WO2004006962A2 - Compose de liaison au facteur tissulaire - Google Patents

Compose de liaison au facteur tissulaire Download PDF

Info

Publication number
WO2004006962A2
WO2004006962A2 PCT/DK2003/000481 DK0300481W WO2004006962A2 WO 2004006962 A2 WO2004006962 A2 WO 2004006962A2 DK 0300481 W DK0300481 W DK 0300481W WO 2004006962 A2 WO2004006962 A2 WO 2004006962A2
Authority
WO
WIPO (PCT)
Prior art keywords
phe
chloromethyl ketone
arg chloromethyl
compound
fviia
Prior art date
Application number
PCT/DK2003/000481
Other languages
English (en)
Other versions
WO2004006962A3 (fr
Inventor
Søren E. BJØRN
Else Marie Nicolaisen
Thomas D. Steenstrup
Original Assignee
Novo Nordisk A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk A/S filed Critical Novo Nordisk A/S
Priority to EP03763617A priority Critical patent/EP1523504A2/fr
Priority to AU2003242507A priority patent/AU2003242507A1/en
Publication of WO2004006962A2 publication Critical patent/WO2004006962A2/fr
Publication of WO2004006962A3 publication Critical patent/WO2004006962A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C12N9/6437—Coagulation factor VIIa (3.4.21.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6815—Enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08—Tripeptides
    • C07K5/0802—Tripeptides with the first amino acid being neutral
    • C07K5/0812—Tripeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08—Tripeptides
    • C07K5/0815—Tripeptides with the first amino acid being basic
    • C07K5/0817—Tripeptides with the first amino acid being basic the first amino acid being Arg
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08—Tripeptides
    • C07K5/0819—Tripeptides with the first amino acid being acidic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21021—Coagulation factor VIIa (3.4.21.21)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • the present invention relates to novel compounds which bind to, inhibit the activity of tissue factor (TF) and mediates a cytolytic immune response.
  • the invention also relates to pharmaceutical compositions comprising the novel compounds as well as their use in the treatment of or prophylaxis of diseases or disorders related to pathophysiological TF activity including cancer, inflammation, atherosclerosis and ischemia/reperfusion.
  • Tissue Factor is a cellular transmembrane receptor for plasma coagulation factor
  • TF/Vlla complexes Normally, TF is constitutively expressed on the surface of many extravascular cell types that are not in contact with the blood, such as fibroblasts, pericytes, smooth muscle cells and epithelial cells, but not on the surface of cells that come in contact with blood, such as endothelial cells and monocytes.
  • TF is also expressed in various pathophysiological conditions where it is believed to be involved in progression of disease states within cancer, inflammation, atherosclerosis and ischemia/reperfusion. Thus TF is now recognised as a target for therapeutic intervention in conditions associated with increased expression.
  • FVIIa is a two-chain, 50 kilodalton (kDa) vitamin-K dependent, plasma serine protease which participates in the complex regulation of in vivo haemostasis.
  • FVIIa is generated from proteolysis of a single peptide bond from its single chain zymogen, Factor VII (FVII), which is present at approximately 0.5 ⁇ g/ml in plasma.
  • the zymogen is catalyticaliy inactive. The conversion of zymogen FVII into the activated two-chain molecule occurs by cleavage of an internal peptide bond.
  • FVIIa binds with high affinity to exposed TF, which acts as a cofactor for FVIIa, enhancing the proteolytic activation of its substrates FVII, Factor IX and FX.
  • TF was recently shown to function as a mediator of intracellular activities either by interactions of the cytoplasmic domain of TF with the cytoskeleton or by supporting the Vila-protease dependent signaling. Such activities may be responsible, at least partly, for the implicated role of TF in tumor development, metastasis and angiogenesis.
  • Cellular exposure of TF activity is advantageous in a crisis of vascular damage but may be fatal when exposure is sustained as it is in these various diseased states.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • IgG immunoglobulin G
  • Another component of the immune system is the activation of the complement system (Byrn, R. A, et al., Nature 344, 667-670, 1990).
  • the two pathways of complement activation are both directed at a central step in complement activation, the cleavage of C3.
  • a single terminal pathway is the formation of a membrane attack complex (MAC).
  • the classical pathway is normally activated by antigen- antibody complexes, where certain antibodies are complement fixing (capable of binding to complement to cause activation of the classical pathway).
  • Activation of the classical pathway can be initiated with binding of C1q, the first factor of complement cascade, to the Fc region of immunoglobulin.
  • C5 convertase which cleaves CS into C5b and C5a.
  • the C5b then binds C6, C7, C8 to form a C5b-8 complex.
  • Binding of C9 molecules to C5b-8 forms C5b-9 (the MAC), which inserts into lipid bilayers and forms transmembrane channels that permit bidirectional flow of ions and macromolecules. By this mechanism, complement causes lysis of the cells.
  • FVIIai Inactivated FVII is FVIIa modified in such a way that it is catalyticaliy inactive. FVIIai is thus not able to catalyze the conversion of FX to FXa, but still able to bind to TF in competition with active endogenous FVIIa and thereby inhibit the TF activity.
  • Hu Z and Garen A (2001) Proc. Natl. Acad. Sci. USA 98; 12180-12185, Hu Z and Garen A (2000) Proc. Natl. Acad. Sci. USA 97; 9221-9225, Hu Z and Garen A (1999) Proc. Natl. Acad. Sci. USA 96; 8161-8166, and International patent application WO 0102439 relates to immunoconjugates which comprises the Fc region of a human lgG1 immunoglobulin and a mutant FVII polypeptide, that binds to TF but do not initiate blood clotting.
  • the present invention provides compounds that act specifically on pathophysiological TF activity and at the same time elicits a cytolytic immune response in a patient.
  • the present invention relates to a immunoconjugates of native humane FVIIa or procoagulant variants thereof.
  • One aspect relates to immunoconjugates, wherein native humane FVIIa or procoagulant variants thereof have been chemically inactivated.
  • the inactiva- tion of the FVIIa proteolytic activity may be obtained in vitro by covalent active site inhibitors e.g. chloromethyl ketones.
  • the conjugate has very high affinity for TF due to the increased affinity of the chemically inactivated binding domain as compared to the binding of native FVII. The high affinity will provide a more efficacious and safe treatment of a patient in need thereof.
  • the conjugate may also have a higher affinity for TF due an avidity effect in dimers, trimers or other multimers with multible TF binding sites.
  • the present invention relates to a compound having the formula A- (LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; C comprises an immunostimulatory effector domain; and wherein the compound binds to TF.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an amount of a compound having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; C comprises an immunostimulatory effector domain; and wherein the compound binds to TF; and a pharmaceutically acceptable carrier or excipient.
  • the present invention relates to a compound for use as a medicament having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; C comprises an immunostimulatory effector domain; and wherein the compound binds to TF.
  • the present invention relates to the use of a compound having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; C comprises an immunostimulatory effector domain; and wherein the compound binds to TF; for the manufacture of a medicament for preventing or treating disease or disorder associ- ated with pathophysiological TF activity.
  • the present invention relates to a polynucleotide construct encoding a Factor VII polypeptide conjugated to (LM)-C, wherein LM is an optional linker moiety and C comprises an immunostimulatory effector domain.
  • the polynucleotide construct is a vector.
  • the polynucleotide construct encodes a polypeptide comprising the sequence independently selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:11.
  • the polynucleotide construct encodes a polypeptide which has the sequence of SEQ ID NO:6.
  • the polynucleotide construct encodes a polypeptide which has the sequence of SEQ ID NO:11. In one embodiment the polynucleotide construct comprises the sequence independently selected from the group consisting of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO: 13. In one embodiment the polynucleotide construct encodes a polypeptide which has the sequence of SEQ ID NO:9. In one embodiment the polynucleotide construct encodes a polypeptide which has the sequence of SEQ ID NO:12. In one embodiment the polynucleotide construct encodes a polypeptide which has the se- quence of SEQ ID NO: 10. In one embodiment the polynucleotide construct encodes a polypeptide which has the sequence of SEQ ID NO:13.
  • the present invention relates to a host cell comprising the polynucleotide construct encoding a Factor VII polypeptide conjugated to (LM)-C, wherein LM is an optional linker moiety and C comprises an immunostimulatory effector domain.
  • the host cell is a eukaryotic cell.
  • the host cell is of mammalian origin.
  • the host cell is selected from the group consisting of CHO cells, HEK cells, and BHK cells.
  • the host cell is a hybridoma cell.
  • the host cell is an isolated lymphoid cell.
  • the cell is isolated from a mouse.
  • the hybridoma cell is ob- tained by fusion of an antibody-producing lymphoid cell with an immortal cell to provide an antibody-producing hybridoma cell.
  • the present invention relates a method for preventing or treating disease or disorder associated with pathophysiological TF activity, the method comprising contacting a TF expressing cell with a compound having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; C comprises an immunostimulatory effector domain; and wherein the compound binds to TF.
  • A is a FVIIa polypeptide
  • LM is an optional linker moiety
  • C comprises an immunostimulatory effector domain
  • the compound binds to TF.
  • the present invention relates to conjugates of FVIIa polypeptides and an effector domain that act to elicit a cytolytic immune response.
  • the FVIIa polypeptides are chemically inactivated factor FVIIa polypeptides.
  • An inactivated conjugate binds TF with high affinity and specificity but do not initiate blood coagulation.
  • the present invention relates to chemically inactivated immunoconjugates of factor FVIIa and the Fc region of a human immunoglobulin including the hinge region. The inactivated immunoconjugates bind TF with high affinity and specificity but do not initiate blood coagulation.
  • TF antagonists have been developed and marketed for therapeutic use in humans.
  • Known therapeutic strategies includes monoclonal antibodies; catalyticaliy impaired FVIIa mutants and chemical inactivated FVIIa.
  • Native FVIIa binds TF with high affinity and most mutants with amino acid substitutions and monoclonal antibodies is expected to bind with equal or less affinity. The low binding affinity for TF may limit their effective use in the clinic.
  • Chemical inactivated FVIIa has been reported to have a modest increase in the affinity for TF as compared to native FVI la.
  • the reported inactive mutants of FVIIa and also the chemically inactivated FVIIa is expected to have short half lives comparable to that of circulating native FVII, i.e. 2-3 hours, which may limit the effective use in the clinic.
  • the present invention further relates to FVIIa polypeptides or active site inhibited de- rivatives thereof which are complexed or chemically coupled to a non-inhibitory anti-FVII antibody, i.e. an antibody, which do not block the FVII/TF complex formation.
  • a non-inhibitory anti-FVII antibody i.e. an antibody, which do not block the FVII/TF complex formation.
  • the antibody is an IgG sub-class antibody and fragments thereof.
  • the antibody may subsequently be chemically coupled to FVII to form a stable, irreversible covalent complex.
  • the invention includes the following derivatives: 1) The Fc domain of an antibody covalent coupled to FVIIa via an active site inhibitor.
  • the FFR-cmk moiety may be chemically coupled to a Fc-domain generated either genetically or by proteolytic digest of select antibody.
  • FVII lightchain (Gla to EGF1 or EGF2) chemically coupled to an antibody or Fc domain to form a complex with one or two FVII light chain molecules and potentially elicit an immune response.
  • FVII does represent the preferred embodiment for 1, 2 and 3, this does not exclude the use of FVII (des-Gla) or any other TF-binding FVII derived protein including truncated forms, analogs, derivatives and fusion proteins.
  • the different affinity of such molecules for TF may provide a method for reducing the potentially undesirable effect of said compound on general haemostasis.
  • FVII analogs or chemical inactivated FVII we propose to use mutated or active site inhibited FVII or FVII analogs in complex with, or chemically coupled to, an anti-FVII antibody or Fc-domain of any IgG sub-type depending on the desired immune response to the complex.
  • This strategy will allow for simple preparation of FVII:anti-FVII or FVII:Fc fusions which otherwise are complicated to produce as genetically engineered constructs due to the large complexity and requirement for post- translational processing.
  • this strategy takes advantage of the fact that the FVII TF complex is extremely tight (with binding affinity in the pM range) and the potential increase in binding affinity upon phosphatidylserine exposure.
  • Non-limiting examples of Factor VII polypeptides which may be used in the present invention having substantially reduced or modified biological activity relative to wild-type Factor VII include R152E-FVIIa (Wildgoose et al., Biochem 29:3413-3420, 1990), S344A-FVIIa (Kazama et al., J. Biol. Chem. 270:66-72, 1995), FFR-FVIIa (Hoist et al., Eur. J. Vase. Endo- vasc. Surg. 15:515-520, 1998), and Factor Vila lacking the Gla domain, (Nicolaisen et al., FEBS Letts. 317:245-249, 1993).
  • the compound having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; and C comprises an immunostimulatory effector domain refers to compounds, wherein A, (LM), and C are chemically bound in the same entity.
  • the chemical bonds may be covalent bonds, intermolecular hydrogen bonds , salt-bridge bonds or other electrostatic interactions.
  • A, (LM), and C in the compound having the formula A-(LM)-C, wherein A is a FVIIa polypeptide; LM is an optional linker moiety; and C comprises an immunostimulatory effector domain, is bound together by covalent bonds.
  • hybridoma cell refers to cells produced by fusion of different cell types. Immunoglobulin molecules are normally synthesized by lymphoid cells derived from B lymphocytes of bone marrow. Lymphocytes can not be directly cultured over long pe- riods of time to produce substantial amounts of their specific antibody. However, Kohler et al., 1975, Nature, 256:495, demonstrated that a process of somatic cell fusion, specifically between a lymphocyte and a myeloma cell, could yield hybridoma cells which grow in culture and produce a specific antibody called a "monoclonal antibody". Myeloma cells are lymphocyte tumor cells which, depending upon the cell strain, frequently produce an antibody them- selves, although "non-producing" strains are known.
  • the compound having the formula A-(LM)-C inhibits TF-mediated FVIIa activity.
  • a in the compound having the formula A-(LM)- C is a FVIIa polypeptide, which is catalyticaliy inactivated in the active site.
  • the compound having the formula A-(LM)-C inhibits TF-mediated coagulation activity.
  • the compound having the formula A-(LM)-C inhibits TF-mediated signaling activity.
  • the compound having the formula A-(LM)-C in- hibits TF-mediated MAPK signaling.
  • the compound having the formula A-(LM)-C inhibits the FVIIa-induced activation of the MAPK signaling.
  • LM is present in the compound having the formula A-(LM)-C. In one embodiment of the invention, LM is absent in the compound having the formula A-(LM)-C. In one embodiment of the invention, C is an immunostimulatory effector domain.
  • the disease or disorder associated with pathophysiological TF activity are deep venous thrombosis, arterial thrombosis, post surgical thrombosis, coronary artery bypass graft (CABG), percutaneous transdermal coronary an- gioplastry (PTCA), stroke, cancer, tumor metastasis, angiogenesis, ischemia/reperfusion, rheumatoid arthritis, thrombolysis, arteriosclerosis and restenosis following angioplastry, acute and chronic indications such as inflammation, septic chock, septicemia, hypotension, adult respiratory distress syndrome (ARDS), disseminated intravascular coagulopathy (DIC), pulmonary embolism, platelet deposition, myocardial infarction, or the prophylactic treatment of mammals with atherosclerotic vessels at risk for thrombosis.
  • FVIIa polypeptide or "FVIIa polypeptides" as used herein means native
  • Factor Vila as well as proteolytic functional equivalents of Factor Vila that contain one or more amino acid sequence alterations relative to native Factor Vila (i.e., Factor VII variants), and/or contain truncated amino acid sequences relative to native Factor Vila (i.e., Factor Vila fragments).
  • Such equivalents may exhibit different properties relative to native Factor Vila, including stability, phospholipid binding, altered specific proteolytic activity, and the like.
  • Fractor VII equivalent encompasses, without limitation, equivalents , of Factor Vila exhibiting substantially the same or improved procoagulant activity relative to wild-type human Factor Vila.
  • Factor VII or “FVII” are intended to mean Factor VII polypeptides in their uncleaved (zymogen) form.
  • Fractor Vila or “FVIIa” are intended to mean native bioactive forms of FVII. Typically, FVII is cleaved between residues 152 and 153 to yield FVIIa.
  • the term “Factor Vila” is also intended to encompass, without limitation, polypeptides having the amino acid sequence 1-406 of wild-type human Factor Vila (SEQ ID NO:1, as disclosed in U.S. Pat- ent No. 4,784,950), as well as wild-type Factor Vila derived from other species, such as, e.g., bovine, porcine, canine, murine, and salmon Factor Vila. It further encompasses natural alle- lic variations of Factor Vila that may exist and occur from one individual to another.
  • variants or variants, as used herein, is intended to designate human Factor VII having the sequence of SEQ ID NO: 1, wherein one or more amino acids of the parent protein have been substituted by another amino acid and/or wherein one or more amino acids of the parent protein have been deleted and/or wherein one or more amino acids have been inserted in protein and/or wherein one or more amino acids have been added to the parent pro- tein. Such addition can take place either at the N-terminal end or at the C-terminal end of the parent protein or both.
  • the variant has a total amont of amino acid substitutions and/or additions and/or deletions independently selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
  • active site and the like when used herein with reference to FVIIa refer to the catalytic and zymogen substrate binding site, including the "Si" site of FVIIa as that term is defined by Schecter, I. and Berger, A., (1967) Biochem. Biophys. Res. Commun. 7:157- 162.
  • TF-mediated FVIIa activity means any TF-dependent activity.
  • the term is intended to include both a TF-mediated coagulation activity and a signaling activity mediated by TF, e.g. MAPK signaling.
  • the TF-mediated FVIIa activity is MAPK signaling.
  • TF-mediated MAPK signaling is intended to mean a cascade of intracellular events that mediate activation of Mitogen-Activated-Protein-Kinase (MAPK) or homo- logues thereof in response to the binding of a FVII polypeptide to TF.
  • MAPK Mitogen-Activated-Protein-Kinase
  • Three distinct groups of MAP kinases have been identified in mammalian cells: 1) extracellular-regulated kinase (Erk1/2 or p44/42), 2) c-Jun N-terminal kinase (JNK) and 3) p38 kinase.
  • the Erk1/2 pathway involves phosphorylation of Erk 1 (p 44) and/or Erk 2 (p 42).
  • Activated MAP kinases e.g.
  • MAPK can translocate to the nucleus where they can phosphorylate and activate transcription factors including (Elk 1) and signal transducers and activators of transcription (Stat). Erk1/2 can also phosphorylate the kinase p90RSK in the cytoplasm or in the nucleus, and p90RSK then can activate sev-eral transcription factors. MAPK signaling may be measured, as described in assay 6.
  • protein kinase is intended to indicate an enzyme that is capable of phosphorylating serine and/or threonine and/or tyrosine in peptides and/or proteins.
  • FVIIa-induced activation of the MAPK signaling is intended to indicate that
  • FVIIa binds to TF in a mammalian cell and thereby induce MAPK signaling.
  • TF-mediated coagulation activity means coagulation initiated by TF through the formation of the TF/FVIIa complex and its activation of FIX and Factor X to FIXa and FXa, respectively.
  • TF-mediated coagulation activity is measured in a FXa generation as- say.
  • FXa generation assay as used herein is intended to mean any assay where activation of FX is measured in a sample comprising TF, FVIIa, FX, calcium and phospholip- ids. An example of a FXa generation assay is described in assay 1.
  • a FVIIa inhibitor may be identified as a substance, which reduces the amidolytic activity by at least 50% at a concentration of the substance at 400 ⁇ M in the FVIIa amidolytic assay described by Persson et al. (Persson et al., J. Biol. Chem. 272: 19919-19924 (1997)).
  • immunological effector domain means a domain that is capable of stimulating an immune response in a mammal.
  • Polypeptides appropriate for use as immunostimulatory effector domains include without limitation; opsonins such as IgG and C3b; proteins with carbohydrate residues that interact with the mannose-fucose receptor of phagocytes; proteins capable of recognition by receptors on scavenger macrophages; ligands for integrins; located on phagocytes; glycoproteins, such as integrins and selectins; and fucosyl transferase, which generates a Gal-Gal epitope recognized by macrophages.
  • the polypeptides of immunostimulatory effector domain can be used in either a full- length or a truncated form, as appropriate.
  • region and domain as used to describe an immunostimulatory effector domain polypeptide includes either a full- length immunostimulatory effector domain polypeptide or a part of the immunostimulatory effector domain polypeptide, such as the IgG regions and domains described below.
  • Immunoglobulin G is the preferred immunostimulatory effector domain polypep- " tide for use in this invention.
  • An IgG protein contains (1) an Fab region (including the VH, VL and CH.sub.1 domains); (2) a hinge region, and (3) an Fc region (including the CH2 and CH3 domains).
  • the Fab region is the region of an antibody protein which includes the antigen- binding portions.
  • the "hinge” region is a flexible area on the immunoglobulin polypeptide that contains many residues of the amino acid proline and is where the Fc fragment joins one of the two Fab fragments.
  • the Fc region which is the constant region on an immunoglobulin polypeptide, is located on the immunoglobulin heavy chains and is not involved in binding antigens.
  • the Fc region can bind to an Fc receptor on phagocytes.
  • Fc receptors such as Fc RI, are integral membrane proteins located on phagocytic white blood cells, such as macrophages.
  • the hinge region is important for regulating Fc-Fc receptor interactions, providing flexibility to the polypeptide and functioning as a spacer.
  • the immunoglobulin polynucleotide used for producing a recombinant polypeptide immunostimulatory effector domain can be from any vertebrate, such as human or mouse.
  • the polynucleotide encodes an immunoglobulin having a substantial number of sequences that are of the same origin as the host.
  • the immunoglobulin is of human origin.
  • the immunoglobulin polynucleotide may code for a full length polypeptide or a fragment, such as a fragment of a larger fusion protein, which includes an immunostimulatory polypeptide effector domain.
  • an immunoglobulin fusion protein Some advantages include one or more of (1) possible increased avidity for multivalent ligands, (2) longer serum half-life, (3) the ability to activate effector cells by the Fc domain, and (4) ease of purification (for example, by pro- tein A chromatography).
  • Example 1 shows the construction of an immunoglobulin fusion protein according to the invention.
  • lgG1 Fc is expressed on the cell surface in a "reverse orientation".
  • the Fc is in a reverse orientation (i.e. with the N-terminus projecting toward the FVIIa polypeptide and the C-terminus projecting away from the FVIIa polypeptide).
  • Immunostimulatory Fc domains expressed in the reverse orientation retains the biological function of lgG1 Fc of binding Fc receptor to mediate macrophage activation, while simultaneously losing the complement fixation capability.
  • Polypeptides immunostimulatory effector domain and their receptors are important for the clearance and destruction of foreign materials, including mammalian cells or bacteria.
  • Immunostimulatory cell surface polypeptides and their receptors activate the phagocytosis and ADCC.
  • the process begins with opsonization of the foreign materials.
  • An opsonin is an agent, usually an antibody or complement components, that makes a cell or microbe more vulnerable to being engulfed by a phagocyte; opsonization is the process of coating a cell with opsonin.
  • a phagocyte is a cell that engulfs and devours another; the process of engulfing and devouring is phagocytosis.
  • the important phagocytes are macrophages and monocytes.
  • Monocytes are a type of large white blood cell that travels in the blood but which can leave the bloodstream and enter tissue to differentiate into macrophages. Macrophages digest debris and foreign cells. Monocytes are generally characterized by the cell surface ex- pression of CD14.
  • FVIIa polypeptides conjugated with immu- noglobulins binds phagocytes through the Fc receptors on the phagocytes.
  • Phagocytes respond to signals from the Fc receptors by assembling cytoskeletal proteins, signaling cy- toskeletal-protein assembly by activation of protein tyrosine kinases, and by phagocytosing the cell coated with immunoglobulin.
  • IgG-Fc RI interaction activates various biological functions such as phagocytosis, endocytosis, ADCC, release of inflammatory mediators and su- peroxide anion production.
  • Macrophages possess organic anion transporter proteins that promote the afflux of anionic substances from the macrophage.
  • Fc RI mediates ADCC by macrophages and triggers both phagocytosis and superoxide production.
  • the compounds and methods of the invention where the Fc domain of IgG is expressed on the FVIIa polypeptides to interact with phagocyte Fc receptor cause phagocytes to bind to the cell expressing TF, inducing ADCC.
  • the lgG1 and lgG3 isotypes, that interact with the high affinity receptor Fc RI on macrophages, are preferred for the compounds and methods of the invention.
  • CMC activity complement-mediated cytotoxic activity
  • ADCC activity antibody-dependent cell-mediated cytotoxicity
  • the biological activity of antibodies is known to be determined, to a large extent, by the Fc region of the antibody molecule (Uananue and Benacerraf, Textbook of Immunology, 2nd Edition, Williams & Wilkins, p. 218 (1984)). This includes their ability to activate complement and to mediate ADCC as effected by leukocytes.
  • Antibodies of different classes and subclasses differ in this respect, and, according to the present invention, antibodies of those classes having the desired biological activity are selected.
  • mouse immunoglobulins of the lgG3 and lgG2a class are capable of activating serum com- plement upon binding to the target cells.
  • antibodies of the IgGI, lgG2a and lgG3 subclass can mediate ADCC, and antibodies of the lgG3, and lgG2a and IgM subclasses bind and activate serum complement.
  • Complement activation generally requires the binding of at least two IgG molecules in close proximity on the target cell. However, the binding of only one IgM molecule activates serum complement.
  • any particular FVIIa polypeptide effector domain conjugate to mediate lysis of the tumor cell target by complement activation and/or ADCC can be assayed.
  • the tumor cells of interest are grown and labeled in vivo; the FVIIa polypeptide effector domain conjugate is added to the tumor cell culture in combination with either serum complement or immune cells which may be activated by the antigen antibody complexes. Cytolysis of the target tumor cells is detected by the release of label from the lysed cells.
  • FVIIa polypeptide effector domain conjugates can be screened using the patient's own serum as a source of complement and/or immune cells. The FVIIa polypeptide effector domain conjugate that is capable of activating complement or mediating ADCC in the in vitro test can then be used therapeutically in that particular patient.
  • C in the compound having the formula A-(LM)- C comprises a molecule selected from the group consisting of mannose binding protein (MBP); proteins with carbohydrate residues that interact with the mannose-fucose receptor of phagocytes; opsonins such as IgG and C3b; proteins capable of recognition by receptors on scavenger macrophages; ligands for integrins normally located on phagocytes; glycopro- teins, such as integrins and selectins; fucosyl transferase, which generates a Gal-Gal epitope recognized by macrophages.
  • MBP mannose binding protein
  • proteins with carbohydrate residues that interact with the mannose-fucose receptor of phagocytes opsonins such as IgG and C3b
  • proteins capable of recognition by receptors on scavenger macrophages ligands for integrins normally located on phagocytes
  • glycopro- teins such as integrin
  • C in the compound having the formula A-(LM)- C is a molecule selected from the group consisting of mannose binding protein (MBP); pro- teins with carbohydrate residues that interact with the mannose-fucose receptor of phagocytes; opsonins such as IgG and C3b; proteins capable of recognition by receptors on scav- enger macrophages; ligands for integrins normally located on phagocytes; glycoproteins, such as integrins and selectins; fucosyl transferase, which generates a Gal-Gal epitope recognized by macrophages.
  • MBP mannose binding protein
  • pro- teins with carbohydrate residues that interact with the mannose-fucose receptor of phagocytes opsonins such as IgG and C3b
  • proteins capable of recognition by receptors on scav- enger macrophages ligands for integrins normally located on phagocytes
  • C in the compound having the formula A-(LM)- C comprises an immunoglobulin molecule or fragment thereof.
  • C in the compound having the formula A-(LM)- C comprises an immunoglobulin molecule.
  • C in the compound having the formula A-(LM)- C comprises an Fc domain or fragment thereof of an immunoglobulin molecule. In one embodiment of the invention, C in the compound having the formula A-(LM)-
  • C is an Fc domain or fragment thereof of an immunoglobulin molecule.
  • the immunoglobulin molecule is selected from the group consisting of lgG1, lgG2, lgG3, IgM, IgA, IgE and IgD.
  • the immunoglobulin molecule is IgG.
  • the immunoglobulin molecule is lgG1.
  • the immunoglobulin molecule is lgG2.
  • the immunoglobulin molecule is lgG3.
  • the immunoglobulin molecule is lgG4.
  • the immunoglobulin molecule is IgM.
  • the immunoglobulin molecule is IgA.
  • the immunoglobulin molecule is IgE.
  • the immunoglobulin molecule is IgD.
  • the immunoglobulin molecule is fully human. In one embodiment the immunoglobulin molecule is a anti-FVII antibody. In one embodiment the immunoglobulin molecule is fully human. In one embodiment the immunoglobulin molecule is a fully human anti-FVII antibody. In one embodiment the anti-FVII antibody is a non- inhibitory antibody, which do not inhibit FVII/TF complex formation.
  • C in the compound having the formula A-(LM)- C comprises the sequence of SEQ ID NO:7.
  • C in the compound having the formula A-(LM)- C has the sequence of SEQ ID NO:7.
  • the compound with the formula A-(LM)-C comprises the sequence of SEQ ID NO:8. In one embodiment of the invention the compound with the formula A-(LM)-C has the sequence of SEQ ID NO:8.
  • C or (LM)-C in the compound having the formula A-(LM)-C is conjugated at the glycosylation side chains of the FVIIa polypeptide.
  • C or (LM)-C in the compound having the for- mula A-(LM)-C is conjugated to a free sulfhydryl group present on the FVIIa polypeptide.
  • the compound of the invention comprises more than one binding site for TF.
  • the compound is a dimer.
  • the compound is a trimer.
  • the compound is a tetramer.
  • the compound is a pentamer.
  • the compound is a hexamer.
  • C is native human FVIIa or a fragment thereof.
  • a in the compound having the formula A-(LM)- C is native human FVIIa.
  • a in the compound having the formula A-(LM)- C is human FVIIa or a fragment thereof, which further comprises replacement of one, two, three, four or five amino acids in the N-terminal Gla domain (amino acids at position corresponding to 1-37 of SEQ ID NO:1) of Factor Vila.
  • This can provide the FVIIa polypeptide with a substantially higher affinity for membrane phospholipids, such as membrane phospholipids of tissue factor-bearing cells.
  • a in the compound having the formula A-(LM)- C is human FVIIa or a fragment thereof, which further comprises replacement of one, two, three, four or five amino acids in the N-terminal Gla domain (amino acids at position corresponding to 1-37 of SEQ ID NO:1) of Factor Vila.
  • This can provide the FVIIa polypeptide with a substantially higher affinity for membrane phospholipids, such as membrane phospholipids of tissue factor-bearing cells.
  • C is native human FVIIa.
  • the compound having the formula A-(LM)-C is not an immunoconjugate comprising the Fc region of a human lgG1 immunoglobulin and a mutant FVII polypeptide, that binds to TF but do not initiate blood clotting.
  • (LM)-C comprises an amino acid sequence.
  • LM in the compound having the formula A- (LM)-C is an amino acid sequence.
  • LM in the compound having the formula A- (LM)-C comprises an amino acid sequence (Gly-Gly-Gly-Gly-Ser)n, wherein n is any integer from 1 to 10.
  • LM in the compound having the formula A- (LM)-C comprises a molecule selected from the group consisting of straight or branched C ⁇ . 5 o-alkyl, straight or branched C 2 . 50 -alkenyl, straight or branched C 2-50 -alkynyl, a 1 to 50 - membered straight or branched chain comprising carbon and at least one N, O or S atom in the chain, C 3-8 cycloalkyl, a 3 to 8 -membered cyclic ring comprising carbon and at least one N, O or S atom in the ring, aryl, heteroaryl, amino acid, the structures optionally substituted with one or more of the following groups: H, hydroxy, phenyl, phenoxy, benzyl, thienyl, oxo, amino, C 1-4 -alkyl, -CONH 2 , -CSNH 2 , C M monoalkylamino, C M dialky
  • LM in the compound having the formula A- (LM)-C is a molecule selected from the group consisting of straight or branched C 1-S0 -alkyl, straight or branched C 2 - 5 o-alkenyl, straight or branched C 2-50 -alkynyl, a 1 to 50 -membered straight or branched chain comprising carbon and at least one N, O or S atom in the chain, C 3 .
  • cycloalkyl a 3 to 8 -membered cyclic ring comprising carbon and at least one N, O or S atom in the ring, aryl, heteroaryl, amino acid, the structures optionally substituted with one or more of the following groups: H, hydroxy, phenyl, phenoxy, benzyl, thienyl, oxo, amino, C ⁇ 4 - alkyl, -CONH 2 , -CSNH 2 , C M monoalkylamino, C 1-4 dialkylamino, acylamino, sulfonyl, car- boxy, carboxamido , halogeno, d-e alkoxy, C 1-6 alkylthio, trifluoroalkoxy, alkoxycarbonyl, haloalkyl.
  • a in the compound having the formula A-(LM)- C is catalyticaliy inactivated in the active site with a chloromethyl ketone inhibitor independently selected from the group consisting of Phe-Phe-Arg chloromethyl ketone, D-Phe-Phe- Arg chloromethyl ketone, L-Phe-Phe-Arg chloromethyl ketone, Phe-Pro-Arg chloromethyl ke- tone, D-Phe-Pro-Arg chloromethyl ketone, L-Phe-Pro-Arg chloromethyl ketone, Glu-Gly-Arg chloromethyl ketone, L-Glu-Gly-Arg chloromethyl ketone, D-Glu-Gly-Arg chloromethyl ketone, Dansyl-Phe-Phe-Arg chloromethyl ketone, dansyl-D-Phe-Phe-Arg chloromethyl ketone, Dansyl-L-Phe-Phe-Arg chloromethyl ketone, Dansyl-Phe-Pro-Arg
  • FFR-cmk refers to D-Phe-Phe-Arg chloromethyl ketone.
  • FFR-FVIIa refers to FVIIa with a D-Phe-Phe-Arg chloromethyl ketone in the active site.
  • LM in the compound having the formula A-(LM)-C comprises a chloromethyl ketone inhibitor independently selected from the group consisting of Phe-Phe-Arg chloromethyl ketone, D-Phe-Phe-Arg chloromethyl ketone, L-Phe-Phe-Arg chloromethyl ketone, Phe-Pro-Arg chloromethyl ketone, D-Phe-Pro-Arg chloromethyl ketone, L-Phe-Pro-Arg chloromethyl ketone, Glu-Gly-Arg chloromethyl ketone, L-Glu-Gly-Arg chloro- methyl ketone, D-Glu-Gly-Arg chloromethyl ketone, Dansyl-Phe-Phe-Arg chloromethyl ketone, dansyl-D-Phe-Phe-Arg chloromethyl ketone, Dansyl-L-Phe-Phe-Arg chloromethyl ketone, Dansyl-Phe-Pro-Arg chloromethyl ketone, Dansyl-D
  • LM in the compound having the formula A-(LM)-C is a chloromethyl ketone inhibitor independently selected from the group consisting of Phe-Phe- Arg chloromethyl ketone, D-Phe-Phe-Arg chloromethyl ketone, L-Phe-Phe-Arg chloromethyl ketone, Phe-Pro-Arg chloromethyl ketone, D-Phe-Pro-Arg chloromethyl ketone, L-Phe-Pro- Arg chloromethyl ketone, Glu-Gly-Arg chloromethyl ketone, L-Glu-Gly-Arg chloromethyl ketone, D-Glu-Gly-Arg chloromethyl ketone, Dansyl-Phe-Phe-Arg chloromethyl ketone, dansyl- D-Phe-Phe-Arg chloromethyl ketone, Dansyl- D-Phe-Phe-Arg chloromethyl ketone, Dansyl-L-Phe-Phe-Arg chloromethyl ketone, Dansyl- Phe-Pro
  • a TF/FVIIa mediated or associated process or event, or a process or event associated with TF-mediated coagulation activity, is any event, which requires the presence of TF/FVIIa.
  • Such processes or events include, but are not limited to, formation of fibrin which leads to thrombus formation; platelet deposition; proliferation of smooth muscle cells (SMCs) in the vessel wall, such as, for example, in intimal hyperplasia or restenosis, which is thought to result from a complex interaction of biological processes including platelet deposition and thrombus formation, release of chemotactic and mitogenic factors, and the migration and proliferation of vascular smooth muscle cells into the intima of an arterial segment; and dele- terious events associated with post-ischemic reperfusion, such as, for example, in patients with acute myocardial infarction undergoing coronary thrombolysis.
  • SMCs smooth muscle cells
  • Fibrinogen is converted to fibrin by the action of thrombin.
  • Thrombin is formed by the proteolytic cleavage of prothrombin.
  • This proteolysis is effected by FXa which binds to the surface of activated platelets and in the presence of FVa and calcium, cleaves prothrombin.
  • TF/FVIIa is required for the proteolytic activation of FX by the extrinsic pathway of coagulation.
  • a process mediated by or associated with TF/FVIIa, or a TF-mediated coagulation activity includes any step in the coagulation cascade from the formation of the TF/FVIIa complex to the formation of a fibrin platelet clot and which initially requires the presence of TF/FVIIa.
  • the TF/FVIIa complex initiates the extrinsic pathway by activation of FX to FXa, FIX to FIXa, and additional FVII to FVIIa.
  • TF/FVIIa mediated or associated process, or TF-mediated coagulation activity can be conveniently measured employing standard assays such as those described in Roy, S., (1991) J. Biol. Chem.
  • vascular disorders such as deep
  • the disease or disorder associated with pathophysiological TF function are not limited to in vivo coagulopatic disorders such as those named above, but includes ex vivo TF/FVIIa related processes such as coagulation that may result from the extracorporeal circulation of blood, including blood removed in-line from a patient in such processes as dialysis procedures, blood filtration, or blood bypass during surgery.
  • Treatment means the administration of an effective amount of a therapeutically active compound of the invention with the purpose of preventing any symptoms or disease state to develop or with the purpose of curing or easing such symptoms or disease states already developed.
  • treatment is thus meant to include prophylactic treatment.
  • cancer or "tumor” are to be understood as referring to all forms of neo- plastic cell growth, including tumors of the lung, liver, blood cells (leukaemias), skin, pancreas, colon, prostate, uterus or breast.
  • peptides, proteins and amino acids as used herein can comprise or refer to "natural", le , naturally occurring amino acids as well as “non.classical” D- amino acids including, but not limited to, the D-isomers of the common amino acids, - isobutyric acid, 4-aminobutyric acid, hydroxyproline, sarcosine, citrulline, cysteic acid, t- butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, designer amino ac- ids such as ⁇ -methyl amino acids, C ⁇ -methyl amino acids, N ⁇ -methyl amino acids, and amino acid analogues in general.
  • amino acids can include Abu, 2-amino butyric acid; ⁇ -Abu, 4-aminobutyric acid; ⁇ -Ahx, 6-aminohexanoic acid; Aib, 2-amino-isobutyric acid; ⁇ -Ala, 3-aminopropionic acid; Orn, ornithine; Hyp, trans-hydroxyproline; Nle, norleucine; Nva, norvaline.
  • GLA as used herein means 4-carboxyglutamic acid ( ⁇ - carboxyglutamate).
  • the "FVIIa inhibitor” may be selected from any one of several groups of FVIIa directed inhibitors. Such inhibitors are broadly categorised for the purpose of the present invention into i) inhibitors which reversibly bind to FVIIa and are cleavable by FVIIa, ii) inhibi- tors which reversibly bind to FVIIa but cannot be cleaved, and iii) inhibitors which irreversibly bind to FVIIa.
  • inhibitors of serine proteases see Proteinase Inhibitors (Research Monographs in cell and Tissue Physiology; v. 12) Elsevier Science Publishing Co., Inc., New York (1990).
  • the FVIIa inhibitor moiety may also be an irreversible FVIIa serine protease inhibi- tor.
  • Such irreversible active site inhibitors generally form covalent bonds with the protease active site.
  • Such irreversible inhibitors include, but are not limited to, general serine protease inhibitors such as peptide chloromethyl ketones (see, Williams et al., J. Biol. Chem.
  • peptidyl cloromethanes or peptidyl cloromethanes; azapeptides; acylating agents such as various guanidinobenzoate derivatives and the 3-alkoxy-4-chloroisocoumarins; sulphonyl fluorides such as phenylmethylsulphonylfluoride (PMSF); diisopropylfluorophosphate (DFP); tosylpropylchloromethyl ketone (TPCK); tosyllysylchloromethyl ketone (TLCK); nitrophenyl- sulphonates and related compounds; heterocyclic protease inhibitors such as isocoumarines, and coumarins.
  • PMSF phenylmethylsulphonylfluoride
  • DFP diisopropylfluorophosphate
  • TPCK tosylpropylchloromethyl ketone
  • TLCK tosyllysylchloromethyl ketone
  • Examples of peptidic irreversible FVIIa inhibitors include, but are not limited to, Phe-Phe-Arg chloromethyl ketone, D-Phe-Phe-Arg chloromethyl ketone, L-Phe-Phe-Arg chloromethyl ketone, Phe-Pro-Arg chloromethyl ketone, D-Phe-Pro-Arg chloromethyl ketone, L-Phe-Pro-Arg chloromethyl ketone, Glu-Gly-Arg chloromethyl ketone, L-Glu-Gly-Arg chloromethyl ketone, D-Glu-Gly-Arg chloromethyl ketone, Dansyl-Phe-Phe-Arg chloromethyl ketone, dansyl-D-Phe-Phe-Arg chloromethyl ketone, Dansyl-L-Phe-Phe-Arg chloromethyl ketone, Dansyl-Phe-Pro-Arg chloromethyl ketone, Dansyl-L-Phe-Phe-Arg chloromethyl ketone, Dansyl-
  • FVIIa inhibitors also include benzoxazinones or heterocyclic analogues thereof such as described in PCT/DK99/00138.
  • linker moiety or LM is meant any biocompatible molecule functioning as a means to link the effector domain to the FVIIa polypeptides.
  • the FVIIa polypeptide and the effector domain are linked to the molecular LM via a chemical bond, e.g. via an amide or peptide bond between an amino group of the LM and a carboxyl group, or its equivalent, of the FVIIa polypeptide and the effector domain, or vice versa.
  • the LM may contain both covalent and non-covalent chemical bonds or mixtures thereof.
  • the LM comprises a plurality of carbon-carbon ⁇ bonds having free rotation about their axes, so as to allow the FVIIa polypeptides and the effector domain to be separated by a distance suitable to both bind the TF site and elicit the effect of the effector domain.
  • Suitable LMs, or backbones comprise group(s) such as, but are not limited to, pep- tides; polynudeotides; sacharides including monosaccharides, di- and oligosaccharides, cyclodextrins and dextran; polymers including polyethylene glycol, polypropylene glycol, polyvinyl alcohol, hydrocarbons, polyacrylates and amino-, hydroxy-, thio- or carboxy- functionalised silicones, other biocompatible material units; and combinations thereof.
  • group(s) such as, but are not limited to, pep- tides; polynudeotides; sacharides including monosaccharides, di- and oligosaccharides, cyclodextrins and dextran; polymers including polyethylene glycol, polypropylene glycol, polyvinyl alcohol, hydrocarbons, polyacrylates and amino-, hydroxy-, thio- or carboxy- functionalised silicones, other biocompatible material units; and
  • the LM may, for example, be selected among the following structures: straight or branched C 1-50 -alkyl, straight or branched C 2-50 -alkenyl, straight or branched C 2 . 50 -alkynyl, a 1 to 50 -membered straight or branched chain comprising carbon and at least one N, O or S atom in the chain, C 3-8 cycloalkyl, a 3 to 8 -membered cyclic ring comprising carbon and at least one N, O or S atom in the ring, aryl, heteroaryl, amino acid, the structures optionally substituted with one or more of the following groups: H, hydroxy, phenyl, phenoxy, benzyl, thienyl, oxo, amino, C 1-4 -alkyl, -CONH 2 , -CSNH 2 , C onoal- kylamino, C M dialkylamino, acylamino, sulfonyl,
  • the LM may be straight chained or branched and may contain one or more double or triple bonds.
  • the LM may con- tain one or more heteroatoms like N,O or S. It is to be understood, that the LM can comprise more than one class of the groups described above, as well as being able to comprise more than one member within a class. Where the LM comprises more than one class of group, such LM is preferably obtained by joining different units via their functional groups. Methods for forming such bonds involve standard organic synthesis and are well known to those of ordinary skill in the art.
  • the LM can comprise more than one class of the groups described above, as well as being able to comprise more than one member within a class.
  • the LM comprises more than one class of group, such LM is preferably obtained by joining different units via their functional groups. Methods for forming such bonds involve standard organic synthesis and are well known to those of ordinary skill in the art.
  • the LM can comprise functional groups, such as, for example hydroxy, oxo, amino, C 1- monoalkylamino, acylamino, sulfonyl, carboxy, carboxamido , halogeno, alkoxy, C 1-6 alkylthio, trifluoroalkoxy, alkoxycarbonyl, or haloalkyl groups.
  • the LM can also comprise charged functional groups, such as for example, ammonium groups or carboxylate groups.
  • the charged functional groups can provide TF antagonists with sufficient solubility in aqueous or physiological systems, provide reactive sites for ionic bonding with other species, and enhance their avidity to other members of the TF/FVIIa/FXa complex.
  • the total amount of charged functional groups are minimised so as to maximise the TF antagonists specificity for TF sites, but not so as to significantly decrease solubility.
  • C 1- 0 -alkyl or “C 1-50 -alkanediyl” as used herein, refers to a straight or branched, saturated or unsaturated hydrocarbon chain having from one to 50 carbon atoms.
  • C 2 . 50 -alkenyl or “C 2-50 -alkenediyl” as used herein, refers to an unsatu- rated branched or straight hydrocarbon chain having from 2 to 50 carbon atoms and at least one double bond.
  • C 2-50 -alkynyl or “C 2-50 -alkynediyl” as used herein, refers to an unsatu- rated branched or straight hydrocarbon chain having from 2 to 50 carbon atoms and at least one triple bond.
  • the C ⁇ . 50 -alkyl residues include aliphatic hydrocarbon residues, unsaturated aliphatic hydrocarbon residues, alicyclic hydrocarbon residues. Examples of a C ⁇ .
  • 50 -alkyl within this definition include but are not limited to decanyl, hexadecanyl, octadecanyl, non- adecanyl, icosanyl, docosanyl, tetracosanyl, triacontanyl, decanediyl, hexadecanediyl, octa- decanediyl, nonadecanediyl, icosanediyl, docosanediyl, tetracosanediyl, triacontanediyl,
  • C 3-8 -cycloalkyl means an alicyclic hydrocarbon residue including saturated alicyclic hydrocarbon residues having 3 to 8 carbon atoms such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl; and C 5 ⁇ unsaturated alicyclic hydrocarbon residues having 5 to 6 carbon atoms such as 1-cyclopentenyl, 2-cyclopentenyl, 3-cyclopentenyl, 1-cyclohexenyl, 2- cyclohexenyl, 3-cyclohexenyl.
  • C 1-6 -alkoxy refers to a straight or branched monovalent substituent comprising a C 1-6 -alkyl group linked through an ether oxygen having its free valence bond from the ether oxygen and having 1 to 6 carbon atoms e.g. methoxy, ethoxy, propoxy, isopropoxy, butoxy, pentoxy.
  • C 1-6 -alkylthio refers to a straight or branched monovalent substituent comprising a C ⁇ . 6 -alkyl group linked through an thioether sulfur atom having its free valence bond from the thioether sulfur and having 1 to 6 carbon atoms.
  • aryl and “heteroaryl” as used herein refers to an aryl which can be optionally substituted or a heteroaryl which can be optionally substituted and includes phenyl, biphenyl, indene, fluorene, naphthyl (1-naphthyl, 2-naphthyl), anthracene (1-anthracenyl, 2- anthracenyl, 3-anthracenyl), thiophene (2-thienyl, 3-thienyl), furyl (2-furyl, 3-furyl) , indolyl, oxadiazolyl, isoxazolyl, quinazolin, fluorenyl, xanthenyl, isoindanyl, benzhydryl, acridinyl, thi- azolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1-imidazo
  • the invention also relates to partly or fully saturated analogues of the ring systems mentioned above.
  • C 1-4 monoalkylamino and “C 1-4 dialkylamino” refer to an amino group having one or both of its hydrogens independently replaced by an alkyl group having 1 to 4 carbon atoms, alkyl being defined above, such as methylamino, dimethylamino, N-ethyl-N- methylamino, ethylamino; diethylamino, propylamino, dipropylamino, N-(n-butyl)-N- methylamino, n-butylamino, di(n-butyl)amino, sec-butylammino, t-butylamino, and the like.
  • acyl or “carboxy” refer to a monovalent substituent comprising a C 1-6 - alkyl group linked through a carbonyl group; such as e.g. acetyl, propionyl, butyryl, isobutyryl, pivaloyl, valeryl, and the like.
  • trifluoroalkoxy refers to an C 1-6 alkoxy group as defined above having three of its hydrogen atoms bonded to one or more of the carbon atoms replaced by fluor atoms, such as (CF 3 )O-, (CF 3 )CH 2 O-.
  • Ci-e-alkoxycarbonyl refers to a monovalent substituent comprising a C 1-6 -alkoxy group linked through a carbonyl group; such as e.g. methoxycarbonyl, carbethoxy, propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, sec- butoxycarbonyl, tert-butoxycarbonyl, 3-methylbutoxycarbonyl, n-hexoxycarbonyl and the like.
  • the term “leaving group” as used herein includes, but is not limited to, halogen, sul- fonate or an acyl group. Suitable leaving groups will be known to a person skilled in the art.
  • “Halogen” refers to fluorine, chlorine, bromine, and iodine.
  • Halo refers to fluoro, chloro, bromo and iodo.
  • “Optional” or “optionally” means that the subsequently described event or circumstances may or may not occur, and that the description includes instances where said event or circumstance occur and instances in which is does not.
  • "aryl ... optionally substituted” means that the aryl may or may not be substituted and that the description includes both unsubstituted aryls and aryls wherein there is substitution
  • the immunostimulatory effector domain conjugates C-(LM) comprising a FVIIa inhibitor to be used in the preparation of a TF antagonist may be prepared by the following methods. In the following methods the FVIIa inhibitor is designated the letter F.
  • the immunostimulatory effector domain C is designated the letter C.
  • Linker part B refers to other linker part of the LM.
  • LM comprising FVIIa inhibitors is prepared by reacting F-B-X, in which X is a functional group capable of reacting with structures C-Y, in which Y is a functional group, by means of normal coupling reactions using coupling reagents known by the person skilled in the art.
  • Method 2
  • LM comprising FVIIa inhibitors may be prepared by reaction between F-B-Z , in which Z is a leaving group and C-W in which W is a nucleofile .
  • leaving groups are halogens, sulfonates , phosphonates.
  • nucleofiles are hydroxy , amino , N- substituted amino, and carbanions.
  • LM comprising FVIIa inhibitors may be prepared by reaction between C-B-Z , in which Z is a leaving group, and F-W, in which W is a nucleofile.
  • leaving groups are halogens, sulfonates , phosphonates.
  • nucleofiles are hydroxy , amino , N- substituted amino, and carbanions.
  • the linker part B can be reacted with structures F and C connected to a solid phase surface using methods well known in the art.
  • Method 5 The immunostimulatory effector domain conjugates C-(LM) comprising a FVIIa inhibitor may be prepared by a sequence of reactions through which F or C firstly are reacted with the activated linker moiety forming F-B, respectively C-B moieties and subsequently the formed product is reacted with C, respectively F moiety.
  • the actual bond formation taking place through reaction on functional groups or derivatives or leaving groups /nucleofiles as described under methods 1-3.
  • reaction can be carried out in solution phase or on a solid phase support using the procedures known by the person skilled in the art.
  • amino acids are represented using abbreviations, as indicated in table 1 , approved by IUPAC-IUB Commission on Biochemical Nomenclature (CBN).
  • Amino acid and the like having isomers represented by name or the following abbreviations are in natural L-form unless otherwise indicated.
  • the left and right ends of an amino acid sequence of a peptide are, respectively, the N- and C-termini unless otherwise specified.
  • the invention also relates to a method of preparing human FVIIa polypeptides as mentioned above.
  • the human FVIIa polypeptides are preferably produced by recombinant DNA techniques.
  • DNA sequences encoding human FVIIa may be isolated by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the protein by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).
  • the DNA sequence encoding the protein is preferably of human origin, i.e. derived from a human genomic DNA or cDNA library.
  • the DNA sequences encoding the human FVIIa polypeptides may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805.
  • phosphoamidite method oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.
  • DNA sequences may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202, Saiki et al., Science 239 (1988), 487 - 491 , or Sambrook et al., supra.
  • the DNA sequences encoding the human FVIIa polypeptides are usually inserted into a recombinant vector which may be any vector, which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced.
  • the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
  • the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
  • the vector is preferably an expression vector in which the DNA sequence encoding the human FVIIa polypeptides is operably linked to additional segments required for transcription of the DNA.
  • the expression vector is derived from plasmid or viral DNA, or may contain elements of both.
  • operably linked indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the polypeptide.
  • the promoter may be any DNA sequence, which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
  • Suitable promoters for directing the transcription of the DNA encoding the human FVIIa polypeptide in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1 (1981), 854 -864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222 (1983), 809 - 814), the CMV promoter (Boshart et al., Cell 41:521-530, 1985) or the adenovirus 2 major late promoter (Kaufman and Sharp, Mol. Cell. Biol, 2:1304-1319, 1982).
  • a suitable promoter for use in insect cells is the polyhedrin promoter (US 4,745,051; Vasuvedan et al., FEBS Lett. 311, (1992) 7 - 11), the P10 promoter (J.M. Vlak et al., J. Gen. Virology 69, 1988, pp. 765-776), the Autographa californica polyhedrosis virus basic protein promoter (EP 397 485), the baculovirus immediate early gene 1 promoter (US 5,155,037; US 5,162,222), or the baculovirus 39K delayed-early gene promoter (US 5,155,037; US 5,162,222).
  • promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073 - 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
  • suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. A (1985), 2093 - 2099) or the tpiA promoter.
  • suitable promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral ⁇ -amylase, A. niger acid stable ⁇ -amylase, A. niger or A. awamori glucoamylase (gluA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A.
  • triose phosphate isomerase or A. nidulans acetamidase.
  • Preferred are the TAKA-amylase and gluA promoters. Suitable promoters are mentioned in, e.g. EP 238023 and EP 383779.
  • the DNA sequences encoding the human FVIIa polypeptides may also, if necessary, be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., Science 222, 1983, pp.809-814) or the TPI1 (Alber and Kawasaki, J. Mol. Appl. Gen. 1, 1982, pp. 419-434) or ADH3 (McKnight et al., The EMBO J. A, 1985, pp. 2093-2099) terminators.
  • the vector may also contain a set of RNA splice sites located downstream from the promoter and upstream from the insertion site for the FVIIa sequence itself.
  • RNA splice sites may be obtained from adenovirus and/or immunoglobulin genes.
  • a polyadenylation signal located downstream of the insertion site.
  • Particularly preferred polyadenylation signals include the early or late polyadenylation signal from SV40 (Kaufman and Sharp, ibid.), the polyadenylation signal from the adenovirus 5 Elb region, the human growth hormone gene terminator (DeNoto et al. Nuc. Acids Res. 9:3719-3730, 1981) or the polyadenylation signal from the human FVII gene or the bovine FVII gene.
  • the expression vectors may also include a noncoding viral leader sequence, such as the adenovirus 2 tripartite leader, located between the promoter and the RNA splice sites; and enhancer sequences, such as the SV40 enhancer.
  • the recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
  • An example of such a sequence is the SV40 origin of replication.
  • suitable sequences enabling the vector to replicate are the yeast plasmid 2 ⁇ replication genes REP 1-3 and origin of replication.
  • the vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g. ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate.
  • selectable markers include amdS, pyrG, argB, niaD or sC.
  • a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) may be provided in the recombinant vector.
  • the secretory signal sequence is joined to the DNA sequences encoding the human FVIIa polypeptides in the correct reading frame.
  • Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the peptide.
  • the secretory signal sequence may be that, normally associated with the protein or may be from a gene encoding another secreted protein.
  • the secretory signal sequence may encode any signal peptide, which ensures efficient direction of the expressed human FVIIa polypeptides into the secretory pathway of the cell.
  • the signal peptide may be naturally occurring signal peptide, or a functional part thereof, or it may be a synthetic peptide. Suitable signal peptides have been found to be the ⁇ -factor signal peptide (cf. US 4,870,008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L.A. Vails et al., Cell 48, 1987, pp.
  • yeast BAR1 signal peptide cf. WO 87/02670
  • yeast aspartic protease 3 YAP3
  • a sequence encoding a leader peptide may also be inserted downstream of the signal sequence and upstream of the DNA sequence encoding the human FVIIa polypeptides.
  • the function of the leader peptide is to allow the expressed peptide to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory vesicle for secretion into the culture medium (i.e. exportation of the human FVIIa polypeptides across the cell wall or at least through the cellular membrane into the periplasmic space of the yeast cell).
  • the leader peptide may be the yeast alpha-factor leader (the use of which is described in e.g.
  • the leader peptide may be a synthetic leader peptide, which is to say a leader peptide not found in nature. Synthetic leader peptides may, for instance, be constructed as described in WO 89/02463 or WO 92/11378.
  • the signal peptide may conveniently be derived from a gene encoding an Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor miehei lipase or protease or a Humicola lanuginosa lipase.
  • the signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A. niger neutral ⁇ -amylase, A. niger acid-stable amylase, or A. niger glucoamylase.
  • Suitable signal peptides are disclosed in, e.g. EP 238 023 and EP 215594.
  • the signal peptide may conveniently be derived from an insect ' gene (cf. WO 90/05783), such as the lepidopteran Manduca sexta adipokinetic hormone precursor signal peptide (cf. US 5,023,328).
  • Selectable markers may be introduced into the cell on a separate plasmid at the same time as the gene of interest, or they may be introduced on the same plasmid. If on the same plasmid, the selectable marker and the gene of interest may be under the control of different promoters or the same promoter, the latter arrangement producing a dicistronic message. Constructs of this type are known in the art (for example, Levinson and Simonsen, U.S. Pat. No. 4,713,339). It may also be advantageous to add additional DNA, known as "carrier DNA,” to the mixture that is introduced into the cells. After the cells have taken up the DNA, they are grown in an appropriate growth medium, typically 1-2 days, to begin expressing the gene of interest.
  • carrier DNA additional DNA
  • appropriate growth medium means a medium containing nutrients and other components required for the growth of cells and the expression of the human FVIIa polypeptides of interest.
  • Media generally include a carbon source, a nitrogen source, essential amino acids, es- sential sugars, vitamins, salts, phospholipids, protein and growth factors.
  • the medium will contain vitamin K, preferably at a concentra- tion of about 0.1 ⁇ g/ml to about 5 ⁇ g/ml.
  • Drug selection is then applied to select for the growth of cells that are expressing the selectable marker in a stable fashion.
  • the drug concentration may be increased to select for an increased copy number of the cloned sequences, thereby increas- ing expression levels. Clones of stably transfected cells are then screened for expression of the human FVIIa polypeptide of interest.
  • the host cell into which the DNA sequences encoding the human FVIIa polypeptides is introduced may be any cell, which is capable of producing the posttranslational modified human FVIIa polypeptides and includes yeast, fungi and higher eukaryotic cells.
  • yeast, fungi and higher eukaryotic cells examples of mammalian cell lines for use in the present invention are the COS-1
  • a preferred BHK cell line is the tk" ts13 BHK cell line
  • BHK 570 cells The BHK 570 cell line has been deposited with the American Type Culture Collection, 12301 Parklawn Dr., Rockville,
  • a tk- ts 3 BHK cell line is also available from the ATCC under accession number CRL 1632.
  • a number of other cell lines may be used within the present invention, including Rat Hep I (Rat hepatoma; ATCC CRL 1600), Rat Hep II (Rat hepatoma; ATCC CRL 1548), TCMK (ATCC CCL 139), Human lung (ATCC HB 8065), NCTC 1469 (ATCC CCL 9.1), CHO (ATCC CCL 61) and DUKX cells (Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980).
  • yeasts cells include cells of Saccharomyces spp. or Schizosac- charomyces spp., in particular strains of Saccharomyces cerevisiae or Saccharomyces kluyveri. Methods for transforming yeast cells with heterologous DNA and producing heterologous poly- peptides there from are described, e.g. in US 4,599,311, US 4,931,373, US 4,870,008, 5,037,743, and US 4,845,075, all of which are hereby incorporated by reference. Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g. leucine.
  • a selectable marker commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g. leucine.
  • a preferred vector for use in yeast is the POT1 vector disclosed in US 4,931 ,373.
  • the DNA sequences encod- ing the human FVIIa polypeptides may be preceded by a signal sequence and optionally a leader sequence, e.g. as described above.
  • suitable yeast cells are strains of Kluyveromyces, such as K. lactis, Hansenula, e.g. H. polymorpha, or Pichia, e.g. P. pastoris (cf. Gleeson et al., J. Gen. Microbiol. 132, 1986, pp. 3459-3465; US 4,882,279).
  • filamentous fungi examples include cells of filamentous fungi, e.g. Aspergillus spp., Neurospora spp., Fusarium spp. or Trichoderma spp., in particular strains of A. oryzae, A. nidulans or A. niger.
  • Aspergillus spp. for the expression of proteins is described in, e.g., EP 272 277, EP 238 023, EP 184 438
  • the transformation of F. oxysporum may, for instance, be carried out as described by Malardier et al., 1989, Gene 78: 147-156.
  • the transformation of Trichoderma spp. may be performed for instance as described in EP 244234.
  • a filamentous fungus When a filamentous fungus is used as the host cell, it may be transformed with the
  • DNA construct of the invention conveniently by integrating the DNA construct in the host chromosome to obtain a recombinant host cell.
  • This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the' cell. Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination.
  • Transformation of insect cells and production of heterologous polypeptides therein may be performed as described in US 4,745,051; US 4,879,236; US 5,155,037; 5,162,222; EP 397,485) all of which are incorporated herein by reference.
  • the insect cell line used as the host may suitably be a Lepidoptera cell line, such as Spodoptera frugiperda cells or Trichoplusia ni cells (cf. US 5,077,214).
  • Culture conditions may suitably be as described in, for instance, WO 89/01029 or WO 89/01028, or any of the aforementioned references.
  • the transformed or transfected host cell described above is then cultured in a suitable nutrient medium under conditions permitting expression of the human FVIIa polypeptide after which all or part of the resulting peptide may be recovered from the culture.
  • the medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection).
  • the human FVIIa polypeptide produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaqueous components of the supernatant or filtrate by means of a salt, e.g.
  • FVIIa DNA sequence is used. This sequence may be modified to encode a desired FVIIa variant.
  • the complete nucleotide and amino acid sequences for human FVIIa are known. See U.S. Pat. No. 4,784,950, which is incorporated herein by reference, where the cloning and expression of recombinant human FVIIa is described.
  • the bovine FVIIa sequence is de- scribed in Takeya et al., J. Biol. Chem, 263:14868-14872 (1988), which is incorporated by reference herein.
  • the amino acid sequence alterations may be accomplished by a variety of techniques. Modification of the DNA sequence may be by site-specific mutagenesis.
  • DNA sequences for use within the present invention will typically encode a pre-pro peptide at the amino-terminus of the FVIIa protein to obtain proper post-translational processing (e.g. gamma-carboxylation of glutamic acid residues) and secretion from the host cell.
  • the pre-pro peptide may be that of FVIIa or another vitamin K-dependent plasma protein, such as factor IX, factor X, prothrombin, protein C or protein S.
  • additional modifications can be made in the amino acid sequence of FVIIa where those modifications do not significantly impair the ability of the protein to act as a coagulation factor.
  • FVIIa in the catalytic triad can also be modified in the activation cleavage site to inhibit the conversion of zymogen FVII into its activated two-chain form, as generally described in U.S. Pat. No. 5,288,629, incorporated herein by reference.
  • transgenic animal technology may be employed to produce the human FVIIa polypeptide. It is preferred to produce the proteins within the mammary glands of a host female mammal. Expression in the mammary gland and subsequent secretion of the protein of interest into the milk overcomes many difficulties encoun- tered in isolating proteins from other sources. Milk is readily collected, available in large quantities, and well characterized biochemically. Furthermore, the major milk proteins are present in milk at high concentrations (typically from about 1 to 15 g/l). From a commercial point of view, it is clearly preferable to use as the host a species that has a large milk yield.
  • livestock mammals including, but not limited to, pigs, goats, sheep and cattle. Sheep are particularly preferred due to such factors as the previous history of transgenesis in this species, milk yield, cost and the ready availability of equipment for collecting sheep milk. See WIPO Publication WO 88/00239 for a comparison of factors influencing the choice of host species. It is generally desirable to select a breed of host animal that has been bred for dairy use, such as East Friesland sheep, or to introduce dairy stock by breeding of the transgenic line at a later date. In any event, animals of known, good health status should be used.
  • milk protein genes include those genes encoding caseins (see U.S. Pat. No. 5,304,489, incorporated herein by reference), beta-lactoglobulin, alpha-lactalbumin, and whey acidic protein.
  • the beta-lactoglobulin (BLG) promoter is preferred.
  • a region of at least the proximal 406 bp of 5' flanking sequence of the gene will generally be used, although larger portions of the 5' flanking sequence, up to about 5 kbp, are preferred, such as about 4.25 kbp DNA segment encompassing the 5' flanking promoter and non-coding portion of the beta-lactoglobulin gene. See Whitelaw et al. , Biochem J. 286: 31-39 (1992). Similar fragments of promoter DNA from other species are also suitable.
  • beta-lactoglobulin gene may also be incorporated in constructs, as may genomic regions of the gene to be expressed. It is generally accepted in the art that constructs lacking introns, for example, express poorly in comparison with those that contain such DNA sequences (see Brinster et al., Proc. Natl. Acad. Sci. USA 85: 836-840 (1988); Palmiter et al., Proc. Natl. Acad. Sci. USA 88: 478-482 (1991); Whitelaw et al., Transgenic Res. 1: 3-13 (1991); WO 89/01343; and WO 91/02318, each of which is incorporated herein by i reference).
  • genomic sequences containing all or some of the native introns of a gene encoding the protein or poly- peptide of interest thus the further inclusion of at least some introns from, e.g, the beta- lactoglobulin gene, is preferred.
  • One such region is a DNA segment which provides for intron splicing and RNA polyadenylation from the 3' non-coding region of the ovine beta- lactoglobulin gene. When substituted for the natural 3' non-coding sequences of a gene, this ovine beta-lactoglobulin segment can both enhance and stabilize expression levels of the protein or polypeptide of interest.
  • the region surrounding the initiation ATG of the sequence encoding the human FVIIa polypeptide is replaced with corresponding sequences from a milk specific protein gene.
  • Such replacement provides a putative tissue-specific initiation environment to enhance expression. It is convenient to replace the entire pre-pro sequence of the human FVIIa polypeptide and 5' non-coding sequences with those of, for example, the BLG gene, although smaller regions may be replaced.
  • a DNA segment encoding the human FVIIa polypeptide is operably linked to additional DNA segments required for its expression to produce expression units.
  • additional segments include the above-mentioned promoter, as well as sequences which provide for termination of transcrip- tion and polyadenylation of mRNA.
  • the expression units will further include a DNA segment encoding a secretory signal sequence operably linked to the segment encoding the human FVIIa polypeptide.
  • the secretory signal sequence may be a native secretory signal sequence of the human FVIIa polypeptide or may be that of another protein, such as a milk protein. See, for example, von Heinje, Nuc. Acids Res. 14: 4683-4690 (1986); and Meade et al., U.S. Pat. No. 4,873,316, which are incorporated herein by reference.
  • Construction of expression units for use in transgenic animals is conveniently car- ried out by inserting a sequence encoding the human FVIIa polypeptide into a plasmid or phage vector containing the additional DNA segments, although the expression unit may be constructed by essentially any sequence of ligations. It is particularly convenient to provide a vector containing a DNA segment encoding a milk protein and to replace the coding se- quence for the milk protein with that of the human FVIIa polypeptide, thereby creating a gene fusion that includes the expression control sequences of the milk protein gene. In any event, cloning of the expression units in plasmids or other vectors facilitates the amplification of the human FVIIa polypeptide. Amplification is conveniently carried out in bacterial (e.g. E. coli) host cells, thus the vectors will typically include an origin of replication and a selectable marker functional in bacterial host cells.
  • bacterial e.g. E. coli
  • the expression unit is then introduced into fertilized eggs (including early-stage embryos) of the chosen host species.
  • Introduction of heterologous DNA can be accomplished by one of several routes, including microinjection (e.g. U.S. Pat. No. 4,873,191), retroviral infection (Jaenisch, Science 240: 1468-1474 (1988)) or site-directed integration using em- bryonic stem (ES) cells (reviewed by Bradley et al., Bio/Technology 10: 534-539 (1992)).
  • the eggs are then implanted into the oviducts or uteri of pseudopregnant females and allowed to develop.
  • FVIIa produced according to the present invention may be purified by affinity chromatography on an anti-FVII antibody column. It is preferred that the immunoadsorption column comprise a high-specificity monoclonal antibody.
  • FVII Single-chain FVII to active two-chain FVIIa
  • factor Xlla as described by Hedner and Kisiel (1983, J. Clin. Invest. 71: 1836-1841), or with other proteases having trypsin-like specificity (Kisiel and Fujikawa, Behring Inst. Mitt. 73: 29- 42, 1983).
  • FVII may be autoactivated by passing it through an ion-exchange chromatography column, such as mono Q.RTM. (Pharmacia Fire Chemicals) or the like (Bjo- ern et al., 1986, Research Disclosures 269:564-565).
  • the FVIIa molecules of the present in- vention and pharmaceutical compositions thereof are particularly useful for administration to humans to treat a variety of conditions involving intravascular coagulation.
  • the compounds of the present invention may have one or more asymmetric centres and it is intended that stereoisomers (optical isomers), as separated, pure or partially purified stereoisomers or racemic mixtures thereof are included in the scope of the invention.
  • the TF antagonist may be prepared in the form of pharmaceutically acceptable salts, especially acid-addition salts, including salts of organic acids and mineral acids.
  • salts include salts of organic acids such as formic acid, fumaric acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, salicylic acid and the like.
  • Suitable inorganic acid-addition salts include salts of hydrochloric, hydrobromic, sulphuric and phosphoric acids and the like.
  • compositions include the pharmaceutically acceptable salts listed in Journal of Pharmaceutical Science. 66, 2 (1977) which are known to the skilled artisan. Also intended as pharmaceutically acceptable acid addition salts are the hydrates which the present compounds are able to form.
  • the acid addition salts may be obtained as the direct products of compound synthesis.
  • the free base may be dissolved in a suitable solvent containing the appropriate acid, and the salt isolated by evaporating the solvent or otherwise separating the salt and solvent.
  • the compounds of this invention may form solvates with standard low molecular weight solvents using methods known to the skilled artisan.
  • the TF antagonist of the invention are useful for the preparation of a pharmaceutical composition for the treatment of or prophylaxis of thrombotic or coagulopathic related dis- eases or disorders including vascular diseases and inflammatory responses.
  • diseases and responses include, but are not limited to deep venous thrombosis, arterial thrombosis, post surgical thrombosis, coronary artery bypass graft (CABG), percutaneous transdermal coronary angioplastry (PTCA), stroke, tumor metastasis, inflammation, septic chock, hypotension, ARDS, pulmonary embolism, disseminated intravascular coagulation (DIC), vas- cular restenosis, platelet deposition, myocardial infarction, angiogenesis, or the prophylactic treatment of mammals with atherosclerotic vessels at risk for thrombosis.
  • CABG coronary artery bypass graft
  • PTCA percutaneous transdermal coronary angioplastry
  • DIC disseminated intravascular coagulation
  • the TF antagonist may be administered in pharmaceutically acceptable acid addition salt form or, where appropriate, as a alkali metal or alkaline earth metal or lower alkylammonium salt. Such salt forms are believed to exhibit approximately the same order of activity as the free base forms.
  • the compounds may be useful in vitro tools for investigating the inhibition of FVIIa, FXa orTF/FVIIa/FXa activity.
  • the present invention includes within its scope pharmaceutical compositions comprising a TF antagonist, as an active ingredient, or a pharmaceutically acceptable salt thereof together with a pharmaceutically acceptable carrier or diluent.
  • the pharmaceutical composition of the invention may comprise a TF antagonist in combination with one or more other compounds exhibiting anticoagulant activity, e.g., platelet aggregation inhibitor.
  • the compounds of the invention may be formulated into pharmaceutical composition comprising the compounds and a pharmaceutically acceptable carrier or diluent.
  • Such carriers include water, physiological saline, ethanol, polyols, e.g., glycerol or propylene glycol, or vegetable oils.
  • pharmaceutically acceptable carriers also encompasses any and all solvents, dispersion media, coatings, antifungal agents, preservatives, isotonic agents and the like. Except insofar as any conventional medium is incompatible with the active ingredient and its intended use, its use in the compositions of the present invention is contemplated.
  • compositions may be prepared by conventional techniques and appear in conventional forms, for example, capsules, tablets, solutions or suspensions.
  • the pharmaceutical carrier employed may be a conventional solid or liquid carrier.
  • solid carriers are lactose, terra alba, sucrose, talc, gelatine, agar, pectin, acacia, magnesium stearate and stearic acid.
  • liquid carriers are syrup, peanut oil, olive oil and water.
  • the carrier or diluent may include any time delay material known to the art, such as glyceryl monostearate or glyceryl distearate, alone or mixed with a wax.
  • the formulations may also include wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavouring agents.
  • the formulations of the invention may be formulated so as to provide quick, sustained, or delayed release of the active ingredient after administration to the patient by employing procedures well known in the art.
  • compositions can be sterilised and mixed, if desired, with auxil- iary agents, emulsifiers, salt for influencing osmotic pressure, buffers and/or colouring substances and the like, which do not deleteriously react with the active compounds.
  • the route of administration may be any route, which effectively transports the active compound to the appropriate or desired site of action, such as oral or parenteral, e.g., rectal, transdermal, subcutaneous, intranasal, intramuscular, topical, intravenous, intraurethral, oph- thalmic solution or an ointment, the oral route being preferred.
  • oral or parenteral e.g., rectal, transdermal, subcutaneous, intranasal, intramuscular, topical, intravenous, intraurethral, oph- thalmic solution or an ointment, the oral route being preferred.
  • the preparation can be tabletted, placed in a hard gelatine capsule in powder or pellet form or it can be in the form of a troche or lozenge.
  • the amount of solid carrier may vary widely but will usually be from about 25 mg to about 1 g.
  • the preparation may be in the form of a syrup, emul- sion, soft gelatine capsule or sterile injectable liquid such as an aqueous or non-aqueous liquid suspension or solution.
  • the preparation may contain a compound of formula (I) dissolved or suspended in a liquid carrier, in particular an aqueous carrier, for aerosol application.
  • a liquid carrier in particular an aqueous carrier
  • the carrier may contain additives such as solubilizing agents, e.g. propylene glycol, surfactants, absorption enhancers such as lecithin (phosphatidylcholine) or cyclodextrin, or preservatives such as parabenes.
  • solubilizing agents e.g. propylene glycol
  • surfactants e.g. propylene glycol
  • absorption enhancers such as lecithin (phosphatidylcholine) or cyclodextrin
  • preservatives such as parabenes.
  • injectable solutions or suspensions preferably aqueous solutions with the active compound dissolved in polyhydroxylated castor oil.
  • Tablets, dragees, or capsules having talc and/or a carbohydrate carrier or binder or the like are particularly suitable for oral application.
  • Preferable carriers for tablets, dragees, or capsules include lactose, corn starch, and/or potato starch.
  • a syrup or elixir can be used in cases where a sweetened vehicle can be employed.
  • a typical tablet which may be prepared by conventional tabletting techniques, contains Core:
  • Active compound (as free compound 10 mg or salt thereof)
  • the compounds of the invention may be administered to a mammal, especially a human in need of such treatment, prevention, elimination, alleviation or amelioration of various thrombolytic or coagulophatic diseases or disorders as mentioned above.
  • mammals also include animals, both domestic animals, e.g. household pets, and non- domestic animals such as wildlife.
  • dosage forms suitable for oral, nasal, pulmonal or transdermal administration comprise from about 0.001 mg to about 100 mg, preferably from about 0.01 mg to about 50 mg of the compounds of formula I admixed with a pharmaceutically acceptable carrier or diluent.
  • the compounds may be administered concurrently, simultaneously, or together with a pharmaceutically acceptable carrier or diluent, whether by oral, rectal, or parenteral (including subcutaneous) route.
  • a pharmaceutically acceptable carrier or diluent whether by oral, rectal, or parenteral (including subcutaneous) route.
  • the compounds are often, and preferably, in the form of an alkali metal or earth alkali metal salt thereof. Suitable dosage ranges varies as indicated above depending upon the exact mode of administration, form in which administered, the indication towards which the administration is directed, the subject involved and the body weight of the subject involved, and the preference and experience of the physician or veterinarian in charge.
  • the compounds of the present invention have interesting pharmacological properties.
  • the compounds of this invention can be used to modulate and normalise an impaired haemostatic balance in mammals caused by deficiency or malfunction of blood clotting factors or their inhibitors.
  • the FVIIa and in particular the TF/FVIIa activity plays an important role in the control of the coagulation cascade, and modulators of this key regulatory activity such as the present invention can be used in the treatment of or prophylaxis of thrombotic or coagulopathic related diseases or disorders including vascular diseases and inflammatory responses.
  • the pharmaceutical composition of the invention may thus be useful for modulating and normalising an impaired haemostatic balance in a mammal.
  • the pharmaceutical composition may be useful for the treatment of or prophylaxis of thrombotic or coagulopathic related diseases or disorders including vascular diseases and inflammatory responses.
  • “Modulating and normalising an impaired haemostatic balance” means achieving an effect on the coagulation system measurable in vitro assays and/or animal models which diminishes the risk for thrombosis or bleedings.
  • the pharmaceutical composition may be useful as an inhibitor of blood coagulation in a mammal, as an inhibitor of clotting activity in a mammal, as an inhibitor of deposition of fibrin in a mammal, as an inhibitor of platelet deposition in a mammal, in the treatment of mammals suffering from deep venous thrombosis, arterial thrombosis, post surgical thrombosis, coronary artery bypass graft (CABG), percutaneous transdermal coronary angioplastry (PTCA), stroke, tumor metastasis, inflammation, septic chock, hypotension, ARDS, pulmonary embolism, disseminated intravascular coagulation (DIC), vascular restenosis, platelet deposition, myocardial infarction, angiogenesis, or the prophylactic treatment of mammals with atherosclerotic vessels at risk for thrombosis.
  • the compositions of the invention may also be used as an adjunct in thrombolytic therapy.
  • the invention relates to a method for inhibiting the TF initiation activity in a mammal which method comprises administering an effective amount of at least one compound of the present invention, in combination with a pharmaceutical acceptable excipient and/ or carrier to the mammal in need of such a treatment.
  • FXa generation assay (assay 1): In the following example all concentrations are final. Updated TF (10 pM), FVIIa (100 pM) and TF antagonist or FFR-rFVIIa (0 - 50 nM) in HBS/BSA (50 mM hepes, pH 7.4, 150 mM NaCl, 5 mM CaCI 2 ,1 mg/ml BSA) are incubated 60 min at room temperature before FX (50 nM) is added.
  • the reaction is stopped after another 10 min by addition of Vz volume stopping buffer (50 mM Hepes, pH 7.4, 100 mM NaCl, 20 mM EDTA).
  • Vz volume stopping buffer 50 mM Hepes, pH 7.4, 100 mM NaCl, 20 mM EDTA.
  • the amount of FXa generated is determined by adding substrate S2765 (0.6 mM, Chromogenix, and measuring absorbance at 405 nm continuously for 10 min.
  • IC 50 values for TF antagonist inhibition of FVIIa/lipidated TF-mediated activation of FX may be calculated.
  • the IC50 value for FFR- rFVIIa is 51 +/- 26 pM in this assay.
  • Monolayers of human lung fi- broblasts WI-38 (ATTC No. CCL-75) or human bladder carcinoma cell line J82 (ATTC No. HTB-1) or human keratinocyte cell line CCD 1102KerTr (ATCC no. CRL-2310) constitutively expressing TF are employed as TF source in FVIIa/TF catalyzed activation of FX.
  • Confluent cell monolayers in a 96-well plate are washed one time in buffer A (10 mM Hepes, pH 7.45, 150 mM NaCl, 4 mM KCI, and 11 mM glucose) and one time in buffer B (buffer A supplemented with with 1 mg/ml BSA and 5 mM Ca 2+ ).
  • buffer A 10 mM Hepes, pH 7.45, 150 mM NaCl, 4 mM KCI, and 11 mM glucose
  • buffer B buffer A supplemented with with 1 mg/ml BSA and 5 mM Ca 2+
  • FX (135 nM) and varying concentrations of TF antagonist or FFR-rFVIIa in buffer B are simultaneously added to the cells. FXa formation is allowed for 15 min at 37°C.
  • FXa 50- ⁇ l aliquots are removed from each well and added to 50 ⁇ l stopping buffer (Buffer A supplemented with 10 mM EDTA and 1 mg/ml BSA).
  • the amount of FXa generated is determined by transferring 50 ⁇ l of the above mixture to a microtiter plate well and adding 25 ⁇ l Chromozym X (final concentration 0.6 mM) to the wells.
  • the absorbance at 405 nm is measured continuously and the initial rates of colour develop- ment are converted to FXa concentrations using a FXa standard curve.
  • the IC50 value for FFR-rFVIIa is 1.5 nM in this assay.
  • Binding studies are employed using the human bladder carcinoma cell line J82 (ATTC No. HTB-1 ) or the human keratino- cyte cell line (CCD1102KerTr ATCC No CRL-2310) or NHEK P166 (Clonetics No. CC-2507) all constitutively expressing TF.
  • Confluent monolayers in 24-well tissue culture plates are washed once with buffer A (10 mM Hepes, pH 7.45, 150 mM NaCl, 4 mM KCI, and 11 mM glucose) supplemented with 5 mM EDTA and then once with buffer A and once with buffer B (buffer A supplemented with with 1 mg/ml BSA and 5 mM Ca 2+ ).
  • the monolayers are prein- cubated 2 min with 100 ⁇ l cold buffer B.
  • Varying concentrations of Mabs (or FFR-FVIIa) and radiolabelled FVIIa are simultaneously added to the cells (final volume 200 ⁇ l). The plates are incubated for 2 hours at 4 °C.
  • the unbound material is removed, the cells are washed 4 times with ice-cold buffer B and lysed with 300 ⁇ l lysis buffer (200 mM NaOH, 1 % SDS and 10 mM EDTA). Radioactivity is measured in a gamma counter (Cobra, Packard Instruments). The binding data are analyzed and curve fitted using GraFit4 (Erithacus Software, Ltd., (U.K.). The IC50 value for FFR-rFVIIa is 4 nM in this assay.
  • the complement is absorbed with a tumor cell line expressing human TF, e.g. J82 (ATCC number HTB-1), alternatively a CHO cell line transfected with full length human TF; approximately 0.1 ml packed cells per ml serum, for 30 min at 4°C.
  • the absorbed complement is centrifuged and stored at -20°C.
  • the tumor cells expressing human TF are labeled with 51 Cr, and washed.
  • a dilution series of the FVIIa polypeptide effector domain conjugate e.g.
  • FVIIa-Fc polypeptide is mixed with 0.1 ml complement (To measure ADCC freshly isolated peripheral blood leukocytes at a ratio of 60 leukocytes per tumor cell is added) and 0.1 ml of 5x10 6 labeled cells per ml, and incubated at 37°C for 30 min. The final volume is adjusted to 0.5 ml, and after mixing and centrifugation (150g for 10 min at 4°C), the released isotope in 0.1 ml supernatant is measured. The amount of 5 Cr released into the medium is used to calculate the % cytolysis as com- pared to a control.
  • Biosensor assay 5 (Assay 5):
  • TF antagonists are tested on the Biacore instrument by passing a standard solution of the TF antagonist over a chip with immobilized TF. This is followed by different concentra- tions of sTF in 10 mM hepes pH 7.4 containing 150 mM NaCl, 10 mM CaCI 2 and 0.0003 % polysorbate 20. Kd's are calculated from the sensorgrams using the integrated Biacore evaluation software. Inhibition of FVIIa/TF-induced p44/42 MAPK activation by TF antagonists with effector domain (Assay 6):
  • the amount of phosphorylated p44/42 MAPK and/or Akt, and/or p ⁇ ORSK is determined by quantitative detection of chemiluminescence (Fujifilm LAS-1000) from western blot analysis.
  • Cells expressing human TF e.g. CCD1102KerTr, NHEK P166, human glioblastoma cell line U87, or human breast cancer cell line MDA-MB231, are cultured in medium with 0 - 0.1 % FCS for 24 or 48 hours prior to the experiment to make cells quiescent. At the day of the experiment the cells must be 70-80% confluent.
  • the experiment is performed by prein- cubating the cells with excess TF antagonist or FFR-rFVIIa in medium without serum for 30 min at 37°C before addition of 10 - 100 nM FVIIa and incubating for 10 min.
  • As a positive control of cell signaling cells are treated with 10 % FCS for 10 minutes.
  • Cells are washed 2 times in ice-cold PBS before cells are lysed in lysis buffer (20 mM Tris, 0.1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 50 mM sodium-fluoride, 10 mM sodium ⁇ -glycerophosphate, 5 mM sodium pyrophosphate, 150 mM NaCl, pH 7.5 containing 0.1 mM 4-(2-aminoethyl)benzene- sulfonyl fluoride (AEBSF) and 1 mM benzamidine.
  • AEBSF 4-(2-aminoethyl)benzene- sulfonyl fluoride
  • lysates were mixed with SDS-sample buffer and loaded on a SDS-polyacrylamide gel. A standard biotinylated protein marker is loaded on each gel. Proteins separated on the SDS-polyacrylamide gel were transferred to nitrocellulose by electroblotting, and the kinases p44/42 MAPK, Akt and p90RSK were visu- alized by immunoblotting with phosphospecific antibodies, and chemiluminiscence is quaniti- ated by Fujifilm LAS1000.
  • a plasmid vector pFVII-Fc for expression of human FVII-human Fc(lgG1 ) fusion protein in mammalian cells is generated based on the pcDNA3.1+ plasmid vector (Invitrogen, Carlsbad, California).
  • the pFVII-Fc vector carries the cDNA nucleotide sequence encoding human FVII including the propeptide, fused to the Fc fragment of human lgG1 , under the control of a strong CMV promoter for transcription of the inserted cDNA, and neomycin phosphotransferase cDNA under the control of an SV40 early promoter for use as a selectable marker.
  • a FVII cDNA insert is generated from a full-length FVII cDNA plasmid (pLN174, Persson and Nielsen, 1996, FEBS Letters, 385, 241-243), but any full length FVII cDNA clone from e.g.
  • a human liver cDNA library could be used, by PCR using Expand High Fidelity (Roche).
  • the PCR product is generated using the oligonucleotides Primer 1 and 2, by procedures for preparing a DNA construct using polymerase chain reaction using specific primers that are well known to persons skilled in the art (cf. PCR Protocols, 1990, Academic Press, San Diego, California, USA):
  • Primer 1 5'- GCTAGCCACCATGGTCTCCCAGGCCCTCAG -3' (SEQ ID NO:2)
  • Primer 2 5'- CGAGCCCCATTTCCCGGATCCGCAGAGCCCAAATCTTGT -3' (SEQ ID NO:3)
  • This PCR reaction generates a FVII cDNA including an in-frame segment encoding
  • the Fc fragment of human lgG1 is amplified from a Human Lymph Node cDNA library (Clontech, BD Biosci- ences, Franklin Lakes, New Jersey, USA), but any cDNA library containing lgG1 could be used, using oligonucleotides Primer 3 and 4:
  • Primer 3 5'- CGAGCCCCATTTCCCGGATCCGCAGAGCCCAAATCTTGT -3' (SEQ ID NO:4)
  • Primer 4 5'- TTGCCGGCCGTCGCACTCATTTA -3' (SEQ ID NO:5)
  • This PCR reaction generates a cDNA sequence of the Fc fragment with the 3' terminal of human FVII cDNA and an in-frame segment encoding Gly-Ser-Ala, 5' to the human Fc cDNA sequence.
  • DNA from both PCR reactions are mixed and a new PCR reaction per- formed using Primer 1 and Primer 4, yielding a fusion protein containing the FVII cDNA, an in-frame segment encoding Gly-Ser-Ala, and a cDNA encoding the Fc fragment of human lgG1.
  • the PCR product is cloned into pCR2.1-TOPO using a topoisomerase cloning kit as per manufacture's instructions (Invitrogen, Carlsbad, California), resulting in an intermediate plasmid, pCR-FVII-Fc.
  • a topoisomerase cloning kit as per manufacture's instructions (Invitrogen, Carlsbad, California)
  • the procedure for moving the complete hFVII-hFc cDNA to pcDNA3.1+ using Nhel and EcoRI restriction enzymes is well known to persons skilled in the art (cf. Molecular Cloning, 2001 , Cold Spring Habor Laboratory Press, Cold Spring Habor, New York, USA):
  • the DNA fragment containing the FVII-Fc cDNA is isolated using agarose gel electrophoresis.
  • the purified insert is ligated into the Nhel and EcoRI site of pcDNA3.1 + vector using T4 DNA ligase and transformed into an appropriate E.coli strain, e.g. DH5 ⁇ or XLI BIue; plasmid vectors containing the desired cDNA sequence are identified and isolated using standard techniques and the sequence is verified by DNA sequencing.
  • the resulting expression vector, pFVII-Fc will encode the following protein:
  • the pFVII-Fc vector is transfected into CHO cells using Lipofectamine, or similar technique, and stable clones are isolated following neomycin selection. Clones secreting FVII-Fc are identified using a FVII ELISA and any high producing clones will be further sub- cloned to yield a clone with a high specific FVII-Fc expression in Dulbecco-modified Eagle's medium with 10 % fetal calf serum. The clone will subsequently be adapted to serum free suspension culture using a commercially available CHO medium (JRH Bioscience). The resulting recombinant FVII-Fc material can then be purified from the media using conventional methods (Thim, L. et al. Biochemistry (1988) 27:7785-93).
  • CHO cells or BHK cells are transfected with the pFVII-Fc vector essentially as previously described (Thim et al. (1988) Biochemistry 27, 7785-7793; Persson and Nielsen (1996) FEBS Lett. 385, 241-243) to obtain expression of FVII-Fc.
  • the FVII-Fc protein is purified as follows: Conditioned medium is loaded onto a 25-ml column of Protein-G Sepharose (Pharmacia Biotech) equilibrated in 20 mM Tris, 100 mM NaCl, pH 7.4. The column is washed in the equilibration buffer, and elution of the protein is accomplished by 0.1 M glycine, pH 2.7.
  • the pH in the fractions containing the FVII-Fc protein is adjusted to pH 7.5 by titration with 2 M Tris, and the pooled fractions are dialysed against 50 mM Hepes, pH 7.5, containing 10 mM CaCI 2 ,100 mM NaCl and 0.02% Triton X-100, before the application to a 25-ml column containing monoclonal antibody F1A2 (Novo Nordisk, Bagsvaerd, Denmark) coupled to CNBr- activated Sepharose 4B (Pharmacia Biotech).
  • the column is equilibrated with 50 mM Hepes, pH 7.5, containing 10 mM CaCI 2 ,100 mM NaCl and 0.02% Triton X-100. After washing with equilibration buffer and equilibration buffer containing 2 M NaCl, bound material is eluted with equilibration buffer containing 10 mM EDTA instead of CaCI 2 . Before use or storage, excess CaCI 2 over EDTA is added or FVII-Fc is transferred to a Ca 2+ -containing buffer. The yield of each step was followed by factor VII ELISA measurements and the purified protein was analysed by SDS-PAGE. Subsequent inactivation of the FVIIa moiety of FVII-Fc molecules by e.g. FFR-cmk are known to the person skilled in the art.
  • Catalyticaliy active FVIIa or FVIIa inhibited with FFR-cmk are mixed with a stoichiometric amount of an anti-FVII antibody (1 antigen binding site per FVII molecule) which do not prevent TF binding is dialyzed against reaction buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCI 2 , pH 7.5) to eliminate any free primary amines and the protein concentration is ad- justed to 2.4 ⁇ M.
  • reaction buffer 50 mM HEPES, 100 mM NaCl, 10 mM CaCI 2 , pH 7.5
  • the appropriate concentration of glutaraldehyde is determined by mixing equal volumes of the protein solution with aqueous glutaraldehyde solutions at different concentrations (500 mM to 32 ⁇ M) for 5 min at room temperature.
  • linkers contains two distinct functionalities, typically they contain one reacting with primary amines and a thiol-reagent (e.g. malemide, pyridyl or iodo-) or a photo-activated group.
  • Catalyticaliy active FVIIa, FVIIai or an anti FVII antibody which do not prevent TF binding, is suspended in dialyzed against reaction buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCI 2 , pH 7.5) to eliminate any free primary amines, and the protein concentration is adjusted to 2.4 ⁇ M. When dealing with an amine specific reagent, this moiety has to be reacted before any other functionality.
  • FVII need to be treated before addition of the antibody
  • a thiol containing inhibitor e.g. Ac-Cys-D-Phe-Phe.Arg- cmk
  • photoactivated linkers the order of reaction is not important.
  • concentration of X-linker is determined by mixing equal volumes of the protein solution with aqueous X-linker solutions at 2-4 fold excess and incubated for 1-2 hours at room temperature. The reaction is then quenched by addition of 10 mM NH OH followed by gelfiltration or dialysis to remove excess reagent.
  • the protein to be coupled is then added at stoichiometric amounts (i.e., 1 antigen binding site per FVII molecule).
  • stoichiometric amounts i.e., 1 antigen binding site per FVII molecule.
  • the intact antibody is first partially reduced by TCEP before addition to pre-labelled FVIIa and the resulting mixture is incubated over night at 4°C, while for photoactivated linkers the mixture is by exposed to long wave UV light for 15 minutes at a distance of 3.5 cm at room temperature
  • the extent of X-linking is then assessed by precipitation of an aliquot by adding 1 / 2 volume of 80% trichloroacetic acid and separation of the reaction products on a reducing SDS/PAGE or by analytical HPLC.
  • the reaction is scaled up using this particular concentration of X-linker and the components separated by binding of the complex to an anion exchange matrix in the presence of 10 mM EDTA and elution of the bound pro- tein by CaCI 2 to remove unbound anti-sera followed gelfiltration to separate complexes from free components.
  • the final product is analyzed for is ability to bind TF using BiaCore and other suitable assays which are well described in the literature.
  • X-linking via specifically derivatized FFR-cmk a) Thiol reactive moiety: The same basic scheme at described for thiol-specific reagents above, however, with the major exception that the thiol-reactive probe is introduced into FVIIa as part of a highly spe- cific active site inhibitor. The inhibitor is introduced into the active site of FVII as previously described for production of FVIIai or ASIS. b) Photoactivated moiety: The same basic scheme at described for thiol-specific reagents above, however, with the major exception that the photo-activated probe is introduced into FVIIa as part of a highly specific active site inhibitor. The inhibitor is introduced into the active site of FVII as previously described for production of FVIIai or ASIS.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des nouveaux composés qui se lient au facteur tissulaire (FT), inhibent son activité et participent indirectement à la réponse immunitaire cytolytique.
PCT/DK2003/000481 2002-07-12 2003-07-09 Compose de liaison au facteur tissulaire WO2004006962A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP03763617A EP1523504A2 (fr) 2002-07-12 2003-07-09 Compose de liaison au facteur tissulaire
AU2003242507A AU2003242507A1 (en) 2002-07-12 2003-07-09 A tissue factor binding immunoconjugate comprising factor viia

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA200201099 2002-07-12
DKPA200201099 2002-07-12

Publications (2)

Publication Number Publication Date
WO2004006962A2 true WO2004006962A2 (fr) 2004-01-22
WO2004006962A3 WO2004006962A3 (fr) 2004-03-18

Family

ID=30011019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2003/000481 WO2004006962A2 (fr) 2002-07-12 2003-07-09 Compose de liaison au facteur tissulaire

Country Status (3)

Country Link
EP (1) EP1523504A2 (fr)
AU (1) AU2003242507A1 (fr)
WO (1) WO2004006962A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1624891A2 (fr) * 2003-05-06 2006-02-15 Syntonix Pharmaceuticals, Inc. Proteines chimeriques a facteur de coagulation-region constante (fc) destinees au traitement de l'hemophilie
WO2006074199A1 (fr) * 2005-01-05 2006-07-13 Syntonix Pharmaceuticals, Inc. Hybrides monomere-dimere chimeriques contenant une immunoglobuline
WO2007115953A1 (fr) * 2006-04-07 2007-10-18 Novo Nordisk Health Care Ag Complexe covalent du facteur vii et du facteur tissulaire
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US20120142593A1 (en) * 2009-03-24 2012-06-07 Bayer Healthcare Llc Factor VIII Variants and Methods of Use
WO2013051900A2 (fr) 2011-10-06 2013-04-11 Hanmi Science Co., Ltd. Dérivés du facteur vii et viia de coagulation sanguine, conjugués et complexes comprenant ceux-ci, et leur utilisation
CN103397009A (zh) * 2013-08-16 2013-11-20 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
CN103599527A (zh) * 2013-08-16 2014-02-26 安源生物科技(上海)有限公司 包含改良型人凝血因子FVII-Fc融合蛋白的药物组合物
AU2010332959B2 (en) * 2009-12-18 2015-08-06 Csl Ltd. Method of purifying polypeptides
CN108024994A (zh) * 2015-07-22 2018-05-11 埃科尼克医疗股份有限公司 治疗与血管发生和新血管形成相关的病症的方法
JP2020537640A (ja) * 2017-09-27 2020-12-24 オハイオ・ステイト・イノベーション・ファウンデーション 組織因子標的化ｃａｒ−ｎｋ及びｃａｒ−ｔ細胞療法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996012800A1 (fr) * 1994-10-24 1996-05-02 Zymogenetics, Inc. Facteur vii modifie
WO2001002439A1 (fr) * 1999-07-01 2001-01-11 Yale University Immunoconjugues cibles neovasculaires
WO2001021661A1 (fr) * 1999-09-20 2001-03-29 Novo Nordisk A/S INHIBITEUR BIVALENT DU COMPLEXE FVIIa/TF/FXa

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996012800A1 (fr) * 1994-10-24 1996-05-02 Zymogenetics, Inc. Facteur vii modifie
WO2001002439A1 (fr) * 1999-07-01 2001-01-11 Yale University Immunoconjugues cibles neovasculaires
WO2001021661A1 (fr) * 1999-09-20 2001-03-29 Novo Nordisk A/S INHIBITEUR BIVALENT DU COMPLEXE FVIIa/TF/FXa

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ZHIWEI HU ET AL: "Intratumoral injection of adenoviral vectors encoding tumor-targeted immunoconjugates for cancer immunotherapy" PNAS, vol. 97, no. 16, 1 August 2000 (2000-08-01), pages 9221-9225, XP002262741 *
ZHIWEI HU ET AL: "Targeting tissue factor on tumor vascular endothelial cells and tumor cells for immunotherapy in mouse models of prostatic cancer" PNAS, vol. 98, no. 21, 9 October 2001 (2001-10-09), pages 12180-12185, XP002262739 -& DATABASE EMBL [Online] SWALL accession no. Q96PQ8, 98% identity in 641aa overlap; XP002262742 *
ZHIWEI HU ET AL: "Targeting tumor vasculature endothelial cells and tumor cells for immunotherapy of human melanoma in a mouse xenograft model" PNAS, vol. 96, no. 14, 6 July 1999 (1999-07-06), pages 8161-8166, XP002262740 *

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9725496B1 (en) 2003-05-06 2017-08-08 Bioverative Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP2298347A1 (fr) * 2003-05-06 2011-03-23 Syntonix Pharmaceuticals, Inc. Protéines chimériques du facteur VII-Fc de la coagulation pour le traitement d'un trouble de l'hémostase
EP1624891A4 (fr) * 2003-05-06 2007-06-06 Syntonix Pharmaceuticals Inc Proteines chimeriques a facteur de coagulation-region constante (fc) destinees au traitement de l'hemophilie
EP3552627A1 (fr) * 2003-05-06 2019-10-16 Bioverativ Therapeutics Inc. Coagulation des protéines chimériques de facteur fc pour traiter l'hémophilie
US7348004B2 (en) 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US7404956B2 (en) 2003-05-06 2008-07-29 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP2077121A1 (fr) * 2003-05-06 2009-07-08 Syntonix Pharmaceuticals, Inc. Fusions protéiques chimères de facteur VII-Fc dans le traitement de maladies hémostatiques
US7820162B2 (en) 2003-05-06 2010-10-26 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US8449884B2 (en) 2003-05-06 2013-05-28 Syntonix Pharmaceuticals, Inc. Clotting factor-fc chimeric proteins to treat hemophilia
US11168125B2 (en) 2003-05-06 2021-11-09 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8329182B2 (en) 2003-05-06 2012-12-11 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US11401322B2 (en) 2003-05-06 2022-08-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP1624891A2 (fr) * 2003-05-06 2006-02-15 Syntonix Pharmaceuticals, Inc. Proteines chimeriques a facteur de coagulation-region constante (fc) destinees au traitement de l'hemophilie
US9636416B2 (en) 2003-05-06 2017-05-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP3002012A1 (fr) * 2003-05-06 2016-04-06 Biogen Hemophilia Inc. Coagulation des protéines chimériques de facteur fc pour traiter l'hémophilie
US8815250B2 (en) 2003-05-06 2014-08-26 Biogen Idec Hemophilia Inc. Clotting factor-Fc chimeric proteins to treat hemophilia
US8932830B2 (en) 2003-05-06 2015-01-13 Biogen Idec Hemophilia, Inc. Immunoglobulin chimeric monomer-dimer hybrids
WO2006074199A1 (fr) * 2005-01-05 2006-07-13 Syntonix Pharmaceuticals, Inc. Hybrides monomere-dimere chimeriques contenant une immunoglobuline
WO2007115953A1 (fr) * 2006-04-07 2007-10-18 Novo Nordisk Health Care Ag Complexe covalent du facteur vii et du facteur tissulaire
US20120142593A1 (en) * 2009-03-24 2012-06-07 Bayer Healthcare Llc Factor VIII Variants and Methods of Use
EP3715356A1 (fr) * 2009-12-18 2020-09-30 CSL Limited Procédé de purification de polypeptides
EP2513135B1 (fr) * 2009-12-18 2020-04-22 CSL Limited Procédé de purification de polypeptides
AU2010332959B2 (en) * 2009-12-18 2015-08-06 Csl Ltd. Method of purifying polypeptides
EP3417881A1 (fr) * 2011-10-06 2018-12-26 Hanmi Science Co., Ltd. Dérivés du facteur vii et viia de coagulation sanguine, conjugués et complexes les comprenant et utilisation associée
WO2013051900A2 (fr) 2011-10-06 2013-04-11 Hanmi Science Co., Ltd. Dérivés du facteur vii et viia de coagulation sanguine, conjugués et complexes comprenant ceux-ci, et leur utilisation
TWI565715B (zh) * 2011-10-06 2017-01-11 韓美科學股份有限公司 凝血因子VII及VIIa之衍生物、接合物及含該接合物之複合物與其用途
US9597378B2 (en) 2011-10-06 2017-03-21 Hanmi Science Co., Ltd. Blood coagulation factor VII and VIIa derivatives, conjugates and complexes comprising the same, and use thereof
AU2012319308B2 (en) * 2011-10-06 2017-08-31 Hanmi Science Co., Ltd. Blood coagulation factor VII and VIIa derivatives, conjugates and complexes comprising the same, and use thereof
EP2763693A4 (fr) * 2011-10-06 2015-12-09 Hanmi Science Co Ltd Dérivés du facteur vii et viia de coagulation sanguine, conjugués et complexes comprenant ceux-ci, et leur utilisation
CN104774269A (zh) * 2013-08-16 2015-07-15 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
CN103397009A (zh) * 2013-08-16 2013-11-20 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
CN103599527A (zh) * 2013-08-16 2014-02-26 安源生物科技(上海)有限公司 包含改良型人凝血因子FVII-Fc融合蛋白的药物组合物
CN103397009B (zh) * 2013-08-16 2015-06-03 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
CN104774269B (zh) * 2013-08-16 2016-02-24 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
US20180207292A1 (en) * 2015-07-22 2018-07-26 Iconic Therapeutics, Inc. Methods for treating disorders associated with angiogenesis and neovascularization
EP3324960A4 (fr) * 2015-07-22 2019-01-23 Iconic Therapeutics, Inc. Procédés permettant de traiter des troubles associés à l'angiogenèse et à une néovascularisation
CN108024994A (zh) * 2015-07-22 2018-05-11 埃科尼克医疗股份有限公司 治疗与血管发生和新血管形成相关的病症的方法
JP2020537640A (ja) * 2017-09-27 2020-12-24 オハイオ・ステイト・イノベーション・ファウンデーション 組織因子標的化ｃａｒ−ｎｋ及びｃａｒ−ｔ細胞療法

Also Published As

Publication number Publication date
WO2004006962A3 (fr) 2004-03-18
AU2003242507A8 (en) 2004-02-02
EP1523504A2 (fr) 2005-04-20
AU2003242507A1 (en) 2004-02-02

Similar Documents

Publication Publication Date Title
US20220073895A1 (en) Human coagulation factor vii polypeptides
JP4537059B2 (ja) ヒト凝固第ｖｉｉ因子ポリペプチド
US9376672B2 (en) Coagulation factor IX compositions and methods of making and using same
JP4597678B2 (ja) ヒト凝固因子ｖｉｉポリペプチド
AU761027B2 (en) Expression and export of angiostatin and endostatin as immunofusis
JP4361730B2 (ja) ビタミンｋ−依存性タンパク質の生成方法
CA2764758C (fr) Molecules chimeriques du facteur vii
EP1451315B1 (fr) Polypeptides du facteur vii de coagulation humain
US20060024730A1 (en) TF binding compounds
KR20030085041A (ko) 응고 인자 ⅶ 유도체
US20030100075A1 (en) Human coagulation factor VII polypeptides
US20060018831A1 (en) TF binding agent and use thereof
EP1744734A2 (fr) Polytherapie
WO2004006962A2 (fr) Compose de liaison au facteur tissulaire
Runge et al. Plasminogen activators. The old and the new.
US20040072755A1 (en) TF antagonist
WO2004007557A2 (fr) Antagoniste du facteur tissulaire
EP1485476A2 (fr) Dimeres antagonistes du tf
US20030229018A1 (en) Dimeric TF antagonist
EP4172179A1 (fr) Compositions bispécifiques ciblées her-2 et procédés de fabrication et d'utilisation de celles-ci
Activators Ei Research AdvancesSeries

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003763617

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003763617

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

WWW Wipo information: withdrawn in national office

Ref document number: 2003763617

Country of ref document: EP