WO2004017910A2 - Total synthesis of heparin - Google Patents

Abstract

The present invention provides for a total synthesis of heparin, including synthesis of the heparin precursor backbone oligosaccharide, deacetylation and N-sulfation of the heparin backbone, epimerization of the backbone, and O-sulfation of saccharide residues of the backbone.

Description

TITLE Total Synthesis of Heparin

FIELD OF THE INVENTION The present invention relates to the synthesis of heparin, including synthesis of the heparin precursor backbone oligosaccharide, deacetylation and N- sulfation of the heparin backbone, epimerization of the backbone, and O-sulfation of saccharide residues of the backbone.

BACKGROUND OF THE INVENTION

Heparin, a natural anticoagulant, exerts its anticoagulant effect through inhibition of thrombin. Specifically, heparin interacts with antithrombin III, a serine protease inhibitor, enhancing the activity of the antithrombin. In the absence of heparin, antithrombin III interacts very slowly with several coagulation cascade proteases including thrombin, plasmin, and Factor Xa. In the presence of heparin, antithrombin III interacts with coagulation cascade proteases several hundred times more quickly, resulting in rapid formation of inactive inhibitor-protease complexes. Heparin is a high molecular weight polysacchari.de belonging to the family of glycosaminoglycans, a family of heteropolysaccharides having repeating disaccharide units. Heparin has a molecular weight that can range from less than 6 kDa to 40 kDa. The basic structure of heparin consists of repeating disaccharide units of glucosarnine and either D-glucuronic acid or L-iduronic acid, connected through 1-^4 linkages.

Glucosarnine residues in heparin are highly N- and O-sulfated, while uronic acid residues are O-sulfated to a lesser extent. The sulfation pattern and the extent of sulfation are both significant factors contributing to the biological activity of heparin. addition to the sulfation content of heparin, the size of the heparin molecule also plays a critical role in the biological activity of heparin. For example, high- or mixed-molecular weight heparin (approximately 9-12 kDa) can affect several components of the coagulation cascade, including antithrombin 111, heparin cofactor II, and von Willebrand Factor. However, mixed-molecular weight heparin therapy also has longer-reaching effects in mammals, including negative side effects such as heparin-induced thrombocytopenia (HIT). HIT patients suffer from an immune reaction to the unfractionated heparin, and as a result, experience life-threatening thrombocytopenic complications. Recently, it has been found that treatment of patients specifically with low-molecular weight heparins (less than 6 kDa) affords the patient the benefit of the anticoagulant properties of traditional heparin without the negative side effects, such as HIT. The increased specificity of lower-molecular weight heparin action arises in part from the fact that the fractionated, low-molecular weight heparin does not bind as well to heparin cofactor II. As a result, the interaction of (low molecular weight) heparin with antithrombin III and the related subsequent physiological events can be more accurately and precisely controlled. The absence of extraneous polysaccharide chains in heparin preparations may also eliminate non-essential antigenic portions of unfractionated heparin. Heparin therapy is an essential tool in the treatment of blood diseases and disorders, and low-molecular weight heparins show great promise as a the newest member of the heparin family. Low-molecular weight heparins are attractive on several levels, and the goal of a more targeted therapy with fewer side effects will create a more specific drug indication for low-molecular weight heparins. However, current methods of producing low-molecular weight heparin are not sufficient to meet the demands for both quality and quantity of this class of therapeutics. Such methods include chemical degradation, enzymatic digestion, and size fractionation of high- molecular weight heparin. At best, varying degrees of clinical success have been observed using these techniques. Heparin biosynthesis in vivo begins with the formation of non-sulfated saccharide polymers of N-acetyl-D-glucosamine (GlcNAc) and D-glucuronic acid (GlcA). The product, N-acetyl heparosan, is then modified by deacetylation and subsequent N-sulfation of some of the GlcNAc residues. N-deacetylation and N- sulfation of the heparin precursor is essential for subsequent modification reactions. Accordingly, the N-deacetylated/N-sulfated heparin precursor becomes the substrate for the next modification, which is the epimerization of some of the GlcA acid units to IdoA units. After the epimerization step, the heparin precursor is then a substrate for subsequent O-sulfation reactions. The heparin precursor is primarily sulfated at the C-6 position of some glucosarnine (GlcN) units and at the C-2 position of some of the IdoA and GlcA acid units. However, a small number of glucosarnine and glucuronic acid residues are also sulfated at the C-3 position. The antithrombin III binding site of heparin, consisting of the pentasaccharide sequence GlcNAc-GlcA- GlcNAc-IdoA-GlcNAc, is only completed upon C-3 -sulfation of the middle GlcNAc residue in the sequence (Figure 1).

While heparin is unique to a limited number of mammals, N- acetylheparosan and other heparin precursors can be found in many lower organisms.

Many strains of E. coli, for example, are known to produce various capsular polysaccharides which are responsible for the particular antigenicity of the strain. The E. coli K5 capsule polysaccharide is identical to N-acetylheparosan, a precursor in heparin biosynthesis, as described above. Such a precursor would have potential as a heparin precursor for in vitro synthesis of heparin were it not for the significant degree of heterogeneity in the repeating disaccharide polymer length of the isolated K5 capsule polysaccharides.

The E. coli kfiA, kfiB, kfiC, and kfiD genes are responsible for the biosynthesis of the E. coli K5 capsule polysaccharide. It is known that the four kfi genes are found in a cluster along the DNA of the E. coli K5 strain, and that more than one of the kfi gene requires another kfi gene, on the protein level at a minimum, in order to properly function. Recently, enzymatic activities of some of the kfi genes have been identified. KfiA is an alpha-UDP-GlcNAc glycosyltransferase, KfiC is a beta-UDP-GlcA glycosyltransferase, and KfiD is a UDP-Glc dehydrogenase. KfiB is believed to be essential for proper K5 polysaccharide biosynthesis, but has not yet been ascribed a more detailed activity.

K5 polysaccharide biosynthesis occurs in an ordered fashion at the inner leaf of the cytoplasmic membrane of E. coli, and the Kfi enzymes are believed to conduct this synthesis as a single, multifunctional complex. More than one of the enzymes is likely associated with the cytoplasmic membrane during this synthesis, and it appears that there is a cooperative relationship between subunit association and interaction of the multienzyme complex with the membrane. Hodson et al. have demonstrated, through Western blotting of isolated membrane fractions, that association of KfiA with the membrane requires only KfiC, but association of KfiB with the membrane fraction required both KfiA and KfiC. Uncertainty as to the involvement of Kfi subunit complex formation for the synthesis of K5 polysaccharide typically hinders the use of this system for in vitro biosynthetic reactions. In the heparin biosynthetic pathway, N-acetylheparosan (K5 polysaccharide) is further processed in order to produce "active" heparin. The ability of heparin to catalyze antithrombin III binding with thrombin, for example, is based on the nature and the extent of sulfation of the heparin saccharide chain. In the pentasaccharide sequence of heparin that is involved in antithrombin III binding, a 3- O-sulfate moiety on the central D-glucosamine is a primary determinant of the anticoagulant activity of heparin. Removal of sulfate groups from any of the residues in the pentasaccharide sequence diminishes the anticoagulant activity of heparin. Moreover, the heterogeneity of N-sulfation in the production of heparin has similar moderating effects on its biological activity. Sulfation of polysaccharides (and other carbohydrates) is catalyzed by a group of enzymes known as sulfotransferases. Specifically, type II membrane bound sulfotransferases are Golgi enzymes which utilize the biological high energy sulfate donor PAPS (adenosine 3 '-phosphate phosphosulfate) to transfer a sulfate group to a specific position on variety of carbohydrate residues (Fukuda et al., 2001, J. Biol. Chem., 276:47747-47750; Esko and Lindahl, 2001, J. Clin. Invest.

108(2):169-73; Forsberg and Kjellen, 2001, J. Clin. Invest. 108(2): 175-80).

Heparan Sulfate/Heparin N-deacetylase/N-sulfotransferase (NDST) is one example of a sulfotransferase enzyme. The synthesis of heparan sulfate, like that of heparin, begins with a disaccharide building block consisting of GlcNAc and GlcA. After the formation of a repeating GlcNAc-GlcA backbone, acetyl groups are removed from the GlcNAc residues, and the newly formed free amines on the GlcN residues are sulfated in the presence of 3'-phosphoadenosine 5 '-phosphosulfate (PAPS). N-sulfation, the end result of the NDST reaction, plays a critical role in determining the ultimate extent of sulfation in HS chains (Bame and Esko, 1989, J. Biol. Chem. 264(14):8059-65).

After NDST action on the heparin backbone, the heparin backbone may be modified in several ways, including epimerization of the GlcA residues to IdoA and sulfation of glucosarnine, glucuronic acid, and iduronic acid residues. Glucuronyl C5-epimerase catalyzes the conversion of D-glucuronic acid to IdoA units at the polymer level during the biosynthesis of HS or heparin. The reaction catalyzed by the C5-epimerase is a reversible reaction including the reversible abstraction and readdition of a proton at C-5 of target hexuronic acid residues, through a carbanion intermediate, with or without an inversion of configuration at C-5 (Prihar et al., 1980, Biochemistry 19:495-500).

Very little information is available about the function of IdoA in the biological activity of heparin and heparan sulfate. However, due to the conformational flexibility of IdoA residues, they are generally believed to promote the binding of heparin and heparan sulfate chains to proteins such as growth factors, cytokines, extracellular-matrix proteins, enzymes and enzyme inhibitors. (Casu et al., 1988, Trends Biochem. Sci. 18:221-225). The single IdoA unit in the heparin pentasaccharide sequence has been identified as being critical for antithrombin binding (Valla et al., Biochimie, 2001, 83, 819-830). The reaction catalyzed by the C5-epimerase therefore is crucial for many biological functions of heparin and HS

(Crawford et al., 2001, J. Biol. Chem.276:21538-21543).

The generation of IdoA residues by the C-5 epimerization of GlcA units is the only reaction that is strictly dependent on enzymatic catalysis in the polymer-modification process of the biosynthesis of heparin/HS, while all other polymer modification processes can be mimicked by chemical procedures (Casu et al., 1994, Carbohydr. Res. 263:271-278). The same C5-epimerase enzyme is responsible for the formation of iduronic acid residues in heparin and heparan sulfate, despite different structural contexts (Li et al, 2001, J. Biol. Chem. 276:20069-20077). The extent of uronic acid epimerization in vivo is believed to depend on both the level of C5-epimerase expression and also on the degree of N-sulfated residues. 2-O- sulfation of IdoA units was also proposed to effectively "remove" the newly formed IdoA units from the D-GlcA/L-IdoA equlibrium and thereby promote the formation of IdoA in a heparin precursor (Hagner-McWhirter et al., 2000, Glycobiology 10:159- 171). A study on the substrate specificity of the epimerase by Jacobsson et al. indicated that the epimerase will not react with uronic acids that are O-sulfated (2- O-sulfation) or that are adjacent to O-sulfated glucosarnine (6-O-sulfation) residues (1979, J. Biol. Chem. 254:2975-2982; Jacobsson et al., 1984, J. Biol. Chem. 259:1056-1063). The substrate specificity is consistent with the overall order of modification of the heparin precursor, suggesting that epimerization begins to occur after GlcNAc N-deacetylation and N-sulfation but before glucosarnine residues undergo 6-O-sulfation and 3-O-sulfation (Jacobsson et al., 1979, J. Biol. Chem. 254:2975-2982; Lindahl et al, 1976, Biochem. Biophys. Res. Commun. 70:492-499).

Among the O-sulfotransferases, heparan sulfate 2 O-sulfotransferase (HS2OST) catalyzes the sulfate transfer from 3 '-phosphate 5' phosphosulfate (PAPS) preferably to the C-2 position of L- iduronic acid (IdoA) in heparan sulfate molecule. Chinese hamster ovary (CHO) cells possess HS2OST activity which is always contaminated with heparan sulfate 6-0 sulfotransferase (HS6OST) activity. Although it is difficult to separate these two enzymatic activities, HS6OST activity can be easily inhibited by addition of 10 mM DTT (Kobayashi et al, 1996, J. Biol. Chem. 271:7645-7653). Kobayashi and his coworkers have purified HS2OST from CHO cells and demonstrated that purified HS2OST did not exhibit any HS6OST activity (Kobayashi et al, 1996, J. Biol. Chem. 271:7645-7653).

Insertional mutagenesis in the HS2OST gene caused renal agenesis and neonatal lethality in the mutant mice (homozygous for the mutation) and disaccharide analysis showed complete loss of 2-sulfated IdoA indicating existence of single HS2OST gene (Bullock et al, 1998, Genes Dev., 12:1894-1906). However, when HS2OST gene was deleted, the mutant mouse embryos still formed most of the organ and tissues, but they had multiple developmental abnormalities including complete failure of kidney development (Merry et al., 2001, J. Biol. Chem. 276:35429-35434). HS2OST is likely involved in developmental processes such that 2-O-sulfation is required for binding of heparan sulfate to fibroblast growth factors. Recently it has been demonstrated that HS2OST-deficient CHO cells can be complimented with

HS3OST (Heparan sulfate 3 -O-sulfotransferase) gene to produce anticoagulant heparan sulfate indicating that 2-0 sulfation itself may not be required for heparin/heparan sulfate binding to antithrombin (Zhang et al., 2001, J. Biol. Chem. 276:28806-28813). On the other hand, others have reported that 2-0 sulfation and C- 5 epimerase interact in vivo during heparin/heparan sulfate biosynthesis (Pinhal et al,

2001, PNAS, 23:12984-12989). They have suggested that 2OST is not only stabilizing the C-5 epimerase, but also required for its translocation to Golgi. It seems that 2-0 sulfation may not required for antithrombin binding; however, 2OST helps C-5 epimerase reactions to keep the equilibrium between GluA-IdoA in forward direction by sulfating IdoA, thus preventing it from converting back to GlcA.

Heparan sulfate 6-O-sulfotransferases are type II transmembrane proteins that transfer sulfate to the 6-position of the GlcS or GlcNAc residues from active sulfate (3'-phosphoadenosine 5 '-phosphosulfate, PAPS). HS6OST-1 is a critical enzyme in the anticoagulant heparan sulfate biosynthetic pathway (Zhang et al., J. Biol. Chem. 276:42311-42321). HS6OST-1 was reported to preferentially transfer sulfate to position 6 of GlcNS residues adjacent to reducing side of IdoA. However, it also adds 6-O-sulfates at GlcA-GlcNS, GlcA-GlcNAc, IdoUA2S-GlcNS, and GlcA-GlcNS3S in vitro. The content of 6-O-sulfation in synthetic heparan sulfate

(HS) was shown to correlate to the ability of transposition of a cell strain clone originating from Lewis-lung-carcinoma. (Nakanishi, 1992, Biochem. J., 288:215- 224).

Sulfotransferases often recognize not only the sugar residues to which sulfate is transferred but also the structure of the neighboring sugar residues.

Different isomers are believed to synthesize different HS structures responsible for different functions. HS 3-O-ST-l and HS 3-O-ST-2 transfer sulfate to position 3 of GlcNS residues adjacent to the reducing side of GlcA and IdoA(2SO ) or GlcA(2SO₄), respectively, and 3-O-ST-3A transfers sulfate to position 3 of GlcN residues adjacent to IdoA(2SO₄). Functional studies of 3-O-sulfotransferases demonstrated that only HS modified by the 3-O-ST-l isomer possesses the anticoagulation activity (Shworak et al, 1994, J. Biol. Chem. 269:2494 1-24952). On the other hand, HS modified by the 3-O-ST-3 isoform provides binding sites for a viral capsular gD glycoprotein, and for initiation of Herpes simplex virus type 1 (HSV-1) entry (Shukla et al., 1999, Cell 99: 13-22).

The above background information illustrates the complexity and variability possible in heparin and heparan sulfate products. This variability is particularly prevalent in heparin and heparan sulfate products isolated from natural sources. Noting the variability in therapeutic effect with different forms and/or sources of heparin, the United States Food and Drug Administration often treats a variation of a known heparin as a "new" anticoagulant. However, because of the efficacy of heparin therapy, it is desirable to increase the consistency in heparin preparations. The importance of proper sulfation of heparin and heparan sulfate is well-documented, and the adverse clinical manifestations arising due to the prevalence of heterogeneous sulfation of heparin and heparan sulfate are well known in the art. Furthermore, the importance of particular sizes of heparin is becoming more apparent to those working with research and clinical aspects of heparin. A methodical synthesis of heparins of specific desired sizes could provide signifcantly greater homogeneous product. Such specificity may be achieved through enzymatic synthesis of heparins or heparan sulfate polysaccharides. Accordingly, there is a long-felt need for a way to produce heparin and heparan sulfate of defined size and with well-defined modifications in order to minimize or eliminate adverse side effects linked with heparin and heparan sulfate therapy.

BRIEF SUMMARY OF THE INVENTION The present invention includes the use of nucleic acids, bacterial strains, and methods for the enzymatic synthesis of heparin through synthesis of heparin precursor intermediates. A key feature of the invention therefore is to express glycosyltransferases that act in concert to synthesize heparin precursors using UDP sugar building blocks, N-deacetylace/N-sulfotransferase and epimerase enzymes that prepare a heparin precursor for sulfation, and O-sulfotransferases that sulfate a heparin precursor to the proper extent and with the proper pattern to produce functional heparin.

The invention provides compositions and methods that facilitate a coordinated in vitro synthesis of heparin having a molecular weight and consistency such that it is therapeutically beneficial to a patient in need of heparin therapy. As noted elsewhere herein, heparin synthesis occurs via the concerted action of several enzymes. The present invention includes the use of these enzymes, DNA encoding them, and cells expressing them, to generate a more homogeneous low molecular weight heparin for use as a therapeutic.

The invention also provides compositions and methods that facilitate a coordinated in vitro synthesis of heparin having variations in the length of the saccharide backbone, in the identity of the saccharide units comprising the disaccharide building block of the heparin polysaccharide, and in the pattern and density of sulfation of the heparin backbone. Variations in any of the aforementioned characteristics of a heparin molecule, as known to one of skill in the art, results in different patterns of biological activity of the heparin molecule. Significant variations in any of the aforementioned characteristics may result in a molecule that cannot accurately be classified as heparin. Such molecules are referred to as "heparin-like" molecules, based on their many structural similarities with heparin. The present invention includes the use of heparin synthetic enzymes, DNA encoding them, and cells expressing them, to generate a heparin-like molecule for use as a therapeutic.

In one embodiment of the invention, an expression vector including the isolated nucleic acids encoding E. coli KfiA, KfiB and KfiC proteins is provided. Another embodiement of the invention provides the expression vector including the isolated nucleic acids encoding E. coli KfiA, KfiB and KfiC proteins, along with at least one arabinose-regulatable promoter.

In another embodiment of the invention, an expression vector including the isolated nucleic acids encoding E. coli KfiA, KfiB and KfiC proteins, wherein the promoter is the arabinose P_BA_D promoter, is provided. In yet another embodiment of the invention, an expression vector includes the isolated nucleic acids encoding E. coli KfiA, KfiB and KfiC proteins under control of the arabinose P_BA_D promoter, along with at least one antibiotic resistance marker and at least one affinity tag designed to facilitate purification of one or more expressed proteins, is provided. One aspect of the present invention provides an expression vector including the isolated nucleic acids encoding E. coli KfiA, KfiB and KfiC proteins under control of the arabinose P_BAD promoter, wherein the expression vector includes at least one antibiotic resistance marker and at least one affinity tag designed to facilitate purification of one or more expressed proteins. Expression of the isolated nucleic acid encoding KfiC protein from such a vector is regulated by one copy of the

P_BA_D promoter and expression of the isolated nucleic acids encoding KfiA protein and KfiB protein is regulated by a second, separate copy of the P_BAD promoter.

In an embodiment of the present invention, a bacterial cell containing any of the above-described expression vectors is provided. In another embodiment of the invention, a bacterial cell containing any of the above-described expression vectors is an Escherichia coli cell. In yet another embodiment of the present invention, an Escherichia coli cell containing any of the above-described expression vectors has knocked-out of its genome a nucleic acid encoding beta-glucuronidase. Such an Escherichia coli cell may be isolated in a further embodiment of the invention.

One embodiment of the present invention provides a method of producing KfiA UDP-GlcNAc transferase, the method including the steps of transforming an expression vector as described above into an appropriate host cell and expressing KfiA therefrom. Another embodiment of the invention provides a method of producing KfiA UDP-GlcNAc transferase, the method including the steps of transforming an expression vector as described above into an Escherichia coli host cell and expressing KfiA therefrom. An Escherichia coli host cell used for expressing KfiA as described above may have knocked out of its genome a nucleic acid encoding beta-glucuronidase.

In a separate embodiment of the present invention, any of the above- described embodiments of the invention including expression of KfiA protein may employ subsequent isolation of the expressed protein. One embodiment of the present invention provides a method of producing KfiC UDP-GlcA transferase, the method including the steps of transforming an expression vector as described above into an appropriate host cell and expressing KfiC therefrom. Another embodiment of the invention provides a method of producing KfiA UDP-GlcA transferase, the method including the steps of transforming an expression vector as described above into an Escherichia coli host cell and expressing KfiC therefrom. An Escherichia coli host cell used for expressing KfiC as described above may have knocked out of the genome a nucleic acid encoding beta-glucuronidase.

In a separate embodiment of the present invention, any of the above- described embodiments of the invention including expression of KfiC protein may employ subsequent isolation of the expressed protein.

In an aspect of the present invention, a method of synthesizing a heparin precursor oligosaccharide in vitro is provided, the method including preparing a synthesis starting material comprising methylumbelliferyl-glucuronic acid, wherein an N-acetylglucosamine moiety is combined with the methylumbelliferyl-glucuronic acid in a saccharide linkage. In a further aspect of the invention, a method of synthesizing a heparin precursor oligosaccharide in vitro includes the synthesis of a heparin precursor oligosaccharide to a defined size by contacting methylumbelliferyl- glucuronic acid starting material with a solution comprising KfiA and UDP-GlcNAc, then contacting the entire resulting mixture with a solution containing UDP-GlcA and KfiC.

Another aspect of the present invention provides a method of synthesizing a heparin precursor oligosaccharide in vitro, the method including preparing a synthesis starting material containing methylumbelliferyl-glucuronic acid, wherein an N-acetylglucosamine moiety is combined with the methylumbelliferyl- glucuronic acid in a saccharide linkage and wherein a heparin precursor oligosaccharide is synthesized to a defined size by sequentially and repeatedly contacting MU-GlcA first with a solution containing Kfi A and UDP-Glc Ac, followed by contacting the entire resulting mixture with a solution containing UDP- GlcA and KfiC.

Yet another aspect of the present invention provides a method of synthesizing a heparin precursor oligosaccharide in vitro, the method including preparing a synthesis starting material containing methylumbelliferyl-glucuronic acid, wherein an N-acetylglucosamine moiety is combined with the methylumbelliferyl- glucuronic acid in a saccharide linkage, and wherein a heparin precursor oligosaccharide is synthesized to a random size by contacting a reaction mixture containing UDP-GlcA and trisaccharide of structure GlcAβl-^4GlcNAcαl^4GlcA- MU with a solution containing UDP-GlcNAc, KfiA, and KfiC. .

One embodiment of the present invention provides a method of purifying a synthesized heparin precursor oligosaccharide as described above from an in vitro synthesis reaction mixture for use in a further synthesis reaction, the method including ethanol precipitation of the oligosaccharide, whereby the oligosaccharide is isolated from the synthesis reaction mixture. In a further aspect of the invention, a method of purifying a synthesized heparin precursor oligosaccharide as described above from an in vitro synthesis reaction mixture includes the step of removing a synthetic enzyme from the synthesis reaction mixture by boiling the reaction mixture prior to isolation of the synthesized heparin precursor oligosaccharide using ethanol precipitation.

In an embodiment of the present invention, a method of converting GlcA in a heparin precursor oligosaccharide to IdoA in vitro is provided, the method including the step of contacting the heparin precursor oligosaccharide with glucuronic acid C-5 epimerase, such that the epimerase catalyzes the conversion of GlcA to IdoA. In another embodiment of the invention, a method of converting GlcA in a heparin precursor oligosaccharide to IdoA includes the step of contacting the heparin precursor oligosaccharide with a solution comprising a heparan sulfate 2-O- sulfotransferase, such that the heparan sulfate 2-O-sulfotransferase transfers a sulfate group to the C-2 position of an IdoA residue in the heparin backone precursor. In yet another embodiment of the present invention, a method of converting GlcA in a heparin precursor oligosaccharide to IdoA includes contacting the heparin precursor oligosaccharide with a solution comprising a heparan sulfate 6-O-sulfotransferase, such that the heparan sulfate 6-O-sulfotransferase transfers a sulfate group to the C-6 position of an IdoA residue in the heparin backone precursor. In still another embodiment of the invention, a method of converting GlcA in a heparin precursor oligosaccharide to IdoA includes contacting the heparin precursor oligosaccharide with a solution comprising a heparan sulfate 3-O-sulfotransferase, such that the heparan sulfate 3-O-sulfotransferase transfers a sulfate to the C-3 position of at least one of the oligosaccharide subunits selected from the group consisting of IdoA and GlcA.

In an embodiment of the present invention, a method of sulfating the C-2 position of an IdoA residue in a heparin precursor oligosaccaride in vitro is provided, the method including contacting the oligosaccharide with a solution containing a heparan sulfate 2-O-sulfotransferase, such that the heparan sulfate 2-O- sulfotransferase transfers a sulfate group to the C-2 position of an IdoA residue in the heparin backone precursor.

In one embodiment of the invention, a method of sulfating the C-6 position of an glucosarnine residue in a heparin precursor oligosaccaride in vitro is provided, the method including contacting the oligosaccharide with a solution containing a heparan sulfate 6-O-sulfotransferase, such that the heparan sulfate 6-O- sulfotransferase transfers a sulfate group to the C-6 position of an glucosarnine residue in the heparin backone precursor. One embodiment of the present invention provides a method of sulfating the C-3 position of an IdoA residue in a heparin precursor oligosaccaride in vitro, the method including contacting the oligosaccharide with a solution containing a heparan sulfate 3-O-sulfotransferase, such that the such that the heparan sulfate 3-O- sulfotransferase transfers a sulfate group to the C-3 position of an IdoA residue in the heparin backone precursor.

Another embodiment of the present invention provides a method of sulfating the C-3 position of an GlcA residue in a heparin precursor oligosaccaride in vitro, the method including contacting the oligosaccharide with a solution containing a heparan sulfate 3-O-sulfotransferase, such that the such that the heparan sulfate 3-O- sulfotransferase transfers a sulfate group to the C-3 position of a GlcA residue in the heparin backone precursor.

In one aspect of the present invention, a method of synthesizing heparin in vitro includes the steps of synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC, deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N- deacetylase/N-sulfotransferase, epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase and O- sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfotransferase, 3-O- sulfotransferase, and 6-O-sulfotransferase.

Another aspect of the present invention provides a method of synthesizing heparin-like glycosaminoglycan in vitro, the method steps including synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA,

KfiB, and KfiC, deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase/N-sulfotransferase, epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase, and O-sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfotransferase, 3-O-sulfotransferase, and 6-O-sulfotransferase.

Yet another aspect of the present invention provides a method of synthesizing heparin-like glycosaminoglycan in vitro, the method steps including synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC, deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase N-sulfotransferase, and O-sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfotransferase, 3-O- sulfotransferase, and 6-O-sulfotransferase.

Still another aspect of the present invention provides a method of synthesizing heparin-like glycosaminoglycan in vitro, including the steps of synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC, deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase N-sulfotransferase, and epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase.

BRIEF DESCRIPTION OF THE DRAWINGS For purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figure 1 is a schematic illustrating the individual steps of heparin synthesis and the enzyme(s) responsible for catalyzing the progression of heparin synthesis from one step to the next.

Figure 2 is a diagram illustrating the similarities and differences among heparin precursor molecules at each stage of total heparin synthesis of the present invention.

Figure 3 is an image of a vector construct of the invention. A first BAD promoter specifically regulating KfiC expression and a second, separate BAD promoter specifically regulating KfiA and KfiB expression, as well as a poly- histidine-encoding sequence on the N-terminal end of the isolated nucleic acid encoding KfiA are included in the vector construct.

Figure 4 is a diagram of the synthesis of a heparin precursor backbone structure according to an embodiment of the present invention. Ethanol precipitation as described elsewhere herein is used to isolate synthesized oligomeric backbone molecules of a limited range of saccharide units. Subsequent elongation of the isolated backbone molecules is carried out to create heparin backbone molecules of various longer oligomeric sizes. Figure 5 is an illustration of the sequences referred to as SEQ ID NOs in the present invention, including glucuronic acid C5 -epimerase, heparan sulfate 3'- O-sulfotransferase, heparan sulfate 6 '-O-sulfotransferase, and primers used for cloning genes of the invention.

DETAILED DESCRIPTION OF THE INVENTION The importance of heparin and heparin precursors having a specific size and with the specific modifications is well known in the art, as are the limitations of prior art in vitro methods for the production of modified and appropriate-sized heparin and heparin precursors, particularly when the starting products are extensively heterogeneous. For example, heparan sulfate resembles heparin, but has a much lower sulfate density. As a result, heparan sulfate does not possess the biological properties of heparin, despite having the same backbone structure.

The present invention mcludes the use of nucleic acids, bacterial strains, and methods for the enzymatic synthesis of heparin through synthesis of heparin precursor intermediates. A key feature of the invention therefore is to express glycosyltransferases that act in concert to synthesize heparin precursors using UDP sugar building blocks, N-deacetylace/N-sulfotransferase and epimerase enzymes that prepare a heparin precursor for sulfation, and O-sulfotransferases that sulfate a heparin precursor to the proper extent and with the proper pattern to produce functional heparin.

The invention provides compositions and methods that facilitate a coordinated in vitro synthesis of heparin having a molecular weight and consistency such that it is therapeutically beneficial to a patient in need of heparin therapy. As noted elsewhere herein, heparin synthesis occurs via the concerted action of several enzymes. The present invention includes the use of these enzymes, DNA encoding them, and cells expressing them, to generate a more homogeneous low molecular weight heparin for use as a therapeutic.

The invention also provides compositions and methods that facilitate a coordinated in vitro synthesis of heparin having variations in the length of the saccharide backbone, in the identity of the saccharide units comprising the disaccharide building block of the heparin polysaccharide, and in the pattern and density of sulfation of the heparin backbone. Variations in any of the aforementioned characteristics of a heparin molecule, as known to one of skill in the art, results in different patterns of biological activity of the heparin molecule. Significant variations in any of the aforementioned characteristics may result in a molecule that cannot accurately be classified as heparin. Such molecules are referred to as "heparin-like" molecules, based on their many structural similarities with heparin. The present invention includes the use of heparin synthetic enzymes, DNA encoding them, and cells expressing them, to generate a heparin-like molecule for use as a therapeutic. Table 1 illustrates the functional result of heparin and heparin-like molecules that differ in either one of or a combination of: the length of the saccharide backbone, the identity of the saccharide units comprising the disaccharide building block of the heparin polysaccharide, and the pattern and density of sulfation of the heparin backbone.

Table 1. The correlation of structural diversity of heparin and heparin-like molecules with various biological functions, as is known in the prior art

The activity of each specific heparin-like molecule, including heparin itself, is listed underneath the structural representation. The list of heparin and heparin-like molecule functions as described in Table 1 should not be considered to be all- inclusive. Rather, according to the present invention, it is now possible to synthesize custom-sized and/or custom-modified heparin and heparin-like molecules which will have the function described in Table 1 as well as additional advantages in heparin therapy.

[IdoA(2S)α l-4GlcNS αl-4]₃ - Binding domain for fibroblast growth factor 2 (FGF2)

[IdoA(2S) αl-4GlcNS(6S) αl-4]₃

- Binding domain for fibroblast growth factor 1 (FGF1)

IdoA(2S) αl -4GlcNS αl-4IdoA(2S) αl-4GlcNS(6S) αl-4IdoA(2S) αl-4GlcNS αl-

4IdoA(2S) αl-4GlcNS(6S)

- Binding domain for hepatocyte growth factor (HGF)

GlcNAc αl -4GlcAβl-4GlcNS(3S) αl-4IdoA(2S) αl -4GlcNS(6S) - Binding domain for antithrombin

IdoA(2S) αal-4GlcN(3S)

- Receptor for HSV infection. Methods and compositions of the present invention encompass a total synthesis of functional heparin useful as a therapeutic from monosaccharide building blocks. Figure 1 is a schematic diagram of heparin synthesis in the simplest form.

Definitions

Certain abbreviations are used herein as are common in the art, such as: "Ac" for acetyl; "Glc" for glucose; "GlcA for glucuronic acid; "IdoA" for iduronic acid; "GlcNAc" for N-acetylglucosamin; "UDP" for uridine diphosphate; "ST" for sulfotransferase. The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

"Encoding" refers to the inherent property of specific sequences of nucleotides in a nucleic acid, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g, as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence. In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

A "nucleic acid" means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a nucleic acid may be either a single-stranded or a double- stranded nucleic acid.

The term "nucleic acid" typically refers to large nucleic acids.

The term "oligonucleotide" typically refers to short nucleic acids, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."

Conventional notation is used herein to describe nucleic acid sequences: the left-hand end of a single-stranded nucleic acid sequence is the 5'-end; the left-hand direction of a double-stranded nucleic acid sequence is referred to as the 5'-direction.

The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."

Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.

"Homologous" as used herein, refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue. By way of example, a region having the nucleotide sequence 5'-ATTGCC-3' and a region having the nucleotide sequence 5'-TATGGC-3' share 50% homology. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positionss of each of the portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue.

As used herein, "homology" is used synonymously with "identity." "Polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term "protein" typically refers to large polypeptides.

The term "peptide" typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus. A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear nucleic acids, nucleic acids associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.

"Expression vector" refers to a vector comprising a recombinant nucleic acid comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis- acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incorporate the recombinant nucleic acid. As used herein in the context of vectors and expression vectors, the term "construct" refers to a vector comprising at least one isolated nucleic acid of the invention.

A "promoter" as used herein refers to a nucleic acid sequence that is specifically recognized by a nucleic acid polymerase, and a sequence to which the polymerase can physcially bind. An "arabinose-regulatable promoter" is a promoter as described above, with the further characteristic that the binding of a polymerase to the promoter sequence can be regulated by arabinose. For example, in the presence of arabinose, the binding of a polymerase to a specific promoter sequence in enabled.

A gene "knock out" refers to the inactivation of a gene in an organism. The gene knock out can be achieved by mutagenesis of the gene (genetically, biologically, or chemically) or by removal of the gene. The end result of a gene knock out is the "functional deletion" of the gene from the organism, allowing one to ascertain the role of the gene and/or gene product in the organism.

A first defined nucleic acid sequence is said to be "immediately adjacent to" a second defined nucleic acid sequence when, for example, the last nucleotide of the first nucleic acid sequence is chemically bonded to the first nucleotide of the second nucleic acid sequence through a phosphodiester bond. Conversely, a first defined nucleic acid sequence is also said to be "immediately adjacent to" a second defined nucleic acid sequence when, for example, the first nucleotide of the first nucleic acid sequence is chemically bonded to the last nucleotide of the second nucleic acid sequence through a phosphodiester bond. A first defined polypeptide sequence is said to be "immediately adjacent to" a second defined polypeptide sequence when, for example, the last amino acid of the first polypeptide sequence is chemically bonded to the first amino acid of the second polypeptide sequence through a peptide bond. Conversely, a first defined polypeptide sequence is said to be "immediately adjacent to" a second defined polypeptide sequence when, for example, the first amino acid of the first polypeptide sequence is chemically bonded to the last amino acid of the second polypeptide sequence through a peptide bond.

A "glycosaminoglycan" or "mucopolysaccharide" is a polysaccharide having disaccharide repeating units containing an N-acetylhexosamine and a hexose or hexuronic acid. Either or both of the components of the disaccharide unit may be sulfated. Examples of glycosaminoglycans include heparan sulfate, keratan sulfates, chondroitin sulfates, dermatan sulfates, and hyaluronic acid.

"Heparin precursor" refers to the -4GlcAβl->4GlcNAcαl- repeating saccharide structure of the E. coli K5 polysaccharide, also known as N- acetylheparosan. As used herein, "heparin precursor" may refer to an oligosaccharide of multiple repeating units of-4GlcAβl->4GlcNAcαl-.

"Heparin" refers to a glycosaminoglycan with a molecular weight that can range from less than 6 kDa to 40 kDa. The basic structure of heparin consists of repeating disaccharide units of glucosarnine and either D-glucuronic acid or L-iduronic acid, connected through 1-^4 linkages. Heparin is further defined by the extent and pattern of sulfation on the glucosarnine and uronic acid residues.

A "heparin-like" molecule is one that shares multiple structural characteristics with heparin, such as the glucosamine-uronic acid repeating backbone disaccharide unit and/or the pattern of sulfation on the glucosarnine and uronic acid residues. A heparin-like molecule may differ from heparin in at least one characteristic such as, for example, the percentage of glucosamme and uronic acid residues sulfated.

"Heparan Sulfate" refers to a glycosaminoglycan with the same basic structure as Heparin, but without the sulfate density found in heparin.

An "epimer" is a stereoisomer of a sugar that differs in hydrogen atom and hydroxyl group arrangement at the first assymetric carbon atom. "Epimerization" is the process whereby the hydroxyl group and hydrogen atom arrangement at the first assymetric carbon atom in a sugar is inverted. An "epimerase" is an isomerase that can catalyze the process of epimerization. A "bifunctional enzyme" refers to a single polypeptide that possesses two distinguishable catalytic activities. The two enzymatic activities may be functional simultaneously or they may operate only one at a time. Further, the two enzymatic activities may be independent of one another or may exist in a cooperative or synergistic manner.

"N-deacetylation" is the chemical loss or removal of an acetyl functional group from a nitrogen-containing functional group, particularly by way of the cleavage of a bond between the acetyl group and the nitrogen atom of a separate functional group. "N-deacetylase activity" is N-deacetylation as catalyzed by an enzyme.

"N-sulfation" is the chemical addition or bonding of a sulfur- containing functional group to a nitrogen-containing functional group, particularly by way of chemical bond formation between the sulfur-containing group and the nitrogen atom of a separate functional group. "N-sulfotransferase activity" is N-sulfation as catalyzed by an enzyme.

"O-sulfation" is the chemical addition or bonding of a sulfur- containing functional group to an oxygen-containing functional group, particularly by way of chemical bond formation between the sulfur-containing group and the oxygen atom of a separate functional group. "O-sulfotransferase activity" is O-sulfation as catalyzed by an enzyme.

An enzyme having "both N-deacetylase and N-sulfotransferase activity" is a single enzyme capable of catalyzing both N-deacetylation and N- sulfation reactions as described above. The N-deacetylation and N-sulfation reactions may be conducted at the same time in the same reaction mixture, or may be conducted separately in separate reaction mixtures.

An enzyme having "O-sulfotransferase activity" is an enzyme capable of catalyzing the transfer of a sulfate group from a first molecule to an oxygen moiety of a separate molecule.

The term "saccharide" refers in general to any carbohydrate, a chemical entity with the most basic structure of (CH₂O)_n. Saccharides vary in complexity, and may also include nucleic acid, amino acid, or virtually any other chemical moiety existing in biological systems. "Monosaccharide" refers to a single unit of carbohydrate of a defined identity.

"Oligosaccharide" refers to a molecule consisting of several units of carbohydrates of defined identity. Typically, saccharide sequences between 2-20 units may be referred to as oligosaccharides.

"Polysaccharide" refers to a molecule consisting of many units of carbohydrates of defined identity. However, any saccharide of two or more units may correctly be considered a polysaccharide.

It should be clear from the discussion herein that the term "glycosyltransferase" refers to any enzyme that can add a saccharide to a protein or carbohydrate. Saccharides used by glycosyltransferases can be nucleotide-charged sugars (eg., UDP-galactose), or they can be oligosaccharides.

An oligosaccharide with a "defined size" is one which consists of an identifiable number of monosaccharide units. For example, an oligosaccharide consisting of 10 monosaccharide units is one which may consist of 10 identical monosaccharide units or 5 monosaccharide units of a first identity and 5 monosaccharide units of a second identity. Further, an oligosaccharide of defined size that consists of monosaccharide units of heterogeneous identity may have the monosaccharide units in any order from beginning to end of the oligosaccharide. An oligosaccharide of "random size" is one which may be synthesized using methods that do not provide oligosaccharide products of defined size. For example, a method of oligosaccharide synthesis may provide oligosaccharides that range from two monosaccharide units to twenty-two saccharide units, including any or all lengths in between.

Description

I. Isolated nucleic acids A. Generally

Referring to Figure 1, methods and compositions of the present invention encompass E. coli UDP-N-acetyl-glucosamine transferase, KfiA, E. coli

UDP-glucuronic acid transferase, KfiC, and a putative E. coli glycosyltransferase accessory protein, KfiB, and isolated nucleic acids encoding these proteins. Together in vitro, the KfiA, KfiB, and KfiC proteins synthesize a heparin precursor backbone. Specifically, these three proteins catalyze the sequential addition of GlcNAc to GlcA and GlcA to GlcNAc to form a polymer of repeating GlcNAc-GlcA disaccharide units.

Referring again to Figure 1, methods and compositions of the present invention also encompass a GlcAc5E protein and an isolated DNA encoding the same that catalyzes the epimerization of a GlcA unit to an IdoA unit in a heparin precursor backbone, such as a polymer of repeating GlcNAc-GlcA disaccharide units synthesized by kfiA, kfiB, and kfiC proteins of the present invention. The percentage of GlcA units epimerized to IdoA in a heparin precursor molecule varies depending upon such factors as precursor length and the occurrence of other modifications following the epimerization step.

Referring yet again to Figure 1, methods and compositions of the present invention also encompass sulfotransferases and isolated nucleic acids encoding the same, which are enzymes that catalyze the transfer of sulfate to another molecule. Heparan sulfate 2-O-sulfotransferase (HS2OST), heparan sulfate 3-O- sulfotransferase (HS3OST), and heparan sulfate 6-O-sulfotransferase (HS6OST-1) catalyze the transfer of sulfate from PAPS, an activated sulfate donor, to a 2-O, 3-O, or 6-O, respectively, of a saccharide unit in a heparin precursor oligosaccharide. As described elsewhere herein, sulfation of a heparin precursor molecule is a final, essential step in the production of active heparin, heparan sulfate, and other heparin- like molecules.

Exemplified herein are E. coli genes kfiA, kfiC, and kfiB. However, the invention should not be construed to be limited to nucleic acids encoding KfiA, KfiC, and KfiB derived from E. coli, but should be construed to include nucleic acids and proteins derived from other bacterial and eukaryotic (eg., mammalian) sources.

Also exemplified herein are mouse genes encoding C-5 epimerase and a 6-O-sulfotransferase. Further exemplified herein is a bovine C-5 epimerase protein and a 2-O-sulfotransferase protein isolated from Chinese hamster ovary cells. However, the invention should neither be construed to be limited to nucleic acids encoding a C-5 epimerase and a 6-O-sulfotransferase derived from mouse, nor to a C-

5 epimerase protein isolated from bovine liver, nor a 2-O-sulfotransferase isolated from Chinese hamster ovary cells, but should be constmed to include nucleic acids and proteins derived from other eukaryotic (eg., mammalian) sources. B. kfi isolated nucleic acids

Referring to Figure 1, the first step in the synthesis of heparin or a heparin-like molecule is the assembly of the backbone structure by glycosyltransferases. B(l . kfiA isolated nucleic acids

The methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising E. coli kfiA, but rather, should be construed to encompass any nucleic acid encoding KfiA protein or a fragment thereof, either known or unknown, which is capable of catalyzing UDP-N- acetyl-glucosamine transfer to a growing heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally- occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing UDP-N-acetyl-glucosamine transfer to a growing heparin precursor polysaccharide, for example. These modified nucleic acid sequences include modifications caused by point mutations, modifications due to the degeneracy of the genetic code or naturally occurring allelic variants, and further modifications that have been introduced by genetic engineering, i.e., by the hand of man. Thus, the term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

Nucleic acids having at least 90 percent identity to E. coli kfiA are also encompassed by the methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm. For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877). This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. Mol. Biol.

215:403-410), and can be accessed, for example at the National Center for Biotechnology Information (NCBI) world wide web site having the universal resource locator <<http://www.ncbi.nlm.nih.gov/BLAST/>>. BLAST nucleotide searches can be performed with the NBLAST program (designated "blastn" at the NCBI web site), using the following parameters: gap penalty = 5; gap extension penalty = 2; mismatch penalty = 3; match reward = 1; expectation value 10.0; and word size = 11 to obtain nucleotide sequences homologous to a nucleic acid described herein. BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the

NCBI web site) or the NCBI "blastp" program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402). Alternatively, PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.) and relationships between molecules which share a common pattern. When utilizing BLAST, Gapped BLAST, PSI-Blast, and PHI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See <<http://www.ncbi.nlm.nih.gov>>.

In another aspect, a nucleic acid useful in the methods and compositions of the present invention and encoding a UDP-N-acetyl glucosarnine transferase nucleic acid may have at least one nucleotide inserted into the naturally- occurring nucleic acid sequence. Alternatively, an additional UDP-N-acetyl glucosarnine transferase protein may have at least one nucleotide deleted from the naturally-occurring nucleic acid sequence. Further, a UDP-N-acetyl glucosarnine transferase nucleic acid useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme. Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art. Such modifications include the deletion, insertion, or substitution of bases, and thus, changes in the amino acid sequence. As is known to one of skill in the art, nucleic acid insertions and/or deletions may be designed into the gene for numerous reasons, including, but not limited to modification of nucleic acid stability, modification of nucleic acid expression levels, modification of expressed polypeptide stability or half-life, modification of expressed polypeptide activity, modification of expressed polypeptide properties and characteristics, and changes in glycosylation pattern. All such modifications to the nucleotide sequences encoding such proteins are encompassed by the present invention.

It is not intended that methods and compositions of the present invention be limited by the nature of the nucleic acid employed. The target nucleic acid encompassed by methods and compositions of the invention may be native or synthesized nucleic acid. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single-stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89. Fragments of nucleic acids encoding smaller than full-length protein are also included in the present invention, provided the protein expressed by the nucleic acid retains the biological activity of the full-length protein.

The "biological activity of UDP-N-acetylglucosamine transferase" is the ability to transfer a N-acetylglucosamine moiety from a UDP-N- acetylglucosamine moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non- reducing end of the growing heparin backbone polysaccharide.

Therefore, a nucleic acid encoding a smaller than full-length UDP-N- acetylglucosamine transferase, KfiA, is included in the present invention provided that the "smaller than full-length" UDP-N-acetylglucosamine transferase has UDP-N- acetylglucosamine transferase biological activity.

In another aspect, the invention may include an isolated nucleic acid of the present invention cloned into a DNA vector. In one aspect of the invention, E. coli kfiA DNA is cloned into a P_BAD expression vector to create a construct useful in the present invention. In another aspect of the invention, E. coli kfiA DNA is cloned into an expression vector downstream of the 3' end of a sequence encoding multiple functional tags. The 5 '-end fusion to kfiA comprises a six-histidine sequence to aid in purification of the expressed polypeptide, an Xpress™ epitope to aid in detection of the expressed polypeptide, and an Enterokinase recognition site for cleavage of the purification and detection sequences from the expressed polypeptide.

In yet another aspect of the present invention, kfiA DNA is expressed in a yeast cell, using an appropriate expression vector and yeast cell. However, as evidenced by the literature relevant to the art, one skilled in the art will appreciate that kfiA DNA can also be expressed in other eukaryotic cells, including mammalian, or prokaryotic cells, including bacteria. KfiA protein encoded by nucleic acids useful in the present invention may be expressed using any technique well-known in the art, such as simple expression, high level expression, or overexpression (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory,

New York).

The nucleic acids useful in methods and compositions of the invention may be purified by any suitable means, as are well known in the art. For example, the nucleic acids can be purified by reverse phase or ion exchange HPLC, size exclusion chromatography or gel electrophoresis. Of course, the skilled artisan will recognize that the method of purification will depend in part on the size of the DNA to be purified.

B(2). kfiC isolated nucleic acids

Referring again to Figure 1, there are multiple enzymes responsible for synthesis of the heparin precursor backbone. KfiC, or UDP-glucuronic acid transferase is one such enzyme included in the invention, exemplified by E. coli KfiC. However, the methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising E. coli kfiC, but rather, should be construed to encompass any nucleic acid encoding KfiC protein or a fragment thereof, either known or unknown, which is capable of catalyzing UDP-glucuronic acid transfer to a growing heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally-occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing UDP- glucuronic acid transfer to a growing heparin precursor polysaccharide, for example. These modifications of nucleic acid sequences are described above with respect to kfiA, all of the methods and descriptions of which are applicable to kfiC.

Nucleic acids having at least 90 percent identity to kfiC are also encompassed by the methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described above. In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding a UDP-glucuronic acid transferase protein may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, an additional UDP-glucuronic acid transferase nucleic acid may have at least one nucleotide deleted from the naturally-occurring nucleic acid sequence. Further, a UDP-glucuronic acid transferase nucleic acid useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme.

Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art, as described above.

It is not intended that the present invention be limited by the nature of the kfiC nucleic acid employed. The target nucleic acid encompassed by methods and compositions of the invention may be native or synthesized nucleic acid. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single-stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89.

Fragments of nucleic acids encoding smaller than full-length protein are also included in the present invention, provided the protein expressed by the nucleic acid retains the biological activity of the full-length protein.

The "biological activity of UDP-glucuronic acid transferase" is the ability to transfer a glucuronic acid moiety from a UDP-glucuronic acid moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non-reducing end of the growing heparin backbone polysaccharide.

Therefore, a nucleic acid encoding a smaller than full-length UDP- glucuronic acid transferase (KfiC) is included in the present invention provided that the "smaller than full-length" UDP-glucuronic acid transferase has UDP-glucuronic acid transferase biological activity.

In another aspect, the invention may include an isolated nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above. In one aspect of the invention, E. coli kfiC is cloned into a PBA_D expression vector to create a construct useful in the present invention.

In another aspect of the invention, E. coli kfiC is cloned into an expression vector downstream of the 3' end of a sequence encoding multiple functional tags. The 5 '-end fusion to kfiC comprises a six-histidine sequence to aid in purification of the expressed polypeptide, an Xpress™ epitope to aid in detection of the expressed polypeptide, and an Enterokinase recognition site for cleavage of the purification and detection sequences from the expressed polypeptide.

In yet another aspect of the present invention, kfiC DNA is expressed in a yeast cell, using an appropriate expression vector and yeast cell. However, as evidenced by the literature relevant to the art, one skilled in the art will appreciate that kfiC DNA can also be expressed in other eukaryotic cells, including mammalian, or prokaryotic cells, including bacteria. kfiC protein encoded by nucleic acids useful in the present invention may be expressed using any technique well-known in the art, such as simple expression, high level expression, or overexpression (Sambrook et al.,

1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

B(3). kfiB isolated nucleic acids

Referring again to Figure 1, there is an accessory protein required for optimal activity of the glycosyltransferases of the invention. KfiB is one such protein of the invention, exemplified by E. coli KfiB. However, the methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising E. coli kfiB, but rather, should be construed to encompass any nucleic acid encoding KfiB protein or a fragment thereof, either known or unknown, which is capable of enhancing UDP-N-acetyl-glucosamine transfer and UDP- glucuronic acid transfer to a growing heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally- occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of enhancing UDP-N-acetyl-glucosamine transfer and UDP- glucuronic acid transfer to a growing heparin precursor polysaccharide, for example. Such modified nucleic acid sequences are described elsewhere herein. Nucleic acids having at least 90 percent identity to E. coli kfiB are also encompassed by methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described herein. In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding a protein having the biological activity of supporting UDP-N-acetyl-glucosamine transfer and UDP-glucuronic acid transfer to a growing heparin precursor polysaccharide may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, a nucleic acid useful in methods and compositions of the present invention and encoding a protein having the biological activity of supporting UDP-N-acetyl-glucosamine transfer and UDP-glucuronic acid transfer to a growing heparin precursor polysaccharide may have at least one nucleotide deleted from the naturally-occurring nucleic acid sequence. Further, a nucleic acid useful in methods and compositions of the present invention and encoding a protein having the biological activity of supporting UDP-N- acetyl-glucosamine transfer and UDP-glucuronic acid transfer to a growing heparin precursor polysaccharide may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme. Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art, as described herein.

As described above, it is not intended that the present invention be limited by the nature of the nucleic acid employed.

Fragments of nucleic acids encoding smaller than full-length protein are also included in the present invention, provided the protein expressed by the nucleic acid retains the biological activity of the full-length protein.

The "biological activity of KfiB" is the ability to support Kfi A- and KfiB-mediated transfer of a saccharide moiety from a UDP-saccharide moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non-reducing end of the growing heparin backbone polysaccharide. Therefore, a nucleic acid encoding a smaller than full-length KfiB is included in the present invention provided that the "smaller than full-length" KfiB has the biological activity described above.

In another aspect, the invention may include an isolated kfiB nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above.In one aspect of the invention, E. coli kfiB DNA is cloned into a P_BAD expression vector to create a construct useful in the present invention.

In another aspect of the invention, E. coli kfiB DNA is cloned into an expression vector downstream of the 3' end of a sequence encoding multiple functional tags. The 5 '-end fusion to kfiB comprises a six-histidine sequence to aid in purification of the expressed polypeptide, an Xpress™ epitope to aid in detection of the expressed polypeptide, and an Enterokinase recognition site for cleavage of the purification and detection sequences from the expressed polypeptide. In yet another aspect of the present invention, kfiB DNA is expressed in a yeast cell, using an appropriate expression vector and yeast cell. However, as evidenced by the literature relevant to the art, one skilled in the art will appreciate that kfiB DNA can also be expressed in other eukaryotic cells, including mammalian, or prokaryotic cells, including bacteria. kfiB protein encoded by nucleic acids useful in the present invention may be expressed using any technique well-known in the art, such as simple expression, high level expression, or overexpression (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

C. GlcAc5E isolated nucleic acids Referring to Figure 1, the epimerization of GlcA residues to IdoA residues follows the glycosyltransferase-catalyzed synthesis of a heparin backbone precursor and the N-deacetylation and N-sulfation by NDST. SEQ ID NO: 1 illustrates glucuronic acid C-5 epimerase (GlcAc5E) cDNA, and the corresponding protein is set forth in SEQ ID NO:2. Methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising SEQ ID NO: 1, but rather, should be construed to encompass any nucleic acid encoding SEQ ID NO:2 or a fragment thereof, either known or unknown, which is capable of catalyzing epimerization of GlcA to IdoA in a growing heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally-occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing epimerization of GlcA to IdoA in a growing heparin precursor polysaccharide, for example. Such modified nucleic acid sequences are described elsewhere herein.

Nucleic acids having at least 90 percent identity to SEQ ID NO:l are also encompassed by methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described herein.

In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding a GlcAc5E protein may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, an additional GlcAc5E protein may have at least one nucleotide deleted from the naturally-occurring nucleic acid sequence. Further, a GlcAc5E protein useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme. Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art, as described herein.

It is not intended that the present invention be limited by the nature of the nucleic acid employed. The target nucleic acid encompassed by methods and compositions of the invention may be native or synthesized nucleic acid. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single-stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89. Fragments of GlcAc5E nucleic acids encoding smaller than full-length protein are also included in the present invention, provided the protein expressed by the nucleic acid retains the biological activity of the full-length protein. The "biological activity of glucuronic acid C-5 epimerase" is the ability to epimerize glucuronic acid in a polysaccharide chain to iduronic acid.

Therefore, a nucleic acid encoding a smaller than full-length GlcAc5E is included in the present invention provided that the "smaller than full-length" GlcAc5E has the ability to epimerize glucuronic acid in a polysaccharide chain to iduronic acid.

In another aspect, the invention may include an isolated nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above.In one aspect of the invention, mouse GlcAc5E DNA is cloned into a pCR-Blunt II-TOPO vector (Invitrogen, Carlsbad, CA) to create a construct useful in the present invention. In another aspect of the present invention, DNA encoding the mouse C-5 epimerase gene is cloned into a pAcGP67B expression vector. In yet another aspect of the invention, a truncated form of the C-5 epimerase is subcloned into the pAcGP67B vector, and the resulting construct is used for large- scale production of additional C-5 epimerase nucleic acid of the invention. In yet a further aspect of the invention, the pAcGP67B-C-5 epimerase DNA construct is used for expression of C-5 epimerase protein of the invention.

In yet another aspect of the present invention, GlcAc5E DNA is expressed in SF9 cells, using an appropriate expression vector. However, as evidenced by the literature relevant to the art, one skilled in the art will appreciate that

GlcAc5E can also be expressed in other insect cells, as expression of exogenous proteins in insect cells is well known in the art. GlcAc5E protein encoded by nucleic acids useful in methods and compositions of the present invention may be expressed using any technique well-known in the art, such as simple expression, high level expression, or overexpression (Sambrook et al., 1989, Molecular Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory, New York). D. sulfotransferase isolated nucleic acids

Referring again to Figure 1, there are several enzymes that act on the heparin precursor after epimerization of some of the GlcA residues to IdoA. Specifically, O-sulfotransferase enzymes are responsible for the sulfation patterns that create the final heparin or heparin-like molecule product, and in particular, heparan sulfate 2-O-sulfotransferase (HS2OST), heparan sulfate 3-O-sulfotransferase (HS3OST), and heparan sulfate 6-O-sulfotransferase (HS6OST-1). SEQ ID NO:3 illustrates HS3OST cDNA, and the corresponding protein is set forth in SEQ ID NO:4. SEQ ID NO: 5 illustrates HS6OST cDNA, and the corresponding protein is set forth in SEQ ID NO:6.

Dd). HS2OST isolated nucleic acids Referring again to Figure 1, the 2-O-sulfotransferase acts on the heparin precursor at the same time the other sulfotransferases act on the heparin precursor, and O-sulfates IdoA residues at the 2-C position. The methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising Chinese Hamster Ovary (CHO) cell HS2OST, but rather, should be construed to encompass any nucleic acid encoding HS2OST or a fragment thereof, either known or unknown, which is capable of catalyzing the transfer of sulfate from PAPS to a 2-0 of a saccharide unit in a heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally- occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing the transfer of sulfate from PAPS to a 2-0 of a saccharide unit in a heparin precursor polysaccharide, for example. Such modified nucleic acid sequences are described elsewhere herein. Nucleic acids having at least 90 percent identity to CHO cell HS2OST are also encompassed by methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described above.

In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding an HS2OST protein may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, an additional HS2OST protein may have at least one nucleotide deleted from the naturally-occurring nucleic acid sequence. Further, an HS2OST protein useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme.

Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art, as described above. In another aspect, the invention may include an isolated HS2OST nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above. D(2 . HS3OST isolated nucleic acids Referring again to Figure 1, the 3-O-sulfotransferase acts on the heparin precursor at the same time the other sulfotransferases act on the heparin precursor, and O-sulfates GlcA and or IdoA residues at the 3-C position. HS3OST is one such 3-O-sulfotransferase enzyme, exemplified by SEQ ID NO:4, which is encoded by SEQ ID NO:3. The methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising SEQ ID NO:3, but rather, should be construed to encompass any nucleic acid encoding SEQ ID NO: 4 or a fragment thereof, either known or unknown, which is capable of catalyzing the transfer of sulfate from PAPS to a 3-0 of a saccharide unit in a heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally-occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing the transfer of sulfate from PAPS to a 3 -O of a saccharide unit in a growing heparin precursor polysaccharide, for example. Such modified nucleic acid sequences are described elsewhere herein.

Nucleic acids having at least 90 percent identity to SEQ ID NO:3 are also encompassed by methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described herein. In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding an HS3OST protein may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, an HS3OST protein may have at least one nucleotide deleted from the naturally- occurring nucleic acid sequence. Further, an HS3OST protein useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme. In another aspect, the invention may include an isolated HS3OST nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above. D(3 . HS6OST isolated nucleic acids Referring again to Figure 1, the 6-O-sulfotransferase acts on the heparin precursor at the same time the other sulfotransferases act on the heparin precursor, and O-sulfates glucosarnine residues at the 6-C position. HS6OST-1 is one such 6-O-sulfotransferase, exemplified by SEQ ID NO:6, which is encoded by SEQ ID NO: 5. However, the methods and compositions of the invention should not be construed to be limited solely to a nucleic acid comprising SEQ ID NO:5, but rather, should be construed to encompass any nucleic acid encoding SEQ ID NO:6 or a fragment thereof, either known or unknown, which is capable of catalyzing transfer of sulfate from PAPS to a 6-0 of a saccharide unit in a growing heparin precursor polysaccharide when expressed. Modified nucleic acid sequences, i.e. nucleic acid sequences having sequences that differ from the nucleic acid sequences encoding the naturally-occurring proteins, are also encompassed by methods and compositions of the invention, so long as the modified nucleic acid still encodes a protein having the biological activity of catalyzing transfer of sulfate from PAPS to a 6-0 of a saccharide unit in a growing heparin precursor polysaccharide, for example. Such modified nucleic acid sequences are described elsewhere herein.

Nucleic acids having at least 90 percent identity to SEQ ID NO:5 are also encompassed by methods and compositions of the present invention. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm as described above. In another aspect, a nucleic acid useful in methods and compositions of the present invention and encoding an HS6OST-1 protein may have at least one nucleotide inserted into the naturally-occurring nucleic acid sequence. Alternatively, an HS6OST-1 protein may have at least one nucleotide deleted from the naturally- occurring nucleic acid sequence. Further, an HS6OST-1 protein useful in the invention may have both a nucleotide insertion and a nucleotide deletion present in a single nucleic acid sequence encoding the enzyme. In another aspect, the invention may include an isolated nucleic acid of the present invention cloned into a DNA vector, the properties and uses of which are described in detail above.

In one aspect of the invention, mouse HS6OST-1 is cloned into a P_BAD/HISB expression vector to create a construct useful in the present invention. In another embodiment, the mouse HS6OST-1 gene of the present invention is cloned into a is cloned into a pCR-Blunt II-TOPO vector (Invitrogen, Carlsbad, CA). In yet another embodiment of the invention, the HS6OST-1 gene is cloned into the pBAD/HisB vector (Invitrogen, Carlsbad, CA) for the purpose of large-scale production of additional HS6OST-1 nucleic acid and for expression of HS6OST-1 protein of the invention. In yet a further embodiment of the invention, the HS6OST-1 gene of the invention is subcloned into a pGEX vector (Amersham Biosciences, Piscataway, NJ), and the pGEX-HS6OST-l construct is used for expression of HS6OST-1 protein of the invention. In another aspect of the invention, E. coli HS6OST-lis cloned into an expression vector downstream of the 3' end of a sequence encoding multiple functional tags. The 5 '-end fusion to HS6OST-1 comprises a six-histidine sequence to aid in purification of the expressed polypeptide, an Xpress™ epitope to aid in detection of the polypeptide, and an Enterokinase recognition site for cleavage of the purification and detection sequences from the polypeptide.

In yet another aspect of the present invention, HS6OST-lis expressed in E. coli, using an appropriate expression vector and E. coli cell. However, as evidenced by the literature relevant to the art, one skilled in the art will appreciate that HS6OST-1 can also be expressed in other cells, as is known to one of skill in the art. HS6OST-1 protein encoded by nucleic acids useful in the present invention may be expressed using any technique well-known in the art, such as simple expression, high level expression, or overexpression (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

II. Polypeptides

The present invention also mcludes an isolated polypeptide comprising an E. coli KfiA molecule. Preferably, the isolated polypeptide comprising an E. coli KfiA molecule is at least about 90% homologous to a polypeptide having the amino acid sequence of E. coli KfiA, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99% homologous to E. coli KfiA, or some fragment thereof. Most preferably, the isolated polypeptide comprising a KfiA molecule is E. coli KfiA.

The present invention also provides for analogs of proteins or peptides which comprise KfiA UDP-N-acetyl glucosarnine transferase as disclosed herein. Analogs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both.

For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function. Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.

Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.

Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the invention are not limited to products of any of the specific exemplary processes listed herein. Fragments of KfiA polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of KfiA UDP-N-acetylglucosamine transferase is the ability to transfer a N-acetylglucosamine moiety from a UDP-N-acetylglucosamine moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non-reducing end of the growing heparin backbone polysaccharide.

Therefore, a KfiA polypeptide smaller than full-length KfiA is included in the present invention provided that the "smaller than full-length" KfiA UDP-N-acetylglucosamine transferase has UDP-N-acetylglucosamine transferase biological activity.

In another aspect of the present invention, compositions comprising an isolated UDP-N-acetyl glucosarnine transferase enzyme may include highly purified UDP-N-acetyl glucosarnine transferase enzymes. Alternatively, compositions comprising the UDP-N-acetyl glucosarnine transferase enzymes may include cell lysates prepared from the cells used to express the particular UDP-N-acetyl glucosamme transferase enzymes. Further, UDP-N-acetyl glucosarnine transferase enzymes of the present invention may be expressed in one of any number of cells suitable for expression of polypeptides, such cells being well-known to one of skill in the art. Such cells include, but are not limited to bacteria, yeast, insect, and mammalian cells.

It will be appreciated that all above description's of UDP-N-acetyl glucosarnine transferase enzymes apply equally to UDP-glucuronic acid transferase enzymes, glucuronic acid C-5 epimerase enzymes, HS2OST enzymes, HS3OST enzymes, and HS6OST-1 enzymes useful for the present invention. Substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification. Harcourt Brace Jovanovich, San Diego).

The present invention also includes an isolated polypeptide comprising an E. coli KfiC molecule. Preferably, the isolated polypeptide comprising an E. coli KfiC molecule is at least about 90%> homologous to a polypeptide having the amino acid sequence of E. coli KfiC, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99% homologous to E. coli KfiC, or some fragment thereof. Most preferably, the isolated polypeptide comprising a KfiC molecule is E. coli KfiC. The present invention also provides for analogs of proteins or peptides which comprise KfiC UDP-glucuronic acid transferase as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques.

Fragments of KfiC polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of KfiC UDP-glucuronic acid transferase is the ability to transfer a glucuronic acid moiety from a UDP-glucuronic acid moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non-reducing end of the growing heparin backbone polysaccharide.

Therefore, a KfiC polypeptide smaller than full-length KfiC is included in the present invention provided that the "smaller than full-length" KfiC UDP- glucuronic acid transferase has UDP-glucuronic acid transferase biological activity. In another aspect of the present invention, compositions comprising an isolated UDP-glucuronic acid transferase enzyme may include highly purified UDP- glucuronic acid transferase enzymes. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein.

The present invention also includes an isolated polypeptide comprising an E. coli KfiB molecule. Preferably, the isolated polypeptide comprising an E. coli KfiB molecule is at least about 90%> homologous to a polypeptide having the amino acid sequence of E. coli KfiB, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99% homologous to E. coli KfiB, or some fragment thereof. Most preferably, the isolated polypeptide comprising a KfiB molecule is E. coli KfiB. The present invention also provides for analogs of proteins or peptides which comprise KfiB polypeptide as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques.

Fragments of KfiB polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of KfiB is the ability to support KfiA- and KfiB- mediated transfer of a saccharide moiety from a UDP-saccharide moiety to an acceptor molecule on a polysaccharide chain. The acceptor molecule in a growing heparin backbone polysaccharide is typically the non-reducing end of the growing heparin backbone polysaccharide.

Therefore, a KfiB polypeptide smaller than full-length KfiB is included in the present invention provided that the "smaller than full-length" KfiB polypeptide has KfiB activity as described above.

In another aspect of the present invention, compositions comprising an isolated KfiB polypeptide may include highly purified KfiB. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein. The present invention also includes an isolated polypeptide comprising a mouse glucuronic acid C-5 epimerase (GlcAc5) molecule. Preferably, the isolated polypeptide comprising a mouse GlcAc5 molecule is at least about 90%> homologous to a polypeptide having the amino acid sequence of SEQ ID NO:2, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99%> homologous to SEQ ID NO:2, or some fragment thereof. Most preferably, the isolated polypeptide comprising a GlcAc5 molecule is SEQ ID NO:2. The present invention also provides for analogs of proteins or peptides which comprise GlcAc5 polypeptide as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques. Fragments of GlcAc5 polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of GlcAc5 is the ability to epimerize glucuronic acid in a polysaccharide chain to iduronic acid.

Therefore, a GlcAc5 polypeptide smaller than full-length GlcAc5 is included in the present invention provided that the "smaller than full-length" GlcAc5 polypeptide has the ability to epimerize glucuronic acid in a polysaccharide chain to iduronic acid.

In another aspect of the present invention, compositions comprising an isolated GlcAc5 polypeptide may include highly purified GlcAc5. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein.

The present invention also includes an isolated polypeptide comprising a Chinese hamster ovary 2-O-sulfotransferase (HS2OST) molecule. The present invention also provides for analogs of proteins or peptides which comprise HS2OST polypeptide as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques. Fragments of HS2OST polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length \ protein. The biological activity of HS2OST is the ability to catalyze the transfer of sulfate from PAPS, an activated sulfate donor, to a 2-0 of an IdoA unit in a heparin precursor polysaccharide. Therefore, a HS2OST polypeptide smaller than full-length HS2OST is included in the present invention provided that the "smaller than full-length" HS2OST polypeptide has the ability to catalyze the transfer of sulfate from PAPS to a 2-0 of an IdoA unit in a heparin precursor polysaccharide. In another aspect of the present invention, compositions comprising an isolated HS2OST polypeptide may include highly purified HS2OST. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein.

The present invention also includes an isolated polypeptide comprising a 3-O-sulfotransferase (HS3OST) molecule. Preferably, the isolated polypeptide comprising a HS3OST molecule is at least about 90% homologous to a polypeptide having the amino acid sequence of SEQ ID NO:4, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99%> homologous to SEQ ID NO:4, or some fragment thereof. Most preferably, the isolated polypeptide comprising a HS3OST molecule is SEQ ID NO:4. The present invention also provides for analogs of proteins or peptides which comprise HS3OST polypeptide as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques.

Fragments of HS3OST polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of HS3OST is the ability to catalyze the transfer of sulfate from PAPS, an activated sulfate donor, to a 3-0 of an IdoA or a GlcA unit in a heparin precursor polysaccharide.

Therefore, a HS3OST polypeptide smaller than full-length HS3OST is included in the present invention provided that the "smaller than full-length" HS3OST polypeptide has the ability to catalyze the transfer of sulfate from PAPS to a 3-0 of an

IdoA or a GlcA unit in a heparin precursor polysaccharide.

In another aspect of the present invention, compositions comprising an isolated HS3OST polypeptide may include highly purified HS3OST. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein. The present invention also includes an isolated polypeptide comprising a mouse 6-O-sulfotransferase (HS6OST-1) molecule. Preferably, the isolated polypeptide comprising a HS6OST-1 molecule is at least about 90%> homologous to a polypeptide having the amino acid sequence of SEQ ID NO:6, or some fragment thereof. More preferably, the isolated polypeptide is about 95% homologous, and even more preferably, about 99% homologous to SEQ ID NO: 6, or some fragment thereof. Most preferably, the isolated polypeptide comprising a HS6OST-1 molecule is SEQ ID NO:6.

The present invention also provides for analogs of proteins or peptides which comprise HS6OST-1 polypeptide as discussed elsewhere herein. Also included in those discussions are polypeptides which have been modified using ordinary molecular biological techniques.

Fragments of HS6OST-1 polypeptides are also included in the present invention, provided the protein possesses the biological activity of the full-length protein. The biological activity of HS6OST-1 is the ability to catalyze the transfer of sulfate from PAPS, an activated sulfate donor, to a 6-0 of an IdoA unit or a glucosarnine unit in a heparin precursor polysaccharide.

Therefore, a HS6OST-1 polypeptide smaller than full-length HS6OST- 1 is included in the present invention provided that the "smaller than full-length" HS6OST-1 polypeptide has the ability to catalyze the transfer of sulfate from PAPS to a 6-0 of an IdoA unit or a glucosamme unit in a heparin precursor polysaccharide.

In another aspect of the present invention, compositions comprising an isolated HS6OST-1 polypeptide may include highly purified HS6OST-1. Such compositions, including lysates and cells for expression from which the lysates are prepared, are discussed elsewhere herein. Further, substantially pure protein isolated and obtained as described herein may be purified by following known procedures for protein purification, as described elsewhere herein.

III. Methods

Until the present invention, those skilled in the art relied upon purification of heparin precursor oligosaccharides to obtain starting material for in vitro modifications of heparin precursors. Such modifications included chemical modifications more often than enzymatic modifications. Further, there is no chemical modification that can mimic the glucuronic acid C-5 epimerization step required to take a heparin precursor oligosaccharide past the point of in vitro N-deacetylation/N- sulfation.

A. Total in vitro synthesis

Disclosed herein is a method for the total synthesis of heparin from sugar building blocks using the enzymes responsible for heparin backbone synthesis, N-sulfotransfer, glucuronic acid C-5 epimerization, and O-sulfotransfer.

The present invention offers a method for synthesizing heparin in a controlled manner. This invention links the UDP-sugar transferase reactions, the N- deacetylase and N-sulfotransferase reactions, the C-5 epimerization reaction, the 2-O- sulfotransfer reaction, the 3 -O-sulfotransfer reaction, and the 6-O-sulfotransfer reaction in a continuous in vitro synthetic pathway.

Further, for the total synthesis of heparin according to the present invention, each subsequent reaction uses the product of the previous reaction as the substrate. For example, the heparin precursor product created by the repeated reactions of the KfiA and KfiC proteins in the presence of the KfiB protein serves as the substrate for the NDST N-deacetylation/N-sulfotransfer reactions. Subsequently, the N-deacetylated/N-sulfated heparin precursor product serves as the substrate for the glucuronic acid C-5 epimerization reaction. Following epimerization, the heparin precursor product then serves as the substrate for the 2-O, 3-O, and 6-0 sulfotransferase enzymes, HS2OST, HS3OST, and HS6OST-l. The present invention also encompasses other heparin-like molecules that are readily synthesized according to methods of the present invention. In an embodiment of the present invention, heparan sulfate is synthesized by expressing the enzymes responsible for glycosyltransfer (heparin backbone synthesis), N- sulfotransfer, glucuronic acid C-5 epimerization, and O-sulfotransfer, and using the enzymes for total synthesis of heparan sulfate from sugar building blocks. As disclosed elsewhere herein, heparan sulfate can be synthesized by limiting the extent to which the oligosaccharide polymer product of the C-5 epimerization reaction is sulfated by the HS2OST, HS3OST, and HS6OST-1 sulfotransferase enzymes. It will be understood that other heparin-like molecules that are produced by controlling O- sulfation of the oligosaccharide polymer product of the C-5 epimerization reaction are encompassed by the present invention.

In an aspect of the present invention, a glycosyltransferase that catalyzes the synthesis of a heparin precursor molecule is produced by a cell containing the isolated nucleic acid for the glycosyltransferase, and the expressed glycosyltransferase is subsequently isolated from either the cell culture medium or upon lysis of the cell. Isolation of an expressed glycosyltransferase is accomplished by means well-known to one of skill in the art. In this aspect of the invention, the expressed glycosyltransferase may contain a terminal fusion tag to assist in isolation. This method and related means of protein isolation are well-known in the art.

It will be understood that descriptions of vectors containing an isolated nucleic acid encoding a glycosyltransferase, expression of a glycosyltransferase in a cell, and conditions for expression of a nucleic acid encoding a glycosyltransferase useful in the present invention apply equally to methods encompassing any and all isolated nucleic acids of the present invention, including epimerases and O- sulfotransferases .

In a further aspect of the present invention, a cell containing and expressing an isolated nucleic acid for a glycosyltransferase of the invention lacks a gene for beta-glucuronidase. The cell may naturally lack the gene, or alternatively, the gene may be "knocked-out" by methods well known to one of skill in the art. In yet a further aspect of the invention, the beta-glucuronidase gene in a cell containing and expressing the genes for the glycosyltransferases of the invention may be inactivated by genetic mutagenesis techniques known to one of skill in the art. In such an aspect of the invention, the glycosyltransferase may be used directly in the cell lysate prepared from the beta-glucuronidase expression cell culture.

In yet another aspect of the present invention, a cell which has the beta-glucuronidase gene knocked-out may be used to express any isolated nucleic acid of the invention, including a UDP-N-acetylglucosamine transferase, a UDP- glucuronic acid transferase, a glucuronic acid C-5 epimerase, a heparan sulfate 2-O- sulfotransferase, a heparan sulfate 3-O-sulfotransferase, or a heparan sulfate 6-O- sulfotransferase. In such an aspect of the invention, the expressed protein product of the isolated nucleic acid of the invention may be used directly in the cell lysate prepared from the beta-glucuronidase-negative expression cell culture. As will be appreciated by one of skill in the art, the beta-glucuronidase-negative expression cell lysate will be free of beta-glucuronidase that would otherwise degrade heparin precursor oligosaccharides synthesized by glycosyltransferase reactions conducted in the cell lysate.

The present invention includes a method of producing KfiA polypeptide for the purpose of synthesizing a heparin backbone precursor oligosaccharide. The isolated nucleic acid encoding a KfiA polypeptide of the present invention may be cloned from an E. coli cell as known to one of skill in the art. A cloned and isolated kfiA DNA is subsequently subcloned into a pBAD vector of the present invention.

A skilled artisan will understand when equipped with a vector comprising an isolated kfiA nucleic acid of the invention that the vector can be transformed into a bacterial cell suitable for expression of exogenous proteins.

Furthermore, the vector comprising an isolated kfiA nucleic acid of the invention can also be transformed into a bacterial cell suitable for expression of endogenous proteins located on a DNA plasmid separate from the genomic DNA.

The present invention also includes a method of producing KfiC polypeptide for the purpose of synthesizing a heparin backbone precursor oligosaccharide. The isolated nucleic acid encoding a KfiC polypeptide of the present invention may be cloned from an E. coli cell as known to one of skill in the art. A cloned and isolated kfiC DNA is subsequently subcloned into a pBAD vector of the present invention. The present invention further includes a method of producing KfiB polypeptide for the purpose of synthesizing a heparin backbone precursor oligosaccharide. The isolated nucleic acid encoding a KfiB polypeptide of the present invention may be cloned from an E. coli cell as known to one of skill in the art. A cloned and isolated kfiB DNA is subsequently subcloned into a pBAD vector of the present invention.

In an embodiment of the present invention, separate isolated nucleic acids encoding KfiA, KfiC, and KfiB polypeptides are cloned into one pBAD expression vector. The three isolated nucleic acids may be arranged in the vector in order to maximize the arabinose-induced expression of the polypeptides or to maximize the activity of the expressed polypeptides. The arrangement of the kfi A, kifB, and kfiC nucleic acids of the present invention refers to the precise physical relationship of each of the nucleic acids to the other two nucleic acids in a plasmid. For example, the 3' end of the kfi A nucleic acid of the invention may be immediately adjacent to the 5' end of the kfiB nucleic acid of the present invention.

The present invention is based in part on the novel discovery that a particular arrangement of isolated kfi nucleic acids in a pBAD vector results in high activity of the expressed Kfi polypeptides. In particular, the nucleic acid sequence having nucleic acids of the invention in the order of 5'-BAD.promoter-kfιA-kfιB-

BAD.promoter-kfiC-3' results in the production of a KfiC enzyme of high activity. One of skill in the art would appreciate that the temporal arrangement of the expression of each of the Kfi polypeptides of the invention, the level of expression of each of the Kfi polypeptides of the invention, and the identity of each of the expressed Kfi polypeptides of the invention may affect the activity of any one of the expressed

Kfi polypeptides of the invention.

In one embodiment of the invention, a glycosyltransferase of the present invention is used in concert with at least one other glycosyltransferase of the invention to synthesize a heparin precursor. Synthesis of a heparin precursor by an isolated glycosyltransferase according to the present invention is performed in a single reaction, wherein more than one glycosyltransferase of the invention works in concert with the other. In this embodiment of the invention, synthesis of a heparin precursor may be carried out with the addition of a single saccharide unit at a time, wherein multiple glycosyltransferases of the invention are acting in concert to effect the synthesis of a heparin precursor backbone.

It will be understood that methods in which polypeptides of the present invention catalyze UDP-N-acetyl glucosamine transfer or UDP-glucuronic acid transfer reactions will have reaction conditions sufficient to support the particular reaction being conducted. In another aspect of the invention, both UDP-N-acetyl glucosamine transfer and UDP-glucuronic acid transfer reactions may be conducted in a single reaction mixture. In this aspect of the invention, the reaction conditions will be sufficient to support both UDP-N-acetyl glucosamine transfer and UDP-glucuronic acid transfer reactions simultaneously. In a further aspect of the invention, reaction conditions sufficient to support both UDP-N-acetyl glucosamine transfer and UDP- glucuronic acid transfer reactions simultaneously also includes KfiB protein.

In an aspect of the present invention, both glycosyltransferase reactions of the present invention, as described above, can readily be conducted in a single reaction mixture at pH 7.0 in the presence of equal concentrations of UDP-GlcNAc and UDP-GlcA, MnCl₂, and lysates from a cell culture expressing KfiC and a cell culture expressing KfiA. As can be appreciated by one of skill in the art, purified KfiC and KfiA polypeptides can be used in place of cell lysates as described above. In yet another aspect of the invention, a first glycosyltransferase of the present invention is used to add a first saccharide unit to a growing heparin backbone polymer. A second and different glycosyltransferase of the invention is used in a reaction subsequent to that of the first glycosyltransferase to add a second and different saccharide unit to the growing heparin backbone. In this embodiment of the invention, synthesis of a heparin precursor may be carried out with the addition of a single saccharide unit at a time, wherein multiple glycosylfransferases of the invention are repeatedly acting one after another to effect the synthesis of a heparin precursor backbone.

Another aspect of the invention provides a heparin backbone synthesis starting material comprising methylumbelliferyl-glucuronic acid (MU-GlcA) as an acceptor for further synthesis. In this aspect of the invention, the starting material is contacted with a solution comprising KfiA and UDP-GlcNAc to produce the disaccharide GlcNAcαl- 4GlcA-MU.

In a further aspect of the invention, a heparin precursor oligosaccharide of defined size is produced by contacting MU-GlcA with a solution comprising KfiA and UDP-GlcNAc, then contacting the entire resulting mixture with a solution comprising UDP-GlcA and KfiC. In this aspect of the present invention, the KfiA and KfiC polypeptides may be used in the form of cell lysates. The cell lysates are prepared from separate cell cultures in which each of KfiA and KfiC are expressed individually. The oligosaccharide product formed after the action of one glycosyltransferase is isolated from the cell lysate that contains the first glycosyltransferase before the second glycosyltransferase is contacted with the oligosaccharide product-containing solution. Table 2 illustrates one aspect of the present invention in which a coordinated synthesis of a heparin backbone precursor is carried out. In this aspect of the invention, a heparin precursor oligosaccharide of defined size is produced by contacting MU-GlcA with a solution comprising KfiA and UDP-GlcNAc, then contacting the entire resulting mixture with a solution comprising UDP-GlcA and

KfiC. The product of this series of reactions is a trisaccharide of structure GlcAβl- 4GlcNAcαl->4GlcA-MU. The sequential process of alternatively contacting the resulting reaction mixture of the previous step with a solution comprising KfiA and UDP-GlcNAc, then a solution comprising UDP-GlcA and KfiC results in the elongation of the oligosaccharide by two units. Accordingly, this sequential process is repeated a defined number of times based on the size of oligosaccharide that is desired.

Table 2. Synthesis of defined size backbone polysaccharide Methylumbelliferyl-glucuronic acid is used as an acceptor to begin synthesis of a heparin precursor molecule, as underivitized glucuronic acid will not serve as an acceptor. As the length of the heparin precursor oligosaccharide increases, the significance of the methylumbelliferyl-glucuronic acid group for glycosyltransfer reactions decreases.

Reaction 1:

MU-GlcA + UDP-GlcNAc — > add (KfiA, Mn²⁺) — > GlcNAcαl ^4GlcA-MU +

UDP

Reaction 2:

GlcNAcαl ^4GlcA-MU + UDPGlcA — > add (KfiC, Mn²⁺) — > GlcAβ 1 ^4GlcNAcαl ->4GlcA-MU + UDP

Reaction 3 (repeat reaction 1): GlcAβl ^4GlcNAcαl - 4GlcA-MU + UDPGlcA — > add (KfiC, Mn²⁺) — >

GlcNAcαl - 4GlcAβl ^4GlcNAcαl ^4GlcA-MU + UDP

Reaction 4 (repeat reaction 2): GlcNAcαl ^4GlcAβl^4GlcNAcαl^4GlcA-MU + UDPGlcA — > add (KfiC, Mn²⁺) — > GlcAβl^4GlcNAcαl- 4GlcAβl^4GlcNAcαl^4GlcA-MU + UDP

In yet a further aspect of the invention, a heparin precursor oligosaccharide of random size is produced by contacting a reaction mixture comprising UDP-GlcA and trisaccharide of structure GlcAβl-^4GlcNAcαl^4GlcA- MU with a solution comprising UDP-GlcNAc, KfiA, and KfiC. Heparin precursor oligosaccharides produced by this method can range from tetramer to 24-mer and larger.

In another aspect of the present invention, a synthesized heparin precursor oligosaccharide is purified from the synthesis reaction mixture for use in a further synthesis reaction. In a further aspect of the invention, an oligosaccharide synthetic enzyme is removed from the synthesis reaction mixture by boiling the reaction mixture and a remaining oligosaccharide synthesis product is recovered using ethanol precipitation. In this aspect of the invention, ethanol is added to a final concentration of 80% to an oligosaccharide mixture synthesized as described above. After centrifugation, the resulting pellet is resuspended and precipitated with ethanol two additional times. The purified and isolated oligosaccharide can then be used in glycosyltransferase reactions to further elongate the heparin precursor oligosaccharide, or it can be used in a subsequent heparin synthetic reaction such as the N-deacetylation/N-sulfotransfer reaction.

In yet another aspect of the present invention, the ethanol precipitation of oligosaccharides as described above may be used to purify oligosaccharides from any composition of the present invention, including compositions containing glucuronic acid C-5 epimerase, heparan sulfate 2-O-sulfotransferase, heparan sulfate 3-O-sulfotransferase, or heparan sulfate 6-O-sulfotransferase, or from compositions containing more than one of the polypeptides of the invention. One of skill in the art would recognize that the methods of the present invention may create compositions from which oligosaccharide products may be isolated.

Following synthesis of a heparin precursor polysaccharide backbone of the present invention, some of the GlcNAc units in the saccharide polymer must be deacetylated and N-sulfated in order to continue synthesis of the heparin precursor in the heparin synthetic pathway. N-deacetylation and N-sulfation of the heparin precursor polysaccharide backbone is carried out by heparan sulfate/heparin N- deacetylase/N-sulfotransferase (NDST) enzyme, as is known in the art. Once N- deacetylation and N-sulfation of the heparin precursor polysaccharide backbone has taken place, the heparin precursor backbone can then be modified by a glucuronic acid C-5 epimerase (GlcAc5E) of the present invention.

Accordingly, the present invention includes a method of producing GlcUAc5E polypeptide for the purpose of epimerizing GlcA units to IdoA units in a heparin backbone precursor oligosaccharide. The isolated nucleic acid encoding a GlcUAc5E polypeptide of the present invention may be cloned from a mouse cDNA library as known to one of skill in the art. A cloned and isolated GlcUAc5E DNA is subsequently subcloned into a vector suitable for the cloning procedures, as is well known to one of skill in the art.

A skilled artisan equipped with an isolated GlcUAc5E nucleic acid of the present invention would know that the GlcUAc5E nucleic acid may be subcloned from a cloning vector into an expression vector. In an embodiment of the present invention, an isolated GlcUAc5E nucleic acid may be subcloned into a pAcGP67B expression vector, as described in detail elsewhere herein.

In an aspect of the present invention, a GlcUAc5E-pAcGP67B construct of the present invention can be co-transfected into Sf9 insect cells along with linearized baculovirus DNA. Expression of the GlcUAc5E polypeptide of the invention will result in GlcUAc5E being secreted into the cell culture medium. As would be known to one of skill in the art, GlcUAc5E may subsequently be used directly in the culture medium or GlcUAc5E may be further purified and isolated from the cell culture medium.

In another embodiment of the present invention, GlcUAc5E may be purified directly from bovine liver, using techniques known to one of skill in the art. Details of purification of GlcUAc5E from bovine liver are described in detail elsewhere herein. In another aspect of the invention, a heparin precursor oligosaccharide of the invention that has been N-deacetylated and N-sulfated by an (NDST) enzyme is contacted with a solution comprising a GlcUAc5E polypeptide of the invention in order to epimerize GlcA residues in the precursor oligosaccharide to IdoA residues. As described elsewhere herein, the resulting heparin precursor oligosaccharide containing "epimerized" glucuronic acid residues may be purified by ethanol precipitation.

In an embodiment of the invention, the extent of epimerization of a heparin backbone precursor oligosaccharide can be qualitatively and quantitatively analyzed by employing a radioactivity-based assay. Production of heparin backbone precursor oligosaccharide according to the present invention must be conducted using D-[5- H]-GlcA as a monosaccharide building block in order to subsequently use a radioactive assay to monitor epimerization. Because GlcUAc5E-based epimerization of GlcA residues in a heparin backbone precursor proceeds by abstraction and re-addtion of a proton at the C-5 position, H-labeled H₂O is a product of the epimerization reaction using D-[5- H]- GlcA-containing heparin backbone precursor oligosaccharide. After removing radiolabeled oligosaccharide from the epimerization reaction mixture, ³H-labeled H₂O can be analyzed using a scintillation counter. Such methods are well known to one of skill in the art, and details for the radioactive reaction and analysis of epimerization of a heparin precursor backbone oligosaccharide are provided elsewhere herein.

The present invention also provides methods for further analytical analysis of heparin precursor backbone oligosaccharides that have undergone epimerization as described above. Specifically, the extent of epimerization in an oligosaccharide of the present invention may be estimated by determining the relative amounts of GlcA and IdoA in the oligosaccharide. Such information is useful for methods and compositions of the present invention when the extent of epimerization may affect the subsequent intermediate reactions and the final polysaccharide product. For example, a low level of epimerization may prevent synthesis of a final product that can be classified as heparin. Armed with analytical information revealing a low level of epimerization in a heparin precursor oligosaccharide, the skilled artisan can then subject the precursor oligosaccharides to further epimerase treatment or use the precursor oligosaccharides for synthesis of a defined heparin-like final oligosaccharide product.

Such an analytical method as described above utilizes depolymerization of the epimerized heparin precursor oligosaccharide with nitrous acid at pH 1.9, followed by enzymatic hydrolysis with glycosidases to yield free uronic acids. As described in detail elsewhere herein, ion exchange chromatography is used to identify the nature and amounts of the uronic acid monomers as compared to commercially obtained standards.

Other methods and compositions of the invention use glucuronic acid GlcUAc5E polypeptides of the invention to catalyze epimerization of glucuronic acid residues to iduronic acid residues in a heparin precursor oligosaccharide. It will be understood that methods in which polypeptides of the present invention catalyze epimerization of glucuronic acid residues to iduronic acid residues in a heparin precursor oligosaccharide will have assay conditions sufficient to support the particular reaction being carried out.

In a further aspect of the invention, the method of using glucuronic acid C-5 epimerase to catalyze epimerization of glucuronic acid residues to iduronic acid residues is carried out on a heparin precursor oligosaccharide synthesized by the method utilizing other polypeptides of the present invention to catalyze UDP-N-acetyl glucosamine transfer or UDP-glucuronic acid transfer as a means of synthesis of a heparin precursor oligosaccharide. Another aspect of the invention provides that UDP-N-acetyl glucosamine transfer, UDP-glucuronic acid transfer, and glucuronic acid C-5 epimerization reactions all occur in one reaction mixture, under conditions suitable to support all three reactions in the single reaction mixture. In an aspect of the present invention, both the N-deacetylase/N- sulfotransferase and epimerase reactions of the present invention, as described above, can readily be conducted in a single assay mixture at, for example pH 6.5 in the presence of 100 mM KC1 and 15 mM MnCl₂, with 2 mg of PAPS.

The present invention includes a method of isolating heparan sulfate 2- O-sulfotransferase (HS2OST) polypeptide for the purpose of sulfating IdoA residues in a heparin backbone precursor oligosaccharide. The HS2OST may be isolated from an Chinese hamster ovary (CHO) cells as known to one of skill in the art. A detailed description of the growth of the CHO cells and the subsequent purification of HS2OST from the cell lysate is provided elsewhere herein. In a further aspect of the invention, a heparin precursor oligosaccharide of the invention that has had GlcA residues epimerized to IdoA is contacted with a solution comprising a heparan sulfate 2-O-sulfotransferase (HS2OST) in order to sulfate the epimerized IdoA residues at the C-2 position. As would be known to the skilled artisan, the heparin precursor oligosaccharide of the invention used in this aspect may be purified away from the other components present from a previous synthesis reaction step, as described in detail elsewhere herein, or the heparin precursor oligosaccharide may be contacted with an HS2OST polypeptide as the oligosaccharide was obtained directly in a synthesis reaction mixture.

The present invention includes a method of producing HS6OST-1 polypeptide for the purpose of synthesizing a heparin backbone precursor oligosaccharide. The isolated nucleic acid encoding a HS6OST-1 polypeptide of the present invention may be cloned from an mouse cDNA library as known to one of skill in the art. A cloned and isolated HS6OST-1 DNA is subsequently subcloned into a pBAD/HisB vector of the present invention, as described elsewhere herein in detail.

A skilled artisan will understand when equipped with a pBAD/HisB vector comprising an isolated HS6OST-1 nucleic acid of the invention that the vector can be transformed into a bacterial cell, such as E. coli, which is suitable for expression of exogenous proteins. The skilled artisan will further understand the methods available for expression and purification of the HS6OST-1 protein using an E. coli expression system.

Expression of HS6OST-1 from the HS6OST-1/ pBAD/HisB construct results in a HS6OST-1 fusion protein with an N-terminal polyhistidine fusion. Using a Ni²⁺-charged chromatographic resin, the HS6OST-1 fusion protein is readily isolated from an E. coli cell lysate.

In a further aspect of the invention, a heparin precursor oligosaccharide of the invention that has had GlcA residues epimerized to IdoA is contacted with a solution comprising a heparan sulfate 6-O-sulfotransferase (HS6OST) in order to sulfate N-sulfated glucosamine (GlcNS) or N-acetylated glucosamine (GlcNAc) residues at the C-6 position. As would be known to the skilled artisan, the heparin precursor oligosaccharide of the invention used in this aspect may be purified away from the other components present from a previous synthesis reaction step, as described in detail elsewhere herein, or the heparin precursor oligosaccharide may be contacted with an HS6OST polypeptide as it was obtained directly in a synthesis reaction mixture. The present invention also includes a method of isolating heparan sulfate 3-O-sulfotransferase (HS3OST) polypeptide for the purpose of sulfating IdoA residues in a heparin backbone precursor oligosaccharide.

In a further aspect of the invention, a heparin precursor oligosaccharide of the invention that has had GlcA residues epimerized to IdoA is contacted with a solution comprising a HS3OST in order to sulfate GlcA, C-2-sulfated iduronic acid (IdoA(2SO ), or C-2-sulfated glucuronic acid (GlcA(2SO ) at the C-3 position. As would be known to the skilled artisan, the heparin precursor oligosaccharide of the invention used in this aspect may be purified away from the other components present from a previous synthesis reaction step, as described in detail elsewhere herein, or the heparin precursor oligosaccharide may be contacted with an HS3OST polypeptide as the oligosaccharide was obtained directly in a synthesis reaction mixture.

The present invention also relates to methods for heterogeneous O- sulfation of a heparin precursor polysaccharide, including heparan sulfate. Such methods utilize at least two O-sulfotransferase polypeptides of the invention, as described above, to catalyze the transfer sulfate from PAPS to a 2-O, a 3-O, or a 6-0 of a heparin precursor oligosaccharide. It will be understood that methods in which O-sulfotransferase polypeptides of the present invention catalyze transfer sulfate to a 2-O, a 3-O, or a 6-0 of a heparin precursor oligosaccharide will have assay conditions sufficient to support the particular reaction being assayed.

In another aspect of the invention, transfer of sulfate to a 2-O, a 3-O, and a 6-0 of a heparin precursor oligosaccharide may be conducted in a single reaction, utilizing the HS2OST, HS3OST, and HS6OST-1 proteins of the invention. In this aspect of the invention, the reaction conditions will be sufficient to support all three sulfate transfer reactions simultaneously. In a further aspect of the invention, the method of using HS2OST, HS3OST, and HS6OST-1 proteins to catalyze the transfer of sulfate to a 2-O, a 3-O, and a 6-0 of a heparin precursor oligosaccharide is carried out on a heparin precursor synthesized by the method utilizing other polypeptides of the present invention to catalyze UDP-N-acetyl glucosamine transfer, UDP-glucuronic acid transfer, and glucuronic acid C-5 epimerase as a means of synthesis of the heparin precursor oligosaccharide.

It will be understood that methods and compositions in which polypeptides of the present invention catalyze a 2-O, 3-O, or 6-0 sulfotransfer reaction will have reaction conditions sufficient to support all particular reactions being conducted. In another aspect of the invention, 2-O, 3-O, and 6-0 sulfotransfer reactions may be conducted in a single reaction. In this aspect of the invention, the reaction conditions will be sufficient to support each of the 2-O, 3-O, and 6-0 sulfotransfer reactions simultaneously.

In a further aspect of the invention, methods and compositions in which polypeptides of the present invention catalyze UDP-N-acetyl glucosamine transfer and UDP-glucuronic acid transfer reactions, epimerization of glucuronic acid residues to iduronic acid residues, and 2-O, 3-O, and 6-0 sulfotransfer reactions will have reaction conditions sufficient to support all particular reactions being conducted.

In this aspect of the invention, such assay conditions may be used to effect the total synthesis of heparin from monosaccharide building blocks.

It will be understood that a heparin precursor oligosaccharide may be purified from a reaction mixture composition of the present invention by any method known to one of skill in the art. In an embodiment of the present invention, ethanol precipitation may be used to purify the heparin precursor oligosaccharide, as described in detail elsewhere herein.

In another embodiment of the invention, a heparin precursor oligosaccharide produced by a single method of the present invention, such as an epimerization method step or a method comprising 2-O-sulfotransferase action on a heparin precursor oligosaccharide, may be purified after that method step and before use in a subsequent method step. In yet a further embodiment of the invention, a heparin backbone precursor oligosaccharide may be purified after every single method step of the present invention. A single method step of the invention may comprise one of the following steps, including UDP-N-acetylglucosamine transferase treatment, UDP-glucuronic acid transferase treatment, N-deacetylation/N- sulfotransfer treament, glucuronic acid C-5 epimerization, 2-O-sulfotransferase treatment, 3-O-sulfotransferase treatment, and 6-O-sulfotransferase treatment. However, a single method step of the present invention is not limited to a single chemical or enzymatic reaction, and as such, a single method step may comprise multiple reactions, such as, but not limited to UDP-N-acetylglucosamine transferase treatment and UDP-glucuronic acid transferase treatment together. B. Total "one-pot" in vitro synthesis

The present invention also offers a method for total synthesis of heparin in a controlled manner. This invention links the UDP-sugar transferase reactions, the N-deacetylase and N-sulfotransferase reactions, the C-5 epimerization reaction, the 2-O-sulfotransfer reaction, the 3-O-sulfotransfer reaction, and the 6-O- sulfotransfer reaction in a single in vitro synthetic pathway.

As would be apparent to one of skill in the art, a single in vitro synthetic pathway can be considered as a "one-pot" synthesis of heparin, starting from the synthesis of a MU-oligosaccharide backbone from sugar monomers in the presence of the UDP-sugar transferases, the N-deacetylase/N-sulfotransferase enzyme, the C-5 epimerase, and the O-sulfotransferases of the invention.

C. Partial in vitro synthesis

In a method of the present invention, a glycosyltransferase that catalyzes the synthesis of a heparin precursor molecule is produced by a cell containing a vector encoding the isolated nucleic acid for the glycosyltransferase. In one aspect, the glycosyltransferase is used in concert to synthesize a heparin precursor molecule inside the cell in which it is expressed, such that the synthesized heparin precursor may be isolated either from the cell culture medium or upon the lysis of the cells.

An E. coli cell appropriate for expression of the Kfi polypeptides of the invention may be transformed with the 5'-BAD.promoter-kfιA-kfiB-BAD.promoter- kfiC-3' of the present invention. By effecting the expression of all three of the Kfi polypeptides of the invention, a heparin precursor backbone oligosaccharide of the invention may be synthesized inside the cell in which the polypeptides are expressed, such that the synthesized heparin precursor may be isolated either from the cell culture medium or upon the lysis of the cells.

D. Scale-up

The present method also mcludes methods and compositions related to scale-up of the reactions presented herein. In particular, the reactions of the methods and compositions presented herein may be increased in size, volume, throughput, and yeild for use and utility in a large-scale industrial capacity.

EXPERIMENTAL EXAMPLES The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

KfiA/UDP-GlcNAc Transferase

The KfiA gene, native to the capsule producing strain of E. coli K5, was cloned into pBAD, a vector commercially available from Invitrogen (Carlsbad, CA). This vector has a BAD promoter inducible with L-arabinose, and the expressed enzyme is HIS-tagged. To get around the problem of beta-glucuronidase competition for substrate, this construct as expressed in BW25141 E. coli cells obtained from the Yale Genetic Stock Center. These cells have the beta-glucuronidase gene knocked- out, resulting in the absence of beta-glucuronidase protein in the cell.

The highest KfiA activity observed was approximately 80% conversion in 1.25 hours using 30% lysate. Because the beta-glucuronidase is also knocked out of E. coli EV239, an E. coli K12 strain, a strain having the Region 1 and 3 genes from Kl inserted into the genome was considered an appropriate alternate strain to use for expression KfiA, since the other kfi genes are native to all of the capsule-producing strains of E. coli. However, the results showed that KfiA expressed alone in E. coli EV239 had no activity. Plasmid DNA from cells with cultures that showed no activity was confirmed as having the kfiA DNA insert by gel electrophoretic analysis. A construct with all four kfi genes from E. coli K5 (KfiA, - B, -C, and -D) did show a low level of KfiA activity. KfiC/UDP-GlcA Transferase The KfiC gene, also native to K5, was cloned into various vector constructs in order to identify a construct that would provide optimal amounts of expressed enzyme with the highest possible activity. To get around the problem of beta-glucuronidase competition for substrate, this construct was expressed in BW25141 E. coli cells obtained from the Yale Genetic Stock Center, as described above.

KfiC activity was only observed when a construct containing KfiA, KfiB, and KfiC genes was created. It was also found that the order of the three genes was not critical to observe KfiC activity. Further, expressing the construct in E. coli

EV239 cells lacking beta-glucuronidase did not improve the KfiC enzyme activity.

The most active form of the KfiC enzyme was obtained using the pBAD.AB.promC construct. In this construct, KfiA and KfiB share a promoter and KfiC was cloned with another copy of the BAD promoter (Figure 2). KfiA with an N-terminal HIS-tag, KfiB, and KfiC with its own copy of the pBAD promoter were all cloned into a pCRblunt vector (Invitrogen, Carlsbad, CA). The construct was transformed into BW25141 cells for expression. UDP-GlcA activity was analyzed using HPLC, and there was a measurably high level of UDP-GlcA transferase activity. This final result revealed that KfiA, KfiB, and KfiC require one another in some capacity in order to attain full levels of activity. While no activity has yet been ascribed to KfiB, it is possible that KfiB may play a structural role in KfiC activity. Synthesis of Methyumbelliferyl glucuronic acid starting material No commercially available oligosaccharide is identical to the first portion of the heparin backbone molecule. The first sugar in the elongation chain for synthesis of heparin is glucuronic acid, but glucuronic acid alone is not an acceptor for KfiA-GlcNAc transferase. As a result, a methylumbelliferyl glucuronic acid derivative (MU-GlcA) was identified as a suitable basis for further syntheses. MU- GlcA is stable and the MU portion of the molecule is easily detectable with UV light.

I. Enzymatic synthesis of the heparin polysaccharide backbone

Step 1. Synthesis of GlcNAc-GlcA-MU (disaccharide-MLO

To a 1 liter reaction vessel, UDP-GlcNAc (10 mM), GlcA-MU (7.5 mM), MnCl₂ (15 mM), and KfiA lysate (60-120 U) were added. The pH of the reaction mixture was maintained at 7.0 using HEPES buffer. The reaction was carried out at 37°C for 2-3 days until a yield of 75-95% was obtained. The reaction was then stopped by heating the reaction mixture to 90°C for 10 minutes to denature the enzyme. Denatured proteins and inorganic precipitation were removed by centrifugation. The disaccharide-MU ("disclosure materials" figure 1) in the clear supernatant was purified on a C18 reverse phase column and lyophilized. Step 2. Synthesis of oligosaccharide-MU starting from disaccharide-MU To a 50 ml centrifuge tube, was added disaccharide-MU (5 mM),

UDP-GlcA (10 mM), MnCl₂ (15 mM) and KfiC lysate (30%) to a final volume of 36 ml. The reaction was carried out at 37°C and pH 7 (controlled using Hepes buffer) for 20 hours. At that point the synthesis mixture contained -80 % trisaccharide (see "disclosure materials" figure 2A). To continue the synthesis the following was added to the reaction: 5.4 ml KfiA lysate (60 - 120 U/liter synthesis), 3.6 ml KfiC cell lysate, 3.6 ml UDP-GlcNAc (100 mM stock) and 1 ml MnCl₂ (300 mM stock). The reaction was allowed to continue for 3 more hours and was stopped by heating the reaction mixture to 80°C for 10 minutes The precipitate was removed by centrifugation. The majority of the oligosaccharide was a tetramer, and a trace amount decasaccharide-MU was confirmed in the reaction mixture ("disclosure materials" figure 2B). Step 3. Synthesis of defined size oligosaccharide-MU

Defined size oligosaccharide can be synthesized by further extending the tetrasaccharide by adding one monosaccharide at a time. To the supernatant obtained in step 2 above (6 ml) was added 0.36 ml UDP-GlcA (100 mM), 1.8 ml KfiC cell lysate (21.5%) and 0.2 ml MnCl₂ (300 mM) and it was incubated at 37°C for 71 hours. After a 4 hour incubation, all of the tetrasaccharide was converted to pentasaccharide. Step 4. Synthesis of extending oligosaccharide-MU To the supernatant obtained in step 2B as shown above (about 2.3 mM oligosaccharide-MU mixture) was added UDP-GlcNAc (7.5 mM), UDP-GlcA (7.5 mM), MnCl₂ (5.6 mM), KfiC lysate (17%), and KfiA lysate (60 U/liter) in a final volume of 53 ml. The reaction was carried out at 37°C and pH 7 (controlled using Hepes buffer) for 71 hours. The reaction was stopped by heating the reaction mixture to 80°C for 10 minutes The precipitate was removed by centrifugation. The majority of the extended oligosaccharides are dodecasaccharide-MU, with traces of polysaccharide having up to 20 monosaccharide units. (See "disclosure materials" figure 3). Step 5. Synthesis of longer backbone - polvsaccharide-MU

Example A. Extending the size of the oligosaccharide-MU backbone obtained in step 4 was carried out by adding 100 μl UDP-GlcA (100 mM), 100 μl UDP-GlcNAc (100 mM), 100 μl KfiA and 300 μl KfiC cell lysates and 50 μl MnCl₂ (300 mM) to 1 ml oligosaccharide mixture. The reaction was incubated at 37°C for 26 hours, at which point the synthesis was terminated by heating the mixture to 90°C for 5 minutes The precipitates were removed by centrifugation. The resulting polysaccharide mixture contained polysaccharides of up to 24 monosaccharide units, with the majority having 17-22 mono-saccharide units (see "disclosure materials" figure 4A).

Example B. To remove the smaller oligosaccharides from the mixture obtained in step 4, 3 ml of the reaction mixture was precipitated with 80% of cold Ethanol (EtOH). The resuspension was kept at -20°C for 30 minutes, and centrifuged at 6,000 x g for 20 minutes in a Bench Top centrifuge (Jouan, Inc, MR 1812). The supernatant was removed and the pellet was dissolved in 0.3 ml of dH₂O and transferred into a 1.5 ml microcentrifuge tube. The oligosaccharides were precipitated again with 1.2 ml of cold Ethanol. The resuspension was kept at -20°C for 30 minutes and centrifuged at 14,000 rpm for 5 minutes in a microfuge. This procedure was repeated to get a more pure oligosaccharide pool. The pellet obtained after the centrifugation was dried on air and dissolved in 0.17 ml of dH O. For the synthesis of polysaccharides, to this solution in the 1.5 ml microcentrifuge tube was added: UDP- GlcNAc (0.15 ml of 0.1 M stock), UDP-GlcA (0.15 ml of 0.1 M stock), MnCl₂ (0.03 ml of 0.5 M Stock), KfiC lysate (0.25 ml), and KfiA lysate (0.25 ml) to a total volume of 1 ml. A 0.015 ml aliquot of of the reaction mixture was immediately withdrawn (0 hours), the enzymes in the remaining reaction mixture were deactivated by heating at

98°C for 5 minutes, the mixture was then centrifuged at 14,000 rpm for 5 minutes, and the supernatant was collected for liquid chromatography-mass spectrometric (LCMS) analysis ("disclosure materials" figure 4B). The results showed that the oligosaccharides in the reaction mixture are those with 15 or more sugar units. While the oligosaccharides smaller than the tetradecasaccharide remained in the 80%> EtOH solution and was discarded in the EtOH precipitation step.

The glycosylation for the remaining reaction mixture was carried out at room temperature with shaking for 89 hours. The reaction was stopped by heating the reaction mixture in a boiling water bath for 5 minutes to deactivate the enzymes. The heat-deactivated reaction mixture was centrifuged at 6,000 g for 20 minutes. The pellet was discarded and the supernatant was stored at 4°C. An aliquot of 0.05 ml supernatant was taken for analysis. The final product showed a single sharp peak close to the injection peak in LC with a UV detector. However, the molecular weights of the polysaccharides mixture were out of the detectable range of the MS equipped with an electron-spray detector. The reaction mixture was further purified by EtOH precipitation as described above ("disclosure materials" figure 5). MALDI-TOF (Matrix Assisted Laser Desorption Ionization - Time of Flight) MS analysis of the sample indicated that the molecular weights are in the range of 4,000 - 11,000 ("disclosure materials" figure 6). Assay for the backbone - HPLC-Fluorescence

The elongation of the backbone was monitored using the following RP-HPLC conditions. In a first chromatographic condition, a Chromolith

Performance RP-18e (10 cm x 4.6 mm) column with Metachem safeguard (Lake Forest, CA) (2 cm x 2 mm, 5 μm) precolumn was used. The mobile phase was 15% MeOH in 25 mM ammonium acetate buffer (adjusted to pH 5.2 with acetic acid) and the flow rate was 5 ml/minutes. A second chromatographic condition utilized a microbore Supelcosil LC-18-T (Phenomenex, Torrance, CA) (15 cm x 2.1, 3 mm) column with flow rate of 0.2 ml/minutes The mobile phase was 10% MeOH in 25 mM ammonium acetate (pH 5.2). In both cases the columns were maintained at 28°C, and the detection wavelength was set at 316 nm. 4-Methyl umbelliferyl-β-GlcA (MU- GlcA) was used as a standard for quantitation. The extinction coefficient is assumed to be the same for the elongated backbone (MU-polysaccharides) since the 4- methylumbelliferone is the chromophore, and the carbohydrates do not contribute to the absoφtion at 316 nm.

The first chromatographic condition as set forth above is a high- throughput method with short run times (< 2 minutes). It was used for routine analysis of samples. The second chromatographic condition set forth above is the slower method (run time ~ 30 minutes), but the advantage of it is that it can be coupled to mass spectrometry (LC-MS), and it also offers better resolution. The identity of all of the chromatographic peaks was verified by LC-MS. The sample was ionized using electrospray ionization (ESI) in negative mode with spray voltage of 4.5 kV and analyzed by ion trap mass analyzer. The detected mass-to-charge values (m z) were compared to the calculated values. As a result, up to MU-21-mer was detected by this method. Mass spectra were acquired with a Voyager DE PRO time- of-flight instrument (Applied Biosystem, Boston, MA) in the linear mode with delayed extraction, and sinapinic acid was used as a matrix. Purification of oligosaccharides of molecular weight greater than 3,000

Ethanol precipitation was used to purify oligosaccharides of the invention. The starting material was a mixture of oligosaccharides obtained from the second synthetic step in the "random size backbone synthesis" as described above. The proteins in the reaction mixture were removed by incubation of the reaction vial in boiling water for 5 minutes followed by centrifugation. The solution mixture contained 48% of disaccharide-MU, 3% of monosaccharide-MU, and other oligosaccharides with a variety of molecular weights (up to 9 disaccharide repeat units), as well as inorganic ions and UDP.

To obtain a pool of oligosaccharides with a relatively higher molecular weight for the synthesis of longer chains of polysaccharides, the oligosaccharide mixture (3 ml) was precipitated with 12 ml of cold Ethanol (EtOH) (Final percentage of EtOH = 80%)). The resuspended oligosaccharides were kept at -20°C for 30 minutes, and centrifuged at 6,000 g for 20 minutes in a centrifuge (Jouan, Inc, MR 1812). The supernatant was removed and the pellet dissolved in 0.3 ml of distilled water (dH2O) and transferred into a 1.5 ml microcentrifuge tube. The oligosaccharides were precipitated again with 1.2 ml of cold EtOH. The resuspension was kept at -20°C for 30 minutes and centrifuged at 14,000 rpm for 5 minutes in a microfuge. This procedure was repeated once to further purify the oligosaccharide pool. The pellet obtained after the centrifugation was dried in air and then dissolved in 0.17 ml of dH2O. For the synthesis of polysaccharides, the following was added to the microfuge tube: UDP-GlcNAc (0.15 ml of 0.1 M stock), UDP-GlcA (0.15 ml of 0.1 M stock), MnC12 (0.03 ml of 0.5 M Stock), KfiC lysate (0.25 ml), and KfiA lysate

(0.25 ml) to a total volume of 1 ml. An aliquot of 0.015 ml of the reaction mixture was immediately withdrawn ("0 hours" time point) and the enzymes were deactivated by heating at 98°C for 5 minutes The entire mixture was then centrifuged at 14,000 rpm for 5 minutes and the supernatant was sent for LC-MS analysis. The MS results showed that the oligosaccharides in the reaction mixture contained at least 15 sugar units. Oligosaccharides smaller than the tetradecasaccharide remained in the 80%> EtOH solution and were discarded in the EtOH precipitation step. The glycosylation for the rest of reaction mixture was carried out at room temperature with shaking for 89 hours (Figure 3). The reaction was then stopped by heating the reaction mixture in a boiling water bath for 5 minutes to deactivate the enzymes. The heat-deactivated reaction mixture was centrifuged at 6,000 g for 20 minutes. The resulting pellet was discarded and the supernatant was stored at 4°C. An aliquot of 0.05 ml of supernatant was taken for analysis.

Analysis of the final product showed a single sharp peak close to the injection peak in LC with a UV detector. However, the molecular weights of the polysaccharides mixture are out of the detectable range of the MS with an electron- spray detector. The reaction mixture was further purified by the EtOH precipitation as described above. Matrix Assisted Laser Desorption Ionization - Time of Flight

(MALDI-TOF) analysis of the sample indicated that the molecular weights are in the range of 4,000 - 11,000.

The EtOH precipitation method is very efficient for accumulating a pool of oligosaccharides with molecular weights larger than 3,000 for the synthesis of longer polysaccharides. This method may be used in each of the backbone modification steps (NDST, C5-eρimerization, 2-OST, 3-OST and 6-OST) to purify the polysaccharides from other small molecules in the reaction mixture. Isolation and purification of glucuronic acid C-5 epimerase

Glucuronic acid C-5 epimerase (GlcAC5E) purification was conducted based on the method of Campbell et al (1994, J. Biol. Chem., 269, 26953-26958).

Frozen bovine liver was purchased from Pel-Freez Biologicals (Rogers, AR). The liver was kept frozen until its use. The large piece of the liver was removed from the freezer and thawed at 4°C overnight. Pieces were cut from the liver and about 220 g of liver weighed out. The liver pieces were washed extensively with dH2O in a beaker immersed in an iced water bath until most of the blood was removed. The liver parts were then cut into smaller pieces. The work was performed on ice to keep the liver proteins from degrading. The liver pieces were washed once with Buffer A (0.025 M Hepes, pH 7.4, 0.015 M EDTA, 0.01 % Triton X-100) and then placed in a pre-cooled lab blender with an equal volume of Buffer A (with 0.1 % Triton X-100 ) containing 0.1 M KCl, 1 mM PMSF and 3 Complete™ protease cocktail tablets (Roche, Mannheim, Germany). Liver tissues were homogenized for 30 seconds in the blender, and the the crude liver extracts were centrifuged at 10,000 rpm using Sorvall 65A rotor in a Sorvall RC5B centrifuge for 1 hour at 4°C. The supernatants were collected and the pellets were re-suspended in Buffer A containing 0.1 M KCl and homogenized for another 30 seconds followed by centrifugation at 10,000 rpm at 4°C as shown above. Then the supernatants were combined and the pellets were discarded. These supernatants were filtered through a cheese cloth and centrifuged at 17,000 rpm (Sorval SS-34 rotor) for 1 hour at 4°C. The pellets or insoluble material were discarded and the supernatants were centrifuged again at 18,000 rpm for 1 hour at 4°C to obtain a clear lysate. A 1 lx 2.5 cm column was packed with 50 ml Heparin SepharoseTM 6 Fast Flow resin (Amersham-Pharmacia Biotech, Uppsala, Sweden) and equilibrated with Buffer A containing 0.1 M KCl at 4°C (cold room). About 250 ml clear liver lysate was loaded onto the Heparin-Sepharose column and the column was then washed extensively with Buffer A containing 0.1 M KCl. The protein was eluted with Buffer A containing 0.55 M KCl. Five 1 ml fractions were collected and analyzed for their protein content. The fractions containing eluted liver proteins were kept at 4°C until they were tested for the C5-Epimerese activity The purified epimerase was able to convert 20-40% of the GlcA units in the chemically N-deacetylated and N-sulfated K5 polysaccharide to IdoA. One freeze-thaw cycle of the epimerase completely abolished the epimerase activity. Therefore, Heparin Sepharose purified fractions containing C-5 epimerase were kept at 4°C to retain the enzyme's C-5 epimerase activity. Amplification of Glucuronyl C5-Epimerase Gene

PCR (Polymerase Chain Reaction) amplifications were performed in a final volume of 50 μl containing 3 ng of template DNA (mouse liver Quick-clone cDNA; Clontech, Palo Alto, CA), 40 pmol of each primer (see the following for the primers information), 10 nmol of dNTP mixture, and 5 units of Herculase™ Enhanced DNA Polymerase (Stratagene, La Jolla, CA) under the conditions of 31 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 74°C for 90 seconds PCR products were subjected to 1% agarose gel electrophoresis, and DNA fragments were excised, purified by QIAEX II gel extraction kit and directly used for TOPO cloning into pCR-Blunt II-TOPO vector (Invitrogen, Carlsbad, CA). Subclones were characterized by restriction endonuclease mapping.

Primers:

Sense: SEQ ID NO:7 Mouse C5EN41R-5αrøHI

5' CGCGGATCCCGGCACTTGAGTAGTGGATTC 3'

BamHl Coding sequence staring from 41st amino acid Antisense: SEQ ID NO:8 Mouse C5EC618-5gffl 5'-ATCCGGCCGCTAGTTGTGCTTTGCCCTACTGCC 3'

Eαgl Stop

Construction of GlcAC5Ε Expression Plasmid using the pAcGP67B Expression Vector Positive colonies with pCR-Blunt II-TOPO vector were picked up and digested by BamHl and Eαgl restriction enzymes. The smaller fragment encompassing the truncate GlcAC5Ε gene (about 1.7 kb) was excised, purified by QIAEX II gel extraction kit and subcloned into the pAcGP67B vector previously cleaved by the same restriction enzymes and gel purified. The resulting pAcGP67B- GlcAC5E plasmids were transformed into One Shot TOP 10 Electrocomp™ E. coli cells (Invitrogen, Carlsbad, CA), and several selected clones were grown up for use in DNA minipreps and characterization by restriction mapping and DNA sequencing. Protein Expression of the Recombinant GlcAC5E inSf9 Insect Cells

GlcA C5-Epimerase was expressed using a BaculoGold™ baculovirus expression system (Pharmingen, San Diego, CA) according to the instructions of the manufacturer. Sf9 insect cells were cotransfected with the pAcGP67B-GlcAC5E construct along with linearized BaculoGold™ baculovirus DNA (Pharmingen, San Diego, CA). Control transfection was performed with a reverse GlcAC5E construct. Single plaques of each cotransfected recombinant were picked and propagated. Culture media was analyzed for epimerase activity.

Unlike the epimerase purified from bovine liver extract using heparin- sepharose column, the recombinant epimerase can resist at least one freeze-thaw cycle. Preparation of Metabolically Radiolabeled E. coli K5 Polysaccharide

E. coli K5 bacteria (ATCC 23506) were pre-cultured at 37°C overnight in 5 ml of LB medium with rapid shaking (250 rpm). For preparative labeling, a 1 ml aliquot of the preculture was added to 45 ml of LB medium lacking glucose. After incubation for 70 minutes (OD₆₀o _nm~0.25), 2 mCi of D-[5- Hjglucose was added along with unlabeled glucose to a final concentration of 0.01%, followed by an additional 1 mCi D-[5-³H]glucose after 2 hours of further incubation. The culture was then maintained for a 24 hours period and was incubated in a boiling water bath for 5 minutes The culture was then centrifuged at 2500 x g for 20 minutes and the supernatant was concentrated to 5 ml using Apollo 7 centrifugal concentrator (10 kDa

MWCO) (Orbital Biosciences, Topsfield, MA). The K5 polysaccharide was precipitated by 80%> cold EtOH, and the precipitate was collected after centrifugation (3000 rpm x 20 minutes) and dissolved in 0.8 ml of TE buffer (50 mM Tris-HCl, pH 8.8, 0.1 M NaCl, 1 mM EDTA). Chemical Modification of Tritium-labeled K5 Polysaccharide

For N-deacetylation, 5-³H-labeled K5 polysaccharide in TE buffer (0.25 ml) was precipitated by 80%> EtOH, the precipitate was dissolved in 0.3 ml of hydrazine monohydrate and transferred into a 4 ml screw-cap glass vial. To this vial was added 30 mg of hydrazine sulfate and the vial was frozen and sealed after circulating the N₂ gas for 5 minutes The vial was then slowly brought to room temperature and incubated at a 96°C oil bath for 5 hours. The reaction was then cooled and the polysaccharide was precipitated twice in 80% EtOH. The precipitate was dissolved in 2.8 ml of solution and concentrated to 0.7 ml using 10 kDa Apollo 7 centrifugal concentrator. N-sulfation was carried out by treatment with 120 mg of trimethylamine.SO in 0.5 M NaHCO₃ solution at 55°C for 1 hour. An additional 120 mg of trimethylamine.SO₃ was added and the reaction mixture was maintained for 5 hours. The N-deacetylated and N-sulfated K5 polysaccharide was then precipitated with 80% EtOH and dissolved in 0.5 ml of H₂O. Radioactive Assay for GlcAC5E The radioactive assay for epimerase activity of the purified or recombinant GlcAC5E is based on the release of ³H (recovered as ³H₂O) from a substrate polysaccharide of the appropriate structure, H-labeled at C5 of HexA units (Jacobsson et al., 1979a). The assay was carried out at 37°C for 60 minutes in a final volume of 50 μl containing 50 mM Hepes buffer, pH 7.5, EDTA (15 mM), KCl (100 mM), Triton X-100 (0.015%), polysaccharide substrate (N-deacetylated N-sulfated K5 polysaccharide or completely desulfated N-sulfated Heparin, 20 μg), and 70% of enzyme preparation (Heparin-column elute fraction of bovine liver extraction or culture medium of virus infected Sf9 cells). Enzyme was omitted in the reaction mixture made for a blank reading. The reaction was stopped by adding 350 μl of 50% DEAE-Sepharose resin in water suspension to absorb the polysaccharide. The radioactivity of [³H]-labeled H₂O (150 μl supernatant after centrifugation atl4,000 rpm x 2 minutes) was counted in a liquid scintillation counter in a 7 ml plastic vial with CytoScint (6 ml) (ICN Biomedial, Irvine, CA). One unit of enzyme activity is defined as the amount of enzyme that catalyzes the transfer of 1 μmole sulfate from PAPS to acceptor per minute at 37°C. Cold Assay for the Recombinant GlcAC5E

A cold, or "non-radiolabeled" assay for GlcAC5E activity was carried out in a 0.5 microcentrifuge tube at 37°C for overnight in a final volume of 50 μl containing 100 mM KCl, polysaccharide substrate (N-deacetylated N-sulfated K5 polysaccharide or completely desulfated N-sulfated Heparin, 20 μg), and 80% of enzyme preparation (dialyzed Heparin-column elute fraction of bovine liver extraction or culture medium of virus infected Sf9 cells). Enzyme was omitted for a blank reading. A vector construct containing the GlcAC5E DNA in reverse orientation was used as a negative control. Analytical Methods for the Detection of GlcAC5E Acitivty

The analytical method for determining the relative amounts of GlcA and IdoA in the N-deacetylated N-sulfated K5 polysaccharide or completely desulfated N-sulfated Heparin utilized depolymerization with nitrous acid at pH 1.9

(resulting in cleavage of the polysaccharide chains at N-sulfated GlcN units and conversion of the susceptible units to 2,5-anhydro-D-mannose residues) followed by enzymatic hydrolysis with glycosidases to yield free uronic acids which were detected by Ion Exchange high-performance anion-exchange chromatography (HPAEC). The reaction mixtures were heated to 98°C for 5 minutes and centrifuged for 5 minutes at 14,000 rpm to deactivate and precipitate the proteins. The supernatants were dialyzed against 100 ml of water on "V" Series Membranes (0.025 μm, Millipore, Bedford, MA) for 1 hour and then evaporated to dryness. Nitrous acid treatment was used to depolymerize the polysaccharides to disaccharides containing uronic acid (GlcA or IdoA) at the non-reducing end and anhydro-D- mannose at the reducing end (Shively, J. E., Conrad, H. E., Biochemistry, 1976, 15:3932-3942). The pellets, containing 5 - 10 μg polysaccharide, were redissolved in

9 μl dH₂O. The solutions were cooled to 4°C and then 1 μl of freshly made 20 mM NaNO₂ in 200 mM HCl was added, and the mixtures were incubated for 4 hrs at 4°C. The reaction was terminated by raising the pH to 5 by adding 2 μl of 200 mM NaOAc. The disaccharides were further digested to monosaccharides by adding

13 μl of enzyme solution containing 0.2 mU α-Iduronidase, 80 Fishman Units β- Glucuronidase in the buffer provided by the vendor (Glyko, Novato, CA). The reaction mixture (in a final volume of 25 μl) was incubated for 16-24 hrs at 37°C.

The uronic acid monomers were separated by high-performance anion exchange chromatography (HPAEC) with a Dionex CarboPac PA1 column (4 x 250 mm) (Sunnyvale, CA). 200 mM NaOH / 200 mM NaOAc was used as an eluent. The flow rate was 1 ml/minutes, and the detection was done with pulsed amperometric detector (PAD). Peaks were identified and quantitated by comparing their retention times and peak areas with commercially obtained standards GlcA (Sigma, St. Louis, MO) and IdoA (TRC).

CHO Cell Culture and Preparation of the Crude Extract

CHO-K1 cells ATCC CCL-61 were received from ATCC (American Type Culture Collection, Bethesda, MD). Upon arrival of the cells, the cells were cultured for 2 days in 10 ml Dulbecco's modified Eagle's medium (DMEM) with high glucose (Biowhittaker, Walkersville, MD) supplemented with 10% (v/v) fetal bovine serum heat inactivated (Gibco-BRL, Rockville MD), 50 μg/ml Streptomycin (Gibco-BRL), lOμg/ml Gentamycin (Gibco-BRL) 50 units/ml Penicillin (Gibco-BRL) and DMEM lx essential amino acids (Gibco-BRL) in 25-cm² Falcon culture flasks (Becton Dickenson, Franklin Lakes, NJ) in an incubator at 37°C under 95% air and 5% CO₂ with humidity. After 2 days, cells were examined for confluency and they were washed twice with 10 ml of PBS (Phosphate buffer solution) without Ca²⁺ or Mg²⁺ (Biowhittaker). The cells were then allowed to grow for 2 days in 10 ml of the same medium. After 2 days, cells were examined for confluency under the microscope. The cells were washed twice with 10 ml of PBS minus Ca²⁺ and Mg²⁺ and then split using lx liquid 0.25 % trypsin-lmM EDTA (Biowhittaker). The cells were then cultured in the media described above in 175 cm² canted neck Falcon flasks (Becton-Dickenson, Franklin Lakes, NJ) for 2 days. The confluent CHO cells were harvested by washing with 2 x PBS and trypsinized with 1.5 ml of lx trypsin solution. The cells were then removed by addition of 8.5 ml of DMEM to neutralize trypsin. After trypsin treatment, the cells were collected in a sterile tube for cell counting. Then the cells were centrifuged (Jouan MR1812 with Jouan rotor) for 60 seconds at 4000 rpm. The sediments were saved and supernatant was discarded.

Purification of 2-O-sulfotransferase

For purification of HS2OST, CHO cell sediments were suspended in Buffer A (10 mM Tris HCl, pH 7.2, 0.1%( /v) Triton X-100, lOmM MgCl₂, 2mM CaCl₂, 20%) (v/v) glycerol and 0.15 M NaCl) to obtain a concentration of 1 x 10⁹ cells/ml. Extraction of proteins from the CHO cells was carried out by homogenizing cell suspensions in Buffer A supplemented with a tablet of Complete™ protease inhibitors (Roche, Mannheim, Germany) with a glass homogenizer on ice. After gentle vortexing and stirring at 4°C for one hour, the cell lysate was centrifuged at 4°C for 30 minutes at 10,000 x g. The supernatants (crude extract) were pooled, and stored at 4°C until needed.

Purification of Heparan Sulfate 2-O-Sulfotransferase from the CHO Cells

Heparin Sepharose ™ 6 Fast flow resin was purchased from Amersham Pharmacia Biotech (Uppsala, Sweden). The resin was packed in a lx 10 cm column to give a bed volume of 5.2 ml and equilibrated with Buffer A containing 0.15 M NaCl at 4°C. Crude CHO cell extract was prepared (1.6 ml) as described above and was applied to the column. The column was washed with approximately 10 times the bed volume of Buffer A containing 0.15 M NaCl. The proteins were then eluted with Buffer A containing 0.4 M NaCl (Flow rate = 0.25 ml / minutes). One-ml fractions were collected and their protein contents were determined by measuring optical density at OD _{80 nm}- The fractions with high protein content were tested for sulfotransferase activity using a radioactive assay as described below. The sulfotransferase assays were conducted both with and without addition of lOmM DTT (10 mM DTT inhibits 6-O-sulfotransferase activity). The fractions containing high sulfotransferase activity were pooled and concentrated 4-fold using Apollo7™ High- Performance Centrifugal Concentration (Orbital Biosciences, Topsfield, MA). Radioactive Assay for activity of the purified HS2OST

Enzyme activity for different saccharide acceptors was assayed at 37°C for 60 minutes in a final volume of 100 μl of 50 mM of Hepes buffer, pH 7.5, with

MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (2.5 mM), protamine chloride (0.075 mg/ml), [³⁵S]-PAPS (1 nmol, 10 μM, 120,000 cpm), acceptor (50 μg; completely desulfated and N-resulfated Heparin was used for standard activity assay), and 20% of enzyme preparation (E. coli cell lysate or Ni -column purified fraction). Enzyme was omitted for blank determination. The reaction was stopped by adding 200 μg of chondroitin sulfate as a carrier. The [³⁵S]-labeled glycosaminoglycan in the reaction mixture was precipitated by adding 480 μl of cold ethanol and stored at -20°C overnight. The pellet was obtained by centrifugation (14,000 φm for 10 minutes) and resuspended and dissolved in 50 μl of TE buffer (50 mM Tris-HCl, pH 8.8, 0.1 M NaCl, 1 mM EDTA), and 35 μl of the solution was applied to a Quick Spin Sephadex

G-25 Column (Roche, Mannheim, Germany). The column was centrifuged at 1,100 x g for 2 minutes [³⁵S]-PAPS and its decomposed products were completely separated. The flow-through was collected in a 7 ml plastic vial. CytoScint (6 ml) (ICN Biomedical, Irvine, CA) was added and the vial was vortexed completely. The radioactivity incoφorated into the enzyme was counted in a liquid scintillation counter. One unit of enzyme activity is defined as the amount of enzyme that catalyzes the transfer of 1 μmol sulfate from PAPS to acceptor per minute at 37°C. Cold Assay for activity of the Purified HS2OST

A "cold" (non-radiolabeled) assay was carried out in a 0.5 microcentrifuge tube at 37°C overnight in 100 μl 50 mM of Hepes buffer, pH 7.5, with MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (2.5 mM), protamine chloride (0.075 mg/ml), cold PAPS (20 nmol, 200 μM), acceptor (20 μg), (completely desulfated and N-resulfated Heparin or N-deacetylated N-sulfated synthetic polysaccharide backbone-MU), and 48%> of enzyme preparation (dialyzed Heparin-column purified fraction). Enzyme was omitted for blank determination.

Sulfation Analysis for Cold Assays The reaction mixtures were heated to 98°C for 5 minutes and centrifuged for 5 minutes at 14,000 φm to deactivate and precipitate the protein. The supernatants were dialyzed against 100 ml of water on "V" Series Membranes (0.025 μm, Millipore, Bedford, MA) for 1 hours and then evaporated to dryness. The samples were then digested to disaccharides by incubating at 30°C for 2 hours, and then incubated at 37°C overnight in 60 μl solution containing Heparinase I (5 Units), Heparinase II (1 Unit) and Heparitinase I (0.002 Units) in 20 mM Tris-HCl buffer, pH 7.1, containing 50 mM NaCl and 4 mM CaCl₂ After the digestion, the solutions were heated to 98°C for 2 minutes and then centrifuged for 5 minutes at 13,400 φm. The supernatants were removed and evaporated to dryness. The resulting variously sulfated disaccharides were labeled with the fluorescent tag Anthranilamide (2-AB) by adding 5 μl of 2-AB (0.7 M) in 30% HOAc / 70% DMSO and 5 μl of NaBH₄CN (1 M stock) in tetrahydrofuran and incubating at 60°C for 2 hours. The labeled disaccharides were suspended in 1 ml of 95%> ACN, and passed through a filter (MF Support Pad, 13mm, Millipore, Bedford, MA) which was pre-wetted by passing 1ml of water followed by 3 ml of 95% ACN. Then the samples were washed with 3 ml of ACN and eluted with 1 ml of 20% ACN. The solutions were dried, re-dissolved in 100 μl water and analyzed by ion exchange HPLC using fluorescence detection. A linear gradient was employed from 0 to 100%) B (A: 15 mM NaH₂PO₄, B: 800 mM NaH₂PO ) over 30 minutes The flow rate was 1 ml/minutes The exitation and emission wavelengths were 330 nm and 420 nm, respectively. Retention times of different disaccharides were determined by processing commercially obtained disaccharide standards (ΔUA-GlcNAc, ΔUA-GlcNAc6S, ΔUA-GlcNS, ΔUA- GlcNS6S, ΔUA2S-GlcNS, ΔUA2S-GlcNS6S) following the same procedure. Amplification of the 6-O-sulfotransferase (HS6OST-1 DNA

PCR (Polymerase Chain Reaction) amplifications were performed in a final volume of 50 μl containing 3 ng of template DNA (mouse liver Quick-clone cDNA from Clontech, Palo Alto, CA), 40 pmol of each primer (see the following for the primers information), 10 nmol of dNTP mixture, and 5 units of Herculase™ Enhanced DNA Polymerase (Invitrogen, Carlsbad, CA) under the conditions of 36 cycles of denaturation at 95°C for 30 seconds, annealing at 68°C for 30 seconds, and extension at 74°C for 100 seconds PCR products were subjected to 1% agarose gel electrophoresis, and DNA fragments were excised, purified by QIAEX II gel extraction kit and directly used for TOPO cloning into the pCRBlunt vector (Invitrogen, Carlsbad, CA). Subclones were characterized by restriction mapping.

Primers: Sense: SEQ ID NO:9 Mouse HS6OST-1-G29N

5' CGCGGATCCAGATCTATGGGGCTGAGTCTGGGCGCG 3'

BamHl Bglϊl Coding sequence staring from 29th amino acid

Antisense: SEQ ID NO: 10 MouseHS6OST- 1 -W402C 5'-CCGTCTAGAGGTACCCTACCACTTCTCAATGATATG 3' Xbal Kpnl Stop

Construction of HS6OST-1 Expression Plasmid in pBAD/HisB Expression Vector Positive colonies (with pCRBlunt vector) were isolated and digested by BgHl and Kpnl restriction enzymes. The smaller fragments encompassing the HS6OST-1 gene (about 1.2 kb) were excised, purified by QIAEX II gel extraction kit and subcloned into the pB AD/HisB vector previously cleaved by the same restriction enzymes and then gel purified. The resulting pBAD/HisB-HS6OST-l plasmids were transformed into One Shot TOP 10 Electrocomp™ E. coli cells, and several selected clones were grown up for minipreps and characterization by restriction mapping and DNA sequencing. Construction of HS6OST-1 Expression Plasmid in pGEX Expression Vector

Positive colonies with pCRBlunt vector were isolated and digested by Bamlll and Xbal restriction enzymes. The smaller fragments encompassing the HS6OST-1 gene (about 1.2 kb) were excised, purified using a QIAEX II gel extraction kit (Qiagen, Chatsworth, CA) and subcloned into gel purified pGEX vector previously cleaved by the same restriction enzymes. The resulting pGEX-HS6OST-l plasmids were subsequently transformed into E. coli XL 1 -Blue Electroporation-Competent Cells, and BL21 Competent Cells (Stratagene, La Jolla, CA). Several selected clones were grown up for plasmid DNA minipreps and characterization by restriction mapping and DNA sequencing. Protein Expression of the Recombinant HS6OST-1 in E. coli Cells were cultured in 27 ml of LB medium containing 150 μg/ml of ampicillin with rapid shaking (250 φm) at 37°C in an incubator shaker. The cultures were monitored by absorbance at 600 nm using a Beckman DU-600 spectrometer. When the Aβoo_nm of the culture reached 0.8 to 1.0 (about 3 hours.), arabinose was added to a final concentration of 0.2%> to induce the protein expression for pBAD/HisB-HS6OST-l expression plasmid. Isopropyl-1-thio-β-D-galactopyranoside (IPTG) was added to a final concentration of 0.4 mM to induce the expression of HS6OST-1 for pGEX-HS6OST-l expression plasmid. After shaking at 37°C (250 φm) for additional 3 hours, the cells were harvested by centrifugation at 4,000 φ for 20 minutes and resuspended in 0.5 ml of 20 mM Tris-HCl buffer (pH 8.5) containing 1% of Triton X-100. Lysozyme (200 μg) and DNasel (5 μg) were then added. The mixture was shaken at 37°C in an incubator for 40 minutes, and the lysate was collected by centrifugation at 11,000 φm for 20 minutes Purification of Recombinant HS6OST-1 from TOP10(pBAD/HisB-HS6OST-n using Ni²⁺-NTA Agarose

HS6OST-1 was purified at 4°C using a Ni²⁺-NTA affinity column which binds to the N-terminal 6-Histidine containing sequence. The Ni²⁺-NTA column was equilibrated with 3 volumes of 1 X binding buffer (5 mM imidazole, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl) before loading the cell lysate. The column was then washed exclusively with 6 volumes of 1 x binding buffer, followed by 6 volumes of 1 x washing buffer (20 mM imidazole, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl) and 6 volumes of 1 x elution buffer (200 mM imidazole, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl). Fractions containing the purified enzyme were combined and concentrated using an Apollo 7 ml High Performance Centrifugal Concentrator (10 K MWCO). The concentrated fraction was stored at 4°C and dialyzed at 4°C against dialysis buffer (20 mM Tris-HCl, pH 7.5) before use in the reaction. Radioactive Assay for the Recombinant HS6OST-1

Enzyme activity of HS6OST-1 with different acceptors was assayed at 37°C for 60 minutes in 100 μl 50 mM Hepes buffer, pH 7.5, with MnCl₂ (5 mM), MgCl₂ (5 mM), CaC12 (2.5 mM), protamine chloride (0.075 mg/ml), [³⁵S]-PAPS (1 nmol, 10 μM, 120,000 cpm), acceptor (50 μg, completely desulfated and N-resulfated Heparin was used for standard activity assay), and 20%> of enzyme preparation (E. coli cell lysate or Ni²⁺-column purified fraction). Enzyme was omitted for blank determination. The reaction was stopped by adding 200 μg of chondroitin sulfate as a carrier. The [³⁵S]-labeled glycosaminoglycan in the reaction mixture was precipitated by adding 480 μl of cold ethanol and storing at -20°C for overnight. The pellet obtained by centrifugation (14,000 φm X 10 minutes) and resuspended/dissolved in 50 ul of TE buffer (50 mM Tris-HCl, pH 8.8, 0.1 M NaCl, 1 mM EDTA). Thirty-five μl was applied onto a quick Spin Sephadex G-25 Column. The column was centrifuged at 1,100 x g for 2 minutes [ S]-PAPS and the decomposed products were completely separated. The flow-through was collected in a 7 ml plastic vial. CytoScint (6 ml) was added and the vial was vortexed completely. The radioactivity resulting from the enzyme activity was counted in a liquid scintillation counter. One unit of enzyme activity is defined as the amount of enzyme that catalyzes the transfer of 1 μmole sulfate from PAP'S to acceptor per minute at 37°C. Cold Assay for the Recombinant HS6OST-1

A "cold" (non-radiolabeled) assay was carried out in a 0.5 microcentrifuge tube at 37°C overnight in 100 μl 50 mM Hepes buffer, pH 7.5, with

MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (2.5 mM), protamine chloride (0.075 mg/ml), cold PAPS (20 nmol, 200 μM), acceptor (20 μg), (completely desulfated and N- resulfated Heparin or N-deacetylated N-sulfated K5 polysaccharides), and 48%> of enzyme preparation (E. coli cell lysate or dialyzed Ni²⁺-column purified fraction). Enzyme was omitted for blank determination.

Sulfation Analysis for Cold Assays

The reaction mixtures were heated to 98°C for 5 minutes and centrifuged for 5 minutes at 14,000 φm to deactivate and precipitate the protein. The supernatants were dialyzed against 100 ml of water on "V" Series Membranes (0.025 μm, Millipore, Bedford, MA) for 1 hour and then evaporated to dryness. Then the samples were digested to disaccharides by incubating at 30°C for 2 hours, and then at 37°C overnight in 60 μl solution containing Heparinase I (5 Units), Heparinase II (1 Unit) and Heparitinase I (0.002 Units) in 20 mM Tris-HCl buffer, pH 7.1, with 50 mM NaCl and 4 mM CaCl₂. After the digestion, the solutions were heated to 98°C for 2 minutes and centrifuged for 5 minutes at 13,400 φm. The supernatants were removed and evaporated to dryness. The resulting variously sulfated disaccharides were labeled with the fluorescent tag Anthranilamide (2-AB) by adding 5 μl of 2-AB (0.7 M) in 30% HOAcl 70% DMSO and 5 μl of NaBH₄CN (1 M stock) in tetrahydrofuran and incubating at 60°C for 2 hours. The labeled disaccharides were suspended in 1 ml of 95%> acetonitrile (ACN), and passed through a filter (MF Support Pad, 13mm, Millipore, Bedford, MA) which was pre-wetted by passing 1 ml of water followed by 3 ml of 95 %> ACN. Then the samples were washed with 3 ml of

ACN and eluted with 1 ml of 20%> ACN. The solutions were dried, redissolved in 100 μl water and analyzed by ion exchange HPLC with fluorescence detection. A linear gradient was employed from 0% to 100% B buffer (A: 15 mM NaH₂PO₄, B: 800 mM NaH₂PO ) in 30 mm. The flow rate was 1 ml/minutes The excitation and emission wavelengths were 330 nm and 420 nm, respectively. Retention times of different disaccharides were determined by processing commercially obtained disaccharide standards (ΔUA-GlcNAc, ΔUA-GlcNAc6S, ΔUA-GlcNS, ΔUA-GlcNS6S, ΔUA2S- GlcNS, ΔUA2S-GlcNS6S) following the same procedure.

Heparin backbone modification reactions conducted using polysaccharide-MU backbone purified bv EtOH precipitation

Example 1. One pot N-deacetylation, N-sulfation, C5-epimerization, and 6-O- sulfation

Heparin-Sepharose column purified recombinant rat liver Heparan sulfate/Heparin N-deacetylase/N-sulfotransferase (rΝDST) (0.5 ml) was combined with eight-fold concentrated C5-epimerase expression Sf9 media (1 ml). The enzyme mixture was dialyzed against 10 mM HEPES buffer, pH 7.5 for 2 hours at 4°C using Slide- A-Lyzer Dialysis Cassettes with MWCO = 7 kDa (Pierce Chemical Company, Rockford, IL). The dialyzed enzyme mixture (3 ml) was added to a 15 ml centrifuge tube containing polysaccharide-MU solution (0.15 ml, about 1 mg), 50 mM MES, pH

6.5, 100 mM KCl, 15 mM MnCl₂, and 2 mg PAPS in a total volume of 4 ml. The reaction was carried out at room temperature with shaking for 85 hours. The reaction was stopped by incubating the vial in boiling water bath for 5 minutes to deactivate the enzymes. The precipitates were removed by centrifugation. An aliquot of 0.3 ml of the supernatant was precipitated and purified by EtOH and dissolved in H₂O before sending for the sulfation ("disclosure materials" figure 8) and epimerization analysis ("disclosure materials" figure 9). The 6-O-sulfation of the sample prepared as described above was carried out in a 0.5 microcentrifuge tube at 37°C for overnight (14.5 hours) in a final volume of 100 μl containing 50 mM of Hepes buffer, pH 7.5, MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (2.5 mM), protamine chloride (0.075 mg/ml), cold PAPS (0.2 mg), precipitate obtained by EtOH precipitation from 0.3 ml of reaction mixture, and 45%> of dialyzed Ni²⁺-column purified recombinant HS6ST-1 ("disclosure materials" figure 10).

Wild type Sf9 cells produce HS6ST activity in the medium. Therefore, the infected Sf9 medium collected for the C5-epimerase also contained HS6ST activity. In the presence of PAPS in the one-pot synthesis, the HS6ST from Sf9 cells in the medium also reacted on the newly formed N-deacetylated and N-sulfated polysaccharide-MU backbone and reached to a saturation point. The addition of more

PAPS and the recombinant HS6ST-1 did not increase the 6-O-sulfation level significantly. These particular results arise because the percentage of the O-sulfation is strongly related to the percentage of N-sulfation and because the IdoA epimerization product resulting from the C5-epimerization will affect the 6-O- sulfation.

Example 2. N-deacetylation, N-sulfation, C5 -epimerization, and 6-O-sulfation

Preparation of the rΝDST enzyme: For these experiments, fresh batch of rΝDST was prepared as follows: InvScl/pYES2-rΝDST cells were grown in 1 liter CM broth with glucose (minus uracil) at 30°C and induced in CM broth with galactose (minus uracil) (Teknova, Half Moon Bay, CA) at 30°C overnight (23 hrs).

The yeast cells were then harvested and lysates were prepared using a kit from Geno Technology, Inc (Genotech, St. Louis, MO). The clear lysates were immediately loaded onto a Heparin Sepharose CL-6B column (Amersham-Pharmacia, Uppsala, Sweden) which was equilibrated with Buffer A (Buffer A: 10 mM Tris-HCl, pH 7.2, 20 mM MgCl₂, 2 mM CaCl , 10 mM β-mercaptoethanol, 0.1 % Triton X-100, 20 %

Glycerol). The column was washed with the same buffer and eluted with Buffer A containing 0.65 M NaCl and fractions were collected and analyzed for sulfotransferase activity with E. coli K5 polysaccharide. The fractions exhibiting high sulfotransferase activity were pooled and concentrated using Apollo7™ (Topsfield, MA) concentrators. Concentrated rNDST fractions were aliquoted and 1 ml was dialyzed against 50 mM MΕS buffer pH 6.5 for 4-5 hours at 4°C in a Slide-A-Lyzer dialysis cassette with a MWCO of 7 kD (Pierce, Rockford, ILL). N-deacetylation of N-sulfation of polysaccharide-MU backbone: For N-deacetylation /N-sulfation, 4 μl of backbone (~ 5 mg/ml) was incubated with 50 μl of dialyzed rΝDST enzyme in 50 mM MES pH 6.5 buffer containing 10 mM MnCl₂ in total of 200 μl reaction mixture at 37°C overnight. In a similar 200 μl experiment, the reaction mixture was incubated with 10 μl of undialyzed rΝDST. On the following day, 10 μl of undialyzed and 20 μl of dialyzed rΝDST along with 8 μl of 10 mM PAPS were added to the reactions (above) respectively. Incubations were carried out overnight at 37°C. On the following day, samples of each reaction were submitted for HPLC analysis, ("disclosure materials" figure 11) There was 49.7% N-sulfation of polysaccharide-MU backbone with dialyzed rΝDST and ("disclosure materials" figure 12) 39.5% N-sulfation of the heparin backbone with undialyzed rΝDST.

Two rΝDST reaction mixtures (100 μl of each of polysaccharide-MU backbone with 49.7% ΝS and 39.5% ΝS, respectively) were combined (~20 μg) and precipitated with EtOH in a 1.5 ml microcentrifuge tube. The pellet was spin- vacuum dried and to this microcentfigue tube was added 0.1 M KCl, 50 mM Hepes, pH 7.5, 5 mM CaCl₂, 0.1% Triton X-100, and dialyzed C5-Eρimerase in Sf9 medium (75%) in a total of 50 μl solution. The reaction was carried out at 37°C for 48 hours. The polysaccharide was EtOH precipitated and dissolved in 20 μl H O and 4 μl was sent for the analysis ("disclosure materials" figure 13). The 6-O-sulfation of rest of the sample was carried out in a 0.5 microcentrifuge tube in a total volume of 100 μl of Hepes buffer (50 mM), pH 7.5, MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (2.5 mM), protamine chloride (0.075 mg/ml), 0.2 mg of PAPS, and 29% of dialyzed Νi²⁺-column purified recombinant HS6ST-1 ("disclosure materials" figure 14). Example 3. N-deacetylation, N-sulfation, C5 -epimerization, 6-O-sulfation, and 3-O- sulfation

For N-deacetylation and N-sulfation, 5- 200 μl reactions containing 4 μl of MU-backbone (~ 5 mg/ml), 50 mM MES pH 6.5 buffer, and 10 mM MnCl₂ were incubated at 37°C with 20 μl of dialyzed rΝDST enzyme overnight (see example 2 above for rΝDST preparation). On the following day, 20 ml of dialyzed rΝDST, 8 μl of 10 mM PAPS and 1 μl of 0.8 M MnCl₂ were added to the overnight (described above) reactions respectively. Incubations continued for 7-8 hours at 37°C, at which time more enzyme (5 μl rNDST) and more PAPS (2 μl of 10 mM stock) were added. On the following day, samples were used for C-5 epimerization. Fifty microliter aliquots were taken for HPLC analysis, "disclosure materials" figure 15 shows the N- sulfation of heparin backbone. In this particular experiment, 58%> of the heparin backbone was N-sulfated (see "disclosure materials" figure 15)

ΝDST reaction mixture (58% Ν-sulfation, 900 μl total) was combined (~90 μg) and the modified polysaccharide-MU backbone was precipitated with EtOH in a 1.5 ml microcentrifuge tube. The pellet was spin- vacuum dried and to this microcentfigue tube, was added 0.1 M KCl, 50 mM Hepes, pH 7.5, 5 mM CaCl₂, 0.1%) Triton X-100, and dialyzed C5-Epimerase in Sf9 medium (75%) in a total of

200 μl solution. The reaction was carried out at 37°C for 48 hours. The polysaccharide was EtOH precipitated and dissolved in 20 μl of H₂O, and 2 μl was reserved for the analysis ("disclosure materials" figure 16).

The 6-O-sulfation of remaining sample was carried out in a 0.5 microcentrifuge tube in a total volume of 238 μl containing Hepes buffer (42 mM), pH 7.5, MnCl₂ (4.2 mM), MgCl₂ (4.2 mM), CaCl₂ (2.1 mM), protamine chloride (0.063 mg/ml), 0.6 mg of PAPS, and 42 % of dialyzed Νi²⁺-column purified recombinant HS6ST-1 ("disclosure materials" figure 17).

Preparation of the Heparan Sulfate/Heparin 3-O-sulfotransferase: A culture of E. coli TOP10/pBAD.3OST E. coli in 1 liter LB media supplemented with

75ug/ml carbenicillin was grown at 37°C, with shaking (250 φm). The culture was induced at OD₆₀o =1.245 with 0.02 % L-arabinose (final concentration) and incubated overnight at 25°C, with shaking. The cells were centrifuged out of the culture suspension, and the resulting pellets were then resuspended in 3 ml of solution containing of Dulbecco's PBS in dH₂O (1 :3) per gram of pellet. For this particular experiment, 22.5 ml of resuspended cell culture was processed through the French Press. This lysate was used for 3-O-sulfation reactions. The remainder of the lysate was frozen at -20°C.

3-O-sulfotransferase reaction: The French pressed lysates for TOP10/pBAD.3OST were centrifuged at 20K for one minute in the microcentrifuge to clarify them. These were then used to set up reactions under the following conditions: 25 mM MOPS at pH 7, 1% Triton-X, O.lmg/ml BSA, lOmM MnCl₂, 5mM MgCl₂, 50 μg Acceptor (Heparan Sulfate or Completely De-sulfated, N-sulfated Heparin), lOuM ³⁵S-PAPS, and 20%> Lysate. The reactions were set up in duplicate with reactions for each acceptor, Heparan Sulfate and Completely De-sulfated, N- sulfated Heparin. Also, sans substrate and sans enzyme controls (no lysate) were analyzed. All reactions were incubated for one hour at 37°C and the reactions were stopped by precipitation with EtOH and using chondroitin sulfate as the carrier at - 20°C. These reaction mixtures were centrifuged for 10 minutes at 14K φm in a microcentrifuge. The liquid was disposed as radioactive waste and the pellets were resuspended in 50 μl TE Buffer. Thirty five μl aliquots were transferred to G25 Sephadex Spin Columns (Roche) and centrifuged at 1100 x g. As a result of the 3-

OST reaction, the S³⁵-PAPS would remain in the column and the acceptor would flow through with any of the S³⁵ Sulfate that had transferred to it. Thus, the flow through was counted in 6 ml cytoscint fluid in the scintillation counter in a wide-open window and compared to the total counts that were added to the reaction ("disclosure materials" figure 18).

Example 4. The total synthesis of heparin/heparan sulfate - like structure bv

N-deacetylation, N-sulfation, C5-epimerization, 2-O-sulfation. 6-O-sulfation, and 3-

O-sulfation

1) N-deacetylation and N-sulfation of polysaccharide-MU backbone — The first modification step

N-deacetylation of N-sulfation of heparin backbone: For larger scale N-deacetylation /N-sulfation, a total of 80 μl (20 x 4 μl) of backbone was incubated with 400 μl (20 x 20 μl) of dialyzed rNDST enzyme in a 50 mM MES pH 6.5 buffer containing 10 mM MnCl₂ in total of 4 ml reaction mixture (performed in 20 x 200 μl aliquots) at 35°C overnight. On the next day, a 75 μl aliquot was withdrawn from the

N-deacetylation reaction for analysis. To perform N-sulfation on the N-deacetylation reactions above, a total of 160 μl (20 x 8 μl) of 10 mM PAPS along with 400 μl (20 x 20 μl) more dialyzed rΝDST, and 20 μl (20 x 1 μl) 800 mM MnCl₂ was added to the reaction mixture and incubation continued at 35°C overnight. On the next day, the N- sulfation reactions were supplemented with 40 μl of dialyzed rΝDST and 40 μl of 10 mM PAPS to further increase N-sulfation of the backbone. On the following day, all of the aliquots were combined and a 50 μl aliquot was then withdrawn for for N- sulfation analysis. The final PAPS concentration was approximately 450 μM. The remaining material was retained for C5 epimerization treatment. N-deacetylation and N-sulfation of MU-Backbone was achieved upon incubation of the heparin backbone with dialyzed rΝDST. After overnight incubation, HPLC analyis of the enzymatically treated reaction product and disaccharide analysis of the products indicated that 37 %> of the heparin backbone was Ν-deacetylated ("disclosure materials" figure 19a). Additional overnight incubation of the 37 % Ν-deacetylated MU-backbone with rΝDST in the presence of PAPS yielded 55 %> Ν-sulfated heparin backbone, ("disclosure materials" figure 19b) 2) C5 -Epimerization of Ν-deacetylated and Ν-sulfated polysaccharide-MU backbone

— The second modification step

The individual ΝDST reaction mixtures as described above (56% Ν- sulfation, 4 ml total) were combined (~1 mg) and the modified polysaccharide-MU backbone was precipitated with EtOH. The pellet was spin-vacuum dried and resuspended in 0.2 ml of H₂O. A 100 μl aliquot of this solution (~0.5 mg) was added to a 1.5 ml microcentrifuge tube in a total volume of 0.7 ml containing 0.1 M KCl, 50 mM Hepes, pH 7.5, 5 mM CaCl₂, 0.1%> Triton X-100, and dialyzed C5-Epimerase in Sf9 medium (56%>). The epimerization reaction was carried out in a 37°C water bath for 24 hours. 3) 2-O-Sulfation of the epimerized, Ν-deacetylated and Ν-sulfated polysaccharide-

MU backbone — The third modification step

The polysaccharide in 350 μl (- 0.25 mg) of the reaction mixture after epimerization was EtOH precipitated in a 1.5 ml microcentrifuge tube. To this tube was also added Hepes buffer (50 mM), pH 7.5, MnCl₂ (5 mM), MgCl₂ (5 mM), CaCl₂ (5 mM), protamine chloride (0.075 mg/ml), 1.2 mg of PAPS, and 40% of Heparin-

Sepharose column purified HS2OST to a total volume of 500 μl. The reaction was performed at 37°C for 48h.

4) 6-O-Sulfation of the 2-O-sulfated. C5- epimerized, Ν-deacetylated and Ν-sulfated polysaccharide-MU backbone — The fourth modification step The polysaccharide in 300 μl (~ 0.15 mg) of the reaction mixture after

2-O-sulfation was EtOH precipitated in a 1.5 ml microcentrifuge tube. To this tube was also added Hepes buffer (45 mM), pH 7.5, MnCl₂ (4.5 mM), MgCl₂ (4.5 mM), CaCl₂ (4.5 mM), protamine chloride (0.068 mg/ml), 0.8 mg of PAPS, and 48% of dialyzed Ni²⁺-column purified recombinant HS6OST-1 to a total volume of 335 μl. The reaction was performed at 37°C for 86h.

5) 3-O-Sulfation of the 6-O-sulfated. 2-O-sulfated, C5- epimerized, N-deacetylated and N-sulfated polysaccharide-MU backbone — The fifth modification step The polysaccharide in 160 μl (~ 80 μg) of the reaction mixture after 6-

O-sulfation was dialyzed against H₂O using a Dialysis Disc (MF disc MCE hydrophilic 0.025 um 25mm) purchased from Millipore Coφoration (Bedford, MA).

Approximately 20 μl of the above 6-0, 2-0 sulfated, N-sulfated and C- 5 epimerized polysaccharide MU backbone was incubated in 50 mM MOPS (pH 7.0) containing 10 mM MnCl₂, 5 mM MgCl₂, 1 % Triton X-100, 0.1 mg/ml BSA, 100 uM

PAPS (cold PAPS and ³⁵S-PAPS) and 20 μl of 3OST (purified through heparin- sepharose column and concentrated) incubated at 37°C overnight. The reactions were precipitated by addition of chondrotin sulfate and EtOH for 2 hours. The precipitated sugars were recovered and processed through G25 Sephadex columns as described above. The radioactivity was counted to determine sulfotransferase activity.

"disclosure materials" figure 26 shows that the acceptor, 6-O, 2-0 sulfated, N sulfated and C5 epimerized MU backbone polysaccharide can be 3-0 sulfated based on this sulfotransferase assay. Without an acceptor, no significant radioactivity was observed. However, without 3OST, the acceptor showed 1/3 of the radioactive counts of the reaction including both enzyme and acceptor. In the latter case, the radioactivity observed represents approximately 4 pmol of sulfate transfer to the 3 position on GlcΝS(6S) in the 6-O, 2-O, N-sulfated and C-5 epimerized polysaccharide.

Claims

CLAIMSWhat is claimed is:

1. An expression vector comprising the following isolated nucleic acids: a) KfiA; b) KfiB; and c) KfiC.

2. The expression vector of claim 1, wherein the expression vector contains at least one arabinose-regulatable promoter.

3. The expression vector of claim 2, wherein the promoter is the arabinose PBAD promoter.

4. The expression vector of claim 3, wherein the vector is a pBAD expression vector comprising at least one antibiotic resistance marker and at least one affinity tag designed to facilitate purification of one or more expressed proteins.

5. The expression vector of claim 4, wherein expression of the isolated nucleic acid encoding KfiC protein is regulated by one copy of the P_BAD promoter and expression of the isolated nucleic acids encoding KfiA protein and KfiB protein is regulated by a second, separate copy of the PB_AD promoter.

6. The expression vector of claim 5, wherein the isolated nucleic acid encoding KfiA is E. coli KfiA, the isolated nucleic acid encoding KfiB is E. coli KfiB, and the isolated nucleic acid encoding KfiC is E. coli KfiC.

7. A bacterial cell comprising the expression vector of claim 1.

8. A bacterial cell comprising the expression vector of claim 2.

9. A bacterial cell comprising the expression vector of claim 3.

10. A bacterial cell comprising the expression vector of claim4.

11. A bacterial cell comprising the expression vector of claim 5.

12. A bacterial cell comprising the expression vector of claim 6.

13. The bacterial cell of claim 7, wherein the cell is Escherichia coli.

14. The bacterial cell of claim 7, wherein a nucleic acid encoding beta- glucuronidase contained in the genome thereof is knocked-out.

15. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 1.

16. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 2.

17. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 3.

18. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 4.

19. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 5.

20. An isolated Escherichia coli cell wherein: a) a nucleic acid encoding beta-glucuronidase is knocked-out; and b) the cell comprises the expression vector of claim 6.

21. A method of producing KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 1 into an appropriate host cell; and b) expressing KfiA therefrom.

22. A method for producing active KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 2 into an appropriate host cell; and b) expressing KfiA therefrom.

23. A method for producing active KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 3 into an appropriate host cell; and b) expressing KfiA therefrom.

24. A method for producing active KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 4 into an appropriate host cell; and b) expressing KfiA therefrom.

25. A method for producing active KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 5 into an appropriate host cell; and b) expressing KfiA therefrom.

26. A method for producing active KfiA UDP-GlcNAc transferase, the method comprising: a) transforming the expression vector of claim 6 into an appropriate host cell; and b) expressing KfiA therefrom.

27. The method of claim 26, wherein the host cell is Escherichia coli.

28. The method of claim 27, wherein a nucleic acid encoding beta- glucuronidase in the genome of the host cell is knocked-out.

29. The method of claim 28, wherein the expressed proteins are subsequently isolated.

30. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 1 into an appropriate host cell; and b) expressing KfiC therefrom.

31. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 2 into an appropriate host cell; and b) expressing KfiC therefrom.

32. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 3 into an appropriate host cell; and b) expressing KfiC therefrom.

33. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 4 into an appropriate host cell; and b) expressing KfiC therefrom.

34. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 5 into an appropriate host cell; and b) expressing KfiC therefrom.

35. A method for producing active KfiC UDP-GlcA transferase, the method comprising: a) transforming the expression vector of claim 6 into an appropriate host cell; and b) expressing KfiC therefrom.

36. The method of claim 35, wherein the host cell is Escherichia coli.

37. The method of claim 36, wherein a nucleic acid encoding beta- glucuronidase in the genome of the host cell is knocked-out.

38. The method of claim 37, wherein the expressed proteins are subsequently isolated.

39. A method of synthesizing a heparin precursor oligosaccharide in vitro, the method comprising preparing a synthesis starting material comprising methylumbelliferyl-glucuronic acid, wherein an N-acetylglucosamine moiety is combined with the methylumbelliferyl-glucuronic acid in a saccharide linkage.

40. The method of claim 39 wherein a heparin precursor oligosaccharide is synthesized to a defined size by contacting methylumbelliferyl-glucuronic acid starting material with a solution comprising KfiA and UDP-GlcNAc, then contacting the entire resulting mixture with a solution comprising UDP-GlcA and KfiC

41. The method of claim 39 wherein a heparin precursor oligosaccharide is synthesized to a defined size by sequentially and repeatedly contacting MU-GlcA first with a solution comprising KfiA and UDP-GlcNAc, followed by contacting the entire resulting mixture with a solution comprising UDP-GlcA and KfiC.

42. The method of claim 39 wherein a heparin precursor oligosaccharide is synthesized to a random size by contacting a reaction mixture comprising UDP-GlcA and trisaccharide of structure GlcAβl- 4GlcNAcαl->4GlcA-MU with a solution comprising UDP-GlcNAc, KfiA, and KfiC.

43. A method of purifying a synthesized heparin precursor oligosaccharide from an in vitro synthesis reaction mixture for use in a further synthesis reaction, the method comprising ethanol precipitation of the oligosaccharide, whereby the oligosaccharide is isolated from the synthesis reaction mixture.

44. The method of claim 43 wherein a synthetic enzyme is removed from the synthesis reaction mixture by boiling the reaction mixture prior to isolation of the synthesized heparin precursor oligosaccharide using ethanol precipitation.

45. A method of converting GlcA in a heparin precursor oligosaccharide to IdoA in vitro, the method comprising contacting the heparin precursor oligosaccharide with glucuronic acid C-5 epimerase, such that the epimerase catalyzes the conversion of GlcA to IdoA.

46. The method of claim 45, wherein the heparin precursor oligosaccharide is further contacted with a solution comprising a heparan sulfate 2-O- sulfotransferase, such that the heparan sulfate 2-O-sulfotransferase transfers a sulfate group to the C-2 position of an IdoA residue in the heparin backone precursor.

47. A method of sulfating the C-2 position of an IdoA residue in a heparin precursor oligosaccaride in vitro, the method comprising contacting the oligosaccharide with a solution comprising a heparan sulfate 2-O-sulfotransferase, such that the heparan sulfate 2-O-sulfotransferase transfers a sulfate group to the C-2 position of an IdoA residue in the heparin backone precursor.

48. The method of claim 45, wherein the heparin precursor oligosaccharide is further contacted with a solution comprising a heparan sulfate 6-O- sulfotransferase, such that the heparan sulfate 6-O-sulfotransferase transfers a sulfate group to the C-6 position of an IdoA residue in the heparin backone precursor.

49. A method of sulfating the C-6 position of an glucosamine residue in a heparin precursor oligosaccaride in vitro, the method comprising contacting the oligosaccharide with a solution comprising a heparan sulfate 6-O-sulfotransferase, such that the heparan sulfate 6-O-sulfotransferase transfers a sulfate group to the C-6 position of an glucosamine residue in the heparin backone precursor.

50. The method of claim 45, wherein the heparin precursor oligosaccharide is further contacted with a solution comprising a heparan sulfate 3-O- sulfotransferase, such that the heparan sulfate 3-O-sulfotransferase transfers a sulfate to the C-3 position of at least one of the oligosaccharide subunits selected from the group consisting of IdoA and GlcA.

51. A method of sulfating the C-3 position of an IdoA residue in a heparin precursor oligosaccaride in vitro, the method comprising contacting the oligosaccharide with a solution comprising a heparan sulfate 3-O-sulfotransferase, such that the such that the heparan sulfate 3-O-sulfotransferase transfers a sulfate group to the C-3 position of an IdoA residue in the heparin backone precursor.

52. A method of sulfating the C-3 position of an GlcA residue in a heparin precursor oligosaccaride in vitro, the method comprising contacting the oligosaccharide with a solution comprising a heparan sulfate 3-O-sulfotransferase, such that the such that the heparan sulfate 3-O-sulfotransferase fransfers a sulfate group to the C-3 position of a GlcA residue in the heparin backone precursor.

53. A method of synthesizing heparin in vitro, the method comprising: a) synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC; b) deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase/N-sulfotransferase; c) epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase; and d) O-sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfotransferase, 3-O- sulfotransferase, and 6-O-sulfotransferase; thereby synthesizing heparin.

54. A method of synthesizing heparin-like glycosaminoglycan in vitro, the method comprising: a) synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC; b) deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase/N-sulfofransferase; c) epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase; and d) O-sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfotransferase, 3-O- sulfotransferase, and 6-O-sulfotransferase; thereby synthesizing a heparin-like glycosaminoglycan.

55. A method of synthesizing heparin-like glycosaminoglycan in vitro, the method comprising: a) synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC; b) deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase/N-sulfofransferase; and c) O-sulfating sugar residues in the heparin precursor with at least one of the sulfotransferases selected from the group consisting of 2-O-sulfofransferase, 3-O- sulfofransferase, and 6-O-sulfotransferase; thereby synthesizing a heparin-like glycosaminoglycan.

56. A method of synthesizing heparin-like glycosaminoglycan in vitro, the method comprising: a) synthesizing a heparin precursor oligosaccharide using E. coli K5 proteins KfiA, KfiB, and KfiC; b) deacetylating and sulfating GlcNAc residues of the heparin precursor oligosaccharide with heparin/heparan sulfate N-deacetylase/N-sulfofransferase; and c) epimerizing at least one GlcA residue in the heparin precursor oligosaccharide to IdoA using glucuronic acid C-5 epimerase; thereby synthesizing a heparin-like glycosaminoglycan.