polypeptide in a biological sample comprising the following steps: a. hybridizing any polynucleotide of the present invention to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and
  • Still another embodiment of the present invention is a method for detecting a polynucleotide of the present invention or a Leukotriene A-4 hydrolase polypeptide of the present invention comprising the steps of:
  • Yet another embodiment of the present invention is a diagnostic kit for conducting any method of the present invention.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Leukotriene A-4 hydrolase, comprising the steps of:
  • Still another embodiment of the present invention is a method of screening for agents which regulate the activity of a Leukotriene A-4 hydrolase, comprising the steps of: a. contacting a test compound with a Leukotriene A-4 hydrolase polypeptide encoded by any polynucleotide of the present invention; and
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Leukotriene A-4 hydrolase, comprising the step of:
  • test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of Leukotriene A-4 hydrolase.
  • Yet another embodiment of the present invention is a method of reducing the activity of a Leukotriene A-4 hydrolase, comprising the step of:
  • Still another embodiment of the present invention is a reagent that modulates the activity of a Leukotriene A-4 hydrolase polypeptide or a polynucleotide wherein said reagent is identified by any methods of the present invention.
  • Even another embodiment of the present invention is a pharmaceutical composition, comprising:
  • an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier is provided.
  • Yet another embodiment of the present invention is the use of an expression vector of the present invention or a reagent of the present invention for modulating the activity of a Leukotriene A-4 hydrolase in a disease, preferably a cardiovascular disorder, atherosclerosis, asthma, COPD, a neurological disorder, cancer or a genitourological disorder.
  • the invention thus provides a human leukotriene A-4 hydrolase that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
  • Human leukotriene A-4 hydrolase and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
  • Human leukotriene A-4 hydrolase polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450, 500, or 532 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below.
  • Other human leukotriene A-4 hydrolase polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450, or 480 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 5 or a biologically active variant thereof, as defined below.
  • a leukotriene A-4 hydrolase polypeptide of the invention therefore can be a portion of a leukotriene A-4 hydrolase protein, a full-length leukotriene A-4 hydrolase protein, or a fusion protein comprising all or a portion of a leukotriene A-4 hydrolase protein.
  • Human leukotriene A-4 hydrolase polypeptide variants that are biologically active, e.g., retain enzymatic activity, also are human leukotriene A-4 hydrolase polypeptides.
  • naturally or non-naturally occurring human leukotriene A-4 hydrolase polypeptide variants have amino acid sequences which are at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 95, 96,
  • Percent identity between a putative human leukotriene A-4 hydrolase polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci.
  • the "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 55:2444(1988), and by Pearson,
  • the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps.
  • the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman & unsch, J. Mol Biol.48:444 (1970); Sellers, SUM J. Appl Math.26:787 (1974)), which allows for amino acid insertions and deletions.
  • % identity of a first sequence towards a second sequence means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson ID, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
  • -maxdiv 40 .
  • Implementations of the CLUSTAL W algorithm are readily available at numerous sites on the internet, including, e.g., http://www.ebi.ac.uk. Thereafter, the number of matches in the alignment is determined by counting the number of identical nucleotides (or amino acid residues) in aligned positions. Finally, the total number of matches is divided by the number of nucleotides (or amino acid residues) of the longer of the two sequences, and multiplied by 100 to yield the % identity of the first sequence towards the second sequence.
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or .deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human leukotriene A-4 hydrolase polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • the invention additionally, encompasses leukotriene A-4 hydrolase polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 , acetylation, formy- lation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the leukotriene A-4 hydrolase polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of leukotriene A-4 hydrolase polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immuno- genicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Fusion proteins are useful for generating antibodies against leukotriene A-4 hydrolase polypeptide amino acid sequences and for use in various assay systems.
  • fusion proteins can be used to identify proteins that interact with portions of a human leukotriene A-4 hydrolase polypeptide.
  • Protein affinity chromatography or library-based assays for protein-protein interactions such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human leukotriene A-4 hydrolase polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises a human leukotrienes A-4 hydrolase polypeptide, such as those described above.
  • the first polypeptide segment also can comprise full-length leukotriene A-4 hydrolase protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • GAL4 DNA binding domain fusions GAL4 DNA binding domain fusions
  • HSV herpes simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the leukotriene A-4 hydrolase polypeptide-encoding sequence and the heterologous protein sequence, so that the leukotriene A-4 hydrolase polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA),
  • Species homologs of human leukotriene A-4 hydrolase polypeptide can be obtained using leukotriene A-4 hydrolase polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of leukotriene A-4 hydrolase polypeptide, and expressing the cDNAs as is known in the art.
  • a human leukotriene A-4 hydrolase polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a leukotriene A-4 hydrolase polypeptide. Coding sequences for human leukotriene A- 4 hydrolase splice variants are shown in SEQ ID NOS: 1 and 4.
  • nucleotide sequences encoding human leukotriene A-4 hydrolase polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or 4 or the complements thereof also are leukotriene A-4 hydrolase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as
  • ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • cDNA Complementary DNA
  • species homologs, and variants of leukotriene A-4 hydrolase polynucleotides that encode biologically active leukotriene A-4 hydrolase polypeptides also are leukotriene A-4 hydrolase polynucleotides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or 4 or the complements thereof also are leukotriene A-4 hydrolase polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
  • variants and homologs of the leukotriene A-4 hydrolase polynucleotides described above also are leukotriene A-4 hydrolase polynucleotides.
  • homologous leukotriene A-4 hydrolase polynucleotide sequences can be identified by hybridi- Q zation of candidate polynucleotides to known leukotriene A-4 hydrolase polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions ⁇ 2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then.
  • homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25%) basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the leukotriene A-4 hydrolase polynucleotides disclosed herein 0 also can be identified by making suitable probes Or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of leukotriene A-4 hydrolase polynucleotides can be identified, for example, by screemng human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology 5 (Bonner et a , J. Mol. Biol. 81, 123 (1973).
  • Variants of human leukotriene A-4 hydrolase polynucleotides or leukotriene A-4 hydrolase polynucleotides of other species can therefore be identified by hybridizing a putative homologous leukotriene
  • test hybrid SEQ ID NO: 1 or 4 or the complements thereof to form a test hybrid.
  • the melting 0 temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to leukotriene A-4 hydrolase polynucleotides 5 or their complements following stringent hybridization and/or wash conditions also are leukotriene A-4 hydrolase polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et ⁇ l., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • A-4 hydrolase polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or 4 or the complements thereof and a polynucleotide sequence which is at least
  • nucleotide sequences 15 about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a human leukotriene A-4 hydrolase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated leukotriene A-4 hydrolase polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise leukotriene A-4 hydrolase nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
  • PCR polymerase chain reaction
  • Human leukotriene A-4 hydrolase cDNA molecules can be made with standard molecular biology techniques, using leukotriene A-4 hydrolase mRNA as a template.
  • Human leukotriene A-4 hydrolase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989).
  • An amplification technique such as PCR, can be used to obtain additional copies . of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • ID NO:2 or 3 or a biologically active variant thereof.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al, Nucleic Acids Res. 16, 8186, 1988; Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991; Parker et al, Nucleic Acids Res. 19,
  • Human leukotriene A-4 hydrolase polypeptides can be obtained, for example, by purification from human cells, by expression of leukotriene A-4 hydrolase polynucleotides, or by direct chemical synthesis.
  • Human leukotriene A-4 hydrolase polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with leukotriene A-4 hydrolase polynucleotides.
  • a purified leukotriene A-4 hydrolase polypeptide is separated from other compounds that normally associate with the leukotriene A-4 hydrolase polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified leukotriene A-4 hydrolase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding leukotriene A-4 hydrolase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N ., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human leukotriene A-4 hydrolase polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340.
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed leukotriene A-4 hydrolase polypeptide in the desired . fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein. See WO 01/98340.
  • ATCC American Type Culture Collection
  • host cells which contain a human leukotriene A-4 hydrolase polynucleotide and which express a human leukotriene A-4 hydrolase polypeptide can be identified by a variety of procedures known to those of skill in the art.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding leukotriene A-4 hydrolase polypeptides include oligo- labeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human leukotriene A-4 hydrolase polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human leukotriene A-4 hydrolase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode leukotriene A-4 hydrolase polypeptides can be designed to contain signal sequences which direct secretion of soluble leukotriene A-4 hydrolase polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane- bound leukotriene A-4 hydrolase polypeptide. See WO 01/98340.
  • Sequences encoding a human leukotriene A-4 hydrolase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl Acids Res. Symp. Ser. 225-232, 1980).
  • a human leukotriene A-4 hydrolase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques
  • Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of leukotriene A-4 hydrolase polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule. See WO 01/98340.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter leukotriene A-4 hydrolase polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human leukotriene A-4 hydrolase polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • An antibody which specifically binds to an epitope of a human leukotriene A-4 hydrolase polypeptide can be used therapeutically, as well as in irnmunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other irnmunochemical assays known in the art.
  • irnmunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other irnmunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human leukotriene A-4 hydrolase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies that specifically bind to leukotriene A-4 hydrolase polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human leukotriene A-4 hydrolase polypeptide from solution. See WO 01/98340.
  • Antisense oligonucleotides are nucleotide sequences that are complementary * to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation.
  • an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, . 45, or 50 or more nucleotides long. Longer sequences also can be used.
  • Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of leukotriene A-4 hydrolase gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth.
  • Modifications of leukotriene A-4 hydrolase gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the leukotriene A-4 hydrolase gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology.
  • Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND iMMUNOLOGic APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994).
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human leukotriene A-4 hydrolase polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the leukotriene A-4 hydrolase polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). See WO 01/98340.
  • genes whose products interact with human leukotriene A-4 hydrolase may represent genes that are differentially expressed in disorders including, but not limited to, cardiovascular disorders, atherosclerosis asthma, COPD, Neurological disorders, cancer, and genitourological disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human leukotriene A-4 hydrolase gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA or, preferably, mRNA is isolated from tissues of interest.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects.
  • RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al,
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human leukotriene A-4 hydrolase.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human leukotriene A-4 hydrolase.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human leukotriene A-4 hydrolase gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human leukotriene A-4 hydrolase polypeptide or a human leukotriene A-4 hydrolase polynucleotide.
  • a test compound preferably binds to a human leukotriene A-4 hydrolase polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds preferably binds to a human leukotriene A-4 hydrolase polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to leukotriene A-4 hydrolase polypeptides or polynucleotides or to affect leukotriene A-4 hydrolase activity or leukotriene A-4 hydrolase gene expression using high throughput screemng.
  • high throughput screemng many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change. Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the leukotriene A-4 hydrolase polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the leukotriene A-4 hydrolase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound that is bound to the leukotriene A-4 hydrolase polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a human leukotriene A-4 hydrolase polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a human leukotriene A-4 hydrolase polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human leukotriene A-4 hydrolase polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
  • Determining the ability of a test compound to bind to a human leukotriene A-4 hydrolase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • a human leukotriene A-4 hydrolase polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a human leukotriene A-4 hydrolase polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the leukotriene A-4 hydrolase polypeptide.
  • a reporter gene e.g., LacZ
  • either the leukotriene A-4 hydrolase polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human leukotriene A-4 hydrolase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the leukotriene A-4 hydrolase polypeptide is a fusion protein comprising a domain that allows the leukotriene A-4 hydrolase polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed leukotriene A-4 hydrolase polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, 5 the beads or microtiter plate wells are washed ' to remove any unbound components.
  • Binding of the interactants can be determined either directly or indirectly, as described above.
  • the complexes can be dissociated from the solid support before binding is determined.
  • a human leukotriene A-4 hydrolase polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated leukotriene A-4 hydrolase polypeptides (or polynucleotides) or test compounds can be immobilized utilizing conjugation of biotin and streptavidin.
  • 20 site such as the active site of the leukotriene A-4 hydrolase polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the leukotriene A-4 hydrolase polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the leukotriene A-4 hydrolase polypeptide, and SDS gel electrophoresis under non- reducing conditions.
  • Screening for test compounds which bind to a human leukotriene A-4 hydrolase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a leukotriene A-4 hydrolase polypeptide or polynucleotide can be used in a cell-based assay system.
  • a leukotriene A-4 hydrolase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a leukotriene A-4 hydrolase polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human leukotriene A-4 hydrolase polypeptide. Enzymatic activity can be measured, for example, as described in Example 4.
  • Enzyme assays can be carried out after contacting either a purified leukotriene A-4 hydrolase polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases enzymatic activity of a human leukotriene A-4 hydrolase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing leukotriene A-4 hydrolase activity.
  • a test compound which increases enzymatic activity of a human leukotriene A-4 hydrolase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human leukotriene A-4 hydrolase activity.
  • test compounds that increase or decrease leukotriene A-4 hydrolase gene expression are identified.
  • a leukotriene A-4 hydrolase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the leukotriehe A-4 hydrolase polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of leukotriene A-4 hydrolase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human leukotriene A-4 hydrolase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human leukotriene A-4 hydrolase polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human leukotriene A-4 hydrolase polynucleotide can be used in a cell-based assay system.
  • the leukotriene A-4 hydrolase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human leukotriene A-4 hydrolase poly- peptide, leukotriene A-4 hydrolase polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a leukotriene A-4 hydrolase polypeptide, or mimetics, activators, or inhibitors of a human leukotriene A-4 hydrolase polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pynolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as. lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human leukotriene A-4 hydrolase can be regulated to treat cardiovascular disorders, atherosclerosis, asthma, COPD, Neurological disorders, cancer, and genitourological disorders.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation.
  • transformed cells There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these aberrant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokmetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • LTB4 Biosynthesis of leukotrieneB4 (LTB4) is mediated by the enzyme 5-lipoxygenase, which catalyzes the oxygenation of arachidonic acid to form 5-hydroperoxyeicosate- traenoic acid, as well as its subsequent dehydration to leukotrieneA4 (LTA4).
  • LTA4 is then modified by the epoxide hydrolase activity of the enzyme LTA4 hydrolase to generate LTB4 (Haeggstrom, J.Z., Wetterholm, A., Vallee, B.L., and Samuelsson, B. 1993. J. Lipid. Mediat. 6, 1-13).
  • LTB4 the inhibitors of LTA4 hydrolase are expected to reduce cancer by decreasing the production of LTB4.
  • An LTB4 receptor antagonist has been shown to inhibit proliferation and induce apoptosis in human pancreatic cancer cells (Tong, W-G., Ding, X-Z, Hennig, R., Witt, R.C., Standop, J., Pour, P.M., and Adrian, T.E. 2002. Clin. Cancer res. 8, 3232-3242).
  • LTB4 receptors are expressed in colonic epithelial cells, and it has been shown that LTB4 promotes the proliferation of colon cancer cells, HT29, and HCT115, in a dose and time dependent manner (Cristiana, B., Hanif, R., and Kashfi, K. 1996. Biochim. Biophys. Acta 1300, 240-246). Expression of a functional LTA4 hydrolase has been shown in human melanoma cells (Okano, M.H., Ikai, K., and Imamura, S. 1997. Arch. Dermatol. Res. 289, 347-351).
  • Central and peripheral nervous system disorders can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders 5 of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders,, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
  • Pain that is associated with neurological disorders also can be treated by regulating the activity of human leukotriene A-4 hydrolase. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and
  • Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective . tissue disease),
  • paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction.
  • Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is though to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a nanowing of the airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology.
  • the airway obstruction of asthma presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to kreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • Glycophorin A Cho and Sharom, Cell Immunol.
  • cyclosporin all inhibit interleukin-2 dependent T lymphocyte proliferation; however, they are known to have many other effects.
  • cyclosporin is used as a immuno- suppressant after organ transplantation. While these agents may represent alternatives to steroids in the treatment of asthmatics, they inhibit interleukin-2 dependent T lymphocyte proliferation and potentially critical immune functions associated with homeostasis.
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • Matrix degradation and emphysema along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
  • Genitourological disorders comprise benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropatbies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • renal diseases such as acute or chronic renal failure
  • immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropatbies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontine
  • Urinary incontinence is the involuntary loss of urine. Urge urinary incontinence
  • UUI is one of the most common types of UI together with stress urinary incontinence (SUI), which is usually caused by a defect in the urethral closure mechanism.
  • UUI is often associated with neurological disorders or diseases causing neuronal damages such as dementia, Parkinson's disease, multiple sclerosis, stroke and diabetes, although it also occurs in individuals with no such disorders.
  • OAB overactive bladder
  • Benign prostatic hyperplasia is the benign nodular hyperplasia of the periurethral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction resulting in progressive lower urinary tract syndromes (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age- related alterations in balance of steroidal sex hormones.
  • LUTS progressive lower urinary tract syndromes
  • the selective alphal-adrenoceptor antagonists such as prazosin, indoramin and tamsulosin are used as an adjunct in the symptomatic treatment of urinary obstruction caused by BPH, although they do not affect on the underlying cause of BPH.
  • BPH increased sympathetic tone exacerbates the degree of obstruction of the urethra through contraction of prostatic and urethral smooth muscle.
  • These compounds inhibit sympathetic activity, thereby relaxing the smooth muscle of the urinary tract.
  • Uroselective alphal -antagonists and alphal -antagonists with high tissue selectivity for lower urinary tract smooth muscle that do not provoke hypotensive side-effects should be developed for the treatment.
  • Drugs blocking dihydrotestosterone have been used to reduce the size of the prostate.
  • 5alpha-reductase inhibitors such as finasteride are prescribed for BPH. These agents selectively inhibit 5alpha-reductase, which mediates conversion of testosterone to dihydrotestosterone, thereby reducing plasma dihydrotestosterone levels and thus prostate growth.
  • the 5alpha-reductase inhibitors do not bind to androgen receptors and, do not affect testosterone levels nor do they possess feminizing side effects.
  • Androgen receptor antagonists are used for the treatment of prostatic hyperplasia due to excessive action or production of testosterone.
  • Various antiandrogens are under investigation for BPH including chlormadione derivatives with no estrogenic activity, orally active aromatase inhibitors, luteinizing hormone-releasing hormone
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right- sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • Myocardial infarction (MI) is generally caused by an abrupt decrease in coronary blood flow that follows a thrombotic occlusion of a coronary artery previously narrowed by arteriosclerosis. MI prophylaxis (primary and secondary prevention) is included, as well as the acute treatment of MI and the prevention of complications.
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting, in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • Atherosclerosis can be considered to represent an inflammatory response of macrophages and lymphocytes to invading pathogenic lipoproteins in the arterial wall. Macrophages have essential functions in all phases of atherosclerosis, from development of the fatty streak to processes that ultimately contribute to plaque rupture and myocardial infarction. An early even in the development of atheroscle- rosis is the adhesion of monocytes to the vascular wall and their migration into subendothelial space. Li et al, Nat. Med. 8, 1235-42, 2002.
  • LTB4 leukotriene B4
  • LTB4 is a potent chemoattractant for monocytes and blocking of LTB4 receptor by a potent antagonist reduces lipid accumulation and monocyte infiltration in a murin model of atherosclerosis, ultimately leading to reduced atherosclerotic lesion size.
  • LTB4 is generated from LTA4 by hydrolysis of an epoxide moiety, a reaction catalyzed by leukotriene A-4 hydrolase, LTA4H.
  • LTA4H leukotriene A-4 hydrolase
  • LTB4 for monocytes and thereby block an initial even in the development of atherosclerosis.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human leukotriene A-4 hydrolase polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of • treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects leukotriene A-4 hydrolase activity can be administered to a human cell, either in vitro or in vivo, to reduce leukotriene A-4 hydrolase activity.
  • the reagent preferably binds to an expression product of a human leukotriene A-4 hydrolase gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the 5 liposome is stable in the animal into which it has been administered for at least about
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of ⁇ 0 targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with "the plasma membrane of the targeted cell to deliver its
  • the transfection efficiency of a liposome is about
  • a liposome is between about 100 and
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the
  • More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases enzymatic activity relative to the enzymatic activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD 50 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 5 Q.
  • compositions that exhibit large therapeutic indices are prefened.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels .of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human leukotriene A-4 hydrolase gene or the activity of a leukotriene A-4 hydrolase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human leukotriene A-4 hydrolase gene or the activity of a human leukotriene A-4 hydrolase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to leukotriene A-4 hydrolase- specific mRNA, quantitative RT-PCR, immunologic detection of a human leukotriene A-4 hydrolase polypeptide, or measurement of enzymatic activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human leukotriene A-4 hydrolase also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding leukotriene A-4 hydrolase in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags. Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis.
  • DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85,
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of leukotriene A-4 hydrolase also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-leukotriene A-4 hydrolase polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and the epoxide hydrolase activity is determined in the following assay: The cell extracts (1-20 ⁇ g) are incubated in 100 ⁇ l of 10 mM Tris ⁇ Cl, pH 8.0, with LTA4 (2.5-125 ⁇ M) for 30 s on ice. Reactions are quenched with 200 ⁇ l of MeOH, followed by the addition of 0.4 nmol of prostaglandin (PG) B 1 or PGB2 as internal standard.
  • PG prostaglandin
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human leukotriene A-4 hydrolase polypeptides in yeast.
  • the leukotriene A-4 hydrolase-encoding DNA sequence is derived from SEQ ID NO: 1 or 4.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the modified endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the conesponding restriction enzymes the modified
  • DNA sequence is ligated into pPICZB.
  • This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter.
  • the resulting pPICZ/md-His6 vector is used to transform the yeast.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography
  • Ni-NTA-Resin Ni-NTA-Resin
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human leukotriene A- 4 hydrolase polypeptide is obtained.
  • Purified leukotriene A-4 hydrolase polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human leukotriene A-4 hydrolase polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2 or 3.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human leukotriene A-4 hydrolase polypeptide is detected by fluorescence measurements of the contents of the wells. A- test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human leukotriene A-4 hydrolase polypeptide.
  • test compound is administered to a culture of human cells transfected with a leukotriene A-4 hydrolase expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18,
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled leukotriene A-4 hydrolase-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1 or 4.
  • a test compound that decreases the leukotriene A-4 hydrolase-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of leukotriene A-4 hydrolase gene expression.
  • a test compound is administered to a culture of human cells transfected with a leukotriene A-4 hydrolase expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is . incubated for the same time without the test compound to provide a negative control.
  • Enzymatic activity is measured using the method of Medina et al. (Proc. Natl. Acad Sci. U.S.A. 88:7620-7624; 1991) or Orning et al.
  • test compound which decreases the enzymatic activity of the leukotriene A-4 hydrolase relative to the enzymatic activity in the absence of the test compound is identified as an inhibitor of leukotriene A-4 hydrolase activity.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • leukotriene A-4 hydrolase is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone manow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, ' placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
  • Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung),
  • NCI-H460 lung
  • HT-116 colon
  • DLD-1 colon
  • MDA-MD-231 breast
  • leukotriene A-4 hydrolase is involved in Neurological disorders
  • tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
  • lung or immune tissues brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung and immune system cells are screened to localize expression to particular cell subsets: lung microvascular endothelial cells, bronchial/tracheal epithelial cells, bronchial/tracheal smooth muscle cells, lung fibroblasts, T cells (T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes), B cells, mononuclear cells (monocytes and macrophages), mast cells, eosinophils, neutrophils, and dendritic cells.
  • T cells T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes
  • B cells mononuclear cells (monocytes and macrophages)
  • mast cells eosinophils, neutrophils, and dendritic cells.
  • the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara-like), freshly isolated neutrophils and monocytes, and cultured monocytes (macrophage-like).
  • Body map profiling also is carried out, using total RNA panels purchased from Clontech.
  • the tissues are adrenal gland, bone manow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
  • leukotriene A-4 hydrolase is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in .direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
  • RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; 10 mM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
  • RNA is extracted once with 1 volume of phenolxhlorof rm:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
  • PDAR Poly Applied Biosystems, CA
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
  • fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO 2 atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO: 1 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA
  • oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
  • test oligonucleotide for seven days results in significantly reduced expression of human leukotriene A-4 hydrolase as determined by Western blotting. This effect is not observed with the control oligonucleotide. After 3 to 7 days, the number of cells in the cultures is counted using an automatic cell counter.
  • the number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide.
  • the number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human leukotriene A-4 hydrolase has an anti-proliferative effect on cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c
  • Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
  • a biologic stimulus i.e., LHRH may be injected i.m.
  • mice were fed at a dosage of 30 ng/mouse to induce a burst of testosterone synthesis).
  • the timing of plasma collection would be adjusted to coincide with the peak of the induced hormone response.
  • Compound effects are compared to a vehicle-treated control group.
  • An F- test is preformed to determine if the variance is equal or unequal followed by a
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetennined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • 1.0 proliferation is determined by measuring a marker of cell number (i.e., MTT or
  • the cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micro- pocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10% formalin. Readout is qualitative
  • Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p ⁇ 0.05 as compared to the growth factor or cells only group.
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0.
  • Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
  • Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05.
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation, are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's, t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size.
  • Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells or fragments, of prostatic adenocarcmoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is 5 externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed. Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are
  • the lungs 20 the lungs
  • the target organ weight i.e.,. the regional lymph nodes.
  • the means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main 30 bronchus using a flat-ended 27 gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly.
  • the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c.
  • Body weights are measured and recorded 2-3 times weekly.
  • the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible. foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
  • Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, ETC Inc. -Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, H ⁇ rby, Sweden).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • One paw is touching the table, and is then moved slowly sideways 5 (5 s for 1 m), first in the forehand and then in the backhand direction.
  • the number of adjusting steps is counted for both paws in the backhand and forehand direction of movement.
  • the sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions.
  • the test is repeated three times on three consecutive days, after an initial training period of three days 1.0 prior to the first testing. Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement.
  • score 1 When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable 30 staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP mesencephalic dopaminergic
  • DAergic mesencephalic dopaminergic
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink.
  • the brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C.
  • sledge microtome (mod. 3-800-Frigocut, Leica) 25 ⁇ m sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
  • TH free-floating tyrosine hydroxylase
  • Rotarod Test We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod.
  • the system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the. first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment
  • The. Morris water escape task measures ' spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice. The performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank. Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds, have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials . (in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below • A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
  • mice After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides. Sections are then stained with haematoxylin and eosin. Morphometric analysis of lung sections is done by calculation of the Linear Mean Intercept (LMI) parameter using a semi-automated computer image analysis system. Each slide (1 per mouse) contains several sections originating from multiple lobes. Twelve non-overlapping areas (each area covering 1.53 x 10-3 cm2) are randomly selected for LMI analysis.
  • LMI Linear Mean Intercept
  • the 12 areas cover a minimum of two lobes per slide.
  • Non-parenchymal com- ponents airways, blood vessels
  • the mean intercept length is calculated for each mouse. Development of emphysema is seen as an increase in LMI.
  • the potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for administration of the compound.
  • test compounds The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages.
  • the cells are isolated from bronchoalveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium.
  • Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated.
  • the potency of a test compound is evaluated by com- paring the rate of elastolysis measured with cells incubated in the presence or absence of the compound.
  • mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11
  • test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection. Blood is collected 90 minutes after the antibody injection. Serum is obtained by centrifugation at 3000 r.p.m. for 10 min. IL-2 and IL-4 levels in the serum are determined by an ELISA.
  • mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered intraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by
  • YAMASA's ELISA kit and their Ig subtypes are done by an Ig ELISA KIT (Rougier
  • mice are injected intraperitoneally with LPS (200 ⁇ g/mouse). Compound is administered intraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- ⁇ concentration in the sample is determined using an ELISA kit.
  • BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch.
  • On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
  • IL-5 300 ng/mouse
  • leukocytes in exudate is collected and the number of total cells is counted.
  • the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution.
  • D10.G4.1 cells (1 x 10 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered intraperitoneally at -4 and +1 hr after these cells injection.
  • PCA Passive cutaneous anaphylaxis
  • Compounds are injected intraperitoneally (i.p.) 0.5 hr prior to antigen injection. Rats without the sensitization, challenge, and compound treatment are used for a blank (control) and rats with sensitization, challenge and vehicle treatment are used to determine a value without inhibition. Thirty min after the challenge, the rats are killed, and the skin of the back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density of the leaked dye.
  • Percent inhibition of PCA with a compound is calculated as follows:
  • % inhibition ⁇ (mean vehicle value - sample value)/(mean vehicle value - mean control value) ⁇ x 100
  • PIP PLP
  • Change in PIP reflects change of both resistance and compliance of the lungs.
  • each drug is given i.v. 5 min before challenge.
  • Wistar rats (200-250 g / Charles River Japan) are anesthetized intraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced
  • the abdominal well is closed and the animals allowed to recover.
  • the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition.
  • a polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
  • Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstructed animals.
  • the bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump.
  • the conscious rats are held under partial restraint in a resfraining device.
  • Wa med saline is infused into the bladder at a rate of 3 ml/hr for control and obstructed animals.
  • the rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstructed and control rats.
  • Overactivity of the obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope.
  • test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
  • an appropriate vehicle such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v
  • An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds (i.e., drug candidates).
  • Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112 mM NaCL 5.9 mM KC1, 1.2 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 2 mM CaCl 2 , 2.5 mM NaHCO 3 , 12 mM glucose).
  • Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
  • Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
  • An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds (i.e., drug Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112 mM NaCl, 5.9 mM KCl, 1.2 mM MgCl 2 , 1.2 mMNaH 2 PO 4 , 2 mM CaCl 2j 2.5 mM NaHCO 3 , 12 mM glucose).
  • test compounds i.e., drug Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112 mM NaCl
  • Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KC1 is determined at 15 minute intervals until reproducible responses are obtained. The response to KC1 is used as an internal standard to evaluate the effect of test compounds.
  • test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation.
  • One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds.
  • the ratio of each contraction to the internal standard e.g., a KCl-induced contraction
  • the ratio of each contraction to the internal standard is calculated, and the effects of the test compounds on the contraction are evaluated.
  • Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
  • a polyethylene catheter BECTON DICKINSON, PE50
  • saline Otsuka
  • the intravesicular pressure is measured a pressure transducer and displayed continuously on a chart recorder.
  • the activity of test compounds is assessed after intravenous administration through a polyethylene cannula inserted into the femoral vein.
  • Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg). The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome. The catheter is tunneled through subcutis of the animal by needle (14G) to neck.
  • ketamine 75 mg/kg
  • xylazine 15 mg/kg
  • PE50 polyethylene catheter
  • the catheter is tunneled through subcutis of the animal by needle (14G) to neck.
  • the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
  • the catheter is tunneled through subcutis of the animal by needle to neck.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in conesponding transgenic mice (e.g., CETP transgenic mice). Triglyceride-lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in Solutol/Ethanol/saline mixtures) and applied by oral gavage or intravenous injection. Before and at the end of the application period, blood samples are typically drawn by retroorbital punctuation. Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above. Plasma levels of human apolipoprotein-AI in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • mice Long-term anti-atherosclerotic potency of drug candidates are evaluated in Apo E- knockout mice. Therefore, animals are fed a standard chow diet (4.5 % fat) or a
  • mice Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed” (Nycomed, Kunststoff, Germany) lOO mg kg'l i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
  • Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • the animals of control groups only receive the vehicle.
  • mean blood pressure and heart rate of treated and untreated control groups are measured. Hemodynamics in anesthetized dogs
  • a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AtropinsulfatR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (Engstr ⁇ mR 300, Engstr ⁇ m, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1,
  • LCX left coronary artery
  • dP/dt left ventricular pressure
  • heart rate heart rate
  • coronary blood flow coronary blood flow
  • oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA).
  • the maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax).
  • dP/dtmax measure of left ventricular contractility
  • Each dose of the test compound is tested at least three times in different animals.
  • the order of injection of the different doses is randomized in each animal.
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 u/ ⁇ l) were obtained from (Qiagen,
  • the reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • the forward primer sequence was: Primerl ggatcctgatgaaccaccac
  • the reverse primer sequence was Primer2 ggataccaccaccaatcagg.
  • reagents were prepared in a total of 25 ⁇ l : lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l AmpliTaq GoldTM, 0.01 U/ ⁇ l AmpErase, and Probel .
  • tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 ⁇ 1 of template cDNA.
  • Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95° C for 15 sec and annealing/extending at 60°C for 1 min.
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle conection) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CT ⁇ G -values were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CT HKG - n -mean value (CT ⁇ - ⁇ G i-value + CT HKG2 -value + ... + CT HKG - n -value) / n
  • CT C DNA-n CT value of the tested gene for the cDNA n
  • CF CDNA - ⁇ detection factor for cDNA n
  • CT CO ⁇ - CD N A - ⁇ conected CT value for a gene on cDNA n
  • HEK 293 cells 22 adrenal gland 66 thyroid 40 thyroid tumor 18 pancreas 57 pancreas liver ckrhosis 50 esophagus 2 esophagus tumor 49 stomach 59 stomach tumor 65 colon 55 colon tumor 61 small intestine 182 ileum 84 ileum tumor 20 ileum chronic inflammation 0 rectum 36 rectum tumor 0 salivary gland 10 fetal liver 22 liver 48 liver liver cinhosis 86 liver lupus disease 56 liver tumor 25
  • HEP G2 cells 48 skeletal muscle 12 cartilage 148 bone connective tissue 132 adipose 8 skin 36 cervix 2 testis 826
  • HeLa cells 15 placenta 38 uterus 113 uterus tumor 46 ovary 36 ovary tumor 36 breast 41 breast tumor 202
  • human human leukotriene A-4 hydrolase is involved in the following diseases and conditions: cardiovascular disorders, atherosclerosis, asthma, COPD, a neurological disorders, cancer and genitourological disorders.
  • Modulators of the human human leukotriene A-4 hydrolase can be used to treat cardiovascular disorders, atherosclerosis, asthma, COPD, a neurological disorders, cancer and genitourological disorders.
  • Regulators of the expression of human leukotriene A-4 hydrolase can be used to treat cardiovascular disorders, atherosclerosis, asthma, COPD, a neurological disorders, cancer and genitourological disorders. .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Selon l'invention, des réactifs qui régulent la leukotriène A-4 hydrolase humaine ainsi que des réactifs qui se fixent sur des produits géniques de la leukotriène A-4 hydrolase peuvent contribuer à la prévention, à l'amélioration et à la correction de dysfonctionnements ou de maladies comprenant, de manière non exhaustive, des troubles cardiovasculaires, l'athérosclérose, l'asthme, la BPCO, des troubles neurologiques, le cancer ainsi que des troubles génito-urinaires.
PCT/EP2003/010771 2002-09-30 2003-09-27 Variants d'epissage de la leukotriene a-4 hydrolase humaine WO2004029237A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003277917A AU2003277917A1 (en) 2002-09-30 2003-09-27 Splice-variants of the human leukotriene a-4 hydrolase

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US41441902P 2002-09-30 2002-09-30
US60/414,419 2002-09-30
US43119302P 2002-12-06 2002-12-06
US60/431,193 2002-12-06
US43441402P 2002-12-19 2002-12-19
US60/434,414 2002-12-19

Publications (1)

Publication Number Publication Date
WO2004029237A1 true WO2004029237A1 (fr) 2004-04-08

Family

ID=32045893

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/010771 WO2004029237A1 (fr) 2002-09-30 2003-09-27 Variants d'epissage de la leukotriene a-4 hydrolase humaine

Country Status (2)

Country Link
AU (1) AU2003277917A1 (fr)
WO (1) WO2004029237A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11426399B2 (en) 2018-05-15 2022-08-30 Alkahest, Inc. Treatment of aging-associated disease with modulators of leukotriene A4 hydrolase
US11957671B2 (en) 2021-11-01 2024-04-16 Alkahest, Inc. Benzodioxane modulators of leukotriene A4 hydrolase (LTA4H) for prevention and treatment of aging-associated diseases

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0979817A1 (fr) * 1997-03-27 2000-02-16 Santen Pharmaceutical Co., Ltd. Inhibiteurs de leucotriene a 4? hydrolase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0979817A1 (fr) * 1997-03-27 2000-02-16 Santen Pharmaceutical Co., Ltd. Inhibiteurs de leucotriene a 4? hydrolase

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 2 July 1999 (1999-07-02), MINAMI ET AL.: "Human leukotriene A-4 hydrolase mRNA, complete cds", XP002267227, Database accession no. J03459 *
HAEGGSTROM J Z ET AL: "Leukotriene A4 hydrolase", PROSTAGLANDINS, BUTTERWORTH, STONEHAM, MA, US, vol. 68-69, August 2002 (2002-08-01), pages 495 - 510, XP004380644, ISSN: 0090-6980 *
HEINZMANN A ET AL: "Studies on linkage and association of atopy with the chromosomal region 12q13-24.", CLINICAL AND EXPERIMENTAL ALLERGY: JOURNAL OF THE BRITISH SOCIETY FOR ALLERGY AND CLINICAL IMMUNOLOGY. ENGLAND, vol. 30, no. 11, November 2000 (2000-11-01), pages 1555 - 1561, XP001184135, ISSN: 0954-7894 *
JENDRASCHAK ELLEN ET AL: "The human leukotriene A-4 hydrolase gene is expressed in two alternatively spliced mRNA forms", BIOCHEMICAL JOURNAL, vol. 314, no. 3, 1996, pages 733 - 737, XP002267225, ISSN: 0264-6021 *
MINAMI M ET AL: "Molecular cloning of a cDNA coding for human leukotriene A4 hydrolase. Complete primary structure of an enzyme involved in eicosanoid synthesis.", THE JOURNAL OF BIOLOGICAL CHEMISTRY. US, vol. 262, no. 29, J03459, 15 October 1987 (1987-10-15), pages 13873 - 13876, XP002267226, ISSN: 0021-9258 *
PENNING THOMAS D ET AL: "Structure-Activity Relationship Studies on 1-[2-(4- Phenylphenoxy)ethyl]pyrrolidine (SC-22716), a Potent Inhibitor of Leukotriene A4 (LTA4) Hydrolase", JOURNAL OF MEDICINAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY. WASHINGTON, US, vol. 43, 2000, pages 721 - 725, XP002197495, ISSN: 0022-2623 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11426399B2 (en) 2018-05-15 2022-08-30 Alkahest, Inc. Treatment of aging-associated disease with modulators of leukotriene A4 hydrolase
US11957671B2 (en) 2021-11-01 2024-04-16 Alkahest, Inc. Benzodioxane modulators of leukotriene A4 hydrolase (LTA4H) for prevention and treatment of aging-associated diseases

Also Published As

Publication number Publication date
AU2003277917A1 (en) 2004-04-19

Similar Documents

Publication Publication Date Title
US7129077B2 (en) Regulation of human aminopeptidase N
WO2004031375A2 (fr) Regulation de la pde1c humaine
US20040253669A1 (en) Regulation of human dcamkl1-like serine/threonine protein kinase
WO2003064639A1 (fr) Régulation du domaine catalytique humain de la protéine mekk
WO2004029237A1 (fr) Variants d'epissage de la leukotriene a-4 hydrolase humaine
WO2004020620A1 (fr) Regulation de l'esterase humaine
US7179629B2 (en) Regulation of human serine/threonine kinase
WO2003052088A2 (fr) Regulation de la sialyltransferase humaine
US20040152092A1 (en) Regulation of human phosphatidic acid phosphatase type 2c-like protein
WO2003100046A1 (fr) Regulation de la kinase humaine
US20050208492A1 (en) Regulation of human serine/threonine kinase
US20050255545A1 (en) Regulation of human hematopoietin receptor-like protein
EP1506290A1 (fr) Regulation de la serine/threonine kinase humaine
WO2003018815A2 (fr) Regulation de la grk humaine
WO2004031391A1 (fr) Regulation de la pde1a humaine
WO2004003191A1 (fr) Regulation de map kinase kinase kinase humaine
WO2003106667A2 (fr) Regulation d'une serine protease de type subtilase humaine
WO2004033678A1 (fr) Variant d'epissage des pde6c humaines
WO2004003189A2 (fr) Regulation de phospholipase c humaine
WO2003093466A1 (fr) Proteine humaine associee au rhomboide
WO2004018661A1 (fr) Regulation de la proteine de type esterase humaine
US20050244825A1 (en) Regulation of human bmp-2 inducible kinase
WO2004033495A2 (fr) Regulation de la pde6b humaine
WO2003057869A1 (fr) Regulation de la sulfatase humaine
WO2003087379A1 (fr) Regulation de la proteine kinase humaine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP