WO2004003191A1 - Regulation de map kinase kinase kinase humaine - Google Patents
Regulation de map kinase kinase kinase humaine Download PDFInfo
- Publication number
- WO2004003191A1 WO2004003191A1 PCT/EP2003/006740 EP0306740W WO2004003191A1 WO 2004003191 A1 WO2004003191 A1 WO 2004003191A1 EP 0306740 W EP0306740 W EP 0306740W WO 2004003191 A1 WO2004003191 A1 WO 2004003191A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- kinase
- kinase kinase
- polypeptide
- polynucleotide
- map
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the invention relates to the regulation of human MAP kinase kinase kinase.
- Mitogen-activated protein (MAP) kinases are a family of enzymes which regulate intracellular signaling pathways. U.S. Patent 6,190,663. MAP kinases are important mediators of signal transduction from cell surfaces to nuclei via phosphorylation cascades. Several subgroups of MAP kinases have been defined and each manifests different substrate specificities and responds to various distinct extracellular stimuli. Thus, the MAP kinase signaling pathways represent common mechanisms for signal transduction by which different extracellular stimuli generate distinct physiological responses inside cells (Egan S E and Weinberg R A (1993) Nature 365:781-783).
- the invention relates to an isolated polynucleotide from the group consisting of: a) a polynucleotide encoding a MAP kinase kinase kinase polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 91% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
- e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a MAP kinase kinase kinase polypeptide.
- Human MAP kinase kinase kinase comprises the amino acid sequence shown in SEQ ID NO: 2.
- a DNA sequence harbouring the coding sequence (ORF) for human MAP kinase kinase' kinase is shown in SEQ ID NO: 1.
- the ORF is shown in SEQ ID NO: 3
- Related ESTs are expressed in lymphoma, natural killer cells, neuroblastoma, and embryonal carcinoma cell lines, as well as in teratocarcinoma, leiomyosarcoma, melanotic melanoma, and placenta.
- SEQ ID NO:2 is a novel splice variant ofthe human mitogen-activated protein kinase kinase kinase 3 (swissnew
- Human MAP kinase kinase kinase of the invention is expected to be useful for the same purposes as previously identified MAP kinase kinase kinase enzymes.
- MAP kinase kinase kinase kinase is believed to be useful in therapeutic methods to treat disorders such as cancer, diabetes, neurological disorders, respiratory disorders, particularly COPD, cardiovascular disorders, gastrointestinal and liver disorders, hematological disorders, and genitourinary disorders.
- Human MAP kinase kinase kinase also can be used to screen for human MAP kinase kinase kinase activators and inhibitors.
- One embodiment of the present invention is an expression vector containing any polynucleotide ofthe present invention.
- Yet another embodiment of the present invention is a host cell containing any expression vector ofthe present invention.
- Still another embodiment of the present, invention is a substantially purified MAP kinase kinase kinase polypeptide encoded by any polynucleotide of the present invention.
- Yet another embodiment of the present invention is a method of producing a MAP kinase kinase kinase polypeptide of the present invention, wherein the method comprises the following steps: a, culturing the host cells of the present invention under conditions suitable for the expression ofthe MAP kinase kinase polypeptide; and b. recovering the MAP kinase kinase kinase polypeptide from the host cell culture.
- Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a MAP kinase kinase kinase polypeptide in a biological sample comprising the following steps: a. hybridizing any polynucleotide of the present invention to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b. detecting said hybridization complex.
- Still another embodiment of the present invention is a method for detecting a polynucleotide of the present invention or a MAP kinase kinase kinase polypeptide ofthe present invention comprising the steps of: a. contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the MAP kinase kinase kinase polypeptide and b. detecting the interaction
- Yet another embodiment of the present invention is a diagnostic kit for conducting any method ofthe present invention.
- Yet another embodiment of the present invention is a method of screening for agents - which decrease the activity of a MAP kinase kinase kinase, comprising the steps of: a. contacting a test compound with a MAP kinase kinase kinase polypeptide encoded by any polynucleotide ofthe present invention; b. detecting binding of the test compound to the MAP kinase kinase kinase polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a MAP kinase kinase kinase.
- Still another embodiment ofthe present invention is a method of screening for agents which regulate the activity of a MAP kinase kinase kinase, comprising the steps of: a. contacting a test compound with a MAP kinase kinase kinase polypeptide encoded by any polynucleotide ofthe present invention; and b.
- a test compound which increases the MAP kinase kinase kinase activity is identified as a potential therapeutic agent for increasing the activity of the MAP kinase kinase kinase
- a test compound which decreases the MAP kinase kinase kinase activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the MAP kinase kinase kinase.
- Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a MAP kinase kinase kinase, comprising the step of:
- test compound contacting a test compound with any polynucleotide of the present invention and detecting binding, of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of MAP kinase kinase kinase.
- Yet another embodiment ofthe present invention is a method of reducing the activity of a MAP kinase kinase kinase, comprising the step of:
- a reagent which specifically binds to any polynucleotide of the present invention or any MAP kinase kinase kinase polypeptide of the present invention, whereby the activity of MAP kinase kinase kinase is reduced.
- Still another embodiment of the present invention is a reagent that modulates the activity of a MAP kinase kinase kinase polypeptide or a polynucleotide wherein said reagent is identified by any methods ofthe present invention.
- Yet another embodiment of the present invention is a pharmaceutical composition, comprising: an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier.
- Yet another embodiment ofthe present invention is the use of an expression vector of the present invention or a reagent ofthe present invention for modulating the activity of a MAP kinase kinase kinase in a disease, preferably cancer, diabetes, a neurological disorder, a respiratory disorder, particularly COPD, a cardiovascular disorder, a gastrointestinal and liver disorder, a hematological disorder . or a genitourinary disorder.
- a disease preferably cancer, diabetes, a neurological disorder, a respiratory disorder, particularly COPD, a cardiovascular disorder, a gastrointestinal and liver disorder, a hematological disorder . or a genitourinary disorder.
- the invention thus provides a human MAP kinase kinase kinase that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
- Human MAP kinase kinase kinase and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
- Human MAP kinase kinase kinase polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400,
- a MAP kinase kinase kinase polypeptide of the invention therefore can be a portion of a MAP kinase kinase kinase protein, a full-length MAP kinase kinase kinase protein, or a fusion protein comprising all or a portion of a MAP kinase kinase kinase protein.
- naturally or non-naturally occurring human MAP kinase kinase kinase polypeptide variants have amino acid sequences which are at least about 91, 95, 96, 97, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof. Percent identity between a putative human MAP kinase kinase kinase polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl Acad. Sci. USA ⁇ °P:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.
- the "FASTA” similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
- the FASTA algorithm is described by
- FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
- the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
- Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
- Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
- Amino acid, insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human MAP kinase kinase kinase polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
- the invention additionally, encompasses MAP kinase kinase kinase polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH , acetylation, form- ylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
- Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
- the MAP kinase kinase kinase polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation ofthe protein.
- the invention also provides chemically modified derivatives of MAP kinase kinase kinase polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
- the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene ⁇ glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
- the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
- Whether an amino acid change or a polypeptide modification results in a biologically active MAP kinase kinase kinase polypeptide can readily be determined by assaying for enzymatic activity, as described for example, in J Biol Chem 1997 Jan
- Fusion proteins are useful for generating antibodies against MAP kinase kinase kinase polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human MAP kinase kinase kinase polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drag screens.
- a human MAP kinase kinase kinase polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
- the first polypeptide segment comprises a MAP kinase kinase kinase polypeptide, such as those described above.
- the first polypeptide segment also can comprise full-length MAP kinase kinase kinase protein.
- the second polypeptide segment can be a full-length protein or a protein fragment.
- Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
- epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
- fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
- MBP maltose binding protein
- S-tag S-tag
- GAL4 DNA binding domain fusions GAL4 DNA binding domain fusions
- HSV herpes simplex virus
- a fusion protein also can be engineered to contain a cleavage site located between the MAP kinase kinase kinase polypeptide-encoding sequence and the heterologous protein sequence, so that the MAP kinase kinase kinase polypeptide can be cleaved and purified away from the heterologous moiety.
- a fusion protein can be synthesized chemically, as is known in the art.
- a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
- Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
- Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA),
- MAP kinase kinase kinase polypeptide polypeptide polynucleotides described below to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of MAP kinase kinase kinase polypeptide, and expressing the cDNAs as is known in the art.
- a human MAP kinase kinase kinase polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a MAP kinase kinase polypeptide.
- a coding sequence for human MAP kinase kinase kinase is shown in SEQ ID NO: 3.
- nucleotide sequences encoding human MAP kinase kinase kinase polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO:l or 3 or their complements also are MAP kinase kinase kinase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
- MAP kinase kinase kinase polynucleotides that encode biologically active MAP kinase kinase polypeptides also are MAP kinase kinase kinase polynucleotides.
- Polynucleotide fragments comprising at least
- SEQ ID NO:l or 3 8 or 25 contiguous nucleotides of SEQ ID NO:l or 3 or their complements also are MAP kinase kinase kinase polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
- Variants and homologs of the MAP kinase kinase kinase polynucleotides described above also are MAP kinase kinase polynucleotides.
- homologous MAP kinase kinase kinase polynucleotide sequences can . be identified by hybridization of candidate polynucleotides to known MAP kinase kinase kinase polynucleotides under stringent conditions, as is known in the art.
- homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
- Species homologs of the MAP kinase kinase kinase polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
- Human variants of MAP kinase kinase kinase polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al., J. Mol Biol. 81, 123 (1973).
- Variants of human MAP kinase kinase kinase polynucleotides or MAP kinase kinase polynucleotides of other species can therefore be identified by hybridizing a putative homologous MAP kinase kinase kinase polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or 3 or the complement thereof to form a test hybrid.
- the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
- Nucleotide sequences which hybridize to MAP kinase kinase kinase polynucleotides or their complements following stringent hybridization and/or wash conditions also are MAP kinase kinase kinase polynucleotides.
- Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et ah, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
- T m of a hybrid between a MAP kinase kinase kinase polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or 3 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and
- Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
- Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
- a human MAP kinase kinase kinase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
- Poly- nucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated MAP kinase kinase polynucleotides.
- restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise MAP kinase kinase kinase nucleotide sequences.
- Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
- Human MAP kinase kinase kinase cDNA molecules can be made with standard molecular biology techniques, using MAP kinase kinase mRNA as a template: Human MAP kinase kinase kinase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
- MAP kinase kinase kinase polynucleotides can be synthesized by synthetic chemistry techniques.
- the degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human MAP kinase kinase kinase polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof.
- PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
- restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al., Nucleic Acids Res. 16, 8186, 1988; Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991; Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991).
- PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA
- Human MAP kinase kinase kinase polypeptides can be obtained, for example, by purification from human cells, by expression of MAP kinase kinase kinase polynucleotides, or by direct chemical synthesis.
- Human MAP kinase kinase kinase polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with MAP kinase kinase kinase polynucleotides.
- a purified MAP kinase kinase kinase polypeptide is separated from other compounds that normally associate with the MAP kinase kinase kinase polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art.
- Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
- a preparation of purified MAP kinase kinase kinase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis.
- the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation ofthe inserted coding sequence.
- Methods which are well known to those skilled in. the art can be used to construct expression vectors containing sequences encoding MAP kinase kinase kinase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
- a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human MAP kinase kinase kinase polypeptide.
- microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with vims expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus,
- TMV TMV
- bacterial expression vectors e.g., Ti or pBR322 plasmids
- animal cell systems See WO 01/98340.
- a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed MAP kinase kinase kinase polypeptide in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate conect insertion, folding and/or function.
- Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities e.g., CHO, HeLa, MDCK, HEK293, and
- WI38 are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing ofthe foreign protein. See WO 01/98340.
- host cells which contain a human MAP kinase kinase kinase polynucleotide and which express a human MAP kinase kinase polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescence activated cell sorting
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding MAP kinase kinase kinase polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
- sequences encoding a human MAP kinase kinase kinase polypeptide can be cloned into a vector for the production of an mRNA probe.
- RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding a human MAP kinase kinase kinase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode MAP kinase kinase kinase polypeptides can be designed to contain signal sequences which direct secretion of soluble MAP kinase kinase kinase polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane- bound MAP kinase kinase kinase polypeptide. See WO 01/98340.
- Sequences encoding a human MAP kinase kinase kinase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et ah, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et a Nucl Acids
- a human MAP kinase kinase kinase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc ' 85, 2149-2154, 1963; Roberge et ah, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
- fragments of MAP kinase kinase kinase polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule. See WO 01/98340.
- MAP kinase kinase kinase polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
- nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter MAP kinase kinase kinase polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
- site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
- Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human MAP kinase kinase kinase polypeptide.
- Fab fragment antigen binding protein
- F(ab') 2 fragment antigen binding protein
- Fv fragment antigen binding protein
- An antibody which specifically binds to an epitope of a human MAP kinase kinase kinase polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex fonnation between an immunogen and an antibody that specifically binds to the immunogen.
- an antibody that specifically binds to a human MAP kinase kinase kinase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
- antibodies that specifically bind to MAP kinase kinase kinase polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human MAP kinase kinase kinase polypeptide from solution. See WO 01/98340.
- Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of MAP kinase kinase kinase gene products in the cell.
- Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et ah, Chem. Rev. 90, 543-583, 1990.
- Modifications of MAP kinase kinase kinase gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the MAP kinase kinase kinase gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are prefened. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
- An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
- Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et ah, U.S. Patent 5,641,673).
- ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
- the coding sequence of a human MAP kinase kinase kinase polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the MAP kinase kinase kinase polynucleotide.
- Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al.
- the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
- the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et ah, EP 321,201). See WO 01/98340.
- genes whose products interact with human MAP kinase kinase kinase may represent genes that are differentially expressed in disorders including, but not ' limited to, cancer, diabetes, neurological disorders, respiratory disorders, particularly COPD, cardiovascular disorders, gastrointestinal and liver disorders, hematological disorders, and genitourinary disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions.
- the human MAP kinase kinase kinase gene or gene product may itself be tested for differential expression.
- the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
- Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
- RNA or, preferably, mRNA is isolated from tissues of interest.
- RNA samples are obtained from tissues of experimental subjects and from conesponding tissues of control subjects.
- RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et ah, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
- Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et ah, Proc.
- the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human MAP kinase kinase kinase.
- treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human MAP kinase kinase kinase.
- the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human MAP kinase kinase kinase gene or gene product are up-regulated or down-regulated.
- the invention provides assays for screening test compounds that bind to or modulate the activity of a human MAP kinase kinase kinase polypeptide or a human MAP kinase kinase polynucleotide.
- a test compound preferably binds to a human MAP kinase kinase kinase polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
- Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
- the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
- Test compounds can be screened for the ability to bind to MAP kinase kinase kinase polypeptides or polynucleotides or to affect MAP kinase kinase kinase activity or
- MAP kinase kinase kinase gene expression using high throughput screening uses high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
- the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically. require assay volumes that range from 50 to 500 ⁇ l. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
- free format assays or assays that have no physical barrier between samples, can be used.
- an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
- the cells are . placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface ofthe agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
- Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995).
- Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
- beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
- test samples are placed in a porous matrix.
- One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the MAP kinase kinase kinase polypeptide, such that normal biological activity is prevented.
- small molecules include, but are not limited to, small peptides or peptide-like molecules.
- either the test compound or the MAP kinase kinase kinase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
- Detection of a test compound that is bound to the MAP kinase kinase kinase polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
- binding of a test compound to a human MAP kinase kinase kinase polypeptide can be determined without labeling either of the interactants.
- a microphysiometer can be used to detect binding of a test compound with a human MAP kinase kinase polypeptide.
- a microphysiometer e.g., CytosensorTM
- CytosensorTM is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS).
- Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human MAP kinase kinase kinase polypeptide (McConnell et ah, Science 257, 1906-1912, 1992).
- Determining the ability of a test compound to bind to a human MAP kinase kinase kinase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BLA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et ah, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
- BLA Bimolecular Interaction Analysis
- BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
- a human MAP kinase kinase kinase polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et ah, Cell 72, 223-232, 1993; Madura et ah, J. Biol. Chem.
- the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
- the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a human MAP kinase kinase kinase polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor
- a DNA sequence that encodes an unidentified protein can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait” and the “prey” proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression ofthe reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the MAP kinase kinase kinase polypeptide.
- a reporter gene e.g., LacZ
- either the MAP kinase kinase kinase polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
- Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
- any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
- Test compounds are preferably bound to the solid support in an anay, so that the location of individual test compounds can be tracked. Binding of a test compound to a human MAP kinase kinase kinase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
- the MAP kinase kinase kinase polypeptide is a fusion protein comprising a domain that allows the MAP kinase kinase kinase polypeptide to be bound to a solid support.
- glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
- the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is detennined.
- MAP kinase kinase kinase polypeptide or polynucleotide
- test compound can be immobilized utilizing conjugation of biotin and sfreptavidin.
- Biotinylated MAP kinase kinase kinase polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
- antibodies which specifically bind to a MAP kinase kinase kinase polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the MAP kinase kinase kinase polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
- Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the MAP kinase kinase kinase polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the MAP kinase kinase kinase polypeptide, and SDS gel electrophoresis under non-reducing conditions.
- Screening for test compounds which bind to a human MAP kinase kinase kinase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a MAP kinase kinase polypeptide or polynucleotide can be used in a cell-based assay system.
- a MAP kinase kinase kinase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a MAP kinase kinase kinase polypeptide or polynucleotide is determined as described above.
- Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human MAP kinase kinase kinase polypeptide. Enzymatic activity can be measured, for example, as described in J Biol Chem 1997 Jan 31;272(5):2668-74.
- Enzyme assays can be carried out after contacting either a purified MAP kinase kinase kinase polypeptide, a cell membrane preparation, or an intact cell with a test , compound.
- a test compound that decreases enzymatic activity of a human MAP kinase kinase kinase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing MAP kinase kinase kinase activity.
- a test compound which increases enzymatic activity of a human MAP kinase kinase kinase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human MAP kinase kinase kinase activity.
- test compounds that increase or decrease MAP kinase kinase kinase gene expression are identified.
- a MAP kinase kinase kinase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the MAP kinase kinase kinase polynucleotide is determined.
- the level of expression of appropriate mRNA or polypeptide in the presence ofthe test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
- the test compound can then be identified as a modulator of expression based on this comparison.
- test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
- test compound when expression of the mRNA or polypeptide is less in the presence ofthe test compound than in its absence, the test compound is identified as an inhibitor ofthe mRNA or polypeptide expression.
- the level of MAP kinase kinase kinase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
- the presence of polypeptide products of a human MAP kinase kinase kinase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmuno assay, Western blotting, and i ⁇ rmunohistochemistry.
- polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human MAP kinase kinase kinase polypeptide.
- Such screening can be carried out either in a cell-free assay system or in an intact cell.
- Any cell that expresses a human MAP kinase kinase kinase polynucleotide can be used in a cell-based assay system.
- the MAP kinase kinase kinase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
- Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
- compositions of the in- vention can comprise, for example, a human MAP kinase kinase kinase polypeptide,
- compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- agent such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- stabilizing compound can be administered to a patient alone, or in combination with other agents, drugs or hormones.
- compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intrarnedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
- Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pynolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpynolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpynolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
- compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or tiiglycerides, or liposomes.
- Non-lipid polycationic amino polymers also can be used for delivery.
- the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the conesponding free base forms.
- the prefened preparation can be a lyophilized powder which can contain - any or all of the following; 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5:5, that is combined with buffer prior to use.
- compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
- MAP3K3 Human MAP kinase kinase kinase (MAP3K3) can be regulated to treat cancer, diabetes, neurological disorders, respiratory disorders, particularly COPD, cardiovascular disorders, gastrointestinal and liver disorders, hematological disorders, and genitourinary disorders.
- Human MAP3K3 is highly expressed in the following cancer tissues: esophagus tumor, stomach tumor, prostate, kidney tumor.
- the expression in the above mentioned tissues and in particular the differential expression between diseased tissue and healthy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose cancer.
- the activity of human MAP3K3 can be modulated to treat cancer.
- Cancer is a disease furidamentally caused by oncogenic cellular transformation.
- transformed cells There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation
- Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
- Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole.
- Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hyperplasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
- Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the sunounding healthy tissue or any other tissues of the body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
- Cancerous cells and tissues may affect the body as a whole when causing paraneoplastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results.
- the ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death ofthe mammal affected. Cancer, tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease.
- Cancers are generally said to be in one of three stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumour have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated.
- Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well.
- cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
- Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence.
- cancer under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as
- carcinoma 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
- Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system.
- Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, uterine adenocarcinoma.
- Cancers ofthe pavement-cell epithelium of the skin and of certain mucous membranes such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well.
- Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
- Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
- Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion.
- Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal.
- Protein kinases are a large family of proteins that transfer the gamma-phosphate of ATP to a specific residue(s) of a protein substrate.
- a protein kinase is classified as a tyrosine, a serine/threonine or a dual specific kinase based on the acceptor residue(s).
- Protein kinases play an important role in signaling pathways regulating a number of cellular functions, such as cell proliferation , apoptosis, angiogenesis and metastasis which are the hallmarks of all cancers.
- Several protein kinases have been identified as oncogenes and shown to be dysregulated in many cancer types, thereby making protein kinases as attractive therapeutic targets for the treatment of cancer.
- Drugs targeted against protein kinases responsible for the dysregulation of any of the aforementioned pathways have the potential for greater efficacy and lower toxicity. See Kumar & Madison, Expert Opin. Emerging Drugs 6, 303-15, 2001.
- Signaling pathways for cell growth and proliferation are initiated at the cell surface by binding of a growth factor ligand to its receptor. Ligand binding to its receptor leads to autophosphorylation and activation of its tyrosine kinase domain.
- the growth factor signal is further transmitted within a cell through a series of protein kinases resulting in changes in DNA synthesis, cell cycle, cellular morphology, gene expression, protein translation and metabolic pathways.
- receptor protein tyrosine kinases examples include EGF receptor, PDGF receptor, VEGF receptor and FGF receptor. Src, abl and lck constitute some of the cytosolic tyrosine kinases.
- Src, abl and lck constitute some of the cytosolic tyrosine kinases.
- serine/threonine kinases examples include MAP kinases, Akt/PKB, and CDKs.
- Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
- type 1 diabetes juvenile onset
- type 2 diabetes adult onset
- Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
- Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
- Other agents that induce beta cell proliferation and regeneration also are potential therapies.
- Type II diabetes is the most common of the two diabetic conditions (6% of the population).
- the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
- Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
- the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
- Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
- the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
- Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
- Type I and Type diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
- agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
- MAP3K3 Human MAP3K3 is highly expressed in the following brain tissues: cerebellum
- brain tissues and in particular the differential expression between diseased tissue and healfhy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose nervous system diseases.
- the activity of human MAP3K3 can be modulated to treat nervous system diseases.
- Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
- Pain that is associated with CNS disorders also can be treated by regulating the activity of human MAP kinase kinase kinase. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy,
- Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia.
- RSD reflex sympathetic dystrophy
- Pain associated with cancer and cancer treatment also can be treated, as' can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania. Respiratory disorders
- Human MAP3K3 is highly expressed in the following tissues of the respiratory system: leukocytes (peripheral blood), neutrophils cord blood, neutrophils peripheral blood, fetal lung, fetal lung fibroblast IMR-90 cells, lung, lung COPD.
- leukocytes peripheral blood
- neutrophils cord blood neutrophils peripheral blood
- neutrophils peripheral blood neutrophils peripheral blood
- fetal lung fetal lung fibroblast IMR-90 cells
- lung lung COPD.
- the expression in the above mentioned tissues and in particular the differential expression between diseased tissue and healthy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose respiratory diseases.
- the activity of human MAP3K3 can be modulated to treat those diseases.
- allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction.
- Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
- the hypersensitivity reaction of allergy develops when the allergen is recogmzed by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
- Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
- Asthma is thought to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening ofthe walls ofthe airways that leads to a nanowing ofthe airways, 2) airway hypenesponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
- Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
- effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
- Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to ineversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
- Cunent pharmacological treatments suffer their own set of disadvantages.
- Commonly used therapeutic agents such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation.
- Agents that can reduce the underlying inflammation such as anti-inflammatory steroids, can have major drawbacks that range from immunosuppression to bone loss (Goodman and Gilman's
- Glycophorin A Cho and Sharom, Cell. Immunol 145, 223-39, 1992
- cyclosporin Alexander et ah, Lancet 339, 324-28, 1992
- a nonapeptide fragment of IL-2 Zav'yalov et ah, Immunol. Lett. 31, 285-88, 1992
- all inhibit interleukin-2 dependent T lymphocyte proliferation however, they are known to have many other effects.
- cyclosporin is used as a immuno- suppressant after organ transplantation.
- COPD chronic obstructive pulmonary (or airways) disease
- Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
- Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
- airflow obstruction is usually progressive and is only partially reversible.
- the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 lymphocytes.
- Inhaled irritants such as cigarette smoke, activate macrophages that are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
- chemokines e.g., interleukin-8
- chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
- Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
- Matrix degradation and emphysema are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
- Protein kinases are signal transducing enzymes that phosphorylate proteins, including other kinases, and, along with protein phosphatases, regulate the level and extent of protein phosphorylation and activation. Intracellular signalling pathways have important roles in inflammatory processes. These pathways may be activated by cytokines, oxidant stress and other inflammatory mediators (reviewed in Kyraikis & Avruch, J. Biol. Chem. 271, 24313-16, 1996; Kyraikis & Avruch, J. Physiol. Rev. 81, 807-69, 2001).
- the pro-inflammatory cytokines, tumor necrosis factor ⁇ (TNF ⁇ ) and interleukin-1 activate the protein ser/thr kinases c-Jun-NH2 -terminal kinase (JNK) and p38 mitogen-activated protein (MAP) kinase, leading to activation of AP-1 and 1KB kinase (IKK), which, in turn, leads to activation ofthe transcription factor NFKB.
- Activation of NFKB is required for the transcription of several pro- inflammatory molecules, including interleukin-8 and ICAM-1.
- Enzymes ofthe MAP kinase class may also act to increase cytokine production by stabilization of mRNA
- aerosol delivery to rat lungs of antisense oligodeoxy- nucleotides to syk kinase mRNA suppressed nitric oxide and TNF ⁇ production from alveolar macrophages stimulated with IgG-anti-IgG complexes (Stenton et ah, J, Immunol. 164, 3790-97, 2000).
- Protein kinase subtypes are therefore attractive therapeutic targets for the attenuation ofthe inflammatory response in COPD.
- Human MAP3K3 is highly expressed in the following cardiovascular related tissues: heart, pericardium, heart atrium (right), heart atrium (left), heart apex, Purkinje fibers, interventricular septum, HUVEC cells. Expression in the above mentioned tissues demonstrates that human MAP3K3 protein or mRNA can be used to diagnose cardiovascular diseases. In addition, the activity, of human MAP3K3 can be modulated to treat cardiovascular diseases.
- Heart failure is defined as a pathophysiological state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failures such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent ofthe underlying cause.
- Myocardial infarction (MI) is generally caused by an abrupt decrease in coronary blood flow that follows a thrombotic occlusion of a coronary artery previously nanowed by arteriosclerosis. MI prophylaxis (primary and secondary prevention) is included as well as the acute treatment of MI and the prevention of complications.
- Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which is inadequate to meet the myocardial requirement for oxygen.
- This group of diseases includes stable angina, unstable angina and asymptomatic ischemia.
- Arrhythmias include all forms of atrial and ventricular tachyanhythmias, atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexitation syndrome, ventricular tachycardia, ventricular flutter, ventricular fibrillation, as well as bradycardic forms of anhythmias.
- Hypertensive vascular diseases include primary as well as all kinds of secondary arterial hypertension, renal, endocrine, neurogenic, others.
- the genes may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications arising from cardiovascular diseases.
- Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and. embolism, inflammatory vascular disorders, Raynaud's phenomenon and venous disorders.
- PAOD peripheral arterial occlusive disease
- embolism inflammatory vascular disorders, Raynaud's phenomenon and venous disorders.
- Atherosclerosis is a cardiovascular disease in which the vessel wall is remodeled, compromising the lumen of the vessel.
- the atherosclerotic remodeling process involves accumulation of cells, both smooth muscle cells and monocyte/macrophage inflammatory cells, in the intima of the vessel wall. These cells take up lipid, likely from the circulation, to form a mature atherosclerotic lesion.
- the formation of these lesions is a chronic process, occurring over decades of an adult human life, the majority of the morbidity associated with atherosclerosis occurs when a lesion ruptures, releasing thrombogenic debris that rapidly occludes the artery. When such an acute event occurs in the coronary artery, myocardial infarction can ensue, and in the worst case, can result in death.
- the formation of the atherosclerotic lesion can be considered to occur in five overlapping stages such as migration, lipid accumulation, recruitment of inflammatory cells, proliferation of vascular smooth muscle cells, and extracellular matrix deposition.
- stages such as migration, lipid accumulation, recruitment of inflammatory cells, proliferation of vascular smooth muscle cells, and extracellular matrix deposition.
- Each of these processes can be shown to occur in man and in animal models of atherosclerosis, but the relative contribution of each to the pathology and clinical significance ofthe lesion is unclear.
- Cardiovascular diseases include but are not limited to disorders of the heart and the vascular system, such as congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular anhythmias, hypertensive vascular diseases, peripheral vascular diseases, and atherosclerosis.
- hyperlipidemia abnormally high levels of fats (cholesterol, triglycerides, or both) in the blood, may be caused by family history of hyperlipidemia, obesity, a high-fat diet, lack of exercise, moderate to high alcohol consumption, cigarette smoking, poorly controlled diabetes, and an underactive thyroid gland), hereditary hyper- lipidemias (type I hyperlipoproteinemia (familial hyperchylomicronemia), type II hyperlipoproteinemia (familial hypercholesterolemia), type III hyperlipoproteinemia, type IV hyperlipoproteinemia, or type V hyperlipoproteinemia), hypolipo- proteinemia, lipidoses (caused by abnormalities in the enzymes that metabolize fats),
- hyperlipidemia abnormally high levels of fats (cholesterol, triglycerides, or both) in the blood, may be caused by family history of hyperlipidemia, obesity, a high-fat diet, lack of exercise, moderate to high alcohol consumption, cigarette smoking, poorly controlled diabetes, and an underactive thyroid gland
- Gaucher's disease Niemann-Pick disease, Fabry's disease, Wolman's disease, cerebrotendinous xanthomatosis, sitosterolemia, Refsum's disease, or Tay-Sachs disease.
- Kidney disorders may lead to hyper or hypotension. Examples for kidney problems possibly leading to hypertension are renal artery stenosis, pyelonephritis, glomerulonephritis, kidney tumors, polycistic kidney disease, injury to the kidney, or radiation therapy affecting the kidney. Excessive urination may lead to hypotension.
- Human MAP3K3 is highly expressed in the following urological tissues: prostate, prostate BPH, bladder, fetal kidney, kidney, kidney tumor, HEK 293 cells.
- the expression in the above mentioned tissues and in particular the differential expression between diseased tissue and healthy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose genitourinary disorders.
- the activity of human MAP3K3 can be modulated to treat genitourinary disorders.
- Genitourinary disorders include benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence like urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
- renal diseases such as acute or chronic renal failure
- immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence like urge-
- Human MAP3K3 is highly expressed in the following tissues of the gastro- enterological system: esophagus, esophagus tumor, stomach, stomach tumor.
- the expression in the above mentioned tissues and in particular the differential expression between diseased tissue and healthy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose gastroenterological disorders.
- the activity of human MAP3K3 can be modulated to treat gastroenterological disorders.
- Gastrointestinal diseases include primary or secondary, acute or chronic diseases of the organs ofthe gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs of the gastrointestinal tract or the body as a whole. They include but are not limited to 1) disorders of the esophagus such as achalasia, vigoruos achalasia, dysphagia, cricopharyngeal inco- ordination, pre-esophageal dysphagia, diffuse esophageai spasm, globus sensation, Banett's metaplasia, gastroesophageal reflux, 2) disorders of the stomach and duodenum such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, neoplasms of the stomach, 3) disorders of the
- Liver diseases include primary or secondary, acute or chronic diseases or injury of the liver which may be acquired or inherited, benign or malignant, and which may affect the liver or the body as a whole. They comprise but are not limited to disorders of the bilimbin metabolism, jaundice, syndromes of Gilbert, Crigler-Najjar, Dubin-Johnson, and Rotor; intrahepatic cholestasis, hepatomegaly, portal hypertension, ascites, Budd-Chiari syndrome, portal-systemic encephalopathy, fatty liver, steatosis, Reye's syndrome, liver diseases due to alcohol, alcoholic hepatitis or cinhosis, fibrosis and cinhosis, fibrosis and cinhosis of the liver due to inborn enors of metabolism or exogenous substances, storage diseases, syndromes of Gaucher and Zellweger, Wilson's disease, acute or chronic hepatitis, viral hepatitis and its variants, inflammatory conditions of the liver due to viruses
- Human MAP3K3 is highly expressed in the following tissues of the hematological system: leukocytes (peripheral blood), neutrophils cord blood, neutrophils peripheral blood, spleen, spleen liver cinhosis.
- leukocytes peripheral blood
- neutrophils cord blood neutrophils peripheral blood
- spleen neutrophils peripheral blood
- spleen liver cinhosis The expression in the above mentioned tissues and in particular the differential expression between diseased tissue and healthy tissue demonstrates that human MAP3K3 protein or mRNA can be used to diagnose hematological diseases.
- the activity of human MAP3K3 can be modulated to treat hematological disorders.
- Hemoglobin in red blood cells is the key component for transporting oxygen from the lungs to the tissues.
- the level of hemoglobin has fallen below 12g/L. Therefore the oxygen carrying capacity of blood is reduced.
- Common reasons for anemia include acute or chronic blood loss, insufficient levels of erythropoietin synthesis in the kidneys (e.g. in dialysis patients) or insufficient output of red blood cells from bone manow after chemotherapy or HIV infection etc..
- Current therapy of anemia is aimed at increasing the hematocrit either by transfusion or by stimulating erythropoiesis with agents such as erythropoietin. The treatment goal is to restore hemoglobin levels above 12g/L.
- Neutropenia is an abnormally low white blood cell count, which causes an increased incidence of infections.
- causes of neutropenia include: drug-induced (e.g., following cancer chemotherapy), increased destruction of neutrophils (e.g., immune-mediated) or decreased bone manow function (e.g., familial neutropenia).
- neutropenia following cancer chemotherapy is cunently treated with growth factors such as G-CSF or GM-
- the treatment goal is to raise the neutrophil count in order to reduce the susceptibility to infection.
- Thrombocytopenia is a disorder where the number of platelets is inappropriately low. Since platelets play an essential role in thrombus formation to limit blood loss following vessel injury, insufficient platelet levels may lead to abnormal bleeding. There are many causes of thrombocytopenia including drug-induced thrombo- cytopenia (e.g., following cancer chemotherapy) and immune thromboytopenia (due to increased degradation of platelets). Platelet transfusions or IL-11 can be used to restore platelet levels in order to reduce the bleeding risk. Aplastic anemia (Pancyteponia)
- Aplastic anemia is a life-threatening hematologic disorder characterized by absent or markedly diminished hematopoietic precursors in the bone manow and resulting in neutropenia, anemia and thrombocytopenia.
- a large number of agents can cause aplastic anemia (drugs, chemicals and toxins) radiation and certain infections can also induce aplastic anemia. More frequently, aplastic anemia occurs as an unpredictable idiosyncratic reaction to drugs such as Antiinflammatory agents, antibiotics, and antiepileptic drugs.
- Aplastic anemia typically develops weeks or month during drag administration or delayed after drag administration has been discontinued.
- aplastic anemia Several congenital and familiar forms of aplastic anemia have been described, including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amegakaryocytic thrompocytopenia.
- This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
- an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human MAP kinase kinase kinase polypeptide binding molecule
- an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
- this invention pertains to uses of novel agents identified by the above-described -screening assays for treatments as described herein.
- a reagent which affects MAP kinase kinase kinase activity can be administered to a human cell, either in vitro or in vivo, to reduce MAP kinase kinase kinase activity.
- the reagent preferably binds to an expression product of a human MAP kinase kinase kinase gene. If the expression product is a protein, the reagent is preferably an antibody.
- an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
- the reagent is delivered using a liposome.
- the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
- a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
- the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
- a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
- the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about
- a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
- Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More prefened liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
- a liposome comprises a compound capable of targeting the lipo- some to a particular cell type, such as a cell-specific ligand exposed on the outer surface ofthe liposome.
- a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
- a reagent such as an antisense oligonucleotide or ribozyme
- from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
- antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
- Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et ah, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE
- a therapeutically effective dose refers to that amount of active ingredient which increases or decreases enzymatic activity relative to the enzymatic activity which occurs in the absence ofthe therapeutically effective dose.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50%) of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 5 o/ED 5 o.
- compositions that exhibit large therapeutic indices are prefened.
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
- the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage varies within this range depending upon the dosage form employed, sensitivity ofthe patient, and the route of administration.
- the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate ofthe particular formulation.
- Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of poly- nucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
- polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transfenin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
- Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about
- effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about
- the reagent is preferably an antisense oligonucleotide or a ribozyme.
- Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
- a reagent reduces expression of a human MAP kinase kinase kinase gene or the activity of a MAP kinase kinase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
- MAP kinase kinase kinase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to MAP kinase kinase kinase-
- any ofthe pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
- the combination of therapeutic agents can act synergistically to effect the treatment or prevention ofthe various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- Human MAP kinase kinase kinase also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding MAP kinase kinase kinase in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent ofthe disease.
- Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
- cloned DNA segments can be employed as probes to detect specific DNA segments.
- the sensitivity of this method is greatly enhanced when combined with PCR.
- a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
- the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
- DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et ah, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et ah, Proc.
- the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
- direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
- Altered levels of MAP kinase kinase kinase also can be detected in various tissues.
- Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
- the polynucleotide of SEQ ID NO: 3 is inserted into the expression vector pCEV4-
- HA and the expression vector pCEV4-HA-MAP kinase kinase kinase polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and HA-MAP kinase kinase kinase proteins are immuno- precipitated with anti-HA-antibody. The proteins obtained are incubated with 30 ⁇ l of kinase buffer (50 mM Tris, pH 7.4, 10 mM MgCl 2 , 2 mM EGTA) and 10 Ci of
- the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human MAP kinase kinase kinase polypeptides in yeast.
- the MAP kinase kinase kinase-encoding DNA sequence is derived from SEQ ID NO:l.
- the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
- the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography
- Ni-NTA-Resin Ni-NTA-Resin
- the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation ofthe polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human MAP kinase kinase kinase polypeptide is obtained.
- MAP kinase kinase kinase polypeptides comprising a glutathione-S-trans- ferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
- Human MAP kinase kinase kinase polypeptides comprise the amino acid sequence shown in SEQ ID NO:2.
- the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
- the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human MAP kinase kinase kinase polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human MAP kinase kinase kinase polypeptide.
- test compound is administered to a culture of human cells transfected with a MAP kinase kinase kinase expression constmct and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
- RNA is isolated from the two cultures as described in Chirgwin et ah, Biochem. 18, 5294-99, 1979).
- Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P -labeled MAP kinase kinase kinase-specific probe at 65°C in Express-hyb (CLONTECH).
- the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ JD NO:3.
- MAP kinase kinase kinase-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of MAP kinase kinase kinase gene expression.
- test compound is administered to a culture of human cells transfected with a MAP kinase kinase kinase expression construct and incubated at 37°C for 10 to
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
- Kinase activity may be measured by phosphorylation of a protein substrate using gamma-labeled P-ATP and quantitation of the incorporated radioactivity using a gamma radioisotope counter.
- Human MAP kinase kinase kinase is incubated with the protein substrate, 32 P-ATP 5 and a kinase buffer. The 32 P incorporated into the substrate is then separated from free 32 P-ATP by electrophoresis, and the incorporated P is counted.
- a determination of the specific amino acid residues phosphorylated is made by phosphoamino acid analysis of the hydrolyzed protein as described by Boyle et ah, Meth. Enzymol 20, 110-148, 1991.
- a test compound which decreases the enzymatic activity of the MAP kinase kinase kinase relative to the enzymatic activity in the absence of the test compound is identified as an inhibitor of MAP kinase kinase kinase activity.
- MAP kinase kinase kinase kinase The qualitative expression pattern of MAP kinase kinase kinase in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT-PCR).
- MAP kinase kinase kinase kinase is involved in cancer
- expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
- MAP kinase kinase kinase kinase is involved in the disease process of diabetes
- the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone manow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
- Human islet cells and an islet cell library also are tested.
- the expression of MAP kinase kinase kinase in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
- MAP kinase kinase kinase kinase is involved in CNS disorders
- the following tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
- the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara-like), freshly isolated neutrophils and monocytes, and cultured monocytes (macrophage-like).
- Body map profiling also is carried out, using total RNA panels purchased from Clontech.
- the tissues are adrenal gland, bone manow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
- Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et ah, BioTechnology 10, 413-17, 1992, and Higuchi et ah, BioTechnology 11, 1026-30, 1993.
- the principle is that at any given cycle within the exponential phase of PCR, the. amount of product is proportional to the initial number of template copies.
- the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et ah, Proc. Natl. Acad. Sci.
- the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
- the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
- RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
- RNA samples 50 ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l
- RNase inhibitor PE Applied Biosystems, CA
- 10 mM Tris-HCl pH 7.9 10 mM Tris-HCl pH 7.9
- lOmM MgCl 2 50 mM NaCl
- 1 mM DTT 1 mM DTT
- RNA is extracted once with 1 volume of phenokchloro- formdsoamyl alcohol (24:24:1) and once with chloroform, and precipitated with
- RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2. ⁇ M of random hexamer primers.
- TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end F AM (6-carboxy-fluorescein) and at the 3 ' end with TAMRA (6-carboxy-tetra- methyl-rhodamine). Quantification experiments are performed on lO ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
- F AM 6-carboxy-fluorescein
- TAMRA 6-carboxy-tetra- methyl-rhodamine
- Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
- PDAR Pre-Developed TaqMan Assay Reagents
- the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix
- the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the mn, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
- the cell line used for testing is the human colon cancer cell line HCT116.
- Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO 2 atmosphere.
- Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO:3 is used as. the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA ACT GAC TAG ATG TAC ATG GAC-3' (SEQ ID NO:21). Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration.
- oligonucleotides Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration- of 10 ⁇ M once per day for seven days.
- test oligonucleotide for seven days results in significantly reduced expression of human MAP kinase kinase kinase as determined by Western blotting. This effect is not observed with the control oligonucleotide.
- the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human MAP kinase kinase kinase has an anti-proliferative effect on cancer cells.
- This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
- Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
- test compound p.o., i.p., i.v., i.m., or s.c
- Plasma is assayed for levels ofthe hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level ofthe hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
- a biologic stimulus i.e., LHRH may be injected i.m.
- Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- specific readout assay protocol these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇
- Rodents are . administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
- animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
- Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
- Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
- Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- Hydron pellets with or without growth factors or cells are implanted into a micro- pocket surgically created in the rodent cornea.
- Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
- Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10% formalin. Readout is qualitative scoring and or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p
- ⁇ 0.05 as compared to the growth factor or cells only group.
- Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an
- Tumor cells or fragments are implanted subcutaneously on Day 0.
- Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
- Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
- Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05.
- Tumor cells are injected intraperitoneally or intracranially on Day 0.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- Established Disease Model is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain- a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
- the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
- the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
- Hormones may also be administered to the rodents to support the growth of the tumors.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
- Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size ofthe primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
- the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination ofthe study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Intracecal Assay Intracecal Assay
- Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/of mortality are recorded daily.
- Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
- Tumor cells are injected into the tail vein, portal vein, or the left ventricle ofthe heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
- Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
- Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days.
- Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels . compared to the vehicle-treated control group.
- Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
- the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
- Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
- Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
- compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
- an intravenous glucose load 0.4 g kg
- Plasma insulin levels are determined.
- test compounds which regulate MAP kinase kinase kinase are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice.
- routes p.o., i.p., s.c, or i.v.
- Plasma insulin levels are determined.
- Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
- mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
- Acute pain is measured on a hot plate mainly in rats.
- Two variants of hot plate testing are used: In the classical variant ammals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
- the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
- Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., it, Lev., s.c, intradermal, transdermai) prior to pain testing.
- application routes i.v., i.p., p.o., it, Lev., s.c, intradermal, transdermai
- Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw ofthe experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
- Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermai) prior to formalin or capsaicin administration.
- application routes i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermai
- Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
- the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
- the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
- a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
- the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
- the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
- Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Luc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, H ⁇ rby, Sweden).
- Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
- a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
- Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and Arndt, Universitat zu K ⁇ ln, Cologne, Germany), and by scoring differences in gait
- Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, ev., s.c, intradermal, transdermai) prior to pain testing.
- application routes i.v., i.p., p.o., i.t, ev., s.c, intradermal, transdermai
- Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of 0.75 mg canageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
- Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermai) prior to pain testing.
- application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermai
- Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., ev., s.c, intradermal, transdermai) prior to pain testing.
- application routes i.v., i.p., p.o., i.t., ev., s.c, intradermal, transdermai
- 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
- MFB medium forebrain bundle
- mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
- Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HCI (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame.
- DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
- Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol.
- the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
- One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction.
- the number of adjusting steps is counted for both paws in the backhand and forehand direction of movement.
- the sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions.
- the test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing.
- Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
- Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
- the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
- test 3 is given for no reaction of movement.
- the test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
- Staircase Test (Paw Reaching).
- a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
- Plexiglass test boxes with a central platform and a removable staircase on each side are used.
- the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
- For each test the animals are left in the test boxes for 15 min.
- the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
- MPTP neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine
- DAergic mesencephalic dopaminergic
- MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss ofthe tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
- TH tyrosine hydroxylase
- mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
- the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transfened to a 20% sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink.
- the brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C.
- sledge microtome (mod. 3800-Frigocut, Leica) 25 ⁇ m sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
- TH free-floating tyrosine hydroxylase
- DAB Diaminobenzidine tetrahydrochloride
- Rotarod Test We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
- the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
- the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time ofthe fall and all the set-up parameters, are recorded. The system also allows a weak cunent to be passed through the base grid, to aid training.
- the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
- a rat is placed in an open field, in which two identical objects are present. The rats inspects both objects during the first trial of the object recognition task.
- a second trial after a retention interval of for example 24 hours, one ofthe two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
- the inspection time at each ofthe objects is registered.
- the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
- Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
- Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
- the passive avoidance task assesses memory performance in rats and mice.
- the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor ofthe light compartment.
- Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours, hi the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
- the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
- 1 mA footshock is administered for 2 sec.
- the rat is removed from the apparatus and put back into its home cage.
- the procedure during the retention session is identical to that of the habituation sessions.
- the step-through latency that is the first latency of entering the dark compartment
- the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
- the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
- Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence ofthe experimenter, and by a radio on a shelf that is playing softly.
- the animals receive four trials during five daily acquisition sessions.
- a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
- the escape platform is always in the same position.
- a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
- an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
- the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
- Four different measures are taken to evaluate the performance of an animal during acquisition training: escape latency, traveled distance, distance to platform, and swimming speed.
- the following measures are evaluated for the probe trial: time (s) in quadrants and traveled distance (cm) in the four quadrants.
- the probe trial provides additional information about how well an animal learned the position of the escape platform. If an animal spends more time and swims a longer distance in the quadrant where the platform had been positioned during the acquisition sessions than in any other quadrant, one concludes that the platform position has been learned well.
- rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
- the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
- the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
- a mouse is put into the start arm at the beginning of training.
- the guillotine door is closed.
- the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
- the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door.
- the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled. The percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start ofthe training session. Scopolamine reduced the per-cent alternations to chance level, or below. A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
- mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
- mice After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides. Sections are then stained with haematoxylin and eosin. Morphometric analysis of lung sections is done by calculation of the Linear Mean Intercept (LMI) parameter using a semi-automated computer image analysis system. Each slide (1 per mouse) contains several sections originating from multiple lobes. Twelve non-overlapping areas (each area covering 1.53 x 10-3 cm 2 ) are randomly selected for LMI analysis.
- LMI Linear Mean Intercept
- the 12 areas cover a minimum of two lobes per slide.
- Non-parenchymal components airways, blood vessels
- the mean intercept length is calculated for each mouse. Development of emphysema is seen as an increase in LMI.
- the potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for administration ofthe compound.
- test compounds The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages.
- the cells are isolated from bronchoalveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3 h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium.
- Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated.
- the potency of a test compound is evaluated by comparing the rate of elastolysis measured with cells incubated in the presence or absence ofthe compound.
- BALB/c mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11 (purified hamster anti-mouse CD3 ⁇ monoclonal antibodies, PHARMLNGEN).
- a test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection.
- Blood is collected 90 minutes after the antibody injection. Serum is obtained by centrifugation at 3000 rpm. for 10 min.
- IL-2 and IL-4 levels in the semm are determined by an ELISA.
- mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered intraperitoneally from day 0 to day 6. On day 7 blood is collected and semm is obtained by centrifugation at 3000 rpm. for 10 min. Serum total levels of IgE are determined by
- YAMASA's ELISA kit and their Ig subtypes are done by an Ig ELISA KIT (Rougier Biotech's, Montreal, Canada).
- mice are injected intraperitoneally with LPS (200 ⁇ g/mouse). Compound is administered intraperitoneally 1 h before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- ⁇ concentration in the sample is determined using an ELISA kit.
- Mouse eotaxin-induced eosinophilia model
- BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch.
- On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
- IL-5 300 ng/mouse
- leukocytes in exudate is collected and the number of total cells is counted.
- the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution.
- D10.G4.1 cells (1 x 10 7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 h blood is collected and serum is obtained by 1.5 centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered intraperitoneally at -4 and +1 h after these cells injection.
- PCA Passive cutaneous anaphylaxis
- Rats are injected intraperitoneally (i.p.) 0.5 h prior to antigen injection. Rats
- control rats with sensitization, challenge and vehicle treatment are used to determine a value without inhibition. Thirty min after the challenge, the rats are killed, and the skin ofthe back is removed. Evans blue dye in the skin is extracted in
- % inhibition ⁇ (mean vehicle value - sample value)/(mean vehicle value - mean control value) ⁇ x 100
- mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in conesponding transgenic mice (e.g., CETP transgenic mice). Triglyceride-lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5% cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in Solutol/Ethanol saline mixtures) and applied by oral gavage or intravenous injection.
- Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INF ⁇ NITY TM triglyceride reagent; Sigma, St. Louis).
- HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
- Plasma levels of human apolipoprotein-AJ in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
- Test compounds are administered orally or intravenously.
- Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
- the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
- Cremophor ® / H 2 O (10/20/70 v/v/v) given orally by gavage.
- the animals of control groups only receive the vehicle.
- mean blood pressure and heart rate of treated and untreated control groups are measured.
- the animals are artificially ventilated at constant volume (Engstr ⁇ mR 300, Engstr ⁇ m, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO 2 concentration of about 5% (NormocapR, Datex, Finland).
- a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer LVH4, Munchen, Germany).
- LCX left coronary artery
- Statham, Oxnard, CA, USA is applied for measurement of coronary blood flow.
- Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brash, Gould, Cleveland, OH, USA).
- the maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax).
- an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose.
- Each dose of the test compound is tested at least three times in different animals.
- the order of injection ofthe different doses is randomized in each animal.
- CD34 + cells were purified by immunomagnetic separation system (MiniMACS, Miltenyi Biotec), according to the manufacture's instructions (Direct CD34 Progenitor Cell Isolation Kit, Miltenyi Biotec). The percentage of CD34 + cells were generally from 90-95%. Erythropoiesis/ Anemia
- 1-2 x 10 4 CD34 + cells were plated in triplicate in 24-well plates with 1ml Iscoves modified Dulbecco medium (IMDM) (Invitrogen) containing 10% fetal bovine seram (FCS, Invitrogen), 1% Glutamine (Invitrogen) supplemented with SCF (25 ng/ml) (PeproTech), different concentration of Erythropoietin (0.01 U/ml - 1 U/ml) (Erypo ® FS 4000, Cilag) with or without compounds. Control cells were incubated with 0.1- 0.2%) DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . After 9 to 14 days cells were harvested, counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation.
- IMDM Iscoves modified Dulbecco medium
- CD34 + cells/ml were plated in triplicate 24-well plates with 1% methylcellulose in IMDM containing 30% FCS, 1% bovine seram albumin (BSA), 2 mM L- glutamine and 10-4 M 2-mercaptoethanol (Methocult H4230, Cell Systems ® ), IL-3 (lOng/ml ) (PeproTech) with different concentration of erythropoietin (0.01 U/ml -
- erythroid progenitors were plated in triplicate in 24-well plates with 1 ml IMDM containing 10% FCS, 1% glutamine supplemented with SCF (25 ng/ml), different concentration of erythropoietin (0.01 U/ml - 1 U/ml) with or without compounds.
- Control cells were incubated with 0.1-0.2%> DMSO instead of compounds.
- the cultures were incubated at 37°C in a fully humidified atmosphere with 5%> CO 2 . After 6 to 8 days cells were harvested and counted to analyze proliferation.
- IMDM IMDM containing 10% FCS, 1% Glutamine supplemented with SCF (25 ng/ml), different concentration of Erythropoietin (0.01 U/ml - 1 U/ml) with or without compounds.
- Control cells were incubated with 0.1-0.2%) DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . After 6 to 8 days cells were harvested and counted to analyze proliferation.
- CD34 + cells isolated from peripheral blood, cord blood or from bone manow were pre-incubated in quadruplicate in 24-well plates in 1ml medium (StemSpan) with 15% FCS, SCF (20 ng/ml) and GM-CSF (2,5 ng/ml) for 6 to 7 days at 37°C and 5.5% CO 2 . Then compounds (0.1.1 or 10 ⁇ M in DMSO) with or without G-CSF (0.25 ng/ml; Neupogen ® ) were added and incubated for another 6 to 7 days.
- the number of the early myelopoietic CD15 + /CDllb " cells and the number of the late myelopoietic CD15 + /CDllb + cells were determined by cell count (proliferation) and FACS (fluorescent associated cell sorting) analysis (differentiation) at day 13-14.
- CD34 + cells isolated from peripheral blood, cord blood or from bone manow were incubated in quadruplicate 24-well plates in 1 ml serum-free medium with 2% BSA, SCF (20 ng/ml) and compounds ( 0.1,1 or 10 ⁇ M in DMSO) with or without TPO (0-lOng/ml) for 12 to 13 days at 37°C and 5% CO 2 .
- the number of the megakaryoid CD41 + cells (scatter profile) were determined by FACS analysis.
- mice were used for compound testing.
- other species e.g. rats, hamsters or guinea pigs have been used in addition.
- repeated dosage is required for detection of changes in peripheral blood parameters.
- blood samples were drawn for analysis of red and white blood cell counts as well as platelet counts using an automated blood analyzer.
- erythropoiesis was assessed by manual hematocrit and reticulocyte count determination. For specific analysis of leukocyte differentiation fluorescent associated cell sorting (FACS) was used.
- FACS leukocyte differentiation fluorescent associated cell sorting
- Immunocompetent Balb/c mice were treated with compounds at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 4 days.
- the WBC white blood cells count
- the neutrophil count were monitored by FACS (CD1 lb + ; scatter properties).
- Immunocompromised Balb/c were generated by intravenous treatment with 5-FU (100 mg/kg ip). 24 hours later the mice were treated with the test compound at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 7 to 13 days.
- Peripheral blood counts (WBC, RBC, PLT) have been determined after retroorbital plexus puncture at days 5, 7, 11 and 14.
- WBC, RBC, PLT Peripheral blood counts
- FACS analysis The expression of specific differentiation markers on stem and progenitor cells (e.g. CD34, CD33, CD38, CDllb) and scatter properties were investigated.
- Thrombopoietic compounds at different doses were administered orally or parenterally following chemotherapy (Carbop latin, 100 mg/kg ip) immunocompromised mice. After repeated administration (once/day or bid for five to seven days) peripheral blood platelets (automated blood analyzer) have been determined after retroorbital plexus puncture at day 5, 7, 11, and 14.
- Wistar rats (200-250 g/ Charles River Japan) are anesthetized intraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
- the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition.
- a polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
- Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstracted animals.
- the bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump.
- the conscious rats are held under partial restraint in a restraining device.
- Warmed saline is infused into the bladder at a rate of 3 ml h for control and obstracted animals.
- the rate of infusion is increased from 3 to 10 ml/h to obtain similar interval times between micturitions in obstracted and control rats.
- Overactivity ofthe obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et ah, J. Urol. 160,
- test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
- an appropriate vehicle such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v
- An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds (i.e., drag candidates).
- Male Wistar rats (200 ⁇ 250 g/ Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112 mM NaCl, 5.9 mM KCI, 1.2 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 2 mM CaCi 2 , 2.5 mM NaHCO 3 , 12 mM glucose).
- Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
- Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
- An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds (i.e., drag candidates).
- Male Wistar rats (200-250 g/ Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) ofthe following composition (112 mM NaCl, 5.9 mM KCI, 1.2 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 2 mM CaCl 2 , 2.5 mM NaHCO 3 , 12 mM glucose).
- Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrasor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCI is determined at 15 minute intervals until reproducible responses are obtained. The response to KCI is used as an internal standard to evaluate the effect of test compounds.
- test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation.
- One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds.
- the ratio of each contraction to the internal standard e.g., a KCl-induced contraction
- the effects ofthe test compounds on the contraction are evaluated.
- Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
- the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
- a polyethylene catheter BECTON DICKINSON, PE50
- saline Otsuka
- Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mgkg). The abdomen is opened through a midline mcision, and . a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome. The catheter is tunneled through subcutis of the animal by needle (14G) to neck.
- the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
- the catheter is tunneled through subcutis of the animal by needle to neck.
- RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
- RNA from each cell or tissue source was first reverse transcribed. 85 ⁇ g of total RNA was reverse transcribed using 1 ⁇ ole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen,
- the first strand synthesis buffer and Omniscript reverse transcriptase (2 U/ ⁇ l) were obtained from (Qiagen, ' Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
- Forward and reverse primers and probes were designed using the Perkin Elmer ABI Primer ExpressTM software and were synthesized by TibMolBiol (Berlin, Germany).
- the forward primer sequence was: Primerl aggtgacactcacggacctt (SEQ ID NO:22).
- the reverse primer sequence was Primer2 agttcaatgcctcctgttcg (SEQ ID NO:23).
- Probel cgccatcgccaccatgga (SEQ ID NO:24), labeled with FAM (carboxy- fluorescein succinimidyl ester) as the reporter dye and TAMRA (carboxytetra- methylrhodamine) as the quencher, was used as a probe.
- FAM carboxy- fluorescein succinimidyl ester
- TAMRA carboxytetra- methylrhodamine
- Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95 °C for 15 sec and annealing/extending at 60°C for 1 min.
- the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
- the CF-value (factor for threshold cycle conection) is calculated as follows:
- PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
- CT HKG - alues were calculated as described in the "Quantitative determination of nucleic acids" section.
- CT C DNA-n CT value ofthe tested gene for the cDNA n
- CF 0D NA- ⁇ CT cor - c D NA -n (conected CT value for a gene on cDNA n)
- fetal heart heart, pericardium, heart atrium (right), heart atrium (left), heart ventricle (left), heart ventricle (right), heart apex, Purkinje fibers, interventricular septum, fetal aorta, aorta, aorta sclerotic, artery, coronary artery, coronary artery sclerotic, pulmonary artery, carotid artery, mesenteric artery, vein, pulmomc valve, coronary artery smooth muscle primary cells, HUVEC cells, skin, adrenal gland, thyroid, thyroid tumor, pancreas, pancreas liver cinhosis, esophagus, esophagus tumor, stomach, stomach tumor, colon, colon tumor, small intestine, ileum, ileum tumor, ileum chronic inflammation, rectum, salivary gland, fetal liver, liver, liver cinhosis, liver tumor, HEP G2 cells, leukocyte
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2003245990A AU2003245990A1 (en) | 2002-06-26 | 2003-06-26 | Regulation of human map kinase kinase kinase |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US39141002P | 2002-06-26 | 2002-06-26 | |
US60/391,410 | 2002-06-26 | ||
US43262202P | 2002-12-12 | 2002-12-12 | |
US60/432,622 | 2002-12-12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2004003191A1 true WO2004003191A1 (fr) | 2004-01-08 |
Family
ID=30003190
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2003/006740 WO2004003191A1 (fr) | 2002-06-26 | 2003-06-26 | Regulation de map kinase kinase kinase humaine |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU2003245990A1 (fr) |
WO (1) | WO2004003191A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015179436A1 (fr) * | 2014-05-19 | 2015-11-26 | Sanford-Burnham Medical Research Institute | Traitement de l'inflammation au moyen d'inhibiteurs de mekk3 ou de peptides bloquants |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999047686A2 (fr) * | 1998-03-16 | 1999-09-23 | Cadus Pharmaceutical Corporation | Proteines humaines mekk, molecules d'acides nucleiques et procedes d'utilisation correspondants |
US5981265A (en) * | 1993-04-15 | 1999-11-09 | National Jewish Center For Immunology And Respiratory Medicine | Methods for regulating MEKK protein activity |
US6333170B1 (en) * | 1993-04-15 | 2001-12-25 | National Jewish Center For Immunology And Respiratory Medicine | Method and product for regulating cell responsiveness to external signals |
WO2003048202A2 (fr) * | 2001-12-03 | 2003-06-12 | Asahi Kasei Pharma Corporation | Gène activant le facteur nucléaire kappa b |
-
2003
- 2003-06-26 AU AU2003245990A patent/AU2003245990A1/en not_active Abandoned
- 2003-06-26 WO PCT/EP2003/006740 patent/WO2004003191A1/fr not_active Application Discontinuation
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5981265A (en) * | 1993-04-15 | 1999-11-09 | National Jewish Center For Immunology And Respiratory Medicine | Methods for regulating MEKK protein activity |
US6333170B1 (en) * | 1993-04-15 | 2001-12-25 | National Jewish Center For Immunology And Respiratory Medicine | Method and product for regulating cell responsiveness to external signals |
WO1999047686A2 (fr) * | 1998-03-16 | 1999-09-23 | Cadus Pharmaceutical Corporation | Proteines humaines mekk, molecules d'acides nucleiques et procedes d'utilisation correspondants |
US6312934B1 (en) * | 1998-03-16 | 2001-11-06 | National Jewish Center For Immunology And Respiratory Medicine | Human MEKK proteins, corresponding nucleic acid molecules, and uses therefor |
WO2003048202A2 (fr) * | 2001-12-03 | 2003-06-12 | Asahi Kasei Pharma Corporation | Gène activant le facteur nucléaire kappa b |
Non-Patent Citations (6)
Title |
---|
[online] 1 November 1997 (1997-11-01), ELLINGER-ZIEGELBAUER HC ET AL.: "Mitogen-activated protein kinase kinase kinase 3 (MEKK 3)", XP002256048, retrieved from EMBL Database accession no. Q99759 * |
DATABASE EMBL [online] EBI; 12 July 2002 (2002-07-12), KOEHRER K ET AL: "Homo sapiens mRNA; cDNA DKFZp762P223", XP002256050, retrieved from EMBL Database accession no. AL834303 * |
DATABASE EMBL [online] EBI; 8 February 2001 (2001-02-08), SHIMKETS RA AND LEACH M: "Human ORF2423 polypeptide sequence SEQ ID NO:4846", XP002256049, retrieved from EMBL Database accession no. AAB42659 * |
ELLINGER-ZIEGELBAUER HEIDRUN ET AL: "Cell cycle arrest and reversion of Ras-induced transformation by a conditionally activated form of mitogen-activated protein kinase kinase kinase 3.", MOLECULAR AND CELLULAR BIOLOGY, vol. 19, no. 5, May 1999 (1999-05-01), pages 3857 - 3868, XP002256047, ISSN: 0270-7306 * |
ELLINGER-ZIEGELBAUER HEIDRUN ET AL: "Direct activation of the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by and inducible mitogen-activated protein kinase/ERK kinase kinase 3 (MEKK) derivative.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 5, Q99759, 1997, pages 2668 - 2674, XP002256046, ISSN: 0021-9258, Retrieved from the Internet <URL:EMBL> * |
YANG JIANHUA ET AL: "The essential role of MEKK3 in TNF-induced NF-kappaB activation.", NATURE IMMUNOLOGY, vol. 2, no. 7, July 2001 (2001-07-01), pages 620 - 624, XP002256108, ISSN: 1529-2908 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015179436A1 (fr) * | 2014-05-19 | 2015-11-26 | Sanford-Burnham Medical Research Institute | Traitement de l'inflammation au moyen d'inhibiteurs de mekk3 ou de peptides bloquants |
Also Published As
Publication number | Publication date |
---|---|
AU2003245990A1 (en) | 2004-01-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20060121562A1 (en) | Human receptor tyrosine kinase mertk | |
WO2004031375A2 (fr) | Regulation de la pde1c humaine | |
WO2003064639A1 (fr) | Régulation du domaine catalytique humain de la protéine mekk | |
US20040253669A1 (en) | Regulation of human dcamkl1-like serine/threonine protein kinase | |
WO2003100046A1 (fr) | Regulation de la kinase humaine | |
US7179629B2 (en) | Regulation of human serine/threonine kinase | |
WO2004003191A1 (fr) | Regulation de map kinase kinase kinase humaine | |
US7049118B2 (en) | Regulation of human serine-threonine protein kinase | |
WO2004020620A1 (fr) | Regulation de l'esterase humaine | |
WO2004009803A2 (fr) | Regulation de l'hepsine humaine | |
US20050208492A1 (en) | Regulation of human serine/threonine kinase | |
WO2003052088A2 (fr) | Regulation de la sialyltransferase humaine | |
WO2004029237A1 (fr) | Variants d'epissage de la leukotriene a-4 hydrolase humaine | |
WO2003064654A1 (fr) | Proteine kinase serine/threonine d'origine humaine | |
US20050255545A1 (en) | Regulation of human hematopoietin receptor-like protein | |
WO2004009623A1 (fr) | Regulation de la serine-threonine kinase interagissant avec des recepteurs humains | |
WO2003033708A2 (fr) | Regulation de la proteine kinase humaine a serine/threonine | |
US20050244825A1 (en) | Regulation of human bmp-2 inducible kinase | |
EP1506290A1 (fr) | Regulation de la serine/threonine kinase humaine | |
WO2004018661A1 (fr) | Regulation de la proteine de type esterase humaine | |
WO2004003189A2 (fr) | Regulation de phospholipase c humaine | |
WO2003093466A1 (fr) | Proteine humaine associee au rhomboide | |
WO2004005501A1 (fr) | Regulation la caseine kinase humaine i epsilon | |
WO2003070929A1 (fr) | Regulation d'une proteine humaine contenant une signature de protease zinc | |
WO2003057869A1 (fr) | Regulation de la sulfatase humaine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |