WO2004020628A1 - Procede de creation genetique de sequences d'acide nucleique derivees de plantes faisant appel a un rearrangement de genes et a une mutagenese selective - Google Patents

Procede de creation genetique de sequences d'acide nucleique derivees de plantes faisant appel a un rearrangement de genes et a une mutagenese selective Download PDF

Info

Publication number
WO2004020628A1
WO2004020628A1 PCT/GB2003/003773 GB0303773W WO2004020628A1 WO 2004020628 A1 WO2004020628 A1 WO 2004020628A1 GB 0303773 W GB0303773 W GB 0303773W WO 2004020628 A1 WO2004020628 A1 WO 2004020628A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
nucleic acid
protein
activity
derived
Prior art date
Application number
PCT/GB2003/003773
Other languages
English (en)
Inventor
David Peter Dixon
Robert Edwards
Original Assignee
University Of Durham
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Durham filed Critical University Of Durham
Priority to AU2003269099A priority Critical patent/AU2003269099A1/en
Publication of WO2004020628A1 publication Critical patent/WO2004020628A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1088—Glutathione transferase (2.5.1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance

Definitions

  • the invention relates to novel plant-derived nucleic acid sequences and proteins encoded thereby in particular Glutathione trans ferases (GST's); methods for the production thereof; and microorganisms and plants transfomed thereby; and their use in enhancing the detoxification of pesticides and organic pollutants.
  • GST's Glutathione trans ferases
  • plants that can tolerate herbicides or organic pollutants are highly desirable.
  • the different susceptibility of plants to a synthetic phytotoxic agent can arise for a number of reasons such as differential uptake or differential sensitivity of the target site to the toxin.
  • tolerance is mainly due to the plants ability to metabolise the toxin, thus reducing its availability to act at its target site.
  • GSTs play a major role in their detoxification. These dimeric enzymes act by substituting an electrophilic group on herbicidal, and other, molecules with the tripeptide glutathione ( ⁇ -glutamyl-cysteinyl- glycine). Typically, this substitution considerably reduces the toxicity of the molecule and tags it for import into the vacuole where further degradation occurs.
  • GSTs have a well characterised role in determining the metabolism and selectivity of chloroacetanilide, thiocarbamate and chloro-s-triazine herbicides in maize.
  • GSTs catalyse the conjugation of these herbicides with the above tripeptide glutathione ( ⁇ -glutamyl-cysteinyl-glycine) to form non-toxic S- glutathionylated products.
  • alternative GST activities determine herbicide selectivity.
  • the photobleaching diphenyl ether herbicides fluorodifen, acifluorfen and fomesafen are rapidly detoxified by GSTs in soybean and peas but are not tolerated well in maize.
  • the group substituted by glutathione is a phenol derivative, and glutathione conjugation effectively cleaves the herbicide in two, drastically reducing its toxicity.
  • the diphenyl ether fluorodifen is rapidly detoxified in peas by a glutathione mediated cleavage of the herbicide (Fig 1A), with this reaction being 4-fold faster than in maize.
  • Phi GST enzymes contain members which are highly active toward chloroacetanilide and thiocarbamate herbicides
  • Tau GST enzymes GSTUs
  • GSTFs are the major class of expressed GST, while in soybean GSTUs predominate, with this difference accounting for the differential detoxification of different classes of herbicide in the two crops.
  • the first is to increase the levels of detoxifying enzyme in the plant as activity should be directly proportional to enzyme concentration. Indeed, some highly herbicide-resistant populations of weeds which are usually well controlled by a herbicide do have greatly enhanced levels of GSTs.
  • the second approach to increasing detoxifying activity is to genetically engineer a plant with a GST which has an activity towards herbicides which is different from those GSTs already present in the plant.
  • This novel GST can come from a species found to contain the GST activity of interest, although the search for a suitable enzyme is likely to be time-consuming.
  • GSTs are ideal enzymes to engineer in heterologous hosts through combining DNA shuffling with mutagenesis.
  • DNA shuffling of related GST genes using reconstructive PCR is a powerful technique to generate a large library of mutants. Coupled with an appropriate screening procedure and subsequent mutation, this system has the potential to generate mutants with enhanced activity towards a wide range of herbicidal and other compounds, providing enzymes tailor-made for a variety of different applications.
  • a method for genetically engineering a plant-derived nucleic acid sequence with specific debilitating activity towards a toxin by means of random gene shuffling and/or mutagenesis in combination with rational design of the mutated sequence comprises in combination random gene shuffling followed by selective site directed mutagenesis of one or more plant-derived nucleic acid sequences(s). More preferably the method comprises random gene shuffling, identification of enhanced activity mutant enzyme(s); identification of conserved characteristics and of residues key to detoxification activity; and site directed mutagenesis of the identified residue.
  • references herein to a protein or enzyme having enhanced detoxifying activity is to a more rapid, more potent, more stable or otherwise novel activity having regard to either the parent protein or enzyme or comparable proteins or enzymes, and which enhances toxin resistance of a host plant or microorganism.
  • this enhanced activity GST need only be expressed at moderate levels in a crop to significantly increase herbicide tolerance thus decreasing the incidence of herbicide-induced injury, though it would be possible to over express the GST to enhance yet further the herbicide tolerance of a particular plant.
  • the method of the invention may be used to engineer resistance to a herbicide in a crop that is usually highly sensitive to the herbicide. This would allow a particular herbicide to be used on a wider range of crops. Further, by engineering activity in a crop towards a non-selective herbicide, selectivity may be achieved. This would allow otherwise unsuitable chemicals which nevertheless may have environmental or other advantages to be developed as herbicides.
  • the invention is applicable to any combination of plant gene source and recipient plant.
  • the method involves the transformation of one plant species, such as Arabidopsis, with a plant- derived nucleic acid sequence originally derived from another plant, such as maize, to confer new tolerance traits toward herbicides.
  • the method of the invention may be used to generate novel proteins or enzymes such as GSTs or the like, to have a specific activity towards a specific class of compounds, in particular to have a detoxifying activity towards classes of compounds which are located and identified in the environment as toxins, whereby the proteins or enzymes are useful for phytoremediation.
  • novel proteins or enzymes such as GSTs or the like
  • Reference herein to rational design is to identifying one or more novel or engineered residues associated with a change in protein activity, and further modifying said residues to produce further changes in protein activity.
  • a method for the rational design and production of at least one novel plant-derived nucleic acid sequence comprising: i) recombining one or a plurality of plant-derived nucleic acid sequences to produce one or a library of mutant recombinant nucleic acids; and ii) screening said library to identify at least one mutant recombinant nucleic acid encoding a toxin debilitating protein; iii) identifying one or more residues associated with changes in protein activity of a toxin debilitating protein encoded by a mutant recombinant nucleic acid obtained in stage (i) due to a mutation therein; and iv) introducing one or more further changes in the residue(s) identified in stage iii) to produce a further mutated nucleic acid or
  • the method may comprise one or more rounds of stage i) recombining.
  • the sequences are suitably at least some of, and more preferably all of those derived from a or the previous round.
  • recombining one or a plurality of sequences comprises digesting the sequence(s) to produce fragments and recombining the fragments.
  • recombining is a random process whereby fragments may take the same or different sequence.
  • recombining is by use of reconstructive error prone PCR.
  • the process produces fragments of the order 0 - 500 bp and recombinant nucleic acids of the order 500 bp-20kb.
  • PCR is operated for up to 100 cycles, preferably of the order of 50 cycles.
  • An amount of one sequence or a plurality of sequences may produce one or more than one recombinant nucleic acid, depending on the amount of sequence(s) employed and the extent of digestion.
  • one or more sequences produce more than one recombinant nucleic acid, more preferably produce from 2 to 1000 mutants, more preferably from 5 to 500.
  • mutation is by point mutation such as deletion or insertion or is by inversion of a fragment or is by chimer formation by recombination of fragments of two or more parent sequences .
  • Screening is by known means. By screening those nucleic acids with retained debilitating activity are identified and mutations key to increased debilitating activity are identified.
  • Preferably identification in stage (iii) is based on the essentially conserved kinetic characteristics of mutant nucleic acid sequences, in which sequences have been shuffled, to identify a residue whose mutation is a key factor determining the detoxification characteristics of the best performing mutant sequence or protein.
  • 5000 mutants were screened of which 7 were of enhanced detoxifying activity, all of which were chimeric (EFD's) in which blocks of sequences had been shuffled.
  • the best performing chimer was selected and, based on the essentially conserved kinetic characteristics of the other chimers, the residue whose mutation was a key factor dete ⁇ nining the detoxification activity of the best mutant was identified.
  • a change in activity in stage (iv) may be a change in activity under all or certain conditions, ie may be increased debilitating activity per se or increased stability of the debilitating enzyme under certain conditions allowing it to maintain debilitating activity under those conditions, such as extremes of temperature, lack or excess moisture and the like.
  • the identified recombinant nucleic acid in stage (ii) or (iv) is a mutant of the parent sequence(s).
  • the recombinant nucleic acid may be a chimer or gene-shuffled version of the parents sequences.
  • a gene -shuffled nucleic acid is typically a shuffled chimer, in which the chimer includes both swopover and insertion of gene sequences.
  • nucleic acids in stages i) or iv) are of the form of point mutations of residues or substitution of sequences as hereinbefore defined for stage i) more preferably mutation in stage iv) is by point mutation such as deletion or insertion or is by inversion of a fragment.
  • the method comprises molecular biological techniques, such as directed evolution and site-directed mutagenesis more preferably reconstructive error - prone PCR.
  • molecular biological techniques such as directed evolution and site-directed mutagenesis more preferably reconstructive error - prone PCR.
  • a plant-derived nucleic acid sequence is a wild-type or synthetic (mutant) nucleic acid sequence.
  • a wild type nucleic acid sequence may be a nucleic acid sequence from a plant which displays poor resistance to phytotoxic chemicals in general or to a specific phytotoxin.
  • a plant-derived nucleic acid sequence is related to the GSTs more preferably encodes GSTs of phi or tau class, more preferably tau class GSTUs, whereby the method introduces greatly increased activity towards herbicides or other toxic synthetic compounds and preferably, towards diphenyl ether herbicides.
  • the GST's may be of any desired plant lineage and are preferably crop plants GST's for example maize or the like.
  • ZraGSTUl and Zr ⁇ GSTU2 are the dominant GSTUs expressed in maize seedlings, albeit being considerably less abundant than the respective GSTFs and show limited activity toward diphenyl ethers, including fluorodifen.
  • the strategy adopted has been to use reconstructive error prone PCR to generate nucleic acid sequences encoding mutant GSTUs derived from nucleic acid sequences encoding both ZmGSTUl and Z GSTU2.
  • Mutant GSTUs showing enhanced activity towards fluorodifen have then been isolated, characterised and their coding sequences subjected to further directed mutagenesis, with the resulting optimised nucleic acid sequences used to transform Arabidopsis thaliana and tested for their ability to enhance herbicide tolerance in planta.
  • the method of the invention as herein defined may comprise recombining any one or more plant-derived nucleic acid sequences encoding a toxin debilitating protein. Sequences for recombining may themselves be mutated.
  • Reference to a nucleic acid encoding a toxin debilitating protein or to a toxin debilitating activity according to the method of the invention is to at least one protein encoded by a recombinant nucleic acid which has tolerance to a desired toxin, by means of its ability to partially or completely, reversibly or preferably irreversibly digest, metabolise, deactivate, mask or otherwise detoxify a desired toxin, for example a desired herbicide or pollutant.
  • a toxin as hereinbefore defined may be any toxic or phytotoxic chemical.
  • Typical toxins may be natural or synthetic and include agricultural toxins such as herbicides, pesticides, fungicides, and the like, industrial toxins such as refinery hydrocarbons, industrial acids, heavy metals and the like; in particular the diphenyl ether class of herbicides such as fluorodifen , fomesafen, acifluorfen as disclosed in Tomlin, C. d. S.
  • the pesticide manual a world compendium 12 th ed British Crop Protection Council, Farnham, the contents of which are incorporated herein by reference; and/or the aryloxyphenoxypropionate class of herbicides and/or the chloroacetanilide class of herbicides and /or the thiocarbamate class of herbicides and/or the chloro-s-triazine class of herbicides and/or members of the sulphonylurea class of herbicides.
  • GSTU's have high debilitating activity against the diphenylether and the aryloxyphenoxypropionate classes and that the GSTF's have high debilitating activity against the chloroacetanilides and the thiocarbamates. Moreover some plant GST's are more or less efficient than others, for example as expressed in planta maize GSTUs are less efficient than legume GSTUs in detoxifying fluorodifen.
  • the method is for recombining at least one nucleic acid encoding a herbicide debilitating protein. More preferably the method is for recombining at least one nucleic acid ' sequence encoding a diphenylether, aryloxyphenoxypropionate, chloroacetanilide, thiocarbamate, chloro-s-triazine or sulphonylurea debilitating protein, more preferably for recombining as hereinbefore defined one or a plurality of nucleic acid sequences encoding one or a plurality of GST's, most preferably GSTU's.
  • the method of the invention is surprisingly highly specific in modifying activity of proteins encoded by GST's towards a specific class of herbicides for example the class of diphenyl ether herbicides, but not of other classes of herbicides i.e activity towards other classes of herbicides investigated was substantially unchanged.
  • the method of the invention may comprise providing a specific nucleic acid sequence encoding a protein providing a specific activity, and is not merely limited to regulating the activity of proteins encoded by nucleic acid sequences by mutation thereof.
  • the method of the invention may comprise providing a nucleic acid encoding a protein of enhanced environmental tolerance, such as drought, frost, heat and the like tolerance thereby improving its existing toxin debilitating activity.
  • a protein of enhanced environmental tolerance such as drought, frost, heat and the like tolerance
  • a plurality of plant-derived nucleic acid sequences to be digested in stage (i) are related nucleic acid sequences having at least 50% identical sequences, allowing efficient recombination without loss of functionality, such as folding and the like, preferably having at least 70% identical sequences, for example in the range 70 - 85 % identical
  • recombination in stage i) is by use of reconstructive PCR to provide a library of competent sequences. Selection of sequences for recombination is with use of any suitable analysis method, for example by gel electrophoresis. Suitably recombination is carried out by techniques known in the art, for example by obtaining suitable plasmids and digesting in enzyme to produce fragments, incubating for a suitable period and analysing the digestion by any suitable known techniques such as by gel electrophoresis. Preferably analysis identifies bands of interest which are isolated and the sequence(s) is/are purified.
  • PCR amplification is conducted under conditions allowing errors, for example error prone transcription of the parental nucleic acid, or amplification of the parental nucleic acid in a mutator cell strain, whereby a plurality of mutant genes are obtained, for example of the order of 1000' s.
  • the method comprises cloning the amplified genes into a suitable plasmid vector by digestion of products and vector with restriction enzymes, ligation of digested vector and PCR products using standard conditions to provide a plurality of mutant enzymes, for example of the order of 1000's, which may then be transformed into cells.
  • stage ii) of the method of the invention suitably the sequences are not isolated but are screened in situ, and may be screened in bacterial and/or plant cells.
  • said library is present in a population of cells and, ideally, said screening involves growing said cells in a medium containing a toxin, and then examining said toxin for physical changes. Physical changes may be observed by colour change, specti'al change or the like as known in the art.
  • said change is a colour change.
  • said screening involves bacterial techniques, such as growing in bacteria, and detecting detoxified toxin or a residue thereof.
  • Detoxified toxin or a residue thereof may be released from cells and detected outside cells or may be retained within cells and detected by lysing and analysing contents of lysed cells.
  • intact bacteria release paranitrophenol, a residue of fluorodifen detoxification, and therefore do not need to be lysed before assaying for detoxifying activity eg fluorodifen -glutathione conjugating activity.
  • cells may be grown in a medium containing a toxin and those which survive the toxin may be cultured on and identified.
  • the screen is constructed around an activity which it is desired to provide in the resultant protein, and most preferably comprises a digestion, metabolisation, deactivation, masking or other detoxifying activity having regard to the toxin in which the sequence encoding the protein is cultured.
  • the method may comprise multiple screens for the purpose of identifying the at least one nucleic acid of the invention.
  • the method may be repeated for further mutation of a selection of nucleic acids to introduce further activities or enhance further existing activities, prior to a single screening stage or after each screening stage, or the mutated nucleic acid may then be cultured or introduced into micro organisms or plants for future cultures.
  • the method of the invention comprises identifying the gene mutation for further recombination by rational design. Identification of gene mutations associated with a particular activity in proteins encoded thereby, is by known techniques, including sequencing genes encoding proteins exhibiting a change in the activity of interest and comparing the type and location of mutations. Identification may be facilitated with screening of a greater number of proteins.
  • further mutation is by point mutation using techniques as known in the art, for example as disclosed in Dixon D. P., et al "Characterisation of a zeta class glutathione transferase from Arabidopsis thaliana with a putative role in tyrosine catabolism", Arch. Biochem. Biophys. 384, 407 - 412; the contents of which are incorporated herein reference.
  • any number of plant-derived nucleic acid sequences could be used, and selection thereof is dictated by convenience and level of activity sought in the protein encoded by the transformed sequence.
  • sequences such as GST encoding sequences are used, preferably 2 to 20, more preferably 2 to 6, most preferably two sequences or GST encoding sequences are used.
  • said sequences or GST encoding sequences have at least 50% identity and more preferably more than 70% identity.
  • the recombinant nucleic acid encoding a toxin debilitating protein has at least 50% identity with any one or more of the starting plant- derived sequences, more preferably more than 70% identity.
  • any suitable GST encoding sequences may be used, for example from the classes phi (GSTF), tau (GSTU), theta or zeta or combinations thereof.
  • GST encoding sequences from same or different classes may be selected, preferably two same class tau GSTU encoding sequences are used for example maize (Zea mays L).
  • mutant genes may be used, for example a single parent gene may be mutated and then the mutant forms digested and recombined.
  • said GST encoding sequences are selected on the basis of the high GST activity of proteins encoded thereby towards the diphenylether class of herbicides such as fluorodifen, acifluorfen or formesafen.
  • said GST encoding sequences comprise, at least, the maize tau class GST, ZmGSTUl and ZwGSTU2, encoding sequences.
  • said recombinant nucleic acid is either mutated or chimeric. More preferably still, said nucleic acid encodes a protein which shows enhanced activity when compared to proteins encoded by either parent.
  • said protein is at least 5-fold more catalytically efficient than that encoded by the most active parent GST sequence and ideally 6-fold more catalytically efficient, for example in the case of EFD4 and EFD5 as hereinbelow referred; and, more preferably, at least 19-fold more catalytically efficient for example in the case of EFD3 as hereinbelow referred; and yet more preferably still 29-fold more catalytically efficient for example in the case of EFD1-115 as hereinbelow referred.
  • the invention therefore comprises a method as hereinbefore defined comprising using reconstructive PCR to randomly recombine and mutagenise two tau class maize GST nucleic acid sequences which encode proteins which are active in detoxifying herbicide fluorodifen; screening proteins encoded by the resultant mutated and chimeric sequences and selecting a number of mutants and/or chimers encoding proteins with catalytic efficiencies towards fluorodifen up to 19-fold more efficient than those encoded by the parent sequences.
  • this efficiency is further increased by identifying in stage iii) a residue as important due to a random mutation which has occurred during reconstructive PCR in stage i), and carrying out further site- directed mutagenesis thereof as in stage iv).
  • identifying key mutations is by identifying as important a mutation present in all the high activity protein encoding mutants, such as a large C- terminal portion derived from one parent together with a small region derived from another parent, or a point mutation.
  • mutant EFD1 a point mutation.
  • the high activity of protein encoded by mutant EFD1 towards fluorodifen was demonstrated to be due to the point mutation. From these data, it is highly likely that this region of the enzyme is close enough to the active site to influence substrate binding, although there is no direct evidence for this. Crystal structures have been determined for a number of plant GSTs, however to date these have all been phi class enzymes.
  • Tau class enzymes which include the enzymes in this study, are sufficiently different from these phi class GSTs to make it difficult to use the structure data to predict which residues are important in substrate binding.
  • a method for the production of at least one novel GST comprising: i) recombining one or a plurality of nucleic acids encoding one or a plurality of GST's to produce a library of recombinant nucleic acids, as hereinbefore defined and obtaining a library of mutant GSTs encoded thereby; ii) screening the library to identify at least recombinant nucleic acid encoding a toxin debilitating GST; iii) identifying one or more residues associated with changes in protein activity due to a mutation in a recombinant nucleic acid obtained in stage (i); and iv) introducing further changes in the identified residue(s) to produce a further library of mutant nucleic acids that encode for GSTs with different activities; and screening as in stage (ii).
  • a novel nucleic acid sequence or protein encoded thereby in particular a novel enzyme such as a novel GST produced by the hereinbefore defined method.
  • said novel sequence when produced by any of the aforementioned methods encodes a protein showing enhanced toxin debilitating activity when compared to either parent.
  • said sequence encodes a GST which is at least 5-fold more catalytically efficient than the most active parent GST and ideally 6- fold more catalytically efficient than the most active parent GST for example in the case of EFD4 and EFD5; and, more preferably, at least a 19-fold more catalytically efficient for example in the case of EFD3.
  • said novel sequence when produced by said method, encodes a protein that is 29-fold more catalytically efficient than the most active parent, for example in the case of EFD1-115.
  • a novel sequence comprises one of the amino acid sequence structures shown in Figure 4, or a sequence structure homologous thereto, wherein a point mutation exists at the amino acid corresponding to the 113 amino acid of GST ZmGSTU2.
  • said point mutation involves the substitution of a glutamine residue for one of the following residues: phenylalanine or alanine or lysine, or ideally a leucine residue.
  • said homologous amino acid has at least 50% identity with at least one of the amino acids shown in Figure 1, preferably 70% identity, more preferably 70- 85% identity.
  • a novel GST encoding sequence comprises the amino acid sequence structure shown in Figure 4 wherein a point mutation exists at the 115 11 amino acid residue, corresponding to the 113 u amino acid of GST Z GSTU2, whereby a glutamine residue has been substituted for a leucine residue.
  • a novel GST encoding sequence having an N-terminal domain comprising between 48 and 62 amino acid residues derived from ZwGSTUl.
  • said novel sequence further comprises a region derived from ZwGSTU2 which is interrupted by a further region derived from ZmGSTU 1.
  • a catalyst adapted to catalyse metabolism of a given toxin such as a herbicide comprising a novel protein, enzyme or GST having novel or increased catalytic activity obtained by the method as hereinbefore defined.
  • a microorganism, plant cell, plant, seed or progeny thereof transformed with a novel sequence of the method as hereinbefore defined, having novel or enhanced tolerance or resistance to a given phytotoxic chemical.
  • the microorganism, plant cell, plant, seed or progeny thereof is transformed with a novel plant-derived sequence of the invention and has novel or enhanced tolerance or resistance to a herbicide.
  • a plant, cell or its progeny is either a monocotyledon or a dicotyledon.
  • a plant is a crop plant such as maize, rice, potato, tomato or sorghum.
  • the host is a transgenic plant cell or plant, or their progeny, including in its genome a polynucleotide encoding a protein of the invention as hereinbefore defined derived from a different plant.
  • the polynucleotide is stably integrated into the genome. Alternatively the polynucleotide is maintained extrachromosomally.
  • a vector or plasmid comprising the protein of the invention as hereinbefore defined.
  • the vector or plasmid is integrated into the genome of the host cell and may be stably integrated into the genome or may be maintained extrachromosomally.
  • a method for the production of a transgenic heterologous plant host that is resistant to a toxin as hereinbefore defined comprising transforming a selected plant genome with a vector of the invention.
  • a method for the production of a transgenic heterologous plant host comprising transforming a selected plant genome with a vector of the invention.
  • a library of mutated sequences as hereinbefore defined having specific activity for use in selecting an sequence encoding a protein having desired activity and culturing plants or cells thereof.
  • a micro organism, plant cell, or plant or seed thereof transfonned with a novel enzyme of the invention, in phytoremediation of a contaminated locus, particularly contaminated soil and the like, or in agriculture or horticulture wherein the micro organism, plant cell, plant or seed is transformed with increased activity to the contaminant to be detoxified or with increased resistance to herbicide to be used in plant protection.
  • the micro organism, plant cell, plant or seed is transfonned with GST encoding nucleic acid sequence having one of the amino acid sequence structures shown in Figure 4, or a sequence structure homologous thereto, wherein a point mutation exists at the amino acid corresponding to the 113 th amino acid of GST ZtwGSTU2 5 and is useful in detoxifying soil contaminated with ex-herbicide, or in protecting the plant against herbicides, specifically fluorodifen and related diphenyl ether compounds.
  • a method for the production of at least one novel protein for use in phytoremediation of at least one identified toxin comprising: i) recombining one or a plurality of plant-derived nucleic acid sequences to produce a library of recombinant nucleic acids; and (ii) screening said library to identify at least one recombinant nucleic acid encoding a toxin debilitating protein; and optionally additionally (iii) identifying one or more residues associated with changes in protein activity with respect to the identified toxin, due to a mutation in a recombinant nucleic acid obtained in stage (i); and (iv) introducing further changes in the identified residue(s) to produce a further library of mutant nucleic acids that encode for proteins with different activities; and screening as in stage (ii).
  • the method for phytoremediation of a contaminated locus comprises cultivating a micro organism, plant cell, plant, seed or progeny thereof, transfonned with a novel enzyme of the invention, with increased activity to the contaminant to be detoxified, under conditions conducive to the detoxification of the contaminant and for a sufficient period for detoxification thereof.
  • the contaminated locus is cultivated with a micro organism, plant cell, plant or seed thereof which is transformed with GST having one of the amino acid sequence structures shown in Figure 1, or a sequence structure homologous thereto, wherein a point mutation exists at the amino acid corcesponding to the 113 th amino acid of GST Z77/GSTU2, and is useful in detoxifying soil contaminated with ex-herbicide, specifically fluorodifen and related diphenyl ether compounds.
  • Figure 1 shows the generation and screening of enhanced fluorodifen detoxifying (EFD) mutants showing an enhancement in the glutathione-dependent detoxification of fluorodifen to -nitrophenol and S-(2-nitro-4- trifluoromethylphenyl)-glutathione (A).
  • EFD enhanced fluorodifen detoxifying
  • Figure 3 shows a detailed view of fluorodifen-induced injury 4 days after spraying wild-type and EFD1-115A transgenic plants with 100 ⁇ M fluorodifen. All other lines showed similar injury to wild-type plants (not shown).
  • Figure 4 shows multiple alignment of fluorodifen high activity mutants with mutated ZmGSTUl (GSTU1) and ZmGSTU2 (GSTU2) deduced amino acid sequences. Regions of sequence derived from ZmGSTU2 are shown in normal type, regions of sequence derived from ZmGSTUl are shown in bold type and regions of crossover are shown in reversed type. Regions derived from the Bluescript expression vector are shown in lower case. Two amino acid substitutions, one in EFD1 and the other in EFD2, are underlined.
  • Fluorodifen, fomesafen and acifluorfen were obtained from Greyhound/ChemService (Merseyside, UK). Herbicides were used diluted from a 20 mM stock solution in acetone. ⁇ -Hexylglutathione and ⁇ -hexylglutathione coupled to Sepharose beads were synthesised as described by Mannervik and Guthenberg (1). All other chemicals were from the Sigma-Aldrich Chemical Company. GST Clones
  • Digested DNA was then purified by phenol- chloroform extraction and ethanol precipitation. Reactions producing fragments of mainly 0-500 bp were used for reconstructive PCR (7).
  • 20 ng/ ⁇ l of digested DNA as template, after 50 cycles (94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s + 3 s per cycle) reaction products of 500 bp- 20 kb were obtained and 1 ⁇ l of this mixhire was used as template for a standard 50 ⁇ l PCR reaction using Ml 3 forward and reverse oligonucleotide primers (30 cycles of: 94 °C for 30 s, 50 °C for 30 s, 72 °C for 60 s).
  • PCR reaction was analysed by agarose gel electrophoresis and bands of interest excised and the DNA purified.
  • PCR products of the expected size were then recloned into pBluescript by digestion of products and vector with Kpn I and Ban ⁇ I restriction enzymes, purification of the resulting fragments, ligation of digested vector and PCR product using standard conditions and transformation into electrocompetent (8) E. coli XLl-Blue MRF' cells. Colonies growing from transformed cells were selected for by planting cells onto LB agar containing ampicillin (100 ⁇ g/ml) and tetracycline (12.5 ⁇ g/ml).
  • GSTUs cloned in either pBluescript or pET plasmids in E.coli were cultured essentially as described previously (4,5) , with the exception that IPTG-induction was omitted for the expression of the galactosidase fusion proteins, and the respective recombinant proteins purified by S-hexylglutathione Sepharose (4,5).
  • the purified GSTs were extensively dialysed to remove j -hexylglutathion and assayed for activity towards CDNB and fluorodifen, the latter measured at 30 °C in 0.1 M glycine-NaOH buffer pH 9.5, 5 mM glutathione and 50 ⁇ M fluorodifen by following the increase in absorbance at 400 nm.
  • HPLC-based assays for activity towards herbicides other than fluorodifen were as described (2), except that assays with fomesafen and acifluorfen were canied out in glycine-NaOH buffer pH 9.5.
  • the protein concentration of purified recombinant GSTs was measured based on their calculated UN absorbance at 280 ran (3).
  • the randomly generated mutant EFD1 had a point mutation corresponding to the 113th amino acid residue of native Z777GSTU2, changing a glutamine residue to a leucine residue. This residue was then subjected to site-directed mutagenesis by PCR using specific mutagenic primers, together with a primer to the T7 promoter, using pEFDl (p Bluescript containing the mutant EFD-1) as the template. Primers used were primer 115E (caagaagatctatgacagcgagactcggctgtgg), primer 115 ⁇ (caagaagatctatgacagcaacactcggctgtgg), primer 115F
  • primer 115A (caagaagatctatgacagctteactcggctgtgg) and primer 115A
  • GST sequences were sub-cloned into pRT108 (9) by PCR from the respective pET- vectors and ligated into the vector's Ncol and BamUI sites, to provide an appropriately positioned CaMN 35S promoter.
  • This cassette was then digested with Hindlll and ligated into similarly digested pCAMBIA 3300 (obtained from the Center for the Application of Molecular Biology to International Agriculture, Canberra, Australia).
  • the resulting vectors were transfonned into Agrobacterium twnefaciens strain C58C3 which was used to transform Arabidopsis thaliana ecotype Columbia by floral dipping (10).
  • Dipped plants were grown to seed set and TI seeds grown in the greenhouse (16 h photoperiod; 23 °C day ;18 °C night) in a 4: 1 mixture of general purpose compost and silver sand.
  • the seedlings were sprayed with 0.02% (w/v) glufosinate ammonium (1 ml per 35 cm 2 ) to select for trans formants.
  • Surviving plants were re-sprayed after 7 days and analysed by western blotting using an anti- ZmGSTUl-2 serum (4). For each construct, 10 transfonned TI lines were analysed by removing a single rosette leaf and the analysing the crude protein directly by SDS-PAGE and western blotting.
  • Z/77GSTUI and ZmGSTU2 having 72% identity in sequence(4,5) were jointly used for reconstructive PCR, performed on a mixture of equal amounts of fragments of pGSTU2 (pBluescript containing cDNA encoding Z/77.GSTU2) and pGSTUl (pBluescript containing cDNA encoding ZmGSTUl).
  • PCR with Ml 3 forward and reverse primers amplified a single product of about 1.3 kb from each reassembled template but not from non- assembled template controls.
  • PCR products were purified and re-cloned into pBluescript SIC to allow expression and selection of the mutant sequences.
  • the sequence of the EFD1 mutant showed that it was a chimeric GST (mainly Z/WGSTU2 with the N-terminus of ZmGSTUl) with three point mutations, of which two were silent.
  • the third point mutation resulted in the substitution of glutamine with leucine at residue 115, conesponding to residue 113 of ZmGSTU2.
  • the EFD mutants were sub-cloned into pET expression vector to give the respective pET-EFD construct, (pET-EFD 1 to 6). Each pET construct was then expressed and in each case the resulting recombinant protein was purified by S- hexylglutathione affinity chromatography. Following affinity purification, recominant proteins (28kDa polypeptide) were dialysed to minimise contamination with S-hexylglutathione. The enzyme preparations appeared pure on analysis by SDS-PAGE. The enzyme kinetics of each pure EFD was examined with the exception of EFD7, which was not analysed further due to the inherent instability of its enzyme activity.
  • EFD1 was the exception, showing a much higher K M for CDNB and glutathione than the other mutants, even though it possessed the substrate-binding domain derived from ZmGSTU2 which has low Km for CDNB (Fig IC).
  • EFD1 had a similar apparent N max (CDNB) as ZmGSTUl, with the overall effect of the mutation being to reduce its preference for CDNB. All enzymes except ZmGSTUl and EFD1 showed negative co- operativity with respect to glutathione, suggesting the conformation EFD1 was significantly different from that of the other largely Z GSTU2-derived mutants (Fig IC).
  • EFD1 Directed mutagenesis of EFD1.
  • a key factor in the evolution of the selective enhancement of GST activity toward fluorodifen in EFD1 was due to a single amino acid substitution.
  • a side effect of this mutation was that EFD1 was predominantly expressed in the insoluble fraction in E. coli.
  • crystal structures of both Phi maize GSTs and Tau wheat GSTs have been reported, on the basis of limited sequence similarity it was not possible to predict the likely effect on protein structure of this substitution. Instead, rational site-directed mutagenesis was employed to substitute the mutated residue and determine the effect on enzyme activity.
  • the original mutation replaced a basic glutamine residue with a small, uncharged leucine residue.
  • the residue was therefore mutated to asparagine (basic, but smaller), glutamic acid (acidic, same size), phenylalanine (large, uncharged) or alanine (small, uncharged), giving the mutants EFD1-115N, EFD1-115E, EFD1-115F and EFD1-115A respectively.
  • This residue was also mutagenised back to glutamine to yield EFD1-115Q, effectively producing the unmutated chimera of the ZmGSTUl and ZmGSTU2 sequences .
  • Each of these mutants was expressed in E. coli as a LacZ fusion protein together with the unmutated chimera EFD1-115Q.
  • the resulting cmde protein extracts were analysed for GST activity and by SDS-PAGE.
  • EFD1-115E or EFD-115N had negligible GST activity, with the mis- folded recombinant polypeptides precipitated as insoluble protein in the inclusion bodies. Extracts from bacteria expressing EFD1-115F, EFD1-115A and EFD1- 115Q all showed high GST activity towards CDNB, and contained appreciable quantities of soluble recombinant polypeptides. These mutants were purified by affinity chromatography and subjected to kinetic analysis (Table 1). EFD1-115Q had characteristics similar to ZmGSTU2 toward both fluorodifen and CDNB, confirming that the point mutation in EFDl was solely responsible for the enhanced fluorodifen activity.
  • the EFDl family of mutants were assayed for conjugating activity toward the chlororacetanilide herbicides alachlor, acetochlor and metolachlor, which are used in cereals and the diphenyl ether herbicides acifluorfen and fomesafen which are used in soybean (Table 2). All EFDl mutants had similar activities to the parent ZmGSTUs toward the chloroacetanilide herbicides.
  • the chimera EFD1-115Q had identical activities to Z/7zGSTU2. All the other EFDl mutants showed significantly higher activities toward acifluorfen than the parent enzymes with EFDl and the EFD1-115L showing elevated activities toward fomesafen. Therefore, the combination of random and directed mutagenesis had derived a set of detoxifying GSTUs which had enhanced activities to all three diphenyl ethers, while having little effect on activities toward other herbicides.
  • Transgenic Arabidopsis plants were engineered to express each of the parent Z/nGSTUs and the mutants EFDl, EFD3 and EFD1-115A under the control of the CaMN 35S promoter. None of the resulting TI or T2 transgenics showed any abnormal phenotype under nonnal growth conditions. T2 plants were analysed for the expression of the introduced GSTUs by western blotting using an antiserum raised to the Z/72GSTUI-2 heterodimer to confirm expression of the recombinant polypeptides (Fig. 2A).
  • the T2 progeny were then assayed for GST activity (Fig. 2B). Relative to untransforaied Arabidopsis, GST activity toward CDNB was enhanced only in lines expressing Z777GSTU2, EFD3 or EFD1-115A, while activity towards fluorodifen was enhanced 19-fold in EFD1-115A transgenics and 7-fold in EFD3 expressors.

Abstract

L'invention concerne un procédé permettant de créer génétiquement une séquence d'acide nucléique dérivée d'une plante et codant une protéine ayant une activité débilitante contre une toxine. Ce procédé consiste à combiner aléatoirement un réarrangement de gènes et une mutagenèse d'une ou de plusieurs séquences d'acide nucléique dérivées de plantes.
PCT/GB2003/003773 2002-08-29 2003-08-29 Procede de creation genetique de sequences d'acide nucleique derivees de plantes faisant appel a un rearrangement de genes et a une mutagenese selective WO2004020628A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003269099A AU2003269099A1 (en) 2002-08-29 2003-08-29 Method for genetically engineering plant-derived nucleic acid sequences comprising gene shuffling and selective mutagenesis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0220038A GB0220038D0 (en) 2002-08-29 2002-08-29 Novel Protein Design
GB0220038.4 2002-08-29

Publications (1)

Publication Number Publication Date
WO2004020628A1 true WO2004020628A1 (fr) 2004-03-11

Family

ID=9943131

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/003773 WO2004020628A1 (fr) 2002-08-29 2003-08-29 Procede de creation genetique de sequences d'acide nucleique derivees de plantes faisant appel a un rearrangement de genes et a une mutagenese selective

Country Status (3)

Country Link
AU (1) AU2003269099A1 (fr)
GB (1) GB0220038D0 (fr)
WO (1) WO2004020628A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100388878C (zh) * 2005-05-16 2008-05-21 中国农业大学 一种促进植物生长和/或提高植物抗性的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001021770A2 (fr) * 1999-09-21 2001-03-29 Syngenta Limited Sequences gst de soja et utilisation dans la production de plantes resistant aux herbicides
WO2001053501A2 (fr) * 2000-01-18 2001-07-26 Peter James Facchini Acides nucleiques de glutathione-s-transferase, polypeptides et procedes correspondants

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001021770A2 (fr) * 1999-09-21 2001-03-29 Syngenta Limited Sequences gst de soja et utilisation dans la production de plantes resistant aux herbicides
WO2001053501A2 (fr) * 2000-01-18 2001-07-26 Peter James Facchini Acides nucleiques de glutathione-s-transferase, polypeptides et procedes correspondants

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DIXON DAVID P ET AL: "Forced evolution of a herbicide detoxifying glutathione transferase.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 26, 27 June 2003 (2003-06-27), pages 23930 - 23935, XP002266756, ISSN: 0021-9258 *
HANSSON L O ET AL: "Evolution of differential substrate specificities in Mu class glutathione transferases probed by DNA shuffling", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 287, no. 2, 26 March 1999 (1999-03-26), pages 265 - 276, XP004462611, ISSN: 0022-2836 *
OH KI-HOON ET AL: "Improvement of oxidative and thermostability of N-carbamyl-D-amino acid amidohydrolase by directed evolution.", PROTEIN ENGINEERING, vol. 15, no. 8, August 2002 (2002-08-01), pages 689 - 695, XP002266755, ISSN: 0269-2139 *
STEMMER W: "DNA shuffling by random fragmentation and reassembly: In vitro recombinationfor molecular evolution", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 91, 1 October 1994 (1994-10-01), pages 10747 - 10751, XP002087463, ISSN: 0027-8424 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100388878C (zh) * 2005-05-16 2008-05-21 中国农业大学 一种促进植物生长和/或提高植物抗性的方法

Also Published As

Publication number Publication date
AU2003269099A1 (en) 2004-03-19
GB0220038D0 (en) 2002-10-09

Similar Documents

Publication Publication Date Title
Karavangeli et al. Development of transgenic tobacco plants overexpressing maize glutathione S-transferase I for chloroacetanilide herbicides phytoremediation
Green The ribonucleases of higher plants
TWI669395B (zh) 一種用於基因標定的通用供體系統
US8017386B2 (en) Divinyl ether synthase gene and protein, and uses thereof
CN106573963B (zh) 疫霉属抗性的属于茄科的植物
IL233858A (en) Glyphosate-resistant plants and related methods
WO2004062351A2 (fr) Gene codant pour la resistance a des herbicides inhibant l'acetolactate synthase
CN108330116B (zh) 除草剂耐受性蛋白质、其编码基因及用途
JP7295163B2 (ja) 除草剤耐性遺伝子及びその使用方法
AU2002238453B2 (en) Method of encoding information in nucleic acids of a genetically engineered organism
CN104145020B (zh) 工程化的杀有害生物蛋白质
JP2003048897A (ja) 抗菌たんぱく質の製造方法
US20150082484A1 (en) Protection against herbivores
US20230115696A1 (en) Bacterial genes and isolates for conferring insect resistance
Hwang et al. The Arabidopsis short-chain dehydrogenase/reductase 3, an ABSCISIC ACID DEFICIENT 2 homolog, is involved in plant defense responses but not in ABA biosynthesis
US5629469A (en) Thiol protease inhibitor
JP2017522001A (ja) サイトカイニンシンターゼ酵素、構築物、および関連する方法
US20150143578A1 (en) Plant regulatory genes promoting association with nitrogen fixing bacteria
WO2004020628A1 (fr) Procede de creation genetique de sequences d'acide nucleique derivees de plantes faisant appel a un rearrangement de genes et a une mutagenese selective
WO2014030090A1 (fr) Monooxygénase à cytochrome p450 métabolisant des herbicides
KR20040052482A (ko) 유전자 이식 디캄바-분해 유기체를 제조하고 사용하기위한 방법 및 물질
EP4311430A1 (fr) Gène de tolérance au chlorotoluron et leurs procédés d'utilisation
CA3042939A1 (fr) Procedes d'amelioration de la frequence de transformation
US20110289632A1 (en) Methylketone synthase, production of methylketones in plants and bacteria
Hemming Production and uses of genetically transformed plants.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP