WO2003062410A2 - Proteine torero - Google Patents

Proteine torero Download PDF

Info

Publication number
WO2003062410A2
WO2003062410A2 PCT/GB2003/000317 GB0300317W WO03062410A2 WO 2003062410 A2 WO2003062410 A2 WO 2003062410A2 GB 0300317 W GB0300317 W GB 0300317W WO 03062410 A2 WO03062410 A2 WO 03062410A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
torero
nucleic acid
disease
activity
Prior art date
Application number
PCT/GB2003/000317
Other languages
English (en)
Other versions
WO2003062410A3 (fr
Inventor
Stephen Cohen
Antonio Giraldez Arellano
Richard Copley
Original Assignee
European Molecular Biology Laboratory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by European Molecular Biology Laboratory filed Critical European Molecular Biology Laboratory
Priority to AU2003202694A priority Critical patent/AU2003202694A1/en
Publication of WO2003062410A2 publication Critical patent/WO2003062410A2/fr
Publication of WO2003062410A3 publication Critical patent/WO2003062410A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel regulator protein and to nucleic acid that encodes this protein.
  • the invention also relates to methods of diagnosis and therapy of disease using this protein and nucleic acids encoding therefor.
  • Secreted signaling proteins of the Sonic Hedgehog/Hedgehog, Wingless/Wnt and Dpp/BMP/nodal families function as morphogens during animal development. In some cases these proteins have been shown to form extracellular gradients that instruct cells in developing tissues about their prospective fate (Strigini and Cohen, 1999; Entchev et al, 2000; Teleman and Cohen, 2000; Lewis et al., 2001, Chen and Shier 2001, reviewed in Teleman et al, 2001).
  • Hedgehog signaling induces elevated expression of its receptor Patched in nearby cells. Patched binds Hedgehog and thereby limits its range of movement (Briscoe et al, 2001; Chen and Struhl, 1996).
  • the Dpp receptor, Thickveins is also capable of sequestering Dpp and limiting its movement (Lecuit and Cohen, 1998).
  • Dpp signaling represses Thickveins expression to allow formation of a long-range gradient.
  • Wg signaling represses Dfz2. Elevated Dfz2 levels in distant cells stabilize Wg to promote formation of a long-range gradient (Cadigan et al, 1998).
  • the shape of ligand gradients can also be controlled by secreted and cell surface proteins distinct from the receptors.
  • the Dpp/BMP-binding binding proteins Chordin Sog and Twisted Gastrulation act together with the protease Tolloid to shape the Dpp/BMP gradient in early embryos (Ashe and Levine, 1999; Oelgeschlager et al, 2000; Decotto and Ferguson, 2001; Ross et al, 2001).
  • Other ligand binding proteins that contribute to spatial regulation of signaling in vertebrate embryos include Wnt-binding inhibitors of the sFRP and W ⁇ F families and Cerberus, which binds both Wnt, BMP and Nodal ligands (reviewed in Niehrs, 1999).
  • Members of the Dkk family of Wnt inhibitors act by competing for binding to LRP6, an essential component of the Wnt receptor (Mao et al, 2001).
  • Heparan Sulfate Proteoglycans can influence ligand-receptor interactions (reviewed in Selleck, 2001). Fibroblast growth factors require HSPGs as cofactors for interaction with their receptors (Plotnikov et al, 1999). Embryos mutant for genes that affect HSPG synthesis are defective in FGF function (Lin et al, 1999). Wg protein binds tightly to glycosaminoglycans (GAGs; Reichsman et al, 1996) and embryos defective in HSPG synthesis show reduced sensitivity to Wg (Binari et al., 1997; hacker et al, 1997; Haerry et al, 1997).
  • the Drosophila sulfateless gene encodes the enzyme N-deacetylase N-sulfotransferase (NDST), which replaces acetyl groups of N-acetylglucosamine (GlcNAc) residues with sulfate groups and thus plays an important early role in modification of the GAG side chains in HSPGs.
  • NDST N-deacetylase N-sulfotransferase
  • HSPGs produced by the GlcNAc/GlcA polymerase Ext Tout velu are required for movement of Hedgehog in the anterior compartment of wing disc (Bellaiche et al, 1998; The et al, 1999). Thus HSPGs appear to play a role in formation of morphogen gradients.
  • the Dally and Dally- like genes encode GPI-anchored proteins of the glipican family that are required in the embryo for cells to have normal sensitivity to Wg (Baeg et al, 2001 ; Lin and Perrimon, 1999; Tsuda et al, 1999). Although it is required for normal Wg activity, Dally has a limited capacity to increase the level of extracellular Wg binding to cells when overexpressed in the wing disc (Strigini and Cohen, 1999). In contrast, cells overexpressing the Dally-like protein, (abbreviated Dly), accumulate Wg to considerably higher levels than surrounding cells (Baeg et al, 2001).
  • Dly may help increase the local concentration of Wg near the cell surface and provide a pool of Wg protein that can become available for receptor binding on release from the HSPG.
  • HSPGs may have a role in gradient formation. It is likely that genes encoding proteins that regulate or comprise the Wingless/Wnt pathway may be associated with various disease states. Identification of genes that modify Wingless/Wnt activity may thus provide the basis for a nucleic acid or protein diagnostic or therapeutic tool.
  • Wingless/Wnt signalling pathway ectopic activation of the Wingless/Wnt signalling pathway in different cells types is known to lead to cancer in different tissues, including colorectal cancer, melanoma, lymphoma, meduloblastoma, hepatoblastoma and ovarian carcinoma among others (Wodarz and Nusse, 1998; Polakis, 2000). It has also been observed that the overexpression of Wntl [Wntl being the closest vertebrate homologue of Wg] due to retroviral insertion is known to cause mammary tumours in mice. There is thus a need for the identification of molecules that are involved in, or affect, the Wingless/Wnt pathway and that may provide the basis for a diagnostic or therapeutic tool.
  • Torero can act by competing with the enzyme NDST/Sulfateless for post-translational modification of Dally-like. Coexpression with Torero reduces the ability of Dly to bind extracellular Wg. Thus, Torero activity helps to shape the extracellular Wg gradient by modifying cell surface proteoglycans. It can be predicted that homologues of Drosophila Torero will allow the possibility to modulate the activity of extracellular Wnt proteins in vertebrates, including humans.
  • the human Torero gene is in the chromosome 17 location q25, in one of the introns for the glucagon receptor.
  • Ensembl gene ENSG00000141594 http://www.ensembl.org
  • ENSG00000141594 is the predicted human Torero protein.
  • Ensembl gene ENSG00000141594 comprises two incorrect amino acid insertions caused by apparently missed introns when compared to our predicted human Torero amino acid sequence.
  • the sequence of the predicted Torero gene in Drosophila has the FlyBase accession number FBgn0036559 and is referred to as gene CG13076 on the FlyBase database.
  • gene CG13076 on the FlyBase database.
  • the predicted CGI 3076 gene is not biologically active.
  • our predicted fly Torero polypeptide set forth in SEQ ID NO. 1, which has a different exon 1 from the predicted CG13076 gene is active in the same in vivo assay.
  • the region depicted in the sequence alignment of Figure 7 is the domain thought to be responsible for the catalytic activity of Torero. Regions of sequence conservation are dispersed throughout this domain. Asp 338 and His 384 of Torero are likely to form part of the active site together with Ser 237. There is a conserved Cysteine at position 100 that may also be important. Polypeptides including one, two, three or all four of these residues form a preferred aspect of the invention.
  • Torero protein may provide the basis for the development of methods and compositions useful in the diagnosis, prevention or treatment of various diseases in both vertebrates (e.g. humans) and invertebrates. Such methods and compositions are described below in relation to the various aspects of the invention.
  • diagnosis may include diagnosing a patient as suffering from a disease and diagnosing a patient as having a predisposition to a disease.
  • prevention is not intended to be restricted to the meaning that the patient will not, or is less likely to, go on to develop the disease; rather the term is intended to have a broader meaning to include the situation where the onset of disease in a patient is delayed.
  • treatment may include ameliorative and curative treatment.
  • diseases which may be diagnosed, prevented or treated in accordance with the present invention may include diseases in vertebrates (e.g. humans) and invertebrates. More specifically diseases which may be diagnosed, prevented or treated in accordance with the present invention may include diseases falling within one or more of the following categories: diseases associated with aberrant Wg/Wnt signalling; diseases associated with aberrant Wg/Wnt accumulation (e.g. aberrant extracellular accumulation and/or decreased or increased Wg/Wnt accumulation); diseases associated with aberrant Wg/Wnt production (e.g. aberrant extracellular production and/or decreased or increased Wg/Wnt production); diseases associated with aberrant Torero polypeptide expression (e.g. aberrant expression of a temporal, spatial or quantitative nature, e.g.
  • Wnt signalling or the “Wingless pathway” we not only refer to Wingless signalling / the Wingless pathway in Drosophila, but we refer to equivalent / homologous pathways in other organisms, such as Wnt signalling / the Wnt pathway in vertebrates, such as in humans. There are many Wnt proteins and at least 3 characterised Wnt signal transduction pathways.
  • the "canonical” Wnt pathway involves Frizzled-type receptors, Dsh, beta-catenin and LEF-1 (reviewed in Taipale J, Beachy PA. The Hedgehog and Wnt signalling pathways in cancer. Nature. 2001 411 :349-54.).
  • the Wnt/planar cell polarity pathway also involves Frizzled-type receptors, Dsh, then small GTPases of the Rac/Rho family and the INK pathway (McEwen DG, Peifer M.Wnt signaling: Moving in a new direction. Curr Biol.2000 10:R562-4.)
  • the third pathway involves heterotrimeric G proteins (reviewed in Malbon CC, Wang H, Moon RT. Wnt signaling and heterotrimeric G-proteins: strange bedfellows or a classic romance? Biochem Biophys Res Commun. 2001 287:589-93.)
  • the "Wnt pathway” is the "canonical” Wnt pathway.
  • a reference to "Wnt signalling” or a to a Wnt protein / gene is a reference to Wnt signalling and the Wnt protein/gene of the canonical Wnt pathway respectively.
  • the "Wnt pathway" is a reference to the Wnt/planar cell polarity pathway and/or the third Wnt pathway mentioned above which involves heterotrimeric G proteins.
  • a reference to "Wnt signalling" or a to a Wnt protein / gene may, in addition to, or as an alternative to, the Wnt signalling or the Wnt protein/gene of the canonical Wnt pathway, be a reference to Wnt signalling and the Wnt protein/gene of the Wnt/planar cell polarity pathway and/or be a reference to Wnt signalling or the Wnt protein/gene of the third Wnt pathway mentioned above which involves heterotrimeric G proteins.
  • the invention may have particular utility in diagnosing, treating or preventing cancer, such as cancer of the colon and other cancers where one of the first events is a mutation in beta-catenin or APC that activate the Wnt signalling pathway.
  • cancers include colorectal cancer, breast cancer, melanoma, lymphoma, meduloblastoma, hepatoblastoma and ovarian carcinoma among others.
  • Diagnosis of cancer may, for example, be achieved by measuring the levels or activity of Torero in a biological sample (eg extracts of cells or tissues, bodily fluids, blood, faeces, tissue, mucous, vaginal fluids, semen and urine) derived from the patient and comparing the levels and/or activity of the enzyme with standards.
  • a biological sample eg extracts of cells or tissues, bodily fluids, blood, faeces, tissue, mucous, vaginal fluids, semen and urine
  • the level or activity of the enzyme could, for example be assayed through an enzymatic test or an ELISA using plates coated with anti- Torero antibody.
  • Torero modifies the structure and stability of Heparan Sulfate Proteoglycans (HSPG).
  • HSPG Heparan Sulfate Proteoglycans
  • Torero could be the gene mutated in one or more of these diseases.
  • the invention may also have utility in the diagnosis, prevention and treatment of disorders involved in the formation/degradation of glucopolysaccharides (Mucopolysaccharidosis).
  • the invention may also have utility in the diagnosis, prevention and treatment of one or more of the following diseases: glycogen storage disease II, diabetes mellitus, atopic dermatitis, neuritis with brachial predilection, epidermodysplasia verruciformis, pseudoneonatal adernoleukodystrophy, Russell-Silver syndrome, campomelic dysplasia and adenomatous polyposis of the colon.
  • glycogen storage disease II glycogen storage disease II
  • diabetes mellitus atopic dermatitis
  • neuritis with brachial predilection epidermodysplasia verruciformis
  • pseudoneonatal adernoleukodystrophy Russell-Silver syndrome
  • campomelic dysplasia adenomatous polyposis of the colon.
  • (i) comprises or consists of the amino acid sequence as recited in SEQ. ID. No. 1 (Fly Torero polypeptide), SEQ. ID. No. 5 (partial human Torero polypeptide, lacking approximately the N-terminal 40-70aa), SEQ. ID. No. 7 (mouse Torero polypeptide) or the full length human Torero polypeptide (hereinafter referred to as the "full length human Torero polypeptide”) comprising the amino acid sequence recited in SEQ. ID. No. 5 in addition to the 5'UTR, start codon and signal peptide of human Torero polypeptide;
  • (ii) comprises or consists of a fragment of a polypeptide of (i) having Torero polypeptide activity or having an antigenic determinant in common with an amino acid sequence as recited in SEQ. ID. No. 1, SEQ. ID. No. 5, SEQ. ID. No. 7 or the full length human Torero polypeptide;
  • (iii) is a functional equivalent of (i) or (ii) having Torero polypeptide activity or having an antigenic determinant in common with an amino acid sequence as recited in SEQ. ID. No. 1, SEQ. ID. No. 5, SEQ. ID. No.7 or the full length human Torero polypeptide;
  • (iv) comprises or consists of a naturally occurring polypeptide which is a mutated version of a wild type Torero polypeptide and which naturally occurring polypeptide has aberrant biological activity;
  • (v) comprises or consists of a functional equivalent of (iv) which functional equivalent mimics the aberrant biological activity of the naturally occurring polypeptide of (iv) or which functional equivalent has an antigenic determinant in common with the naturally occurring polypeptide of (iv), which antigenic determinant is may or may not be shared with the corresponding wild type Torero polypeptide.
  • isolated polypeptide By an “isolated polypeptide” is meant a polypeptide which is devoid of, in whole or part, tissue or cellular components with which the polypeptide is normally associated in nature. Thus, a polypeptide contained in a tissue extract would constitute an “isolated” polypeptide, as would a polypeptide synthetically or recombinantly produced.
  • isolated does not denote the method by which the polypeptide is obtained or the level of purity of the preparation. Thus, such isolated species may, for example, be produced recombinantly, isolated directly from the cell or tissue of interest or produced synthetically based on the determined sequences.
  • Torero polypeptide includes naturally occurring, wild type Torero polypeptides and more specifically naturally occurring vertebrate (preferably human) and invertebrate homologues of the Drosophila Torero polypeptide having Torero polypeptide activity (eg the mouse Torero polypeptide set forth in SEQ ID No. 7 and the full length human Torero polypeptide).
  • the term "Torero polypeptide” includes naturally occurring polypeptides that comprise or consist of the amino acid sequences recited in SEQ. ID. No. 1 (Drosophila Torero polypeptide); SEQ. ID. No. 5 (partial human Torero polypeptide) and SEQ. ID. No. 7 (mouse Torero polypeptide), including naturally occurring mature, pre-, pro- or prepro- versions of the aforementioned amino acid sequences.
  • Troro polypeptide also includes naturally occurring mutated versions of the aforementioned polypeptides, which mutated versions have aberrant biological activity compared to the corresponding wild type polypeptide.
  • a naturally occurring polypeptide does not denote the method by which the polypeptide is obtained.
  • a naturally occurring polypeptide may, for example, be produced recombinantly, isolated directly from the cell or tissue of interest or produced synthetically based on the determined sequences.
  • naturally occurring polypeptide is intended to refer to polypeptides consisting of a naturally occurring amino acid sequence.
  • a polypeptide having "aberrant biological activity” we include polypeptides whose activities are quantitatively or qualitatively different, or both, as compared with a wild type Torero polypeptide.
  • a polypeptide according to (iv) or (v) above has increased or decreased activity as compared with the corresponding wild type Torero polypeptide.
  • the aberrant biological activity of the polypeptide according to (iv) or (v) above is associated with a disease such that an individual expressing that polypeptide may be predisposed to a disease or may be suffering from a disease as a result of the aberrant biological activity.
  • the disease is a human disease.
  • the disease is cancer.
  • the disease is a disorder involved in the formation/degradation of glucopolysaccharides (Mucopolysaccharidosis).
  • the disease is Schimke Immunoosseous Dysplasia; Mucosulfatidosis or Sulfatidosis Juvenile, Austin Type; Progressive Mucinous Istiocytosis; Geleophysic Dysplasia; Hypertrichotic Osteochondrodysplasia;; Juvenile Hyaline Fibromatosis; Alder Anomaly; or Winchester Disease.
  • the disease results from a defect in Hyaluronan Metabolism.
  • the full length human Torero polypeptide sequence and the cDNA sequence of the human Torero polypeptide will be able to be readily devised by those skilled in the art.
  • the full length cDNA can be obtained by (1) isolation of cDNA clones by screening of conventional cDNA libraries by conventional methods, (2) by 5'RACE.
  • polypeptide which polypeptide:
  • (iii) is a functional equivalent of (i) or (ii) having Torero polypeptide activity. wherein if the polypeptide is a naturally occurring polypeptide it is an isolated polypeptide.
  • the second aspect of the invention relates to the golgi tethered form of Drosophila Torero polypeptide.
  • golgi-tethered forms of other Torero polypeptides eg of the human Torero polypeptide
  • Torero polypeptides eg of the human Torero polypeptide
  • Those skilled in the art will readily be able to devise methods of synthesising golgi-tethered forms of Torero (for example, see Bruckner et al, Nature. 2000; 406(6794): 411-5).
  • golgi-tethered human Torero could be prepared by fusing amino acids 1-122 of GalNAc-T3 (accession# GI: X92689) in frame with the human Torero sequence in the place corresponding to aa 58 of Drosophila Torero. It might be necessary to use a full length Human protein beginning at the amino acid after the signal peptide.
  • polypeptide having "Torero polypeptide activity” we include polypeptides having any combination of one, two, three, four, five, six, seven or eight of the following activities:
  • ⁇ / ⁇ hydrolase activity preferably glycosaminoglycan deacetylase activity
  • Gallus gallus 'GLYPICAN-1 PRECURSOR HEPARAN SULFATE PROTEOGLYCAN CORE PROTEPN
  • SWP:P50593 gi:1707999
  • polypeptide includes any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e. peptide isosteres. This term refers both to short chains (peptides and oligopeptides) and to longer chains (proteins).
  • polypeptide and protein are used interchangeably herein.
  • polypeptides of the present invention may be in the form of a mature protein or may be a pre-, pro- or prepro- protein that can be activated by cleavage of the pre-, pro- or prepro- portion to produce an active mature polypeptide.
  • the pre-, pro- or prepro- sequence may be a leader or secretory sequence or may be a sequence that is employed for purification of the mature polypeptide sequence.
  • Polypeptides may contain amino acids other than the 20 gene-encoded amino acids, modified either by natural processes, such as by post-translational processing or by chemical modification techniques which are well known in the art.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • blockage of the amino or carboxyl terminus in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention.
  • polypeptides of the present invention can be prepared in any suitable manner.
  • Such polypeptides include isolated naturally occurring polypeptides (for example purified from cell cultures), recombinantly-produced polypeptides (including fusion proteins), synthetically- produced polypeptides or polypeptides that are produced by a combination of these methods.
  • the functionally equivalent polypeptides of the first and second aspect of the invention may be polypeptides that are homologous to a Torero polypeptide, preferably a Torero polypeptide as recited as recited in SEQ ID NO. 1, SEQ ID NO. 5, SEQ ID NO. 7, or the full length human Torero polypeptide.
  • Two polypeptides are said to be "homologous", as the te ⁇ n is used herein, if the sequence of one of the polypeptides has a high enough degree of identity or similarity to the sequence of the other polypeptide. "Identity” indicates that at any particular position in the aligned sequences, the amino acid residue is identical between the sequences. "Similarity” indicates that, at any particular position in the aligned sequences, the amino acid residue is of a similar type between the sequences. Degrees of identity and similarity can be readily calculated (Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing.
  • Homologous polypeptides therefore include natural biological variants (for example, allelic variants or geographical variations within the species from which the polypeptides are derived) and mutants (such as mutants containing amino acid substitutions, insertions or deletions) of a Torero polypeptide (preferably as recited in SEQ ID NO. 1, 5 or 7, or the full length human Torero polypeptide), or of a fragment of a Torero polypeptide (preferably as recited in SEQ ID NO. 1, 5 or 7, or the full length human Torero polypeptide).
  • a Torero polypeptide preferably as recited in SEQ ID NO. 1, 5 or 7, or the full length human Torero polypeptide
  • a Torero polypeptide preferably as recited in SEQ ID NO. 1, 5 or 7, or the full length human Torero polypeptide
  • Such mutants may include polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
  • conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code.
  • conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code.
  • conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • conservative substitutions is intended combinations such as Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Particularly preferred are mutants in which several, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9
  • substitutions, additions and deletions which result in a protein whose basic properties, for example enzymatic activity (type of and specific activity), thermostability, activity in a certain pH-range (pH-stability) have not been altered.
  • Such mutants also include polypeptides in which one or more of the amino acid residues includes a substituent group.
  • functionally equivalent polypeptides of the first aspect or second of the invention have a degree of sequence identity with a Torero polypeptide (preferably as recited in SEQ ID NO. 1, SEQ ID NO. 5, SEQ ID NO. 7, or the full length human Torero polypeptide), and/or with active fragments thereof, of greater than 10% (preferably, over a specified region).
  • a Torero polypeptide preferably as recited in SEQ ID NO. 1, SEQ ID NO. 5, SEQ ID NO. 7, or the full length human Torero polypeptide
  • More preferred polypeptides have (i) degrees of identity of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% with a Torero polypeptide; and/or (ii) degrees of identity of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% with active fragments of a Torero polypeptide.
  • preferred active fragments of the Torero polypeptides are those that include the catalytic residues Ser237, Asp338 and His384, or equivalent residues, and which possess Torero polypeptide activity and/or which has an antigenic determinant in common an amino acid sequence as recited in SEQ. ID. No. 1, SEQ. ID. No. 5, SEQ. ID. No. 7, the full length human Torero polypeptide; or a naturally occurring polypeptide according to (iv) of the first aspect of the invention.
  • the active fragment comprises or consists of the amino acid residues 93 to 413 of the fly Torero polypeptide sequence as set forth in SEQ JJD NO. 1.
  • equivalent residues to the residues Ser237, Asp338 and His384, we include the equivalent Ser, Asp and His residues in non-fly Torero polypeptides which form a catalytic triad.
  • the putative active site residues of these sequences marked with a black diamond in Figure 7.
  • residues Ser237, Asp338 and His384 we also include residues which may replace residues Ser237, Asp338 or His384 residues (or the putative active site residues of the fly and mouse polypeptide sequences marked with a black diamond in Figure 7) in a naturally occurring Torero polypeptide, provided that the protein retains Torero polypeptide activity.
  • the Histidine residue may be replaced by Lysine or Arginine.
  • the Aspartate residue may be replaced by Glutamate or His.
  • the Serine residue may be replaced by Threonine'
  • the length of the region conserved in the identified Torero proteins is around 325 amino acids.
  • the most distinctive sequence feature is a very conserved block of small residues flanking a central serine, roughly a third of the way along the sequences (Fig 7).
  • Many of the identified Torero proteins also share an additional conserved C-terminal cysteine rich motif of around 15 residues, found after the coiled-coil insert of Torero (not shown).
  • the functional equivalents of the first and second aspect of the invention comprise a conserved G-X--S-X-G 2 motif.
  • Xi is S.
  • X 2 A.
  • X- C.
  • the functional equivalents of the first and second aspect of the invention comprise the catalytic residues Ser237, Asp338 and His384, or equivalent residues, and possess Torero polypeptide activity and/or have an antigenic determinant in common an amino acid sequence as recited in SEQ. ID. No. 1, SEQ. ID. No. 5, SEQ. ID. No. 7, the full length human Torero polypeptide; or a naturally occurring polypeptide according to (iv) of the first aspect of the invention.
  • the polypeptides of the first and second aspects of the invention include fragments of a Torero polypeptide (preferably of a Torero polypeptide recited in SEQ ID NO.l, 5 or 7, or of the full length human Torero polypeptide), functional equivalents of the fragments of a Torero polypeptide (preferably of a Torero polypeptide recited in SEQ ID NO.l, 5 or 7, or of the full length human Torero polypeptide), and fragments of the functional equivalents of a Torero polypeptide (preferably of a Torero polypeptide recited in SEQ ID NO.l, 5 or 7), provided that those functional equivalents and fragments retain Torero polypeptide activity or have an antigenic determinant in common with an amino acid sequence as recited in SEQ ID NO.l, 5 or 7, or with an amino acid sequence described in embodiment (iv) of the first aspect of the invention.
  • fragment refers to a polypeptide having an amino acid sequence that is the same as part, but not all, of the amino acid sequence of a Torero polypeptide or one of its functional equivalents. Accordingly, fragments containing one or more single or multiple amino acid deletions from either terminus (or from internal stretches of) a Torero polypeptide or one of its functional equivalents form one aspect of the invention.
  • the fragments should comprise at least n consecutive amino acids from the Torero polypeptide and, depending on the particular sequence, n preferably is 5 or more (for example, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30 or more). Small fragments may form an antigenic determinant.
  • the fragments of the first and second aspect of the invention comprise an antigenic determinant such that the fragment may be used to raise an antibody that is immunospecific for a polypeptide according to the first or second aspect of the invention, such as a Torero polypeptide.
  • an antibody “immunospecific for a polypeptide according to the first or second aspect of the invention, such as a Torero polypeptide” we include antibodies which have a higher affinity for a Torero polypeptide or a polypeptide according to the first or second aspect of the invention than for unrelated polypeptides of the prior art.
  • higher affinity we refer to at least a 2 fold, preferably 4, 8, 10 fold higher affinity.
  • the polypeptides of the first and second aspect of the invention include variants of the Torero polypeptides or fragments thereof, functional equivalents of the variants of the Torero polypeptides or of variants of Torero polypeptide fragments, and fragments of the aforementioned polypeptides.
  • Such polypeptides are subject to the proviso that they have Torero polypeptide activity, have an antigenic determinant in common with an amino acid sequence as recited in SEQ ID NO.
  • variants including mutants containing one or more single or multiple amino acid substitutions, insertions or deletions from the aforementioned polypeptides are included within the scope of the first and second aspects of the invention.
  • Such variants may include polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residues may or may not be one encoded by the genetic code.
  • conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • conservative substitutions is intended combinations such as Gly, Ala; Val, He, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Particularly preferred are mutants in which several, i.e.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids are substituted, deleted and/or added in any combination.
  • substitutions, additions and deletions which result in a protein whose basic properties, for example enzymatic activity (type of and specific activity), thermostability, activity in a certain pH-range (pH-stability) have not been altered.
  • the polypeptides of the first and second aspect of the invention may form part of a fusion protein.
  • Such fusion proteins may include one or more additional peptides fused at either or both of the amino- or carboxy- terminus of the proteins (or inserted into the middle).
  • additional amino acid sequences which may contain secretory or leader sequences, pro-sequences, sequences which aid in purification, detection, expression, separation of the protein or sequences that confer higher protein stability, for example during recombinant production, or other additional properties as desired.
  • the polypeptide of the first and second aspect of the invention may be fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
  • a protein according to the first or second aspect of the present invention may be fused to an effector or reporter molecule such as a label, toxin or bioactive molecule.
  • an effector or reporter molecule such as a label, toxin or bioactive molecule.
  • the purpose of the additional polypeptide may be to aid detection, expression, separation or purification of the protein or may be to lend additional properties to the protein as desired.
  • Suitable candidates for fusion may include reporter molecules such as luciferase, green fluorescent protein, or horse radish peroxidase. Labels of choice may be radiolabels or molecules that are detectable spectroscopically, for example fluorescent or phosphorescent chemical groups. Linker molecules such as streptavidin or biotin may also be used.
  • peptides or polypeptides may be fused to a polypeptide of the first or second aspect of the invention.
  • Suitable peptides may be, for example, beta-galactosidase, glutathione-S-transferase, luciferase, polyhistidine tags, secretion signal peptides, the Fc region of an antibody, the FLAG peptide, cellulose binding domains, cafmodulin and the maltose binding protein.
  • Antibodies or peptides used to target a protein of the first or second aspect of the invention more efficiently towards a site of action may also be fused to the aforementioned polypeptides.
  • These fusion molecules may be fused chemically, using methods such as chemical crosslinking. Suitable methods will be well known to those of skill in the art and are generally described in O'Sullivan et al Anal. Biochem. (1979) 100, 100-108. Suitable methods include cross-linking of the thiol groups of cysteine residues or cross-linking using formaldehydes. Chemical cross-linking will in most instances be used to fuse non-protein compounds, such as cyclic peptides and labels.
  • the method of choice will often be to fuse the molecules genetically.
  • the genes or gene portions that encode the proteins or protein fragments of interest are engineered so as to form one contiguous gene arrange so that the codons of the two gene sequences are transcribed in frame.
  • the proteins of the first and second aspect of the present invention may be prepared by any suitable means as will be clear to the person skilled in the art.
  • the protein is generated by recombinant DNA technology by expression of the encoding DNA in an expression vector in a host cell.
  • Such expression methods are well known to those of skill in the art and many are described in detail in DNA cloning: a practical approach, Volume II : Expression systems, edited by D. M. Glover (IRL Press, 1995) or in DNA cloning : a practical approach, Volume IF : Mammalian systems, edited by D. M. Glover (IRL Press, 1995).
  • Protein compounds may also be prepared using the known techniques of genetic engineering such as site-directed or random mutagenesis as described, for example, in Molecular Cloning: a Laboratory Manual: 2nd edition, (Sambrook et al, 1989, Cold Spring Harbor Laboratory Press) or in Protein Engineering: A practical approach (edited by A. R. Rees et al, IRL Press 1993). . Cell-free translation systems can also be employed to produce proteins, for example using RNAs derived from the DNA constructs of the present invention.
  • a functional equivalent of the first or second aspect of the invention may have one or more of the above-mentioned properties of functional equivalents (and indeed a combination of the above-mentioned characteristics of functional equivalents).
  • a functional equivalent may be a fusion protein which comprises a fragment of a sequence which is homologous with the amino acid sequence recited in SEQ. ID. No. 1.
  • the invention provides a ligand which specifically binds to a polypeptide of the first or second aspect of the invention.
  • a fourth aspect of the invention provides a method of making an antibody, and antibodies generated by this method which are immunospecific for a polypeptide of the first or second aspect of the invention, wherein the method comprises injecting a polypeptide of the first or second aspect of the invention into an animal and collecting antibodies generated from the animal against the polypeptide.
  • the ligand or antibody of the third or fourth aspect of the invention inhibits the Torero polypeptide activity of a polypeptide of the first or second aspect of the invention or the activity of a naturally occurring mutated version of a wild type Torero polypeptide.
  • the ligand of the third aspect of the invention is an antibody which is immunospecific for a polypeptide of the first or second aspect of the invention, preferably a Torero polypeptide recited in SEQ ID NO. 1, 3, 5 or 7 or a naturally occurring polypeptide of the first or second aspect of the invention.
  • the antibody is immunospecific for a naturally occurring mutated version of a wild type Torero polypeptide.
  • the antibody of the fourth aspect of the invention is immunospecific for a Torero polypeptide recited in SEQ ID NO. 1, 3, 5 or 7 or a naturally occurring polypeptide of the first or second aspect of the invention.
  • the antibody is immunospecific for a naturally occurring mutated version of a wild type Torero polypeptide.
  • Such antibodies may be polyclonal or monoclonal antibodies, that are immunospecific for a polypeptide of the first or second aspect of the invention. Such antibodies may be employed to isolate or to identify clones expressing the polypeptides of the invention or to purify the polypeptides by affinity chromatography. The antibodies may also be employed as diagnostic or therapeutic aids (eg to be used in relation to the diagnosis, prevention and treatment of the diseases mentioned herein), amongst other applications, as will be apparent to the skilled reader.
  • an antibody “immunospecific” for a given polypeptide we include antibodies which have a higher affinity for the polypeptide than for unrelated polypeptides of the prior art. By “higher affinity” we refer to at least a 2 fold, preferably 4, 8, 10 fold higher affinity.
  • an immunogen preferably a purified protein
  • an adjuvant preferably a purified protein
  • animals are immunized with the mixture.
  • the animal's immune response to the immunogen preparation is monitored by taking test bleeds and determining the titer of reactivity to the protein of interest. For example, when appropriately high titers of antibody to the immunogen are obtained, usually after repeated immunizations, blood is collected from the animal and antisera are prepared.
  • serum containing polyclonal antibodies is used, the polyclonal antibodies can be purified by a variety of methods, such as by immunoaffinity chromatography, using known procedures.
  • the polypeptide used to immunise the animal may, for example, be derived by recombinant DNA technology, by purification of the natural protein or can be synthesized chemically. If desired, the polypeptide can be conjugated to a carrier protein. Commonly used carriers to which the polypeptides may be chemically coupled include bovine serum albumin, thyroglobulin and keyhole limpet haemocyanin. The coupled polypeptide is then used to immunise the animal. Monoclonal antibodies immunospecific for a polypeptide of the first or second aspect of the invention can also be readily produced by one skilled in the art using, e.g., hybridoma technology. The general methodology for making monoclonal antibodies by using hybridoma technology is well known.
  • immortal antibody-producing cell lines can be created by cell fusion, as well as by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., M. Schreier et al. Hybridoma Techniques (1980); Hammerling et al. Monoclonal Antibodies and T-cell Hybridomas (1981); Kennett et al. Monoclonal Antibodies (1980); U.S. Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,452,570; 4,466,917; 4,472,500, 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against the polypeptides of the first or second aspect of the invention can be screened for various properties; i.e., for isotype, epitope, affinity, etc.
  • Monoclonal antibodies are particularly useful in purification of the individual polypeptides against which they are directed.
  • genes encoding the monoclonal antibodies of interest may be isolated from hybridomas, for instance by PCR techniques known in the art, and cloned and expressed in appropriate vectors.
  • antibody denotes not only the intact molecule, but also active fragments thereof, such as Fab, F(ab') 2 and Fv, which retain their immunospecificity for a polypeptide of the first or second aspect of the invention. (See, e.g., Baldwin, R. W. et al.
  • the term also contemplates chimeric antibodies that retain immunospecificity for a polypeptide of the first or second aspect of the invention.
  • the antibody can include the variable regions or fragments of the variable regions which retain specificity for a polypeptide of the first or second aspect of the invention. Chimeric antibodies are discussed by Neuberger et al (1988, 8th International Biotechnology Symposium Part 2, 792-799).
  • Suitably prepared non-human antibodies can be "humanized" in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies.
  • the antibody may be a "bispecific" antibody, that is an antibody having two different antigen binding domains, each domain being directed against a different epitope.
  • the binding agent is preferably an antibody or antigen binding fragment thereof such a Fab, Fv, ScFv and Ab ? but it may also be any other ligand which exhibits the preferential binding characteristic mentioned above.
  • Affinity chromatography is described in Scopes, R. K. (1993) Protein Purification: principles and practice 3rd Ed. Springer- Verlag, New York, ISBN 0-387-44072-3, 3-540- 94072-3. (See chapters 7 and 9 in particular).
  • Antibodies generated by the above techniques have additional utility in that they may be employed as reagents in immunoassays, radioimmunoassays (RIA) or enzyme-linked immunosorbent assays (ELISA).
  • the antibodies can be labelled with an analytically-detectable reagent such as a radioisotope, a fluorescent molecule or an enzyme.
  • the ligands of the third aspect of the invention include non-protein ligands, such as drug molecules.
  • the ligands of the third aspect of the invention and the antibodies of the fourth (and third) aspect of the invention specifically block Torero enzyme activity and/or its ability to bind to one or all of its substrates.
  • the invention provides an isolated nucleic acid molecule which comprises or consists of a nucleic acid molecule encoding a polypeptide of the first or second aspect of the invention or an antibody of the third or fourth aspect of the invention.
  • the nucleic acid molecule of the fifth aspect of the invention comprises or consists of:
  • nucleic acid molecule comprising or consisting of the nucleic acid sequence set forth in SEQ ID No 6 preceded by the 5' part of the human Torero gene that contains the 5' UTR, start codon and the signal peptide;
  • nucleic acid molecule encoding the amino acid sequence of SEQ ID No 1 , 3, 5 or 7, or the full length human Torero polypeptide;
  • nucleic acid molecule being degenerate to the sequence of the nucleic acid molecule of (d).
  • isolated nucleic acid molecule we include a nucleic acid molecule which is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or; a nucleic acid sequence, as it exists in nature, but linked to a polynucleotide other than that to which it is linked in nature.
  • isolated nucleic acid molecule may comprise the promoter and/or other expression-regulating sequences which normally govern its expression and it may comprise introns, or it may consist of the coding sequence only, for example a cDNA sequence.
  • isolated does not denote the method by which the nucleic acid molecules are obtained or the level of purity of the preparations.
  • isolated species may, for example, be produced recombinantly, isolated directly from the cell or tissue of interest or produced synthetically based on the determined sequences.
  • hybridizing refers to the association of two nucleic acid molecules with one another by hydrogen bonding.
  • the term as used herein relates to stringent or non-stringent hybridization conditions. Preferably, it relates to stringent conditions. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory (1989) N. Y., Ausubel, "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley Interscience, N. Y. (1989), or Higgins and Hames (eds)”Nucleic acid hybridization, a practical approach"IRL Press Oxford, Washington DC, (1985).
  • one molecule will be fixed to a solid support and the other will be free in solution. Then, the two molecules may be placed in contact with one another under conditions that favour hydrogen bonding. Factors that affect this bonding include: the type and volume of solvent; reaction temperature; time of hybridization; agitation; agents to block the non-specific attachment of the liquid phase molecule to the solid support (Denhardt's reagent or BLOTTO); the concentration of the molecules; use of compounds to increase the rate of association of molecules (dextran sulphate or polyethylene glycol); and the stringency of the washing conditions following hybridization (see Sambrook et al. [supra]).
  • the inhibition of hybridization of a completely complementary molecule to a target molecule may be examined using a hybridization assay, as known in the art (see, for example, Sambrook et al [supj'a]).
  • a substantially homologous molecule will then compete for and inhibit the binding of a completely homologous molecule to the target molecule under various conditions of stringency, as taught in Wahl, G.M. and S.L. Berger (1987; Methods Enzymol. 152:399- 407) and Kimmel, A.R. (1987; Methods Enzymol. 152:507-511).
  • Stringent hybridisation conditions refers to conditions in a hybridization reaction that favour the association of very similar molecules over association of molecules that differ. Stringent hybridisation conditions are defined as overnight incubation at 42°C in a solution comprising 50% formamide, 5XSSC (150mM NaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5x Denhardts solution, 10% dextran sulphate, and 20 microgram/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1X SSC at approximately 65°C. Non-stringent conditions involve the hybridisation reaction being carried out at 35°C (see Sambrook et al. [supra]).
  • the conditions used for hybridization are stringent conditions.
  • a sixth aspect of the invention provides an isolated nucleic acid molecule which hybridizes under stringent conditions with a nucleic acid molecule of the fifth aspect of the invention.
  • the nucleic acid molecules of the sixth aspect of the invention may, for example, have utility as probes or as used antisense molecules.
  • antisense molecules such as oligonucleotides, can be designed to recognise, specifically bind to and prevent transcription of a target nucleic acid encoding a polypeptide of the invention, as will be known by those of ordinary skill in the art (see, for example, Cohen, J.S., Trends in Pharm. Sci., 10, 435 (1989), Okano, J. Neurochem.
  • antisense oligonucleotides are 15 to 35 bases in length. However, it is appreciated that it may be desirable to use oligonucleotides with lengths outside this range, for example 10, 11, 12, 13, or 14 bases, or 36, 37, 38, 39 or 40 bases or more.
  • a nucleic acid probe capable of screening for a nucleic acid molecule of the fifth or sixth aspect of the invention.
  • the probe hybridizes with a nucleic acid molecule of the fifth or sixth aspect of the invention under stringent conditions.
  • the probe preferably comprises at least 15, 20, 25, 30, 35, 45, 50, 50, 100, 150, 200, 300 oligonucleotides, preferably between 15 and 30 or 15 and 45 oligonucleotides.
  • An eighth aspect of the invention also provides a process for detecting a nucleic acid molecule of the fifth or sixth aspect of the invention, comprising the steps of: (a) contacting a nucleic probe according to the seventh aspect of the invention with a biological sample under hybridizing conditions to form duplexes; and (b) detecting any such duplexes that are formed.
  • a biological sample may be selected from the group consisting of: extracts of cells or tissues, bodily fluids, blood, faeces, tissue, mucous, vaginal fluids, semen and urine.
  • a nucleic acid molecule of the seventh aspect of the invention may be used as a hybridization probe for RNA, cDNA or genomic DNA, in order to isolate full-length cDNAs and genomic clones encoding a Torero polypeptide (and other polypeptides of the first and second aspect of the invention) and to isolate cDNA and genomic clones of homologous or orthologous genes that have a high sequence similarity to the nucleic acids sequences explicitly recited herein.
  • One method for isolating a nucleic acid molecule of the fifth or sixth aspect of the invention is to probe a genomic or cDNA library with a natural or artificially-designed probe using standard procedures that are recognised in the art (see, for example, "Current Protocols in Molecular Biology", Ausubel et al. (eds). Greene Publishing Association and John Wiley Interscience, New York, 1989,1992).
  • Probes comprising at least 15, preferably at least 30, and more preferably at least 40 or 50, contiguous bases that correspond to, or are complementary to, the appropriate encoding nucleic acid sequence (e.g. SEQ ID 2, 4, 6 or 8), may be particularly useful probes.
  • Such probes may be labelled with an analytically-detectable reagent to facilitate their identification.
  • Useful reagents include, but are not limited to, radioisotopes, fluorescent dyes and enzymes that are capable of catalysing the formation of a detectable product.
  • probes the person skilled in the art will be capable of isolating complementary copies of genomic DNA, cDNA or RNA polynucleotides encoding proteins of interest from human, mammalian or other animal sources and screening such sources for related sequences, for example, for additional members of the family, type and/or subtype.
  • the probes may be used to detect mutated versions of the wild type human Torero polypeptide in a biological sample (or in vivo) from a patient, which mutated version may be implicated in disease.
  • isolated cDNA sequences will be incomplete, in that the region encoding the polypeptide will be cut short, normally at the 5' end.
  • Several methods are available to obtain full length cDNAs, or to extend short cDNAs. Such sequences may be extended utilising a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements. For example, one method which may be employed is based on the method of Rapid Amplification of cDNA Ends (RACE; see, for example, Frohman et al, PNAS USA 85, 8998-9002, 1988).
  • RACE Rapid Amplification of cDNA Ends
  • Another method which may be used is capture PCR which involves PCR amplification of DNA fragments adjacent a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods Applic, 1, 111-119). Another method which may be used to retrieve unknown sequences is that of Parker, J.D. et al. (1991); Nucleic Acids Res. 19:3055-3060). Additionally, one may use PCR, nested primers, and PromoterFinderTM libraries to walk genomic DNA (Clontech, Palo Alto, CA). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
  • nucleic acid molecules of the present invention may be used for chromosome localisation. In this technique, a nucleic acid molecule is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important step in the confirmatory correlation of those sequences with the gene-associated disease.
  • the nucleic acid molecules of the present invention are also valuable for tissue localisation. These techniques include in situ hybridization techniques and nucleotide amplification techniques, such as PCR. Results from these studies provide an indication of the normal functions of the polypeptide in the organism. In addition, comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by a mutant gene provide valuable insights into the role of mutant polypeptides in disease. Such inappropriate expression may be of a temporal, spatial or quantitative nature.
  • the nucleic acid molecules of the invention comprise at least n consecutive nucleotides from the sequences explicitly disclosed herein (or sequences complementary thereto) where, depending on the particular sequence, n is 8 or more (for example, 10, 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).
  • the nucleic acids of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non- coding strand, also referred to as the anti-sense strand.
  • nucleic acid molecule also includes analogues of DNA and RNA, such as those containing modified backbones, and peptide nucleic acids (PNA).
  • PNA peptide nucleic acids
  • PNAs may be pegylated to extend their lifespan in a cell, where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P.E. et al. (1993) Anticancer Drug Des. 8:53-63).
  • a nucleic acid molecule which encodes the amino acid sequence of SEQ ID NO:l, 3, 5, 7 or the full length human Torero polypeptide, or a fragment of the aforementioned amino acid sequences may comprise or consist of a nucleic acid sequence that is identical to the coding sequence of a nucleic acid molecule shown in SEQ ID NOs: 2, 4, 6 or 8 respectively or a fragment thereof. These molecules also may have a different sequence which, as a result of the degeneracy of the genetic code, encodes the polypeptide of SEQ ID NO: 1, 3, 5 or 7 or the full length human Torero polypeptide, or a fragment of the aforesaid amino acid sequences.
  • nucleic acid molecules that encode a polypeptide of SEQ ID NO:l, 3, 5 or 7 or the full length human Torero polypeptide, or a fragment of the aforesaid amino acid sequences may include, but are not limited to, the coding sequence for the mature polypeptide or polypeptide fragment by itself; the coding sequence for the mature polypeptide or polypeptide fragment and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pro-, pre- or prepro- polypeptide sequence; the coding sequence of the mature polypeptide or polypeptide fragment, with or without the aforementioned additional coding sequences, together with further additional, non-coding sequences, including non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription (including termination signals), ribosome binding and mRNA stability.
  • the nucleic acid molecules may also include additional sequences which encode additional amino acids, such as those which provide additional functionalities.
  • Nucleic acid molecules falling within the scope of the invention include variants of the nucleic acid sequences explicitly recited herein (and fragments thereof) which variants differ from the aforementioned nucleic acid molecules by nucleotide substitutions, deletions or insertions.
  • the substitutions, deletions or insertions may involve one or more nucleotides. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or insertions.
  • the nucleic acid molecules of the invention can also be engineered, using methods generally known in the art, for a variety of reasons, including modifying the cloning, processing, and/or expression of the gene product (the polypeptide). DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides are included as techniques which may be used to engineer the nucleotide sequences. Site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and so forth.
  • the nucleic acid molecules of the present invention may be ligated to a heterologous sequence so that the combined nucleic acid molecule encodes a fusion protein.
  • a fusion protein that can be recognised by a commercially-available antibody.
  • a fusion protein may also be engineered to contain a cleavage site located between the sequence of the polypeptide of the invention and the sequence of a heterologous protein so that the polypeptide may be cleaved and purified away from the heterologous protein.
  • Preferred embodiments of the fifth, sixth and seventh aspect of the invention are nucleic acid molecules that comprise or consist of a sequence that is at least 70%, 80%, 90%, 95%, 97%, 99% or 99.5% identical or 100% identical over its entire length to a nucleic acid molecule encoding a polypeptide set forth in SEQ ID NO: 1, 3, 5 or 7 or encoding active fragments of said polypeptides, and nucleic acid molecules that are substantially complementary to such nucleic acid molecules.
  • preferred active fragments are those that include the region of a Torero polypeptide (preferably the region of the fly Torero polypeptide) predicted as being responsible for the catalytic activity of the Torero polypeptide (the functionally active site of Torero), and variants thereof that possess the catalytic residues Ser237, Asp338 and His384, or equivalent residues, and which possess Torero polypeptide activity and/or which have an antigenic determinant in common with the functionally active site of Torero.
  • preferred nucleic acid molecules include those that are at least 70% identical over their entire length to a nucleic acid molecule encoding the functionally active site of Torero.
  • Percentage identity is as determined using BLAST version 2.1.3 using the default parameters specified by the NCBI (the National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/).
  • a ninth aspect of the invention relates to a vector, preferably plasmid, cosmids, viruses and bacteriophages comprising a nucleic acid molecule of the invention (eg of the fifth, sixth or seventh aspects of the invention).
  • Such vectors may comprise further genes such as marker genes which allow for the selection of said vector in a suitable host cell and under suitable conditions.
  • the nucleic acid molecules of the invention may be operatively linked in said vector to expression control sequences allowing expression in prokaryotic or eukaryotic cells.
  • Expression of said nucleic acid molecules comprises transcription of the nucleic acid molecules into a translatable mRNA.
  • Regulatory elements ensuring expression in eukaryotic cells preferably mammalian cells, are well known to those skilled in the art. They usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers.
  • Possible regulatory elements permitting expression in prokaryotic host cells comprise, e. g., the lac, t ⁇ or tac promoter in E.
  • regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the CMV-, SV40-, RSV- promoter (Rous sarcoma virus), CMV enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells.
  • Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as the SV40-poly-A site or the tk-poly-A site, downstream of the polynucleotide.
  • suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pCDM8, pRc/CMV, pcDNAI, pcDNA3 (In-vitrogene), pSPORTl (GIBCO BRL).
  • said vector is an expression vector, gene transfer or targeting vector.
  • the vectors of the present invention may be cloning or expression vectors. Expression vectors and gene targeting or transfer vectors are well known in the art and can be adapted for specific p poses of the invention by the person skilled in the art.
  • expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vectors of the invention into targeted cell populations.
  • viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus.
  • Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N. Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N. Y. (1989).
  • the nucleic acid molecules and vectors of the invention can be reconstituted into liposomes for delivery to target cells.
  • a tenth aspect of the invention provides a host transformed with a nucleic acid molecule of the invention or a vector of the ninth invention.
  • the term "transformed” as used herein includes transfection and transduction unless otherwise indicated.
  • the host cells of the invention may be prokaryotic or eukaryotic.
  • the nucleic acid molecule or vector of the invention which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally.
  • the recombinant DNA molecule of the invention can be used for "gene targeting” and/or “gene replacement”, for restoring a mutant gene or for creating a mutant gene via homologous recombination; see for example Mouellic, Proc. Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene Targeting, A Practical Approach, Oxford. University Press.
  • the host is a mammalian cell, a fungal cell, a plant cell, an insect cell or a bacterial cell.
  • Preferred fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae.
  • the term "prokaryotic" is meant to include all bacteria which can be transformed or transfected with a polynucleotide for the expression of the protein of the present invention.
  • Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis.
  • the isolation and purification of the microbially or otherwise expressed polypeptides of the invention may be by any conventional means such as, for example, preparative chromatographic separations and immunological separations such as those involving the use of monoclonal or polyclonal antibodies.
  • mammalian cells HEK 293, CHO, HeLa and NIH 3T3 are preferred.
  • insect cells it is most preferred to use Spodoptei-a fi-ugiperda cells, whereas the most preferred bacterial cells are E. coli cells.
  • An eleventh aspect of the invention relates to a method of producing a polypeptide of the first of second aspect of the invention comprising culturing a host of the invention and isolating the produced polypeptide.
  • the polypeptide of the invention may be exported to the culture medium or maintained within the host. Suitable protocols for obtaining the polypeptide produced are well-known in the art for both ways of polypeptide production.
  • Nucleic acid molecules according to the present invention may also be used to create transgenic animals (preferably non-human animals), particularly rodents (eg rats and mice) and Drosophila flies. Knockout non-human animals are also included within the scope of the invention.
  • the invention provides a transgenic animal or a knockout non- human animal that has been transformed to express higher, lower or absent levels of a polypeptide of the first or second aspect of the invention.
  • the polypeptide having modified activity as compared to a polypeptide of the first or second aspect of the invention is a wild type Torero polypeptide.
  • the polypeptide having modified activity as compared to a polypeptide of the first or second aspect of the invention is a mutated version of a wild type Torero polypeptide, preferably a naturally occurring mutated version of a wild type Torero polypeptide.
  • the above-described transgenic animals may provide useful models for the study of disease and may also be using in screening regimes for the identification of compounds that are effective in the diagnosis, prevention or treatment of disease.
  • a further aspect of the invention provides a method for screening for a compound effective to diagnose, prevent or treat a disease (preferably one of the above-mentioned diseases), by contacting a non-human transgenic animal of the twelfth aspect of the invention with a candidate compound and detennining the effect of the compound on the physiology and/or disease of the animal.
  • a disease preferably one of the above-mentioned diseases
  • the invention provides a compound that is effective to alter the expression of a natural gene which encodes a polypeptide of the first aspect of the invention or to regulate the activity of a polypeptide of the first aspect of the invention.
  • Such compounds may activate (agonise) or inhibit (antagonise) the level of expression of a nucleic acid or the activity of a polypeptide of the invention.
  • the compound of the thirteenth aspect of the invention is a drug-like compound or lead compound.
  • drug-like compound is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament.
  • a drug-like compound may exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate target cellular membranes, but it will be appreciated that these features are not essential.
  • lead compound is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, poorly soluble, difficult to synthesise or has poor bioavailability) may provide a starting-point for the design of other compounds that may have more desirable characteristics.
  • a fourteenth aspect of the invention provides screening methods that are capable of identifying a compound according to the thirteenth aspect of the invention. More specifically, there is provided a method for the identification of a compound that is effective in the diagnosis, prevention or treatment of a disease (preferably one of the above-mentioned diseases), the method comprising contacting a polypeptide according to the first or second aspect of the invention, a nucleic acid molecule according to the fifth, sixth or seventh aspect of the invention with one or more compounds suspected of possessing binding affinity for said polypeptide or nucleic acid molecule, and selecting a compound that binds specifically to said nucleic acid molecule or polypeptide.
  • Agonist or antagonist compounds may be isolated from, for example, cells, cell-free preparations, chemical libraries or natural product mixtures.
  • agonists or antagonists may be natural or modified substrates, ligands, enzymes, receptors or structural or functional mimetics.
  • Compounds that are most likely to be good antagonists are molecules that bind to the polypeptide of the invention without inducing the biological effects of the polypeptide upon binding to it.
  • Potential antagonists include small organic molecules, sugar molecules, peptides, polypeptides and antibodies that bind to the polypeptide of the invention and thereby inhibit or extinguish its activity. In this fashion, binding of the polypeptide to nonnal cellular binding molecules may be inhibited, such that the normal biological activity of the polypeptide is prevented.
  • the polypeptide of the invention that is employed in such a screening technique may be free in solution, affixed to a solid support, borne on a cell surface or located intracellularly.
  • such screening procedures may involve using appropriate cells or cell membranes that express the polypeptide that are contacted with a test compound to observe binding, or stimulation or inhibition of a functional response.
  • the functional response of the cells contacted with the test compound is then compared with control cells that were not contacted with the test compound.
  • Such an assay may assess whether the test compound results in a signal generated by activation of the polypeptide, using an appropriate detection system.
  • Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist in the presence of the test compound is observed.
  • simple binding assays may be used, in which the adherence of a test compound to a surface bearing the polypeptide is detected by means of a label directly or indirectly associated with the test compound or in an assay involving competition with a labelled competitor.
  • competitive drug screening assays may be used, in which neutralising antibodies that are capable of binding the polypeptide specifically compete with a test compound for binding. In this manner, the antibodies can be used to detect the presence of any test compound that possesses specific binding affinity for a polypeptide of the invention.
  • Assays may also be designed to detect the effect of added test compounds on the production of mRNA encoding the polypeptide in cells.
  • an ELISA may be constructed that measures secreted or cell-associated levels of polypeptide using monoclonal or polyclonal antibodies by standard methods known in the art, and this can be used to search for compounds that may inhibit or enhance the production of the polypeptide from suitably manipulated cells or tissues. The formation of binding complexes between the polypeptide and the compound being tested may then be measured.
  • Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to the polypeptide of interest (see International patent application WO84/03564).
  • polypeptides of the invention may be used to identify membrane-bound or soluble receptors, through standard receptor binding techniques that are known in the art, such as ligand binding and crosslinking assays in which the polypeptide is labelled with a radioactive isotope, is chemically modified, or is fused to a peptide sequence that facilitates its detection or purification, and incubated with a source of the putative receptor (for example, a composition of cells, cell membranes, cell supernatants, tissue extracts, or bodily fluids).
  • a source of the putative receptor for example, a composition of cells, cell membranes, cell supernatants, tissue extracts, or bodily fluids.
  • the efficacy of binding may be measured using biophysical techniques such as surface plasmon resonance and spectroscopy.
  • Binding assays may be used for the purification and cloning of the receptor, but may also identify agonists and antagonists of the polypeptide, that compete with the binding of the polypeptide to its receptor. Standard methods for conducting screening assays are well understood in the art.
  • the invention also includes a screening kit useful in the methods for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, that are described above.
  • the invention includes the agonists, antagonists, ligands, receptors, substrates and enzymes, and other compounds which modulate the activity or antigenicity of the polypeptide of the invention discovered by the methods that are described above.
  • the invention provides a polypeptide of the first or second aspect of the invention, a ligand of the third aspect of the invention, an antibody of the third or fourth aspect of the invention, an antibody of the third or fourth aspect of the invention, a nucleic acid molecule of the fifth, sixth or seventh aspect of the invention, a vector of the ninth aspect of the invention, a host cell of the tenth aspect of the invention, a transgenic animal of the twelfth aspect of the invention, a compound of the thirteenth aspect of the invention for use in medicine.
  • a sixteenth aspect of the invention relates to the use of a polypeptide of the first or second aspect of the invention, a ligand of the third aspect of the invention, an antibody of the third or fourth aspect of the invention, a nucleic acid molecule of fifth, sixth or seventh aspect of the invention, a vector of the ninth aspect of the invention, a host cell of the tenth aspect of the invention, a method of the eleventh aspect of the invention, a transgenic animal of the twelfth aspect of the invention, or a compound of the thirteenth aspect of the invention in the manufacture of a medicament for the diagnosing, preventing or treating a disease (preferably one of the above-mentioned diseases).
  • a disease preferably one of the above-mentioned diseases.
  • a method of preventing or treating a disease in a patient comprising administering to the patient a polypeptide of the first or second aspect of the invention, a ligand of the third aspect of the invention, an antibody of the third or fourth aspect of the invention, a nucleic acid molecule of the fifth, sixth or seventh aspect of the invention, a vector of the ninth aspect of the invention, a host cell of the tenth aspect of the invention, a method of the eleventh aspect of the invention, or a compound of the thirteenth aspect of the invention.
  • a disease preferably one of the above-mentioned diseases
  • the Torero polypeptide for diseases involving aberrant expression of the Torero polypeptide, in which the expression of a natural gene encoding a polypeptide of the first aspect of the invention, or in which the activity of a polypeptide of the first aspect of the invention, is lower in a diseased patient when compared to the level of expression or activity in a healthy patient, the polypeptide, nucleic acid molecule, ligand or compound administered to the patient should be an agonist.
  • the polypeptide, nucleic acid molecule, ligand or compound administered to the patient should be an antagonist.
  • antagonists include antisense nucleic acid molecules, ribozymes and ligands, such as antibodies.
  • a pharmaceutical composition comprising: (i) a polypeptide of the first or second aspect of the invention, a ligand of the third aspect of the invention, an antibody of the third or fourth aspect of the invention, a nucleic acid molecule of the fifth, sixth or seventh aspect of the invention, a vector of the ninth aspect of the invention, a host cell of the tenth aspect of the invention, a method of the eleventh aspect of the invention, a compound of the thirteenth aspect of the invention; and (ii) a pharmaceutically acceptable carrier and/or diluent and/or excipient.
  • the pharmaceutical composition comprises antisense nucleic acid molecules specifically hybridizing to the nucleic acid molecules of the present invention, capable of regulating, preferably decreasing heavy expression.
  • the pharmaceutical composition comprises a polypeptide of the first or second aspect of the invention, preferably a polypeptide of the first or second aspect of the invention which has Torero polypeptide activity.
  • a pharmaceutical composition would be useful, for instance, as a drug to reduce sensitivity to Wnt proteins.
  • compositions of the eighteenth aspect of the invention may be suitable as therapeutic or diagnostic reagents to diagnose, treat or prevent disease.
  • the compositions of the eighteenth aspect of the invention may be suitable as vaccines, or as other immunogenic compositions, as outlined below.
  • suitable pha ⁇ naceutical carriers and diluents as well as of excipients are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc.
  • Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the patient in need thereof at a suitable dose.
  • compositions of the invention should preferably comprise a therapeutically effective amount of the polypeptide, nucleic acid molecule, ligand, antibody, vector, host cell or compound of the invention.
  • therapeutically effective amount refers to an amount of a therapeutic agent needed to treat (including to ameliorate) or prevent a targeted disease or condition, or to exhibit a detectable therapeutic or preventative effect.
  • the therapeutically effective dose can be estimated initially either in cell culture assays, for example, of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • dosages for any one patient depend upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • a suitable dosage can be determined by routine experimentation and is within the judgement of the clinician.
  • an effective dose will be from 0.01 mg/kg to 50 mg/kg, preferably 0.05 mg/kg to 10 mg/kg.
  • the treatment may consist of a single dose or a plurality of doses over a period of time.
  • formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
  • compositions of the present invention may be effected by different ways, including, but not limited to, topical, oral, intravenous, intraperitoneal, , intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, intradermal or subcutaneous applications (for example, see WO98/20734), subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, intravaginal or rectal means.
  • Gene guns or hyposprays may also be used to administer the pharmaceutical compositions of the invention.
  • the therapeutic compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
  • One approach comprises administering to a subject an inhibitor compound (antagonist) as described above, along with a pharmaceutically acceptable carrier in an amount effective to inhibit the function of the polypeptide, such as by blocking the binding of ligands, substrates, enzymes, receptors, or by inhibiting a second signal, and thereby alleviating the abnormal condition.
  • an inhibitor compound as described above
  • a pharmaceutically acceptable carrier in an amount effective to inhibit the function of the polypeptide, such as by blocking the binding of ligands, substrates, enzymes, receptors, or by inhibiting a second signal, and thereby alleviating the abnormal condition.
  • antagonists are antibodies.
  • such antibodies are chimeric and/or humanised to minimise their immunogenicity, as described previously.
  • polypeptide that retain binding affinity for the ligand, substrate, enzyme, receptor, in question, may be administered.
  • polypeptide may be administered in the form of fragments that retain the relevant portions.
  • expression of the gene encoding the polypeptide can be inhibited using expression blocking techniques, such as the use of antisense nucleic acid molecules (as described above), either internally generated or separately administered.
  • Modifications of gene expression can be obtained by designing complementary sequences or antisense molecules (DNA, RNA, or PNA) to the control, 5' or regulatory regions (signal sequence, promoters, enhancers and introns) of the gene encoding the polypeptide.
  • inhibition can be achieved using "triple helix" base-pairing methodology. Recent therapeutic advances using triplex DNA have been described in the literature (Gee, J.E. et al (1994) In: Huber, B.E. and B.I.
  • the complementary sequence or antisense molecule may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Such oligonucleotides may be administered or may be generated in situ from expression in vivo.
  • Ribozymes are catalytically active RNAs that can be natural or synthetic (see for example Usman, N, et al, Curr. Opin. Struct. Biol (1996) 6(4), 527-33). Synthetic ribozymes can be designed to specifically cleave mRNAs at selected positions thereby preventing translation of the mRNAs into functional polypeptide. Ribozymes may be synthesised with a natural ribose phosphate backbone and natural bases, as normally found in RNA molecules. Alternatively the ribozymes may be synthesised with non- natural backbones, for example, 2'-0-methyl RNA, to provide protection from ribonuclease degradation and may contain modified bases.
  • RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of non- traditional bases such as inosine, queosine and butosine, as well as acetyl-, methyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine and uridine which are not as easily recognised by endogenous endonucleases.
  • One approach comprises administering to a subject a therapeutically effective amount of a compound that activates the polypeptide, i.e., an agonist as described above, to alleviate the abnormal condition.
  • a therapeutic amount of the polypeptide in combination with a suitable pharmaceutical carrier may be administered to restore the relevant physiological balance of polypeptide.
  • a pharmaceutical composition of the invention which comprises a nucleic acid molecule or vector of the invention in gene therapy.
  • Gene therapy may be employed to effect the endogenous production of the polypeptide by the relevant cells in the subject.
  • Gene therapy is used to treat permanently the inappropriate production of the polypeptide by replacing a defective gene with a corrected therapeutic gene.
  • Gene therapy of the present invention can occur in vivo or ex vivo. Ex vivo gene therapy requires the isolation and purification of patient cells, the introduction of a therapeutic gene and introduction of the genetically altered cells back into the patient. In contrast, in vivo gene therapy does not require isolation and purification of a patient's cells.
  • Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, adenoviruses, and adeno- associated viruses, among others.
  • Gene therapy which is based on introducing therapeutic genes, for example for vaccination into cells by ex-vivo or in-vivo techniques is one of the most important applications of gene transfer.
  • Suitable vectors, methods or genedelivery systems for in-vitro or in-vivo gene therapy are described in the literature and are known to the person skilled in the art ; see, e. g., Giordano, Nature Medicine 2 (1996), 534-539; Schaper,
  • nucleic acid molecules and vectors of the invention may be designed for direct introduction or for introduction via liposomes, or viral vectors (e. g. adenoviral, retroviral) into the cell. Additionally, a baculoviral system can be used as eukaryotic expression system for the nucleic acid molecules of the invention.
  • nucleic acids to a specific site in the body for gene therapy may also be accomplished using a biolistic delivery system, such as that described by Williams (Proc. Natl. Acad. Sci. USA 88 (1991), 2726-2729). Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the art of molecular biology, see, e. g., WO 94/29469.
  • Gene therapy may be carried out by directly administering the recombinant DNA molecule or vector of the invention to a patient or by transfecting cells with the polynucleotide or vector of the invention ex vivo and infusing the transfected cells into the patient.
  • research pertaining to gene transfer into cells of the germ line is one of the fastest growing fields in reproductive biology and may be used to generate a transgenic animals of the twelfth aspect of the present invention.
  • the polynucleotides and vectors comprised in the pharmaceutical composition of the invention may be designed for direct introduction or for introduction via liposomes, or viral vectors (e. g. adenoviral, retroviral) containing said recombinant DNA molecule into the cell.
  • said cell is a germ line cell, embryonic cell, stem cell or egg cell or derived therefrom.
  • An embryonic cell can be for example an embryonic stem cell as described in, e. g., Nagy, Proc. Natl. Acad. Sci. USA 90 (1993) 8424-8428.
  • the introduced nucleic acid molecules and vectors of the invention express the polypeptide of the invention after introduction into said cell and preferably remain in this status during the lifetime of said cell.
  • cell lines which stably express the polynucleotide under the control of appropriate regulatory sequences may be engineered according to methods well known to those skilled in the art.
  • host cells can be transformed with the polynucleotide or vector of the invention and a selectable marker, either on the same or separate vectors.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective medium.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows for the selection of cells having stably integrated the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • Such engineered cell lines are particularly useful in screening methods or methods for identifying an inhibitor of the polypeptides of the present invention.
  • the invention provides that they can be used in vaccines to raise antibodies against the disease causing agent.
  • Vaccines according to the invention may either be prophylactic (i.e. to prevent disease) or therapeutic (i.e. to treat disease).
  • Such vaccines comprise immunising antigen(s), immunogen(s), polypeptide(s), protein(s) or nucleic acid, usually in combination with pharmaceutically-acceptable carriers as described above, which include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Additionally, these carriers may function as immunostimulating agents ("adjuvants").
  • the antigen or immunogen may be conjugated to a bacterial toxoid, such as a toxoid from diphtheria, tetanus, cholera, H. pylori, and other pathogens.
  • a bacterial toxoid such as a toxoid from diphtheria, tetanus, cholera, H. pylori, and other pathogens.
  • polypeptides may be broken down in the stomach, vaccines comprising polypeptides are preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection).
  • Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.
  • This invention also relates to the use of nucleic acid molecules according to the present invention as diagnostic reagents. Detection of a mutated form of the Torero gene characterised by the nucleic acid molecules of the invention which is associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, which results from under-expression, over-expression or altered spatial or temporal expression of the gene. Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques.
  • Nucleic acid molecules for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR, ligase chain reaction (LCR), strand displacement amplification (SDA), or other amplification techniques (see Saiki et al, Nature, 324, 163-166 (1986); Bej, et al, Crit. Rev. Biochem. Molec. Biol, 26, 301-334 (1991); Birkenmeyer et al, J. Virol. Meth., 35, 117-126 (1991); Van Brunt, J., Bio/Technology, 8, 291-294 (1990)) priorto analysis.
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • a nineteenth aspect of the invention provides a method of diagnosing a disease, or a predisposition to a disease, in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide according to the invention or the activity of a polypeptide of the first or second aspect of the invention in tissue from said patient and comparing said level of expression or activity to a control level, wherein a level that is different to said control level is indicative of disease or a predisposition to disease.
  • Torero expression is also upregulated by Wnt in vertebrates. Since Torero is a secreted protein, this would provide a way to diagnosis early/medium/late steps of cancer (or any other disease where the levels of Wnt signalling have been altered) by measuring the levels of enzyme in blood/ faeces/ tissue/ mucous/vaginal fluids/ semen/ urine, though an enzymatic test or an ELISA using plates coated with anti- Human-Torero antibody.
  • Such a method will preferably be carried out in vitro. Similar methods may be used for monitoring the therapeutic prevention or treatment of disease in a patient, wherein altering the level of expression or activity of a polypeptide or nucleic acid molecule over the period of time towards a control level is indicative of regression of disease or the lessening of a predisposition to said disease.
  • a twentieth aspect of the invention provides a method of monitoring the therapeutic prevention or treatment of disease in a patient, comprising monitoring over a period of time the level of expression or activity of a polypeptide according to the first or second aspect of the invention, or the level of expression of a nucleic acid molecule according to the fifth or sixth aspect of the invention in tissue from said patient, wherein altering said level of expression or activity over the period of time towards a control level is indicative of regression of said disease or the lessening of a predisposition to said disease.
  • a number of different such methods according to the nineteenth or twentieth aspect of the invention exist, as the skilled reader will be aware, such as methods of nucleic acid hybridization with short probes, point mutation analysis, polymerase chain reaction (PCR) amplification and methods using antibodies to detect aberrant protein levels. Similar methods may be used on a short or long term basis to allow therapeutic treatment of a disease to be monitored in a patient.
  • the invention also provides kits that are useful in these methods for diagnosing disease.
  • the method may comprise the steps of: a) contacting a sample of tissue from the patient with a nucleic acid probe (preferably a nucleic acid probe according to the seventh aspect of the invention) under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule of the invention and the probe; b) contacting a control sample with said probe under the same conditions used in step a); and c) detecting the presence of hybrid complexes in said samples; wherein detection of levels of the hybrid complex in the patient sample that differ from levels of the hybrid complex in the control sample is indicative of disease or a predisposition to disease.
  • a nucleic acid probe preferably a nucleic acid probe according to the seventh aspect of the invention
  • a twenty-first aspect of the invention comprises a diagnostic method comprising the steps of: a) obtaining a tissue sample from a patient being tested for disease; b) isolating a nucleic acid molecule according to the invention from said tissue sample; and c) diagnosing the patient for disease by detecting the presence of a mutation in the nucleic acid molecule which is associated with disease.
  • an amplification step for example using PCR, may be included.
  • Deletions and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to labelled RNA of the invention or alternatively, labelled antisense DNA sequences of the invention. Perfectly-matched sequences can be distinguished from mismatched duplexes by RNase digestion or by assessing differences in melting temperatures.
  • the presence or absence of the mutation in the patient may be detected by contacting DNA with a nucleic acid probe that hybridises to the DNA under stringent conditions to form a hybrid double-stranded molecule, the hybrid double-stranded molecule having an unhybridised portion of the nucleic acid probe strand at any portion corresponding to a mutation associated with disease; and detecting the presence or absence of an unhybridised portion of the probe strand as an indication of the presence or absence of a disease-associated mutation in the corresponding portion of the DNA strand.
  • Point mutations and other sequence differences between the reference gene and "mutant" genes can be identified by other well-known techniques, such as direct DNA sequencing or single- strand conformational polymo ⁇ hism, (see Orita et al, Genomics, 5, 874-879 (1989)).
  • a sequencing primer may be used with double-stranded PCR product or a single- stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabelled nucleotides or by automatic sequencing procedures with fluorescent-tags.
  • Cloned DNA segments may also be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR.
  • point mutations and other sequence variations can be detected as described above, for example, through the use of allele- specific oligonucleotides for PCR amplification of sequences that differ by single nucleotides.
  • DNA sequence differences may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (for example, Myers et al, Science (1985) 230:1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (see Cotton et al, Proc. Natl. Acad. Sci. USA (1985) 85: 4397- 4401).
  • mutations such as microdeletions, aneuploidies, translocations, inversions, can also be detected by in situ analysis (see, for example, Keller et al, DNA Probes, 2nd Ed., Stockton Press, New York, N.Y., USA (1993)), that is, DNA or RNA sequences in cells can be analysed for mutations without need for their isolation and/or immobilisation onto a membrane.
  • Fluorescence in situ hybridization is presently the most commonly applied method and numerous reviews of FISH have appeared (see, for example, Trachuck et al, Science, 250, 559-562 (1990), and Trask et al, Trends, Genet., 7, 149-154 (1991)).
  • an array of oligonucleotide probes comprising a nucleic acid molecule according to the invention can be constructed to conduct efficient screening of genetic variants, mutations and polymo ⁇ hisms.
  • Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see for example: M. Chee et al, Science (1996), Vol 274, pp 610-613).
  • diseases may be diagnosed by methods comprising determining, from a sample derived from a subject, an abnormally decreased or increased level of polypeptide or mRNA. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantification of nucleic acid molecules, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
  • nucleic acid amplification for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
  • a twenty-second aspect of the invention provides a diagnostic method which comprises the steps of: (a) contacting a ligand as described above with a biological sample under conditions suitable for the formation of a ligand-polypeptide complex; and (b) detecting said complex.
  • the diagnostic method of the twenty- second aspect of the invention is used in the diagnosis of a disease mentioned herein.
  • Protocols such as ELISA, RIA, and FACS for measuring polypeptide levels may additionally provide a basis for diagnosing altered or abnormal levels of polypeptide expression.
  • Normal or standard values for polypeptide expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably humans, with antibody to the polypeptide under conditions suitable for complex formation The amount of standard complex formation may be quantified by various methods, such as by photometric means.
  • Antibodies which specifically bind to a polypeptide of the invention may be used for the diagnosis of conditions or diseases characterised by expression of the polypeptide, or in assays to monitor patients being treated with the polypeptides, nucleic acid molecules, ligands and other compounds of the invention.
  • Antibodies useful for diagnostic purposes may be prepared in the same manner as those described above for therapeutics. Diagnostic assays for the polypeptide include methods that utilise the antibody and a label to detect the polypeptide in human body fluids or extracts of cells or tissues.
  • a diagnostic kit of the present invention may comprise:
  • a diagnostic kit may comprise a first container containing a nucleic acid probe that hybridises under stringent conditions with a nucleic acid molecule according to the invention; a second container containing primers useful for amplifying the nucleic acid molecule; and instructions for using the probe and primers for facilitating the diagnosis of disease.
  • the kit may further comprise a third container holding an agent for digesting unhybridised RNA.
  • a diagnostic kit may comprise an array of nucleic acid molecules, at least one of which may be a nucleic acid molecule according to the invention.
  • a diagnostic kit may comprise one or more antibodies that bind to a polypeptide according to the invention; and a reagent useful for the detection of a binding reaction between the antibody and the polypeptide.
  • kits will be of use in diagnosing a disease or susceptibility to disease, particularly bacterial infections.
  • a twenty-third aspect of the invention provides for use of a polypeptide of the first or second aspect of the invention as an ⁇ / ⁇ hydrolase, preferably as a glycosaminoglycan deacetylase.
  • a twenty-fourth aspect of the invention provides for the use of a nucleic acid molecule according to the fifth aspect of the invention to express a polypeptide that possesses ⁇ / ⁇ hydrolase activity, preferably glycosaminoglycan deacetylase activity.
  • the ⁇ / ⁇ hydrolase of the twenty-third and twenty-fourth aspects of the invention modifies a proteoglycan, preferably a heparan sulfate proteoglycan, preferably the Dally and/or Dally-like proteoglycans (or an invertebrate/vertebrate homologue of Dally or Dally-like).
  • Torero reduces the binding of Wingless to the proteoglycan Dally-like at the cell surface in Drosophila wing imaginal discs.
  • Wingless and Wnt molecules are difficult to produce in cell culture, since Wingless and Wnt remain bound to the cells that produce it.
  • recombinant Wingless or Wnt are not commercially available, although recombinant Wingless or Wnt would be very useful in research, for instance in investigating Wingless or Wnt signalling and diseases associated with signalling.
  • a cell strain could be used that produces a polypeptide of the first or second aspect of the invention, preferably a naturally occurring polypeptide or a golgi tethered form of Torero, to generate recombinant Wnt, Wingless.
  • This method could be generalised to the production of any secreted protein in cultured cells that has an affinity for glycosaminoglycans. In this way, cells that don't retain the proteins can be generated and such cells would allow the proteins to be more readily obtained from the cell culture.
  • B Dorsal thorax of a s ⁇ al4 /+ Epg31259l+ fly. The wing was replaced by a duplication of dorsal thorax (arrowheads).
  • C Dorsal thorax of a s(f ,4 l+ UAS-sggl+ fly. Overexpression of the Wg pathway antagonist Sgg/ZW3 produced the same phenotype as Epg31259 in (B).
  • D Cuticle preparation of a wg Ga!4 /+ Epg31259/+ leg.
  • FIG. 3 Torero mutant wing discs Wing imaginal discs labeled with antibodies to Wingless protein, Nubbin protein and Teashirt protein (Tsh). D and V indicate Dorsal and Ventral compartments.
  • Nubbin labels the wing pouch and hinge. Tsh labels the presumptive body wall. Wg is expressed along the DV boundary of the wing pouch and in a stripe in the dorsal body wall (arrowhead). The two rings of Wg expression in the hinge region are only partially in focus.
  • B, C Wing imaginal discs from Torero 3 /Torero 5 flies.
  • C The wing pouch and hinge were duplicated.
  • A-F Wing imaginal discs labeled with antibodies to Wingless protein, Nubbin protein and Teashirt protein (Tsh).
  • A-C Epistasis test for Torero and armadillo.
  • A s ⁇ P AL4 l+ Epg31259l+ wing disc. Loss of the wing pouch is indicated by loss of Nubbin. Note the symmetric duplication of the Tsh-expressing thoracic region, including the thick stripe of Wg expression.
  • B s( AL4 l+ UAS-arm SIO l+ wing disc. Note the duplication of the wing pouch and the loss of Tsh expressing thoracic structures.
  • FIG. 5 Torero activity shapes the Wg protein gradient
  • A wild-type anterior wing margin.
  • Upper panel sense organ precursor cells labeled with anti- Hindsight.
  • Lower panel dorsal view of the anterior wing margin. Note the single row of stout mechanosensory bristles and the second row of thinner, curved chemosensory bristles along the edge of the wing.
  • B Anterior wing margin in a wing disc with Torero 3 mutant clones. Mutant cells are marked by the absence of the Myc marker. Additional rows of Hnt-expressing sense organ precursors form.
  • Lower panel Mutant sensory bristles were marked with yellow. Some ectopic bristles were wild-type.
  • Torero shows similarity to pectin acetylesterases and ⁇ / ⁇ hydrolases
  • Figure 7 Alignment of representative sequences of NAH domains.
  • the human sequence corresponds to Ensembl gene ENSG00000141594, although with modifications to the gene structure prediction to remove two insertions caused by apparently missed introns when compared to the Torero amino acid sequence.
  • the mouse sequence is a conceptual translation of a cDNA, genbank identifier 12860425.
  • Other genbank identifiers Arabidopsis, 6671966; Rice, 15128424; Mung bean, 7488883; Archaeoglobus fulgidus, 11499269.
  • the alignment is coloured using the CHROMA program with default parameters, and an 80% conservation threshold (PMID: 11590103).
  • the putative active site residues are marked with a black diamond ( ⁇ ).
  • the alignment also shows representative sequences from solved structures (PDB accession codes in brackets) in the region of the 'nucleophile-elbow' motif, highlighting the G-X-S-X-G motif. Start and end residue numbers of the fragments are given.
  • Torero acts as a secreted protein
  • the slower migrating form at ⁇ 66kD was the major fo ⁇ n seen in the m2 cells. Very little of this protein was recovered in the conditioned medium from cells expressing the m2 mutant protein. The lower level of the wt Torero in cell lysates compared to the m2 from may be due to secretion of the wt protein. Torero GT runs at a higher molecular weight due to addition of the 121 amino-acid transmembrane domain from Gal-T3. Torero-GT was not recovered from the conditioned medium.
  • C Cuticle preparation of a wild-type wing.
  • Torero modifies Dally and Dally-like (A) Immunoblots of S2 cells transfected to express Dly-HA (lines 1-3) and Dally-HA(lines 4- 6). Lanes 1, 4 cotransfected with empty vector. Lanes 2, 5 cotransfected to express wt Torero. Lanes 3, 6 cotransfected to express the S237A mutant form of Torero. Upper panels: probed with anti-HA. Middle panels: same blots reprobed to show Torero expression. Lower panels: reprobed to show Tubulin as a loading control. Cotransfection with wt Torero leads to production of a faster-migrating form of Dly-HA (Dly*) and to reduced levels of Dally-HA.
  • Dly* Dly-HA
  • Upper panels show overviews of the wing pouch. Higher magnification views of the wing margin are shown below (overlay followed by Wg, HA and Torero channels, shown separately).
  • Torero is a repressor of Wingless activity
  • s( aH is expressed in all cells of the wing imaginal disc primordia in the embryo and is subsequently activated along the dorsal-ventral boundary of the wing disc under control of the Notch pathway and in the wing pouch in response to Wg signaling.
  • s ⁇ P aU control EPg31259 caused loss of the wing and duplication of the dorsal thorax (Fig 1A, B).
  • EPg31259 was inserted 5 Kb upstream of the predicted gene CGI 3076 (Fig 2A).
  • Fig 2A The predicted gene corresponding to CGI 3076 was overexpressed in EPg31259 by in situ hybridization.
  • Gal4 directed expression of the predicted CGI 3076 gene did not produce the thorax duplication phenotype caused by EPg31259. This raised the possibility that the predicted gene does not accurately represent the Torero transcription unit.
  • a full-length cDNA was isolated from an embryonic cDNA library. Expression of this cDNA using ScP a ' 4 reproduced the thorax duplication phenotype caused by EPg31259 expression. Sequence analysis indicated that the functional Torero ORF differed from the predicted gene in its first exon (Fig 2A).
  • Torero repressed Wg activity when overexpressed To ask whether mutants that reduce Torero activity had the opposite effect and led to an increase in Wg activity, we examined wing discs from Torero mutant larvae.
  • the primordia of the adult wing and thoracic body wall can be visualized in the wing disc by expression of Nubbin (Nub) and Teashirt (Tsh) proteins (Fig 3A).
  • Nub is a POU-homeodomain protein expressed in the presumptive wing blade and wing hinge.
  • Tsh is a zinc finger protein expressed in the presumptive thorax.
  • Ectopic Wg activity can lead to duplication of wing structures at the expense of thorax (Ng et al, 1996; Wang et al, 2000).
  • Torero mutant discs showed this phenotype.
  • the severity of these defects ranged from duplication of the wing pouch and hinge associated with a reduced thorax (Fig 3B) to almost complete loss of thorax associated with a severely abnormal wing duplication (Fig 3C, see legend).
  • the same range of phenotypes was obtained by expression of Arm 510 to activate the Wg pathway in the early wing disc.
  • Fig 4(B) shows an example of the milder phenotype. Torero modulates responsiveness to Wg
  • Torero reduced the effects of activation of the Wg pathway at the level of the Wg receptor.
  • increased Wg activity suppressed the defects caused by Torero overexpression.
  • Wg forms a long-range protein gradient and regulates several target genes in different spatial domains in the wing disc (Zecca et al, 1996; Neumann and Cohen, 1997).
  • Achaete-Scute is a high threshold Wg target, expressed in cells close to the DV boundary.
  • Achaete-Scute expression specifies the proneural region in the anterior wing margin in which the single row of sense organ precursor (SOP) cells will form.
  • SOP sense organ precursor
  • Torero is a member of the ⁇ / ⁇ -hydrolase superfamily and shows homology to pectin acetylesterases
  • G-X-S-X-G is a conserved active site motif, termed a 'nucleophile-elbow', which forms part of a Ser, Asp, His catalytic triad.
  • Pectin acetylesterases modify the polysaccharides in the extracellular matrix of the plant cell wall. They hydrolyze the ester bond linking the acetyl group to the C2 position of galacturonic acid (Fig 6B).
  • Torero might act by removing acetyl groups from N-acetylglucosamine residues of GAGs. The acetyl group is linked to C2 of N-acetylglucosamine by an amide bond.
  • the role of the Serine nucleophile is the same in ester and amide hydrolysis. On the basis of its proposed function, we suggest naming this the Torero amide hydrolase domain (NAH).
  • Torero acts as a secreted protein in vivo
  • Torero Pectin acetylesterases from plant pathogens act as secreted enzymes to digest plant cell walls.
  • Torero might act as an extracellular enzyme affecting the GAG side chains of HSPGs at the cell surface.
  • Torero-GT Golgi- tethered form of Torero, in which the signal peptide was replaced with the transmembrane domain from a Golgi-resident enzyme (Torero-GT; Bruckner et al 2000). Secretion was assayed by immunoprecipitation from cell lysates and from the medium in which the cells were grown.
  • Wild-type Torero protein was recovered by immunoprecipitation from both the cell lysate and the conditioned medium (Fig 8 A).
  • the Torero 2 mutant protein was recovered at low levels in the conditioned medium and appeared to accumulate to higher levels in the cell lysate.
  • Golgi-tethered Torero (GT) was not recovered from conditioned medium.
  • GT Golgi-tethered Torero
  • the two proteins were expressed in the dorsal (D) compartment of the wing disc under apterous G ⁇ L4 control. We compared their effects on Dil and Hnt expression in D and V compartments.
  • the HSPG core proteins Dally and Dly are required for normal levels of Wg signaling activity (Baeg et al, 2001; Lin and Perrimon, 1999; Tsuda et al, 1999). Elevated Dally or Dly expression has been shown to increase Wg accumulation in the wing disc, though Dly is much more potent (Baeg et al, 2001; Strigini and Cohen, 2000). We therefore asked whether Torero might act by modifying Dally or Dly when the proteins were coexpressed by transfection in S2 cells.
  • Dly-HA An epitope-tagged version of Dly (Dly-HA) migrated as a broad band at -115 kD in SDS-PAGE in lysates of S2 cells, with minor bands at 97 and 105 kD (Fig 9A lane 1).
  • the 115 kD band presumably reflects the glycosylated form of the protein produced by addition of GAG side chains.
  • Coexpression of Dly-HA with wild-type Torero increased the amount of the 97kD form of Dly-HA (lane 2, Dly*).
  • the small amount of this band present in S2 cells expressing Dly-HA may reflect activity of the endogenous Torero protein, which was detected on longer exposures (not shown).
  • Dally-HA migrated as a broad smear above 95kD when expressed in S2 cells (lane 4). Torero had no effect on the electrophoretic mobility of Dally- HA, but caused a substantial reduction in the amount of Dally-HA recovered (lane 5).
  • Torero is structurally and functionally related to ⁇ / ⁇ -hydrolase enzymes
  • Torero S237A was ineffective in reducing the level of Dally-HA (Fig 9A lane 6), and was ineffective in producing the 97kD Dly* form (lane 3).
  • the GAG side chains of HSPGs consist largely of repeated dimers of GlcNAc and glucuronic acid.
  • the first step in modification of the side chains involves replacement of the acetyl moiety on many of the GlcNAc residues with a sulfate moiety by an enzyme called N-deacetylase/N- sulfotransferase (NDST).
  • NDST N-deacetylase/N- sulfotransferase
  • GlcNAc residues modified by NDST should not be a good substrate for Torero.
  • Torero acts on Dly to shape the Wg gradient
  • Dly has been shown to bind and stabilize extracellular Wg protein in the wing disc (Baeg et al, 2001).
  • Torero modifies the ability of Dly to bind Wg
  • Expression of Dly-HA in a broad band of cells in the center of the wing disc under spalt Ga ' 4 control caused accumulation of Wg protein, mainly outlining the cell surface (Fig 10A). Under these conditions we observed scalloping of the wing margin, suggesting that Wg is partially sequestered by binding to Dly and is less available for binding to its receptor.
  • Torero encodes a novel enzyme modifying proteglycans
  • Heparan sulfate proteglycans are present in very large numbers on the cell surface and are thought to provide a low affinity binding sites for secreted signaling proteins, including Wg.
  • Wg has been shown to bind to GAGs in cell culture (Reichsman et al, 1996).
  • the cell surface proteoglycans Dally and Dally-like (Dly) have been implicated in Wg signaling (Baeg et al, 2001; Lin and Perrimon, 1999; Tsuda et al, 1999). Dally and Dly expression levels can influence the amount of Wg bound to cells.
  • HSPGs Modification of HSPGs by sulfation is important for their function.
  • the NDST enzyme Sulfateless, is responsible for deacetylating and sulfating GlcNAc residues in the GAG side- chains of HSPGs (Lin et al, 1999; Lin and Perrimon, 1999). Both activities are carried out by one protein. Sulfation is required for subsequent modifications that enrich the structural complexity of the GAG side-chains (reviewed in Perrimon and Bernfield, 2000).
  • Torero competes with NDST for modification of GlcNAc residues in HSPGs.
  • Torero is a member of the ⁇ / ⁇ hydrolase family of enzymes.
  • Torero deacetylates GlcNAc residues in the HSPG GAG side-chains and renders them poor substrates for sulfation by NDST. Reduced sulfation might alter the ability of the GAG side-chains to bind Wg. Spatial pattern and gradient formation
  • Wg, Dpp and Hh each regulate the expression of genes that influence the shapes of their gradients (reviewed in Teleman et al, 2001. Each of these ligands regulates the level of expression of its receptor in ways that can influence the shape of the gradient. Hh signaling induces Patched expression and thereby limits its ability to spread in the A compartment (Chen and Struhl, 1996). High levels of Wg and Dpp repress expression of their receptors, Tkv and Dfz2, and may thereby allow formation of longer-range gradients (Cadigan et al, 1998; Lecuit and Cohen, 1998). Our findings indicate that Wg can also influence formation of its own gradient by modulating the activity of cell surface HSPGs.
  • Wg induces expression of Torero, which can act either during GAG biosynthesis or as a secreted protein to modify cell-surface HSPGs.
  • Torero activity allowed excess accumulation of Wg protein, resulting in an increase in the range of Wg activity.
  • overexpression of Torero limited the ability of cells to bind and stabilize Wg, thereby limiting the ability of Wg to spread in the disc epithelium and form a long-range gradient.
  • elevating Torero levels limited Wg movement and caused phenotypes ranging from scalloping of the wing to early failure to specify the wing pouch.
  • the predicted CGI 3076 cDNA was produced by PCR amplification of the 4 exons.
  • a cDNA library was prepared in lambda-ZapII (Stratagene) using mRNA from 0-24 hour embryos expressing Arm Si0 under tubulin Ga14 control. Arm sl ° activates the wingless pathway and was used to increase the levels of Torero mRNA expression.
  • RNA probes were prepared from a PCR product amplified from genomic DNA. Primers: 5' AAAGAATTCTGCAGCAGTGATTCGTGGTC 5'
  • Fly strains wg Ga!4 was produced by replacing the PZ element inserted in wg 110727 with the P ⁇ GAWB ⁇ element in sd 0 " 14 as described in Preston and Engels (1996).
  • UAS-FLP is described in Campbell and Tomlinson (1998).
  • UAS-dally is described in Jackson et al (1997).
  • UAS-Dly is described in Baeg et al. (2001).
  • UAS-arm S10 is described in Pai et al (1997).
  • UAS-sgg is described in Steitz et al (1998).
  • Fig 5B yw hsFlpl/yw; Torero 3 FRT80B/ ⁇ y + ⁇ M hs ⁇ Myc FRT80B
  • Fig 5C yw; en Ga!4 /UAS-FLP; Torero 3 FRT80B / ⁇ y + ⁇ M hs ⁇ Myc FRT80B
  • Heat shock was performed for 60' at 38°C at 48 ⁇ 12 hours to induce clones. Two hours before dissection, larvae were heat shocked for 30' to induce hs ⁇ Myc expression.
  • RmHa-Torero and UAS-Torero were produced by cloning the full-length cDNA in pRmHa3 into pUAST.
  • the M146K point mutant was introduced by PCR amplification of two fragments.
  • Fragment 1 was amplified by the T3 primer and GCCGACGTCTCTCGTCTCTGGCCACTGGGAGGAGGTCTTTAGGTGG, which introduced the point mutation and an Aatll site.
  • Fragment 2 was amplified with primers GAGAGACGTCGGCGGCATTCT and TCGCTTCTTGGACTTTGTGCC to produce a second fragment of Torero that includes the Aatll site.
  • Notl-Aatll cut fragment 1 and Aatll- SacII cut fragment 2 were cloned into pRmHa-Torero cut with Notl and SacII.
  • Torero S237A was produced by PCR amplification in two steps.
  • PCRI GGTGGCGAATTCTCTAGAACTAGTGGAT and
  • Torero-GT was produced by PCR amplification of aa 1-122 from GalNAc-T3 (GI: X92689) with the primers AAAGATCTATGGCTCACCTAAAGCGACTAGTAAAAT and AATGGATCCTTCCCCACCAGGTGCATTTGAATCC. This fragment was digested with Bglll and BamHI and cloned in frame with aa 58-673 of Torero in pUAST and pRmHa3.
  • Dly-HA was produced by inserting an oligonucleotide encoding the HA sequence (top strand: TACCCCTACGACGTCCCGGAC) in frame at a unique Ndel site in the coding sequence of Dly (GI: AF317090). Dly-HA was then recloned into pRmHa3 and pUAST. Dally-HA was recloned into pRmHa3 by PCR from pUAST Dally-HA (Tsuda et al, 1999). Antibodies
  • S2 cells were transfected with 2-6 ⁇ g of DNA using 4 ⁇ l per well of CellFectin (Invitrogen). After 14-18 hours the transfection mix was removed, cells were recovered in 3ml of SMF medium (GibCo) for 6-8 hours and induced with 0.7 mM CuS0 4 for 3 days. Cells were washed twice with PBS and lysed by boiling in 120 ⁇ l SDS-PAGE sample buffer.
  • S2 cells transfected with 3 ⁇ g of empty vector, pRmHa-Torero, pRmHa- Torero 2 or pRmHa-Torero-GT were lysed in 200 ⁇ l of 5m mM Tris (pH8), 150 mM NaCl, 1% TritonX-100 and protease inhibitors (Boehringer) supplemented with ImM PMSF.
  • l/10 th of the cell lysate was diluted in 1 ml of lysis buffer and immunoprecipitated with 2 ⁇ l of Guinea pig anti-Torero. 3ml of conditioned medium from the same wells were adjusted to 0.1% TritonX-100 and immunoprecipitated with l ⁇ l/ml of anti-Torero.
  • Tout-velu is a Drosophila homologue of the putative tumour suppressor EXT-1 and is needed for Hh diffusion, Nature 394, 85-8.
  • LDL- receptor-related protein 6 is a receptor for Dickkopf proteins, Nature 411, 321-5.
  • Twisted gastrulation is a conserved extracellular BMP antagonist, Nature 410, 479-83.
  • Proximal distal axis formation in the Drosophila leg distinct functions of teashirt and homothorax in the proximal leg, Mech Dev 94, 47-56.
  • SEQ ID NO. 3 Protein sequence of the Gogli tethered for of Drosophila Torero
  • SEQ ID NO.4 DNA sequence of the Gogli tethered form of Drosophila Torero (ToreroGT)) AAAGATCTATGGCTCACCTAAAGCGACTAGTAAAATTACACATTAAAAGACATTACCATAAAAAGTTCTGGAA GCTTGGTGCAGTAATTTTTTTCTTTATAATAGTTTTGGTTTTAATGCAAAGAGAAGTAAGTGTTCAATATTCC AAAGAGGAATCAAGGATGGAAAGGAACATGAAAAACAAAACAAGATGTTGGATTTAATGCTAGAAGCTGTAA ACAATATTAAGGATGCCATGCCAAAAATGCAAATAGGAGCACCTGTCAGGCAAAACATTGATGCTGGTGAGAG ACCTTGTTTGCAAGGATATTATACAGCAGCAGAATTGAAGCCTGTCCTTGACCGTCCACCTCAGGATTCAAAT GCACCTGGTGGGGGGAAGGATCCATTGAGGGACACCAGCATGAACATGATCCAGCGCAACTACATGGTGATGC ACTCGGCCAGCGGCTCCGG
  • SEQ ID NO. 5 Human Torero Protein (It lacks the N terminus approximately 40-70 aa)
  • SEQ ID NO. 6 Human Torero, excluding the 5' part of the gene that contains the 5' UTR, start codon and the signal peptide.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un nouveau mécanisme par lequel une signalisation Wg régule la forme du gradient de protéine Wg. Des niveaux élevés de signalisation Wg induisent l'expression d'une protéine avec une similarité avec des acétylestérases de pectine prédites de plantes ou d'agents pathogènes de plante. Nous avons appelé ce gène Torero du fait de son phénotype mutant à perte de fonction (andalou pour la libellule). Lorsqu'il est surexprimé, le gène Torero bloque l'activité Wg. La perte de la fonction Torero conduit à augmenter l'activité Wg par la modification de la forme du gradient de protéine Wg. L'activité Torero est requise dans l'embryon et dans les disques imaginaux pour limiter l'activité Wg.
PCT/GB2003/000317 2002-01-25 2003-01-27 Proteine torero WO2003062410A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003202694A AU2003202694A1 (en) 2002-01-25 2003-01-27 Torero protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0201808.3 2002-01-25
GBGB0201808.3A GB0201808D0 (en) 2002-01-25 2002-01-25 Protein

Publications (2)

Publication Number Publication Date
WO2003062410A2 true WO2003062410A2 (fr) 2003-07-31
WO2003062410A3 WO2003062410A3 (fr) 2004-03-11

Family

ID=9929803

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/000317 WO2003062410A2 (fr) 2002-01-25 2003-01-27 Proteine torero

Country Status (3)

Country Link
AU (1) AU2003202694A1 (fr)
GB (1) GB0201808D0 (fr)
WO (1) WO2003062410A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012027723A1 (fr) * 2010-08-27 2012-03-01 Stem Centrx, Inc Modulateurs de la protéine de notum et leurs procédés d'utilisation
EP2643019A1 (fr) * 2010-11-24 2013-10-02 Lexicon Pharmaceuticals, Inc. Anticorps contre notum pectinacetylesterase
US8802365B2 (en) 2011-03-22 2014-08-12 Whitehead Institute For Biomedical Research Methods for identifying candidate modulators of NOTUM activity
CN110862975A (zh) * 2019-12-18 2020-03-06 西南大学 柑橘果胶乙酰酯酶CsPAE及其编码基因和应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001094641A2 (fr) * 2000-06-09 2001-12-13 Idec Pharmaceuticals Corporation Nouvelles cibles geniques et ligands se fixant a celles-ci pour le traitement et le diagnostic de carcinomes ovariens
WO2002002759A2 (fr) * 2000-06-29 2002-01-10 Millennium Pharmaceuticals, Inc. 32225, un nouveau membre de la famille des $g(a)/$g(b)-hydrolases humaines, et utilisations correspondantes
WO2002062841A2 (fr) * 2001-02-02 2002-08-15 Incyte Genomics, Inc. Proteines secretees

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9921009D0 (en) * 1999-09-07 1999-11-10 Neuropa Ltd Essential genes and assays relating thereto
AU2001245945A1 (en) * 2000-03-23 2001-10-03 Pe Corporation (Ny) Detection kits, such as nucleic acid arrays, for detecting the expression of 10,000 or more drosophila genes and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001094641A2 (fr) * 2000-06-09 2001-12-13 Idec Pharmaceuticals Corporation Nouvelles cibles geniques et ligands se fixant a celles-ci pour le traitement et le diagnostic de carcinomes ovariens
WO2002002759A2 (fr) * 2000-06-29 2002-01-10 Millennium Pharmaceuticals, Inc. 32225, un nouveau membre de la famille des $g(a)/$g(b)-hydrolases humaines, et utilisations correspondantes
WO2002062841A2 (fr) * 2001-02-02 2002-08-15 Incyte Genomics, Inc. Proteines secretees

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
BRETON C ET AL: "PCR cloning and expression analysis of a cDNA encoding a pectinacetylesterase from Vigna radiata L" FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 388, 1996, pages 139-142, XP002129460 ISSN: 0014-5793 *
DATABASE EMBL [Online] 1 February 2000 (2000-02-01) STRAUSBERG R: "hc98f06.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2908067 3' similar to TR:O80731 O80731 PUTATIVE PECTINACETYLESTERASE PRECURSOR, mRNA sequence." Database accession no. AW340565 XP002262866 *
DATABASE EMBL [Online] 24 November 2000 (2000-11-24) STRAUSBERG, R: "maa34h03.y1 NCI_CGAP_Li10 Mus musculus cDNA clone IMAGE:3812981 5' similar to TR:Q9VUX3 Q9VUX3 CG13076 PROTEIN, mRNA sequence." Database accession no. BF322230 XP002262868 *
DATABASE EMBL [Online] 29 August 2002 (2002-08-29) STRAUSBERG R.L., ET AL.: "Homo sapiens hypothetical protein LOC147111, mRNA (cDNA clone IMAGE:5225889), partial cds." Database accession no. BC036872 XP002262869 -& DATABASE SWALL [Online] 1 October 2002 (2002-10-01) STRAUSBERG R.: "Hypothetical protein (Fragment)" Database accession no. Q8N410 XP002262870 -& STRAUSBERG R L ET AL: "Generation and initial analysis of more than 15,000 full -length human and mouse cDNA sequences" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 99, no. 26, 24 December 2002 (2002-12-24), pages 16899-16903, XP002245220 *
DATABASE EMBL [Online] 4 September 2001 (2001-09-04) MUZNY D., ET AL.: "Drosophila melanogaster 3L BAC RP98-18K24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence." Database accession no. AC093499 XP002250860 *
DATABASE EMBL [Online] 9 February 2001 (2001-02-09) ADACHI J, ET AL: "Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730593N15 product:hypothetical protein, full insert sequence." Database accession no. AK019987 XP002262867 cited in the application -& KAWAIJ ET AL: "Functional annotation of a full-length mouse cDNA collection" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 409, no. 6821, 8 February 2001 (2001-02-08), pages 685-690, XP002952962 *
DATABASE GENESEQ [Online] 17 July 2001 (2001-07-17) DAVIES RW, ET AL.: "Drosophila melanogaster essential gene fragment, SEQ ID NO: 482." Database accession no. AAH29293 XP002250861 & WO 01 18547 A (YANG MING YAO ;KAISER KIM (GB); UNIV GLASGOW (GB); DAVIES ROGER WA) 15 March 2001 (2001-03-15) *
DATABASE GENESEQ [Online] 26 March 2002 (2002-03-26) VENTER JC, ET AL.: "Drosophila melanogaster polypeptide SEQ ID NO 30057" Database accession no. ABB67755 XP002250862 -& DATABASE GENESEQ [Online] 26 March 2002 (2002-03-26) VENTER JC, ET AL.: "Drosophila melanogaster genomic polynucleotide SEQ ID NO 17104" Database accession no. ABL21877 XP002250863 -& WO 01 71042 A (PE CORP NY) 27 September 2001 (2001-09-27) *
DATABASE SWALL [Online] 1 May 2000 (2000-05-01) ADAMS M.D., ET AL.: "CG13076 protein" Database accession no. Q9VUX3 XP002250859 -& ADAMS MARK D ET AL: "The genome sequence of Drosophila melanogaster." SCIENCE (WASHINGTON D C), vol. 287, no. 5461, 24 March 2000 (2000-03-24), pages 2185-2195, XP002169943 *
GERLITZ OFFER ET AL: "Wingful, an extracellular feedback inhibitor of wingless." GENES & DEVELOPMENT, vol. 16, no. 9, 1 May 2002 (2002-05-01), pages 1055-1059, XP002250858 May 1, 2002 ISSN: 0890-9369 *
GIRALDEZ ANTONIO J ET AL: "HSPG modification by the secreted enzyme Notum shapes the Wingless morphogen gradient." DEVELOPMENTAL CELL, vol. 2, no. 5, May 2002 (2002-05), pages 667-676, XP009014916 May, 2002 ISSN: 1534-5807 *
MATA JUAN ET AL: "Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis." CELL, vol. 101, no. 5, 26 May 2000 (2000-05-26), pages 511-522, XP002250857 ISSN: 0092-8674 *
NARDINI MARCO ET AL: "alpha/beta Hydrolase fold enzymes: The family keeps growing." CURRENT OPINION IN STRUCTURAL BIOLOGY, vol. 9, no. 6, December 1999 (1999-12), pages 732-737, XP002250856 ISSN: 0959-440X *
OLLIS D L ET AL: "THE ALPHA/BETA HYDROLASE FOLD" PROTEIN ENGINEERING, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 5, no. 3, 1992, pages 197-211, XP002057138 ISSN: 0269-2139 *
ZENG W ET AL: "NAKED CUTICLE ENCODES AN INDUCIBLE ANTAGONIST OF WNT SIGNALLING" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 403, no. 6771, 17 February 2000 (2000-02-17), pages 789-795, XP000934072 ISSN: 0028-0836 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012027723A1 (fr) * 2010-08-27 2012-03-01 Stem Centrx, Inc Modulateurs de la protéine de notum et leurs procédés d'utilisation
CN103260646A (zh) * 2010-08-27 2013-08-21 斯坦申特雷克斯公司 Notum蛋白调节剂和使用方法
JP2013539468A (ja) * 2010-08-27 2013-10-24 ステム セントリックス， インコーポレイテッド Ｎｏｔｕｍタンパク質モジュレーターおよび使用法
AU2011293127B2 (en) * 2010-08-27 2016-05-12 Abbvie Stemcentrx Llc Notum protein modulators and methods of use
EP2643019A1 (fr) * 2010-11-24 2013-10-02 Lexicon Pharmaceuticals, Inc. Anticorps contre notum pectinacetylesterase
EP2643019A4 (fr) * 2010-11-24 2014-12-31 Lexicon Pharmaceuticals Inc Anticorps contre notum pectinacetylesterase
US11059907B2 (en) 2010-11-24 2021-07-13 Lexicon Pharmaceuticals, Inc. Antibodies that bind Notum Pectinacetylesterase
US8802365B2 (en) 2011-03-22 2014-08-12 Whitehead Institute For Biomedical Research Methods for identifying candidate modulators of NOTUM activity
CN110862975A (zh) * 2019-12-18 2020-03-06 西南大学 柑橘果胶乙酰酯酶CsPAE及其编码基因和应用

Also Published As

Publication number Publication date
AU2003202694A1 (en) 2003-09-02
WO2003062410A3 (fr) 2004-03-11
GB0201808D0 (en) 2002-03-13

Similar Documents

Publication Publication Date Title
JP2002525115A (ja) 発作、高血圧、糖尿病および肥満を予報および治療する、遺伝子およびタンパク質
JP2003502046A (ja) 新規ヒト環状ヌクレオチドホスホジエステラーゼ
MXPA04010674A (es) Moleculas de reconocimiento en superficie de celula que contienen dominio de inmunoglobulina.
EP1124572B1 (fr) Genes et proteines destines a la prevention et therapie de maladies renales et de troubles associes
US9049849B2 (en) Screening methods for compounds useful for treating pancreatic dysfunction
JP2005528336A (ja) シスチン−ノットフォールドタンパク質
WO1998022584A1 (fr) GENE CODANT POUR LE RECEPTEUR C1q ET SON APPLICATION DANS L'AUGMENTATION DE LA DEFENSE DE L'HOTE
JP2000512484A (ja) ヒト・ヒアルロナン・レセプター
WO2003062410A2 (fr) Proteine torero
EP2275118A2 (fr) Proteines spécifiques du pancreas
CA2335096A1 (fr) Procedes et materiaux associes a de nouveaux polypeptides semblables a cd39
JP2003210183A (ja) ヒトＩκＢ−β
CA2370519C (fr) Acides nucleiques codant un polypeptide comprenant un domaine mutt
US20030175754A1 (en) RVP-1 variant differentially expressed in crohns disease
US20030068311A1 (en) Transmembrane protein differentially expressed in cancer
US20030054446A1 (en) Novel retina-specific human proteins C7orf9, C12orf7, MPP4 and F379
WO1999007854A2 (fr) Serine/threonine kinase et ses utilisations
US20060179497A1 (en) Methods to treat conditions associated with insulin signaling dysregulation
US20030175787A1 (en) Vesicle membrane proteins
US6908765B1 (en) Polypeptide—human SR splicing factor 52 and a polynucleotide encoding the same
US20030166881A1 (en) Novel genes associated with allergic hypersensitivity and mast cell activation
JP2005500049A (ja) 有機化合物
JPWO2002064770A1 (ja) 新規スカベンジャー受容体クラスａ蛋白質
WO1999055839A1 (fr) Reforcemtent des defenses de l'hote
US20030054385A1 (en) Human ubiquitin-conjugating enzymes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP