WO2003040407A2 - Novel markers for cardiopathies - Google Patents

Novel markers for cardiopathies Download PDF

Info

Publication number
WO2003040407A2
WO2003040407A2 PCT/EP2002/012522 EP0212522W WO03040407A2 WO 2003040407 A2 WO2003040407 A2 WO 2003040407A2 EP 0212522 W EP0212522 W EP 0212522W WO 03040407 A2 WO03040407 A2 WO 03040407A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
genes
ests
dcm
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/012522
Other languages
French (fr)
Other versions
WO2003040407A3 (en
Inventor
Patricia Ruiz
Rafael Grzweskowiak
Mario Drungowski
Henning Witt
Karl J. Osterziel
Andreas Perrot
Aydah Saleh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Max Planck Gesellschaft zur Foerderung der Wissenschaften eV filed Critical Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Publication of WO2003040407A2 publication Critical patent/WO2003040407A2/en
Publication of WO2003040407A3 publication Critical patent/WO2003040407A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a diagnostic composition comprising nucleic acid molecules which are capable of specifically hybridizing to the mRNAs of genes showing abnormal gene expression associated with a cardiopathy, particularly a cardiomyopathy, e.g. dilated cardiomyopathy (DCM) .
  • the present invention also relates to the use of said nucleic acid molecules for diagnosis of such diseases or a disposition to such diseases .
  • DCM Dilated cardiomyopathy
  • the technical problem underlying the present invention is to provid means (or markers) for diagnosis of cardiopathies like DCM or diagnosis of a disposition to cardiopathies like DCM.
  • the present invention relates to a diagnostic composition
  • a diagnostic composition comprising at least one nucleic acid molecule, preferably single-stranded nucleic acid molecule (s), which (a) each comprises a gene listed in Table 2 and/or Table 4, preferably Table 2, or a fragment thereof or (b) is capable of specifically hybridizing to the mRNA of at least one gene listed in Table 2 and/or Table 4, preferably Table 2.
  • the term "capable of specifically hybridizing” has the meaning of hybridization under conventional hybridization conditions, preferably under stringent conditions as described, for example, in Sambrook et al . , Molecular Cloning, A Laboratory Manual, 2 nd edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, or in Example 1 (A) , below. Also contemplated are nucleic acid molecules that hybridize at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency) , salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC) .
  • Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • hybridization probe (or primer) nucleic acid molecules can be used, for example, that have exactly or basically the nucleotide sequence of the genes depicted in Table 2, Table 4, Table 6A or 6C, or parts of these sequences.
  • the term “schulnucleic acid molecule” as used herein also comprises fragments which are understood to be parts of the nucleic acid molecules that are long enough to specifically hybridize to transcripts of the genes of Table 2, Table 4, Table 6A or 6C.
  • These nucleic acid molecules can be used, for example, as probes or primers in a diagnostic assay.
  • the nucleic acid molecules of the present invention have a length of at least 10, in particular of at least 16 and, particularly preferred, of at least 25 nucleotides.
  • the nucleic acid molecules of the invention can also be used, for example, as primers for a PCR reaction.
  • the fragments used as hybridization probe or primer can be synthetic fragments that were produced by means of conventional synthesis methods.
  • the diagnostic composition of the present invention comprises at least 50 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 50 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
  • the diagnostic composition of the present invention comprises at least 150 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 150 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
  • the diagnostic composition of the present invention comprises at least 300 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 300 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
  • the diagnostic composition of the present invention comprises at least 600 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 600 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
  • nucleic acid molecules of the diagnostic composition of the present invention are bound to a solid support, for example, a polystyrene microtiter dish or nitrocellulose paper.
  • the nucleic acid molecules of the diagnostic composition are present in a microarray format which can be established according to well known methods.
  • the microarray can be produced starting from cDNA clones, plasmids etc. by PCR amplification of a given gene or gene fragment. These fragments are then spotted or robotically arrayed onto a solid support which can be, e.g., glass, nylon or any other suitable surface.
  • the present invention also relates to a method for diagnosing a cardiopathy, preferably a cardiomyopathy, more preferably dilated cardiomyopathy (DCM) or a disposition to such a disease comprising contacting a target sample with (a) nucleic molecule (s) as described above and comparing the concentration of individual mRNA(s) with the concentration of the corresponding mRNA(s) from at least one healthy donor.
  • An aberrant (increased or decreased) mRNA level of at least one gene, preferably at least 50 genes, more preferably at least 300 genes determined in the sample in comparison to the control sample is an indication of a cardiopathy like DCM or a disposition to a cardiopathy like DCM.
  • samples are, preferably, obtained from serum, blood or myocardial tissue.
  • total RNA is obtained according to standard procedures.
  • a DNAse treatment is performed.
  • the nucleic acid molecule is typically a nucleic acid probe for hybridization or a primer for PCR.
  • the person skilled in the art is in a position to design suitable nucleic acids probes based on the information provided in the tables.
  • the target cellular component i.e. mRNA, e.g., in myocardial tissue
  • Detection methods include Northern blot analysis, RNase protection, in situ methods, e.g.
  • in situ hybridization in situ hybridization, in vitro amplification methods (PCR, LCR, QRNA replicase or RNA-transcription/amplification (TAS, 3SR) , reverse dot blot disclosed in EP-B1 0 237 362) ) and other detection assays that are known to those skilled in the art.
  • Products obtained by in vitro amplification can be detected according to established methods, e.g. by separating the products on agarose gels and by subsequent staining with ethidium bromide.
  • the amplified products can be detected by using labeled primers for amplification or labeled dNTPs.
  • detection is based on a microarray.
  • the probes can be detectably labeled, for example, with a radioisotope, a bioluminescent compound, a chemiluminescent compound, a fluorescent compound, a metal chelate, or an enzyme.
  • the present invention also relates to the use of the nucleic acid molecules described above for the preparation of a diagnostic composition for the diagnosis of DCM or a disposition to DCM.
  • the present invention relates to the use of the nucleic acid molecules of the present invention for the isolation or development of a compound which is useful for therapy of cardiopathies like DCM.
  • the nucleic acid molecules of the invention and the data obtained using said nucleic acid molecules for diagnosis of DCM might allow to identify genes which are specifically dysregulated, thus may be considered as potential targets for therapeutic interventions .
  • Figure 1 Verification of array results by RT-PCR The graph depicts regulation ratios obtained from conventional and real time RT-PCR protocols as compared to those from the cDNA array. Values were standardised to GAPDH expression levels .
  • Figure 2 Cluster image showing gene regulation ratios from DCM patients
  • Figure 5 Size distribution and integrity of amplified RNA Total and amplified RNAs were resolved in the agarose gel electrophoresis. Lines 1-2: 100 ng of total RNA from human fetal kidney fibroblasts (293) and dermal fibroblasts (HDK) respectively; lines 3-4: 10% of the first round of amplification; lines 6-7: 10% of the second round of amplification; NTC: 100% of the no template control. Note the increase of the transcript fraction and molecular weight distribution.
  • RNA from each biopsy was applied an the Agilent 6000 RNA Nanochip and run an the Agilent 2100 Bioanalyser.
  • A The size and integrity were evaluated. L- RNA size ladder. Lines 1, 2: aRNA from patient A and B respectively. Lines 3, 4: no template controls.
  • B Fluorescence profile of the sample from the line 1. The aRNA concentration was calculated as the area below the curve.
  • Figure 7 Influence of the RNA amplification an the relative transcript abundance
  • FIG. 10 Verification of array results by real time Q-PCR The graphs depict regulation ratios obtained using real time PCR transcript measurement an human DCM and mouse MLP-/- material. Mean values from 3 independent, normalised measurements are shown.
  • A White and grey bars represent the regulation ratios obtained by the array analysis and by the Q- PCR approach respectively.
  • B Bars represent the regulation ratios of MLP -/- mice as compared to control littermates.
  • C List of genes in alphabetical order.
  • FIG 11 Biological processes involved in DCM 266 differentially genes were grouped into 21 cell processes according to the Gene Ontology terminology using Celera and Gene Card data bases. Black and white bars represent down (- ) and up (+) regulated genes respectively.
  • Log values of the mean regulation ratios for each process were hierarchically clustered. Patients are ordered by disease severity as in Table 5. In blue are indicated clusters correlating with disease progression. The colour scale with corresponding ratios is presented. Ratios lower than 1 are masked.
  • dilated cardiomyopathy DCM
  • control samples were analysed using the human UniGene RZPD1 set containing 33,689 clones (https://www.rzpd.de/my_rzpd/ unigeneSets . shtml) .
  • cDNAs were PCR amplified using universal primers (primer 1 (5' -CCCCAGGCTTTACACTTTATGCTTCCGGCTCG-3' ) and primer 2 (5' -GGTGCGGGCCTCTTCGCTATTACGCCA-3' ) and the products were spotted onto 22x22 cm nylon membranes (Hybond N+, Amersham, Freiburg, Germany) using in-house robots. PCR products were spotted without duplicates and in addition a kanamycin cDNA was spotted as a "guide dot" to aid image analysis .
  • Myocardial biopsies (2-3 mm 3 ) were collected from clinically stable male patients suffering from idiopathic DCM during routine heart catheterisation in the Charie/Franz-Volhard-technik (Berlin) (Table 1) . They were taken from the posteriolateral wall of the left ventricle in all cases, flash frozen in liquid nitrogen and stored at -80°C. Coronary artery disease in each case was excluded by selective coronary angiography, as-well as hypertension. Myocardial samples from four non-transplanted hearts were used as controls.
  • 100 ng of aRNA were used per cDNA array.
  • the resulting radioactive cDNA was purified using sephadex columns and denaturated together with salmon sperm and human placenta DNA as blocking ' reagents.
  • radioactively-labelled 1 ng kanamycin cDNA was added to the complex probe. Following denaturation this mixture was added to 10 ml hybridisation buffer (1M NaCl, 1% SDS, O.lxSSC) and hybridised overnight at 65°C to the cDNA filters. After washing three times for 20 min at 65°C (0.1% SDS, 0. IX SSC) the filters were exposed for approx. 6 hours on Fuji BAS screens .
  • Probes were generated from aRNA from pooled controls and from single patients ' samples. Since the experiment was performed twice on each patient, we obtained 2x10 signal intensity comparisons for each cDNA clone. Determination of signal intensities was done using Visual Grid (GPC-Biotech, Kunststoff, Germany) and background intensities were calculated using in- house developed scripts: on the basis of several empty spots per block a three-dimensional profile was generated (REF) and subtracted. Normalisation of signal intensities between two filters was done using the median of the ratios of the strongest signals (aprox. 15%) .
  • a group of 16 differentially expressed and sequence verified genes was selected representing ESTs/novel as well as other transcripts reported to be DCM-relevant .
  • Gene-specific primers were designed flanking ⁇ 300bp of the 3 f translated region.
  • DCM and control aRNAs were pooled independently and 5 ⁇ g from each were used to generate cDNA templates (100 ⁇ l) .
  • GAPDH primers For conventional RT-PCR analysis 1 ⁇ l from each cDNA sample was used together with gene-specific and GAPDH primers (GAPDH has been reported previously to be a reliable reference gene for cardiac tissue.
  • the cycling conditions were: (95°C 30 sec, 57°C-60°C 30 sec, 72°C 45 sec) x 25 times.
  • PCR products were visualised by gel electrophoresis and quantified using I ageQuant software (Molecular Dynamics, Sunnyvale, CA, USA) . After standardisation to GAPDH internal controls the regulation ratios were calculated.
  • BMI body mass index
  • EF ejection fraction
  • FS shortening fraction
  • Ao mean mean aortic pressure
  • LEDD/BSA left ventricular end-diastolic dimension/body surface area
  • NYHA New York Heart Association classification
  • DCM dilated cardiomyopathy
  • control samples were analysed using the human UniGene RZPDl set containing 34,176 clones (http://www.rzpd.de).
  • cDNAs were PCR amplified using universal primers and the products were spotted onto 22x22 cm nylon membranes (Hybond N+, Amersham) using in-house robots. PCR products were spotted and in addition a kanamycin cDNA was spotted as a guide dot to aid image analysis. Two hundred and eighty nine cDNA clones
  • concentration and integrity of the amplified RNA (aRNA) from each biopsy was estimated using the Bioanalyser (Agilent Technologies) .
  • 100 ng of aRNA was used per cDNA array.
  • the resulting radioactive cDNA was purified using Sephadex columns, denatured and added to denatured salmon sperm and human placenta DNA as blocking reagents.
  • radioactively-labelled 1 ng kanamycin cDNA was added to the compeex probe. This mixture was added to 10 ml hybridisation buffer (1M NaCl, 1% SDS, O.lxSSC) and hybridised overnight at 65°C to the cDNA filters. After washing three times for 20 min at 65°C (0.1% SDS, 0.1X SSC) the filters were exposed for approx. 6 hours an Fuji BAS screens.
  • Whole heart samples from 12-weeks old MLP -/- and wild-type mice were kindly provided by Dr. E. Ehler (ETH, Zurich) . Total RNA was isolated, and cDNA synthesised using a MMLV reverse transcriptase as described below. For Q-PCR experiments 1 ⁇ l was used as a template .
  • Gene-specific primers for mouse and human genes were designed with GCG Prime software to generate 50-100 bp long amplicons. All DCM and control aRNAs were pooled independently and 5 ⁇ g from each were used to generate cDNA templates (100 ⁇ l) . The GeneAmp, 5700 Sequence Detection System (Applied Biosystems) was then used: 1 ⁇ l of the cDNA from DCM and control samples respectively was used in triplicate reactions (96-well format) with 1 ⁇ l of 10 pM gene specific primers and 2.5 ⁇ l SYBR GreenMix. The cycling conditions were: 95°C 15 sec, 60°C 1 min. The transcript levels were standardised to the internal control (PO ribosomal phospho-protein gene) for each measurement.
  • radioactivity detection is a more sensitive technique that combines the robustness with the ability to compare multiple normalised experiments. Accordingly, low expressed transcripts were detected: myomesin, CD81, gdpdissociation inhibitor.
  • RNA amplification protocol Evaluation of the RNA amplification protocol
  • HDF Human dermal fibroblasts
  • human foetal kidney fibroblasts (293 BHK) .
  • Cells grown under standard cell culture conditions were used to isolate total RNA (two independent preparations from each cell line) .
  • Two rounds of the T7-based amplification protocol (Eberwine 1996) were applied to 100 ng of the total RNA.
  • the integrity, size range and concentration of the amplified RNA (aRNA) and total RNA (TRNA) were evaluated using the Agilent Bioanalyser and agarose gel electrophoresis ( Figure 5) .
  • Most of the transcripts after 2 rounds of amplification range in size between 150 and 900 nucleotides.
  • the efficiency of amplification after 2 rounds was about 1300 fold.
  • RNA samples from two DCM biopsies analysed after two rounds of amplification an Bioanalyser are shown in Figure 6.
  • each of the two aRNA (100 ng) and two TRNA (20 ⁇ g) samples was radio-labeled and hybridised independently to nylon membranes carrying 21,888 cDNA clones (a subset of the UniGene Setl) . After background subtraction, the intensities were normalised to the median of the 25% brightest spots.
  • the differentially expressed genes between HDF and 293BHK cell lines were selected according to a signal/background ratio z3 and a regulation ratio z3 (see also below) .
  • RNA amplification The influence of the RNA amplification an the relative transcript abundance was assessed by selecting the differentially expressed genes using either T-RNA or aRNA, and comparing gene sets. From the 21,888 clones analysed differential expression showed 405 and 395 genes when total or amplified RNA was used respectively ( Figure 7) . In these two groups common were 305 genes ( about 77%) . This indicates adequate levels of reproducibility and linearity of the amplification protocol in our experiments, and agrees with previous reports using similar protocols.
  • the correlation indices increased. Based an the results obtained the selection criteria for differentially expressed cDNA clones/genes where set to a signal/background ratio >3 and a regulation ratio >3.
  • the VisualGrid Software produced raw intensities for every measured cDNA clone an the array, as well as local background values (signals corresponding to the empty spots) . All intensities were rescaled an each filter separately by dividing them by the 75% quantile of all signal intensities of the corresponding filter. Raw intensities were background corrected by subtracting the local background estimates block wise (one empty spot per block; 384x6 blocks per filter with a 3x3 spotting pattern). These values are referred to as L(j/i), where i denotes a given cDNA clone and j a given filter.
  • the signal to background ratio was used, the ratio of average expression levels between the DCM and the control group, and the absolute difference between these groups measured in terms of the p-value of a two sample t-test. Note, that this p-value does not describe the statistical signifance of deregulated genes accurately, because there is a difficult multiple testing problem with dependent variables (interacting genes; see below) .
  • Control and treatment labels were randomly permuted and from these simulations, the proportion ⁇ 0 of induced (up- or down-regulated) transcripts was estimated by calculating 0.25 and 0.75 quantiles for the total of all simulated p-values and for the total of all simulated Control- to-DCM-ratios .
  • ⁇ A' is the number of original data falling into both of these quantile intervals and B' is the average number for 2000 permutated data sets.
  • the False Discovery Rate reflects the proportion of falsely rejected null hypotheses among all rejected null hypotheses.
  • three joint rejection criteria were used: A gene was called induced, if both signal-to-background-ratio and control-to-DCM-ratio exceed the value of 3 and its p-value (from a two-sample t-test) was less than 0.001. A total of 655 cDNA clones meeting these criteria were found.
  • ANGP1_F AAGGTCACACTGGGACAGCAGG
  • RNAs DCM and control amplified RNAs
  • the gene expression patterns generated were compared using either total or amplified RNA. When signal intensities of each experiment were plotted, high correlation indices using total vs. total RNA (98%) and aRNA vs. aRNA (97%) were found.
  • Table 2 shows 45 differentially expressed sequence verified transcripts with a p-value ⁇ 0.001 and regulation ratio >2. Highlighted are genes confirmed by two RT-PCR based methods.
  • cDNA clones represent genes involved in the oxidative phosphorylation in mitochondria or sarcomeric/cytoskeletal components. A few others are implicated in calcium cycling or cell energy metabolism (e.g. phospholamban, calsarcin-1, fatty acid binding protein 3, creatine kinase, succinate dehydrogenase) . Interestingly, also genes related to immune interactions and apoptosis (CD81, interleukin 1 receptor like protein, beclin, apoptosis related protein 3) were found.
  • CD81 interleukin 1 receptor like protein, beclin, apoptosis related protein 3
  • DCM tissues and potentially involved in the pathogenesis of DCM are additionally shown in Table 3. These include several proteins involved in Z-disc formation, sarcomere stabilisation and muscle-cell signalling (Table 3A) . Some of these were common to all DCM-samples (e.g. cardiac alpha actin, troponin and dystrophin, Table 2) . It is reasonable to speculate that among these differentially expressed genes, some may represent new valuable candidates for genetic studies. The failure of cell-survival pathways to inhibit myocyte apoptosis is a critical step in the initiation of dilation and heart failure.
  • Example 5 Extended studies on monitoring the progression of dilated cardiomyopathy by gene expression profiling using cardiac biopsies
  • Example 1 The 655 differentially expressed genes were resequenced, and after excluding redundant clones representing the same gene and clones with incorrect annotation, a list of 364 differentially expressed transcripts was assembled. From these 144 represent ESTs and therefore putative novel (i.e. not related to the disease so far) transcripts associated to DCM (the table containing ESTs is shown below as Table 6A) .
  • the "lipid metabolism” group contained genes involved in lipid degradation and fatty acid catabolism: lipoprotein lipase, fatty acid binding protein, acyl CoA isomerase, CoA reductase etc. Strikingly, a gradual increase in expression levels of almost all transcripts was observed in this group correlating with the progression of DCM.
  • Calumenin which may participate in the immunological defence system, and could be involved in the pathological process of amyloid deposits formation seen in different types of tissues is also upregulated. These findings add further evidence to the involvement of amyloidosis in the aetiology of cardiomyopathy.
  • Calsarcin a member of the novel calcineurin interacting protein family, has been shown to interact with the Z-disc protein a-actinin linking the calcineurin signalling pathway with the contractie apparatus.
  • gene profiles of certain genes show a progressive increase in expression levels, and may therefore be directly associated with the development of DCM.
  • lim-domain family members were found in the present study: four and a half lim domain protein 1, actin associated lim protein and Z-band alternatively spliced PDZ motif (ZASP) , representing further putative DCM-associated candidate genes. Intriguing is also sn ⁇ px, a novel stretch- responsive protein, which has been shown to regulate transcription and myocyte muscle hypertrophy.
  • ZASP Z-band alternatively spliced PDZ motif
  • An important component of the hypertrophic gene program is the calcineurin- mediated signaling pathway.
  • genes related to this cascade were included in the "intracellular signaling" group: e.g. GDP dissociation inhibitor 1, RAB 35 and novel gene calsarcin.
  • apoptosis-related genes may help to confirm this hypothesis.
  • pro-apoptotic genes correlate with disease progression: small edrk-rich factor 2, voltage- dependent anion channel 1 and 2, kallikrein 11 and prostaglandin D2 synthase.
  • genes controlling cell cycle were down-regulated in DCM patients: anaphase- promoting complex subunit 7, cyclin-dependent kinase 5, cyclin D binding myb-like transcription factor 1 and fms-related tyrosine kinase 1.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Described is a diagnostic composition comprising nucleic acid molecules which are capable of specifically hybridizing to the mRNAs of genes showing abnormal gene expression associated with a cardiopathy, particularly a cardiomyopathy, e.g. dilated cardiomyopathy (DCM). Also described is the use of said nucleic acid molecules for diagnosis of such diseases or a disposition to such diseases.

Description

Novel markers for cardiopathies
The present invention relates to a diagnostic composition comprising nucleic acid molecules which are capable of specifically hybridizing to the mRNAs of genes showing abnormal gene expression associated with a cardiopathy, particularly a cardiomyopathy, e.g. dilated cardiomyopathy (DCM) . The present invention also relates to the use of said nucleic acid molecules for diagnosis of such diseases or a disposition to such diseases .
Dilated cardiomyopathy (DCM) , a major form of human heart failure, is characterised by a progressive, uniform dysfunction of the entire myocardium. DCM can occur independently of coronary artery disease, and often has ' a genetic component. The analysis of this subtype of cardiomyopathy provides therefore an invaluable opportunity to uncover intrinsic, muscle-specific pathways for heart failure.
In 25-30% of DCM patients the disorder has been attributed to genetic mutations in cytoskeletal proteins involved in linkage between sarcomere and extracellular matrix, force transmission or cell and nuclear membrane structure. Recently, the importance of cytoskeletal proteins in the pathogenesis of DCM has been emphasised. Increased biomechanical stress on myocytes has been assumed to generate persistent signals for ventricular hypertrophy and in long-term dilation and heart failure. Conco itantly, hypertrophic and apoptotic programs might be activated. The molecular balance between these two may determine whether chamber dilation occurs or not. A further critical factor in heart remodelling and heart failure seems to be the dysregulation of calcium homeostasis.
During the development of DCM cardiac myocytes undergo remodelling processes. While initially compensatory, they ultimately accelerate functional deterioration and the onset of cardiac failure. Disturbances in cytoskeletal, apoptotic and calcium-related signalling may essentially underlay a complex remodelling program and constitute the basis for the pathological events during dilation. Unfortunately, so far suitable methods for diagnosis of DCM or for the determination of the risk to develop DCM were not available.
Thus, the technical problem underlying the present invention is to provid means (or markers) for diagnosis of cardiopathies like DCM or diagnosis of a disposition to cardiopathies like DCM.
The solution to said technical problem is achieved by providing the embodiments characterized in the claims. Based on biomathematical analysis, gene expression profiles of dilated cardiomyopathy and control samples were analysed. Biopsies from 10 patients were collected by routine heart catheterization. An „in silico" normalised human Unigene library containing 33.689 clones was PCR amplified and robotically arrayed on nylon membranes. The resulting filters were hybridised with 33P labelled cDNAs derived from RNA isolated from 4 healthy and 9 dilated cardiomyopathy biopsies. 650 differentially expressed transcripts were identified and several of these were confirmed by reverse-transcribed- and real ti e-PCR. Global trends in gene expression patterns were revealed by hierarchical clustering and functional categorisation. The largest number of differentially regulated genes was found to be involved in energy metabolism, sarcomere architecture and cell signalling. Moreover, several transcripts may be involved in cytoskeletal signalling, myocyte survival/apoptosis and calcium homeostasis, and be essential for dilative remodelling and heart failure. Convenient custom-arrays for routine profiling can be developed on this basis and provide a sensitive diagnostic resource .
It is reasonable to assume that genes exhibiting a concerted regulation in all DCM samples (or most of the DCM samples) , might directly be involved in the pathogenesis and/or progression of DCM. Among the known genes, phospholamban, cardiac actin, ATP synthase and dystrophin were found to be upregulated in all nine patients samples. Several ESTs were also identified in this context. These may therefore represent new valuable candidates as diagnostic or therapeutic targets. In summary the study leading to the present invention represents the first report on gene expression profiling of >33,000 unique cDNAs using human cardiac biopsies. The resulting profiles provide a sensitive diagnostic resource and might enable to describe the pathways involved in the pathophysiology of this cardiac disease.
Accordingly, the present invention relates to a diagnostic composition comprising at least one nucleic acid molecule, preferably single-stranded nucleic acid molecule (s), which (a) each comprises a gene listed in Table 2 and/or Table 4, preferably Table 2, or a fragment thereof or (b) is capable of specifically hybridizing to the mRNA of at least one gene listed in Table 2 and/or Table 4, preferably Table 2.
As used herein, the term "capable of specifically hybridizing" has the meaning of hybridization under conventional hybridization conditions, preferably under stringent conditions as described, for example, in Sambrook et al . , Molecular Cloning, A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, or in Example 1 (A) , below. Also contemplated are nucleic acid molecules that hybridize at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency) , salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37 °C in a solution comprising 6X SSPE (20X SSPE = 3M NaCl; 0.2M NaH2P04; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg/ml salmon sperm blocking DNA, followed by washes at 50°C with 1 X SSPE, 0.1% SDS . In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC) . Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
As a hybridization probe (or primer) nucleic acid molecules can be used, for example, that have exactly or basically the nucleotide sequence of the genes depicted in Table 2, Table 4, Table 6A or 6C, or parts of these sequences. The term „nucleic acid molecule" as used herein also comprises fragments which are understood to be parts of the nucleic acid molecules that are long enough to specifically hybridize to transcripts of the genes of Table 2, Table 4, Table 6A or 6C. These nucleic acid molecules can be used, for example, as probes or primers in a diagnostic assay. Preferably, the nucleic acid molecules of the present invention have a length of at least 10, in particular of at least 16 and, particularly preferred, of at least 25 nucleotides. The nucleic acid molecules of the invention can also be used, for example, as primers for a PCR reaction. The fragments used as hybridization probe or primer can be synthetic fragments that were produced by means of conventional synthesis methods.
In a preferred embodiment, the diagnostic composition of the present invention comprises at least 50 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 50 genes listed in Table 2, Table 4, Table 6A and/or Table 6C. In a more preferred embodiment, the diagnostic composition of the present invention comprises at least 150 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 150 genes listed in Table 2, Table 4, Table 6A and/or Table 6C. In an even more preferred embodiment, the diagnostic composition of the present invention comprises at least 300 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 300 genes listed in Table 2, Table 4, Table 6A and/or Table 6C. In the most preferred embodiment, the diagnostic composition of the present invention comprises at least 600 nucleic acid molecules which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C, or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 600 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
In a further preferred embodiment, the nucleic acid molecules of the diagnostic composition of the present invention are bound to a solid support, for example, a polystyrene microtiter dish or nitrocellulose paper.
In an even more preferred embodiment, the nucleic acid molecules of the diagnostic composition are present in a microarray format which can be established according to well known methods. For example, the microarray can be produced starting from cDNA clones, plasmids etc. by PCR amplification of a given gene or gene fragment. These fragments are then spotted or robotically arrayed onto a solid support which can be, e.g., glass, nylon or any other suitable surface.
The present invention also relates to a method for diagnosing a cardiopathy, preferably a cardiomyopathy, more preferably dilated cardiomyopathy (DCM) or a disposition to such a disease comprising contacting a target sample with (a) nucleic molecule (s) as described above and comparing the concentration of individual mRNA(s) with the concentration of the corresponding mRNA(s) from at least one healthy donor. An aberrant (increased or decreased) mRNA level of at least one gene, preferably at least 50 genes, more preferably at least 300 genes determined in the sample in comparison to the control sample is an indication of a cardiopathy like DCM or a disposition to a cardiopathy like DCM. For diagnosis, samples are, preferably, obtained from serum, blood or myocardial tissue. For analysis of gene expression, total RNA is obtained according to standard procedures. Preferably, a DNAse treatment (in order to get rid of contaminating DNAs) is performed.
The nucleic acid molecule is typically a nucleic acid probe for hybridization or a primer for PCR. The person skilled in the art is in a position to design suitable nucleic acids probes based on the information provided in the tables. The target cellular component, i.e. mRNA, e.g., in myocardial tissue, may be detected directly in situ, e.g. by in situ hybridization or it may be isolated from other cell components by common methods known to those skilled in the art before contacting with a probe. Detection methods include Northern blot analysis, RNase protection, in situ methods, e.g. in situ hybridization, in vitro amplification methods (PCR, LCR, QRNA replicase or RNA-transcription/amplification (TAS, 3SR) , reverse dot blot disclosed in EP-B1 0 237 362) ) and other detection assays that are known to those skilled in the art. Products obtained by in vitro amplification can be detected according to established methods, e.g. by separating the products on agarose gels and by subsequent staining with ethidium bromide. Alternatively, the amplified products can be detected by using labeled primers for amplification or labeled dNTPs. Preferably, detection is based on a microarray.
The probes (or primers) can be detectably labeled, for example, with a radioisotope, a bioluminescent compound, a chemiluminescent compound, a fluorescent compound, a metal chelate, or an enzyme.
The present invention also relates to the use of the nucleic acid molecules described above for the preparation of a diagnostic composition for the diagnosis of DCM or a disposition to DCM.
Finally, the present invention relates to the use of the nucleic acid molecules of the present invention for the isolation or development of a compound which is useful for therapy of cardiopathies like DCM. For example, the nucleic acid molecules of the invention and the data obtained using said nucleic acid molecules for diagnosis of DCM might allow to identify genes which are specifically dysregulated, thus may be considered as potential targets for therapeutic interventions .
Brief description of the drawings
Figure 1: Verification of array results by RT-PCR The graph depicts regulation ratios obtained from conventional and real time RT-PCR protocols as compared to those from the cDNA array. Values were standardised to GAPDH expression levels .
Figure 2 : Cluster image showing gene regulation ratios from DCM patients
650 differentially expressed genes were hierarchically clustered into groups by the similarity of regulation ratios using the hierarchical clustering software CLUSTER (Eisen et al., PNAS USA 95 (1998), 14863-8. In the matrix mean regulation ratios from two independent experiments are shown. Each column represents one sample/patient and each row one cDNA clone. Regulation ratios lower than in the control (downregulated genes) are plotted in green, higher in red (upregulated genes) . Enlarged clusters show genes with high, uniform expression in all DCM samples (1) and those related to disease progression (2) .
Figure 3: Functional categorisation
296 out of 650 differentially expressed genes were classified on the basis of their well-defined functions. Seven functional clusters are displayed. Clone IDs and common gene names are indicated.
Figure 4: Distribution of normalised signals of oligonucleotide test hybridisations
Intensities from eight filters were extracted and normalised to the median of the 15% strongest intensities. 94% of the signals have mean signal to background ratio >3.
Figure 5: Size distribution and integrity of amplified RNA Total and amplified RNAs were resolved in the agarose gel electrophoresis. Lines 1-2: 100 ng of total RNA from human fetal kidney fibroblasts (293) and dermal fibroblasts (HDK) respectively; lines 3-4: 10% of the first round of amplification; lines 6-7: 10% of the second round of amplification; NTC: 100% of the no template control. Note the increase of the transcript fraction and molecular weight distribution.
Figure 6: Screenshot of the analysis of human DCM aRNAs using the Bioanalyser
One μl of amplified RNA from each biopsy was applied an the Agilent 6000 RNA Nanochip and run an the Agilent 2100 Bioanalyser. (A) The size and integrity were evaluated. L- RNA size ladder. Lines 1, 2: aRNA from patient A and B respectively. Lines 3, 4: no template controls. (B) Fluorescence profile of the sample from the line 1. The aRNA concentration was calculated as the area below the curve. Figure 7: Influence of the RNA amplification an the relative transcript abundance
The gene expression profiles of two human fibroblast cell lines (D - HDF and K - 293BHK) were compared. From 21,888 analysed cDNA clones 405 were identified as differentially expressed when using T-RNA. Using the same selection criteria but aRNA instead 395 differentially expressed clones were determined. 305 (77%) of them were common to both sets, indicating a high degree of reproducibility and linearity of the amplification protocol used. The scatter plots shown demonstrate in addition strong correlation indices when comparing T-RNA vs. T-RNA and aRNA vs. aRNA in both cell lines, 90 and 92% respectively
Figure 8: High reproducibility of the experimental procedure Signal intensities corresponding to 253 clones of the overlapping 3840-set have a signal/background ratio >3. The signal intensity of 230 of these (91%) differed in both sets less than 3-fold having a strong correlation coefficient (98%) when part 1 and 2 were compared.
Figure 9: Experimental design
A set of 2 nylon membranes carrying 34,176 cDNA clones was used to hybridise with radio-labelled representations of RNA from control and DCM aRNA samples respectively. The overlap of 3,840 clones between membranes provided reproducibility controls. In each experiment one control and two DCM hybridisations were performed. Experiments were repeated independently producing for each gene 20 comparisons of gene expression levels between DCM and controls respectively, and regulation ratios were calculated. Differentially expressed genes were selected if in all 20 comparisons the following criteria were fulfilled: regulation ratio >3, signal/background ratio >3, and p-value <0.001.
Figure 10: Verification of array results by real time Q-PCR The graphs depict regulation ratios obtained using real time PCR transcript measurement an human DCM and mouse MLP-/- material. Mean values from 3 independent, normalised measurements are shown. (A) White and grey bars represent the regulation ratios obtained by the array analysis and by the Q- PCR approach respectively. (B) Bars represent the regulation ratios of MLP -/- mice as compared to control littermates. (C) List of genes in alphabetical order.
Figure 11: Biological processes involved in DCM 266 differentially genes were grouped into 21 cell processes according to the Gene Ontology terminology using Celera and Gene Card data bases. Black and white bars represent down (- ) and up (+) regulated genes respectively.
Figure 12 :
(A) Clustering expression patterns for genes associated with different biological processes
Log values of the mean regulation ratios for each process were hierarchically clustered. Patients are ordered by disease severity as in Table 5. In blue are indicated clusters correlating with disease progression. The colour scale with corresponding ratios is presented. Ratios lower than 1 are masked.
(B) As (A); further gene clusters of cell processes.
The below examples explain the invention in more detail.
Example 1 General Methods : Examples 1 to 4
(A) Production of cDNA arrays and sequence verification of the clones
Gene expression of dilated cardiomyopathy (DCM) and control samples was analysed using the human UniGene RZPD1 set containing 33,689 clones (https://www.rzpd.de/my_rzpd/ unigeneSets . shtml) . cDNAs were PCR amplified using universal primers (primer 1 (5' -CCCCAGGCTTTACACTTTATGCTTCCGGCTCG-3' ) and primer 2 (5' -GGTGCGGGCCTCTTCGCTATTACGCCA-3' ) and the products were spotted onto 22x22 cm nylon membranes (Hybond N+, Amersham, Freiburg, Germany) using in-house robots. PCR products were spotted without duplicates and in addition a kanamycin cDNA was spotted as a "guide dot" to aid image analysis .
Two hundred and thirty six cDNA clones (chosen among the differentially expressed genes with lowest p-values) were rearrayed from the original UniGene RZPDl set (UniGene Berlin, Germany) , grown over night and plasmid DNAs were used as sequencing templates together with vector-specific primers (see above) . Samples were precipitated and loaded onto ABI3700 machines and the obtained sequences were analysed using BLASTN against publicly available databases (GenEmbl, SwissProt, dbest) and annotated. The UniGene annotation could not be confirmed for 68, i.e. 29% of the clones.
(B) Patients" biopsies
Myocardial biopsies (2-3 mm3) were collected from clinically stable male patients suffering from idiopathic DCM during routine heart catheterisation in the Charie/Franz-Volhard- Klinik (Berlin) (Table 1) . They were taken from the posteriolateral wall of the left ventricle in all cases, flash frozen in liquid nitrogen and stored at -80°C. Coronary artery disease in each case was excluded by selective coronary angiography, as-well as hypertension. Myocardial samples from four non-transplanted hearts were used as controls.
Total RNA was isolated from each biopsy in parallel by the standard Trizol method and 20 μg of RNA were subjected to two rounds of in-vitro amplification using a T7-based protocol [Eberwine, Biotechniques 20 (1996), 584) (MegaScript, Ambion, Austin, Texas) . The concentration and integrity of the amplified RNA (aRNA) from each biopsy was estimated using the Bioanalyser (Agilent Technologies, Palo Alto, CA, USA) . For the labelling process 100 ng of aRNA were used per cDNA array. The aRNA was primed with random hexamers and reverse transcribed in the presence of α33P-dCTP. The resulting radioactive cDNA was purified using sephadex columns and denaturated together with salmon sperm and human placenta DNA as blocking ' reagents. To aid grid positioning during image analysis radioactively-labelled 1 ng kanamycin cDNA was added to the complex probe. Following denaturation this mixture was added to 10 ml hybridisation buffer (1M NaCl, 1% SDS, O.lxSSC) and hybridised overnight at 65°C to the cDNA filters. After washing three times for 20 min at 65°C (0.1% SDS, 0. IX SSC) the filters were exposed for approx. 6 hours on Fuji BAS screens .
(C) Data analysis
Probes were generated from aRNA from pooled controls and from single patients' samples. Since the experiment was performed twice on each patient, we obtained 2x10 signal intensity comparisons for each cDNA clone. Determination of signal intensities was done using Visual Grid (GPC-Biotech, Munich, Germany) and background intensities were calculated using in- house developed scripts: on the basis of several empty spots per block a three-dimensional profile was generated (REF) and subtracted. Normalisation of signal intensities between two filters was done using the median of the ratios of the strongest signals (aprox. 15%) . All signal intensities were used to calculate the p-values (t-test; REF) and gene regulation ratios were finally clustered using the hierarchical clustering software CLUSTER (Eisen et al . , PNAS USA 95 (1998) , 1221-7) .
(D) Quantitative RT-PCR
A group of 16 differentially expressed and sequence verified genes was selected representing ESTs/novel as well as other transcripts reported to be DCM-relevant . Gene-specific primers were designed flanking ~300bp of the 3f translated region. DCM and control aRNAs were pooled independently and 5μg from each were used to generate cDNA templates (100 μl) . For conventional RT-PCR analysis 1 μl from each cDNA sample was used together with gene-specific and GAPDH primers (GAPDH has been reported previously to be a reliable reference gene for cardiac tissue. The cycling conditions were: (95°C 30 sec, 57°C-60°C 30 sec, 72°C 45 sec) x 25 times. PCR products were visualised by gel electrophoresis and quantified using I ageQuant software (Molecular Dynamics, Sunnyvale, CA, USA) . After standardisation to GAPDH internal controls the regulation ratios were calculated.
For real-time quantitative PCR the GeneAmp 5700 Sequence Detection System (GeneAmp, Applied Biosystems, Foster City, CA, USA) was used: 1 μl of cDNA from DCM and control samples, respectively was used in triplicate reactions with gene specific primers and SYBR Green dye. The cycling conditions were (95°C 15 sec, 60°C 1 min) x 17-25 cycles. The regulation ratios were calculated as 2n (n=cycle difference between DCM and control) and standardised to GAPDH internal controls.
Table 1 : Clinical data of DCM patients
Patient Age BMI EF FS Ao mean LVEDD/BSA NYHA Septum kg-/m2 % % icwαHg mm/m2 class mm
Normal 15-4( . >60 >30 9 25-30 <12
Range
A 80 19 28 25 78 32 3 11
B 68 26 20 14 92 42 3 12
C 35 35 49 17 94 29 3 11
D 51 31 44 28 91 27 1 11
E 44 24 19 6 86 32 4 10 F 55 29 34 n 84 39 3 6
G 40 39 47 20 89 29 2 11
H 33 28 19 16 75 33 2 13
I 60 24 33 21 97 30 3 11
J 62 24 55 14 90 36 3 10
Several clinical parameters related to cardiac performance from ten (A-J) , male DCM-patients are shown: body mass index (BMI), ejection fraction (EF) , shortening fraction (FS) , mean aortic pressure (Ao mean) , left ventricular end-diastolic dimension/body surface area (LVEDD/BSA) , New York Heart Association classification (NYHA) and septum thickness. N.d. value not determined.
General methods : Example 5
( (A) Production of cDNA arrays and sequence verification of cDNA clones
Gene expression of dilated cardiomyopathy (DCM) and control samples was analysed using the human UniGene RZPDl set containing 34,176 clones (http://www.rzpd.de). cDNAs were PCR amplified using universal primers and the products were spotted onto 22x22 cm nylon membranes (Hybond N+, Amersham) using in-house robots. PCR products were spotted and in addition a kanamycin cDNA was spotted as a guide dot to aid image analysis. Two hundred and eighty nine cDNA clones
(chosen from a list of differentially expressed genes with a low false discovery rate) were rearrayed from the original UniGene RZPDl set. Bacterial clones were grown over night and plasmid DNAs used as sequencing templates together with vector-specific primers. Samples were precipitated and loaded onto ABI 3700 machines and the sequences obtained were analysed using BLASTN (1) against publicly available databases
(GenEmbl, SwissProt, dbest) .
(B) Tissues samples and hybridisation Myocardial biopsies (2-3 mm3) were collected in the Charite/Franz-Volhard-Klinik (Berlin) during routine heart catheterisation from clinically stable, normotensive male patients suffering from idiopathic DCM. They were taken from the posteriolateral wall of the left ventricle in all cases, flash frozen in liquid nitrogen and stored at -80°C. Coronary artery disease in each case was excluded by selective coronary angiography. Myocardial samples from four non-transplanted healthy hearts were used as controls. Total RNA was isolated from each biopsy in parallel by the standard Trizol method and RNA was subjected to two rounds of in-vitro amplification using a T7-based protocol (Eberwine, Biotechniques 20 (1996), 584-591) (MegaScript, Ambion) . The concentration and integrity of the amplified RNA (aRNA) from each biopsy was estimated using the Bioanalyser (Agilent Technologies) . For the labelling process 100 ng of aRNA was used per cDNA array. The aRNA was primed with random hexamers and reverse transcribed in the presence of a33P-dCTP. The resulting radioactive cDNA was purified using Sephadex columns, denatured and added to denatured salmon sperm and human placenta DNA as blocking reagents. To aid grid positioning during image analysis radioactively-labelled 1 ng kanamycin cDNA was added to the compeex probe. This mixture was added to 10 ml hybridisation buffer (1M NaCl, 1% SDS, O.lxSSC) and hybridised overnight at 65°C to the cDNA filters. After washing three times for 20 min at 65°C (0.1% SDS, 0.1X SSC) the filters were exposed for approx. 6 hours an Fuji BAS screens. Whole heart samples from 12-weeks old MLP -/- and wild-type mice were kindly provided by Dr. E. Ehler (ETH, Zurich) . Total RNA was isolated, and cDNA synthesised using a MMLV reverse transcriptase as described below. For Q-PCR experiments 1 μl was used as a template .
(C) Data analysis
Signal intensities were determined using a Visual Grid software (GPC-Biotech, Munich) . The data was then background corrected and normalised. Details are given in the Methods Appendix. The analysis of differential expression followed the method published by Tusher and co-authors (29) . Briefly, first the percentage of induced transcripts was estimated and in a second step set rigorous selection criteria were applied to obtain a list of differentially expressed genes with a low false discovery rate.
(D) Quantitative RT-PCR
Gene-specific primers for mouse and human genes were designed with GCG Prime software to generate 50-100 bp long amplicons. All DCM and control aRNAs were pooled independently and 5 μg from each were used to generate cDNA templates (100 μl) . The GeneAmp, 5700 Sequence Detection System (Applied Biosystems) was then used: 1 μl of the cDNA from DCM and control samples respectively was used in triplicate reactions (96-well format) with 1 μl of 10 pM gene specific primers and 2.5 μl SYBR GreenMix. The cycling conditions were: 95°C 15 sec, 60°C 1 min. The transcript levels were standardised to the internal control (PO ribosomal phospho-protein gene) for each measurement. The experiment was repeated 3 times. Assuming the linear amplification of amplicons about 100 nt, the mean regulation ratios were calculated as 2Δct (ΔCt - threshold cycle difference) . To control product specificity dissociation curves for each gene were evaluated. Each experiment included no template, no RT and no primer controls to monitor reaction specificity.
(E) Array quality control cDNA clones were PCR amplified using vector-specific primers: primer 1 (5" -CCCCAGGCTTTACACTTTATGCTTCCGGCTCG-3 » ) , primer 2 (5'GGTGCGGGCCTCTTCGCTATTACGCCA-3 ' ) . The quality of PCR products was controlled as follows: 12 PCR products were randomly selected from each 384 well-plate, and their size, integrity and concentration was assessed by agarose gel electrophoresis. In total 2816 products were analysed (about 8% of the UniGene Set). 109 (3.8%) PCR reactions did not produce any visible band and 83 (2.9%) gave double bands. Test hybridisations an one array from each batch using a PCR primer-specific probe were also performed. After regular background subtraction and array normalisation about 98% of the features showed adequate signal intensities (at least >lx- fold over background) and signal intensity distribution (Figure 4) . The choice of radioactive labelling (p33) versus Cy5/Cy3 was dictated by several parameters: radioactivity detection is a more sensitive technique that combines the robustness with the ability to compare multiple normalised experiments. Accordingly, low expressed transcripts were detected: myomesin, CD81, gdpdissociation inhibitor.
(F) Evaluation of the RNA amplification protocol To assess the linearity and reproducibility of the T7 amplification protocol, the gene expression profiles obtained were compared using total versus amplified RNA from two different sources: Human dermal fibroblasts (HDF) and human foetal kidney fibroblasts (293 BHK) . Cells grown under standard cell culture conditions were used to isolate total RNA (two independent preparations from each cell line) . Two rounds of the T7-based amplification protocol (Eberwine 1996) were applied to 100 ng of the total RNA. The integrity, size range and concentration of the amplified RNA (aRNA) and total RNA (TRNA) were evaluated using the Agilent Bioanalyser and agarose gel electrophoresis (Figure 5) . Most of the transcripts after 2 rounds of amplification range in size between 150 and 900 nucleotides. The efficiency of amplification after 2 rounds was about 1300 fold.
Amplified RNA samples from two DCM biopsies analysed after two rounds of amplification an Bioanalyser are shown in Figure 6. For the complex hybridisation experiments each of the two aRNA (100 ng) and two TRNA (20 μg) samples was radio-labeled and hybridised independently to nylon membranes carrying 21,888 cDNA clones (a subset of the UniGene Setl) . After background subtraction, the intensities were normalised to the median of the 25% brightest spots. The differentially expressed genes between HDF and 293BHK cell lines were selected according to a signal/background ratio z3 and a regulation ratio z3 (see also below) .
The influence of the RNA amplification an the relative transcript abundance was assessed by selecting the differentially expressed genes using either T-RNA or aRNA, and comparing gene sets. From the 21,888 clones analysed differential expression showed 405 and 395 genes when total or amplified RNA was used respectively (Figure 7) . In these two groups common were 305 genes ( about 77%) . This indicates adequate levels of reproducibility and linearity of the amplification protocol in our experiments, and agrees with previous reports using similar protocols.
In addition scatter plots of T-RNAs and aRNAs revealed a strong linear correlation and reproducibility (Figure 6) .
(G) Reproducibility of data - selection criteria for differentially expressed genes
For spotting density reasons the Unigene Setl library containing 30,336 cDNA clones was split and spotted onto two Nylon membranes: one membrane containing 16,128 (part 1) and the second one containing 21,888 cDNA clones (part 2). After PCRamplification of clone inserts we obtained filters containing 34,176 spotted PCR-products with 3,840 from overlapping clones, which enabled us to conduct additional controls for data reproducibility and method fidelity. The signal intensities produced after hybridizations to these overlapping clones were analysed in detail. It was found that about 91% of the clones produced comparable results (Figure 8) indicating a high degree of reproducibility of the experiments. The overall correlation coefficient among overlapping clones was about 59%. When the selection criteria were based an higher signal/background ratios, the correlation indices increased. Based an the results obtained the selection criteria for differentially expressed cDNA clones/genes where set to a signal/background ratio >3 and a regulation ratio >3.
(H) Data analysis
Preprocessing of the data
The VisualGrid Software produced raw intensities for every measured cDNA clone an the array, as well as local background values (signals corresponding to the empty spots) . All intensities were rescaled an each filter separately by dividing them by the 75% quantile of all signal intensities of the corresponding filter. Raw intensities were background corrected by subtracting the local background estimates block wise (one empty spot per block; 384x6 blocks per filter with a 3x3 spotting pattern). These values are referred to as L(j/i), where i denotes a given cDNA clone and j a given filter.
Filter normalization
Visual inspection of the data revealed nonlinear distortions between filters. More precisely, it became obvious that filter-to-filter normalization needs to be done differently for low abundance transcripts than for high abundance transcripts. For each cDNA clone, a signal to noise ratio was calculated and signal intensities were log-transformed. Subsequently, an average intensity G± over all filters was calculated and the clones were sorted according to these values starting with the lowest intensity clone. For a fixed length window (± 50) a moving average l(j/i) was calculated for each filter L(j/i) . The same was done for the averages G± resulting in a moving average curve g_ . Finally the distortions were compensated by subtracting the filter wise moving average curve from the intensities L(j/i) and adding the moving average of the means (L (j/i) -> (j/i) -1 (j/i) +gι ) as described before (Tusher et al., PNAS 98 (2001), 5116-5121). Estimation of the percentage of induced transcripts
As criteria for the selection of deregulated transcripts the signal to background ratio was used, the ratio of average expression levels between the DCM and the control group, and the absolute difference between these groups measured in terms of the p-value of a two sample t-test. Note, that this p-value does not describe the statistical signifance of deregulated genes accurately, because there is a difficult multiple testing problem with dependent variables (interacting genes; see below) . Control and treatment labels were randomly permuted and from these simulations, the proportion π0 of induced (up- or down-regulated) transcripts was estimated by calculating 0.25 and 0.75 quantiles for the total of all simulated p-values and for the total of all simulated Control- to-DCM-ratios . λA' is the number of original data falling into both of these quantile intervals and B' is the average number for 2000 permutated data sets. The proportion of non-regulated transcripts was estimated as π0 = min ( 1, A/B ) = 0.4360.
Statistical significance by false discovery rates
The False Discovery Rate (FDR) reflects the proportion of falsely rejected null hypotheses among all rejected null hypotheses. Again, three joint rejection criteria were used: A gene was called induced, if both signal-to-background-ratio and control-to-DCM-ratio exceed the value of 3 and its p-value (from a two-sample t-test) was less than 0.001. A total of 655 cDNA clones meeting these criteria were found. Again, we estimated the false discovery rate by random permutation of the class labels and applying the rejection criteria to the permuted data (p-values had to be recalculated) . In a simulation with 2000 permutations an average total number of 0.9075 falsely rejected genes was found. This leads to a False Discovery Rate of FDR = 0.4360 * 0.9075/655 = 6.0413* 10~4.
(I) Primers used for real-time Q-PCR Primers are ordered alphabetically. Each sequence is presented in the common 5' to 3' direction. F-forward primer, R- reverse primer.
Human:
ABLIM1_F GATATCAAGAACGGGCAGGC
ABLIM1_R TGCATTTAAAGCACCCCAAGT
ACTC-F TCTGGAGGCACCACTATGTAC
ACTC_R GTTTGGGAGAC CCAAGAAGC
AC S_F GTGACATCGACATCAGGA7AG
ACTS_R CTGGAGGTGGAGTGTGTCTAG
ANGP1_F AAGGTCACACTGGGACAGCAGG
ANGPT1_R GGAGGGGCCACAAGCATCAAAC
CALU_F GGAGACCTCATTGCCACCAAGG
CALU_R TCCTCAGGGTGCAGGAAAGCTG
CD81_F AAGGCTGTGGTGAAGACCTTC
CD81-R CTCAGTACACGGAGCTGTTC
CS_F GGGTTGCCACACCATTTGGAGG
CS-R AAGGACCGTCTGCCAGAAAGGG
CVHSP-F CAAGACCCTAGGAGACGCC
CVHSP_R GGAGAGGCACTCAGATTTTG
ENIGMA_F TGCAAGGGGGCAAGGACTTCAATG
ENIGMA_R AGGAGTGAGCCGGGAAATGGAGAG
FHL1_F ATCGGTGCGGACTCCAAGGAGG
FHLl-R GCGGAAGCAGGTGTCATGCCAG
FHL2_F ACCAACCCCATCAGCGGACTTG
FHL2-R TCGTTATGCCACTGCCGTTCCTC
FK506BP_F TGAAGAGGGTGCAGCCCAGATGAG
FK506BP-R CCATATGCCACATCAGGGGTGCAG
GDIl-F CTATTGCCAGCACTACTGTG
GDI1-R CGGCCACAATCACTGCTCAG
LPL__F GAACATCCCATTCACTCTGC
LPL__R GTAGATTCGCCCAGTTTCAG
MLP__F ACGCTCAGTTACCACCAGCAACC
MLP_R GGGCACTTCTCGGACTCTCCAAAC
MYL2 F CCCTGAGGAAACCATTCTC MYL2-R GACAAGGTAGGGACAGAGGC MYOMl_F ACGGACCACTGCAACCTCAAG MYOMl_R GAGAAGCATGAAGGACGTCTC PDGDS-F ACTCCGTGTCAGTGGTGGAGAC PDGDS-R TGTACAGCAGCGCGTACTGGTC PLN-F CTTCAGACTTCCTGTCCTGC PLN_R TGTACTCAGGAAGTGGTCTG PO_F CGCTGCTGAACATGCTCAAC PO_R TCGAACACCTGCTGGATGAC REQ_F CTGTTCTGACTGTGGCCGCTC REQ_R CCACATCAAGAGGAGTTCTG SMPX_F TTTCGGCCAGGAGCAGGTCAAC SMPX_R TCATCCGAGGTGGGAGGAACAC TNN_F CTTGAAATTCGTAATGCTGC TNN_R CAGATGCTTAGCGAAGTGAC ZASP_F ACAGACACCATGACCCACCTGG ZASP R TCGTGGAGATGGGAATGGGACG
Mouse :
CALU_F GGAGACCTCATTGCCACCAAGG
CALU_R TCCTCAGGGTGCAGGAA7AGCTG
CVHSP_F ACCATGATCCCTGACAATGACCGC
CVHSP-R GCCTGAGAGTGTTCGGAGTGACTG
GDI_F TGACGACAAACAGGACCACCTCAC
GDI_R AGGGACGGACAGACGCACTCATTC
MY0M1_F AGCACAAGTTCCCGACTGTCCC
MY0M1_R GCTTCTCAGCCTGCATCCAAAACC
PDGDS_F ACTCCGTGTCAGTGGTGGAGAC
PDGDS_R TGTACAGCAGCGCGTACTGGTC
PO_F CGCTGCTGAACATGCTCAAC
PO_R TCGAACACCTGCTGGATGAC
REQ_F ACGTCGGAGAACGATGACCAGC
REQ-R TGTGGTAGCCACGGTCACAGTC
SMPX_F TTTCGGCCAGGAGCAGGTCAAC
SMPX_R TCATCCGAGGTGGGAGGAACAC
ZASP F GGGCACGACCTCAATGAGGATG ZASP_R GAGTTGTTCCTCGGAAGCTCGG
Example 2 : Genes differentially expressed in DCM patients
For gene expression analysis biopsies from 10 well characterised DCM-patients were collected. All DCM and control amplified RNAs (aRNAs) showed the required concentration, size-range and integrity after amplification. To evaluate the influence and reliability of the RNA amplification protocol, the gene expression patterns generated were compared using either total or amplified RNA. When signal intensities of each experiment were plotted, high correlation indices using total vs. total RNA (98%) and aRNA vs. aRNA (97%) were found.
aRNAs from pooled controls and each of 10 DCM samples were hybridised independently. The experiment was performed twice and for each cDNA clone we obtained 2x10 data points. Using in-house developed scripts (see Methods section) 655 differentially expressed genes with a signal to background ratio >3, regulation ratio >3 and p-value <0.001 were selecetd. From these, 236 cDNA clones were resequenced and a list containing 45 sequence-verified clones is shown in Table 2. Similarly to other reports, it was found that the corresponding UniGene annotation could not be confirmed for 29% of the clones.
Table 2: Genes differentially expressed in DCM (GeneBank; http://ncbi .nlm.nih.gov/)
Ratio Gene Gene Description Bank
Accessio n
+ ^3& 0S60 Ac a-c ^tt/ pfta !<■ skeletal.. &Lu. seα,is-
+ 22 «5 mozs2 Acre s ift, c.&:tr c άus le
+ 18,56 W96195 ACTG2 actin, gamma 2, smooth muscle, enteric + $$Xl ^ύU mm fay<>$ito i t $t>l ιt ti<i\f $A x&Φz &tβx X -o -di^c, -"slow
+ 17,62 AA393481 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosph carrier) , member 3
+ 13,65 AA059229 ATP5B ATP synthase, H+ transporting, mitochondrial FI compl beta polypeptide
+ 10,93 AA452026 ATP5J ATPsynthase, H+ transporting, mitochondrial FO compl subunit 6
Figure imgf000025_0001
+ $, mAZIHQ S>M
+ 8,33 N94072 COX7A2 cytochrome c oxidase subunit Vila polypeptide 2 (liver)
+ 8,03 H46859 COX4 cytochrome c oxidase subunit IV
+ 7,44 H20248 PRDX5 peroxiredoxin 5
+ 7,34 AA004452 COX cytochrome c oxidase subunit Vila VIIa-L
+ 7,26 R35172 MDH2 malate dehydrogenase 2, NAD (mitochondrial)
+ 7,13 W72020 MYL Myosin regulatory light chain (EST)
+ 6,87 AA101919 PFK phosphofructokinase, muscle
+ 6,47 AA427605 YBPC3 myosin-binding protein C, cardiac
+ < S HZUM KKOMl
+ 6,11 AA148548 FABP3 fatty acid binding protein 3, muscle and heart
+ 6, 08 N98684 COX6C cytochrome c oxidase subunit Vic
+ £ 5 T<£34 c t
+ 5,58 N74591 ZASP Z-band alternatively spliced PDZ-motif
+ 5,53 46362 RPS3A ribosomal protein S3A
+ 5,36 07478 SMPX small muscle protein, X-linked
+ 5,33 W44729 M9 muscle specific gene
+ 5,25 AA411948 NUBM NADH-ubiquinone oxireductase subunit CI-B12 mRNA (EST)
+ 5,06 R35362 VDAC2 voltage-dependent anion channel 2
+ 4,96 R20677 NHP2 1 non-histone chromosome protein 2 (S, cerevisiae) -like 1
+ 4,75 AA421123 COX6B cytochrome c oxidase subunit Vib
Figure imgf000025_0002
+ 4,57 N31747 RPS18 Homo sapiens mRNA for ribosomal protein S18
+ 4,50 N80251 PTGDS prostaglandin D2 synthase (21kD, brain)
+ 4,34 H43495 GABARAP GABA(A) receptor-associated protein
+ 4,28 AA063144 RTBDN retbindin
+ 4,04 H45324 SNRPN small nuclear ribonucleoprotein polypeptide N
Figure imgf000025_0003
+ 3,78 N74965 VDUP1 upregulated by 1, 25-dihydroxyvitamin D-3
+ 3,62 R27628 CAU calumenm
+ 3,60 95873 CS-1 calcineurin-bindmg protein calsarcin-1
+ 3,43 N70808 ATP5JD ATP synthase, H+ transporting, mitochondrial FIFO, subun d
+ 3,43 AA035617 Human il ' s tumor-related protein (QM) mRNA
+ 3,40 AA115597 PMP22 peripheral myelin protein 22
+ 3,28 R36063 TUBA1 tubulin, alpha 1 (testis specific)
+ 2,94 AA426014 NAPG N-ethylmaleirαide-sensitive factor attachment proteii alpha
+ 2,70 AA025445 TUBA1 tubulin alpha 1
+ 2,67 AA416994 AMR1 laminin receptor 1 + 2 55 R59301 UBC ubiquitin C
+ 2 31 AA435545 RPS2 ribosomal protein S2
+ 2 00 AA009778 RP 37 ribosomal protein L37
+ 1 93 AA404438 TMSB Human thymosin beta-4 mRNA
- 3 89 AA009869 EPB41 erythroid isoform protein 4,1 mRNA
- 3 03 AA464018 Homo sapiens cDNA: FLJ23241 fis, clone CO 01375
- 67 AA417186 PRPH Human peripherin
- 2 60 AA417940 SPRL Homo sapiens mRNA for small proline rich protein 1: protein
- 2 , 53 H20981 VAMP 2 vesicle-associated membrane protein 2 (synaptobrevin 2)
- 2 , 45 AA059469 clone r56121 formin 2-like protein mRNA,
- 2 , 33 AA062552 KIPl cyclin-dependent kinase inhibitor IB (p27, Kipl)
- 2 , 05 AA062980 MRPL33 mitochondrial ribosomal protein 33
Table 2 shows 45 differentially expressed sequence verified transcripts with a p-value <0.001 and regulation ratio >2. Highlighted are genes confirmed by two RT-PCR based methods.
Table 3: Genes differentially expressed in DCM tissue and involved in the pathogenesis of DCM
Figure imgf000026_0001
Figure imgf000027_0001
Regulation ratios below 5 are depicted as t or I and those above 5 are depicted as tt or -H. Parts A, B, C contain genes involved in cytoskeletal, apoptotic and calcium signalling respectively. (11) Yang et al., Circulation 102 (2000), 3046; (12) Stanton et al., Circulation Research _86 (2000), 939; (17) Zechner et al . , J.Biol. Chem. 273 (1998), 8232; (18) Hirai et al., Oncogene 12 (1996), 641; (21) Roof et al . , J. Cell.Biol. 138 (1997), 575; (22) Wang et al . , J.Biol. Chem. 272 (1997), 17542; (23) Moore et al . , Biochemical Journal 326 (Pt 1) (1997), 17; (24) Joneson et al . , Science 274 (1996), 1374; (25) Mata et al . , J. Biol. Chem. 271 (1996), 16888; (26) Burns et al . , Nature 367 (1994), 476; (27) Dedhar et al., Nature 367 (1994), 480; (28) Frey et al . , PNAS USA 97 (2000), 14632; (29) Frey et al . , Nature Medicine 6 (2000), 1221; (30) Wu et al., EMBO J. 19 (2000), 1963; (31) Zhang et al . , PNAS USA 98 (2001), 5497; (32) Arber et al . , Cell 88 (1997), 393- 403.
In addition, about 650 genes could be identified showing altered expression levels in most DCM samples (Table 4)
Table 4: Additional genes differentially expressed in most DCM tissues (GeneBank; http://www.ncbi.nlm.nih.gov) reg p-val done gene
1 3.00 3.78E-04 09C02 128331 R12564R09914 1 1 VPS11 11 177 vaαtolar protein sorting 11 (yeast homolog;
1 3,03 9.90E-04 &3Q21 810263 AA4β401β.AA4β4728 1 I MG MC 28 Hornfl sapiens cDNA: FLI23241 Bs, clone CO 0137S
1 3.07 1.03E-08 S1F13 299523 N74977 1 1 ARSD X 25 arylsulfatasa D
1 3.15 8.S6E-04 05D03 118011 T935B3 92155 1 I FU22679 X 120 hypothetical rotein FLJ2287!
1 3,16 2,81 E-04 64101 381Θ31 AA058828 1 1 FLT1 3 1S4 lnns-reteted tyrosine k aεe 1 (vasoular endothelial growth factαrfvaseu
1 317 2.84E-OS 49115 291539 726791 1 G 1775 Homo sapiens, done IMAGE3954132, mRNA, partial eds
1 3.21 239E-06 B4022 752874 AA4175B9.AA41768B 1 1 CSNK1G3 5 134 casein Wrtass 1, gamm 3
1 3,21 5.25E-04 62D07 364950 AA02 459,AA024β75 1 1 MG 15 B ESTs
1 332 2.B7E-07 82022 731124 AA417305 1 1 MO M01 EST, Weakly similar to S65B24 reverse transcrlptasa homolog [H.sapiens
1 351 1.70E-O6 E5B03 322S75 16497,W397 9 1 I GAS5 1 609 growth arrest-ape-ific 5
1 354 2.36E-04 62015 964070 AA021194.M0215781 I LOC51031 17250 CGI-150 roteir
1 359 7.74E-04 49F13 282873 N90S55.NΘ94631 I KIAA0738 7 116 K1AA0738 gftne prpducl
1 3,61 559EO4 81N11 729414 AA397873,AA3996931 1 MG 1015 ESTa
-1 3.63 7.34IΞ- 4 01L.19 71307 T47643.T476421 I MS 1 36 ESTs i ass 3-4.9E-06 15M23 4038B R55S92,H55354 1 I KlAAl7l -, 342 KIAAl719 pratβiri
1 365 1.29E-08 49J22 293940 N66043,NΘ566β 1 1 EEAi 1253 early endo.ome antigen 1, 1B2l<C
-1 3.87 7,81 E-OS 50101 294B77 N71299,W016O7 1 I MG 455 ESTs. Modsralety similar to ALU1_HUMAN All) SUBFAMILY J 6EC
■1 3.74 1.60E-05 2.6E+24 5171B H2 120,H22936 1 I MQ.135 ESTS
1 3.79 E.21E-04 60B12 380220 AA013018,AA012S32 1 I FOJ12899 5 104 hypothetical protein FL)1289£
•1 3,E5 3.54E-04 55B04 323371 W42Θ4B.W42648 1 I APP 21 1136 amyloid beta (A4) precursor protein {protease neain-ll, Atøieim
1 3,87 3.62E-05 27H17 179144 H50102.H5014fi 1 1 MG MC 35 ESTS
•1 383 7.95E-Q4 91P14 7S5376 MAO
1 3,94 7.51 E-OS 07C03 121214 T97080 1 I MG 22 Homo sapiens dona |MAGE:121214 mRNA sequence
1 4,04 3.39E-05 87P14 770B26 AA427G38 4342B31 I FU11749 MC 108 hypothetical protein FU1174S
1 24 S.62E-04 93E+12 810075 AA464959,AA465033 1 I VAV29 1Qflvav2 onoύgene
•1 434 5.40E-OS 07103 121475 T972Θ2.TS7406 1 I KIAA1 07344 KIAA1407 protein
1 4.37 7.47E-05 64B12 415764 W84750,WB450Θ 1 I MS 154 ESTs
1 4,47 3.28E-05 O9I02 128823 R164B2,R1678£ 1 1 MG 129 ESTa, Highly slmltørlD AF1B1399 1 HSPC281 [H-Bapmns;
-1 4sa 2.37E-0$ S C06 31O053 W24340.N95SO1 1 1 DLST 14 178 dihydrolipoamide S-sueeinytlransFsfasθ (E2 component of 2-oxc
1 4.5B 1.1BE-05 93017 810812 AA4S8873,AA45Srj83 1 I MG 17 0 ESTa
1 4.75 S.S1E-09 37H21 243312 H95077.H94 11 1 | MG 33 ESTs
•1 S.67 1.63E-05 11620 30208 R14S35,R40l 3B 1 I TNRC34368 MnUdeoSdβ repeat containing J
1 8.01 4.97E-0+ 77U1Θ
1 1031 6.50E-04 6βF16 469666 AA027S91 ,AA027e4B 21 MAN2B1 19227 maπnoaid.Sβ, alpha, claεε 26, member 1 1 F 20494 X
1 10.93 3.71E-06 BBH06 774166 AA452026,AA429821 11 ATF5J 21 328 ATP εyntnase, Ht iraπspoπlng, rnitochondrlal F0 complex
1 11.S2 1.34E-09 SU07 299658 W06870,N70860 1 1 ACTA1 1 815 actin, alpha 1 , skeletal muscle
1 12.02 2 74E-r_4 52A11 300709 W07βl2,NB087921 MGC27-t919284 hypothetical protein MGC2749 I MYH7 4605 rnyosln, hea
1 12.24 7.93E-C6 SSFlO 463854 AA0279541 I MG 383 Homo sapiens mRNA for KIAA1190 protein, partial eds
1 12.48 3.69E-04 B8N09 773771 AA427940.AA43455B 1 I PUN 6308 phospliolflmban
1 13.18 1.07E-04 62N14 368311 M02567».AA025β78 1 I CKMT2587 oreafπa kiriase, mitochαndrial 2 (sarcorή«r1c)
1 1331 2 14E-05 51P17 299994 N91524.W07135 1 I TNNI3 19 108 tropαπin I, cardiac
1 13.46 2.93E- 4 6.4E+08 381777 AA05S229 1 1 ATP5B i2 1185 ATP Eynthase, H+ transporting, mrtochondilal F1 eomptex. beta pol-
1 13.87 2.71 E-04 BOA02 726764 AA O1701,AA39aie1 1 I MG 35 ESTs
1 ##### 0837 1.430 S0K1Q2 95Θ13 N74591, 02529 1 I2ASP 10 132Z-baή altemativβ splloeO PDZ-moKI
1 15.27 6.58E-04 11011 2S422 R14S83,R4135Θ 1 I NR113 X 592 nuclear raceptorsubfajπily 1, group I, mambef 5
1 1S.92 1.39E-07 ISOOαOO 423 3 R67147,R69968 1 I CRYM 1654 ciysallln. m.
1 17.62 7.2SE-04 B1C02 72B303 AA393491 A435 0 2 ISLC25A3 2 1709 solute carrier family 25 (mitochondrial carrier; phosphi
1 18.S7 E.53E-Q4 60O01 35B439 9S10S.W9Θ1041 l ACTG22398 actin, gamma 2, emoolh mU3Cle, enteric
1 2285 1.54E-08 S2D11 302834 N9O202. 37O701 1 ACTO 15 176 actin, alpha, cardiac iisda
1 2B.02 2.66E-05 50L.02 297645 N84024.N68355 1 1 YL2 12413 myoein, light polypeptida 2, reβolaiory, carOiae, slov
1 3,00 4.176-04 47P10 2BB718 N5.209,N75235 1 I LOC5123Θ 11 243 hypothetical proielr
1 3.01 2.55E-04 80G24 728925 AA39B433,AA40332 1 I LPIN1 2202 llpln 1
1 3,01 2.82E-M 08B08 12671B R071131 I MGC12236 172 hypothetical protein MQC122J
1 902 8.65E-04 59K02 346920 790B3,W7β2771 I CORT 1 121 COrtistatln
1 3.03 7.75E-04 69I06 490647 AA133448 A 15742 1 1 PCOLCE2373 procollagen C-andopeptklase sπhancer _
1 3.09 8-71 E-04 51H10 300251 N7eS24, 07353 1 1 ODC1 2606 ornithina decarboxylasa 1
1 3,oa 2.14E-05 80O09 7267<i2 AA3B82B0 A4018021 I MG MO 68 ESTs i 310 9.35E-05 87F23 768504 AA425051 A"l9S9a9 1 1 ZNF93 6022lne Rngarproteln 9 (a cellular retroviral nucleic add binding
1 3.11 3.04E-07 64B13 415283 S5052.WB2096 1 I ATPEE 20405 ATP synthase, H+ transporting, micochondπal F1 eomptex, ep
1 3.14 9-93E-05 77J10
1 3,15 8.76E-05 54G07 309449 30722,N99081 1 1 RPS4Y Y 391 ribosomal protein 64. Y-ltnked
1 321 1.41E-0S 43K14 271675 N425B3.N31569 1 I LS 33 203 Lsrή3 protein
1 3,23 8.40E-04 17G24 1334B6 R27476 1 1 TAX1BP17 62Θ Taxi (human T^eβ leukemia virus r/pe I) binding protein 1
1 328 9 3ΘE-05 14O20 33888811SS RR 33063.R4914421 MGC1S211 2 18 hypothetical protein MGC1B211 I TUBA1 2345 tubulin. alpha '
1 329 3.94E-05 Θ2H13 36S011 M063625,M036709 1 I FBXL46 55 f-box and leuclne-rich repeat protein <■
1 329 5.46E-04 77A16
1 3,31 1.46E-06 91P07 788148 A 50177,AA450112 1 ITNNT2 1 133 troponin T2, cardiac
1 3,31 2.79E-04 51M0S 299149 W05280.N75471 1 I PA1P25477 PABP-intβractlng prαtain 2
1 333 2.8BE-04 60B07 359466 AA010712.AAO1O711 1 I V VF12239 von WHβbrarid factor
1 3.33 1.19E-05 55F0S 323556 44387.W45720 1 I PMP22 17331 paπphstal myelin protein ZZ
1 334 1.B5E-04 43A13 270168 N40714.N27Q4B 1 I MG 326 ESTs
1 335 3.0$E-04 87J16 768628 AA426347rAA430322 1 I IL11RA 9101 interieukin 11 receptor, a'phε
1 3.41 B-42E-04 28D02 171B31 H18489.H1S1552 1 MG 97 ESTs I MG MC H EST,
1 3.44 4.00EO481D07 72S141 AA435B40 1 I MG 32 ESTS
1 3.44 4.98E-05 49A18 291835 N67479,W03408 1 1Z.19 X 1772,19 gene
1 3.50 5.68E-04 52 08 302146 W38400,N79828 1 I KIP21587 DNA-depandsnt rotein Wπase catalytic s-bunlt-lnteracting proteir
1 3.S2 8.38E-05 27H10 182292 H41902.H41941 1 ISLC2A5 1 144 solute carrier family 2 (facilitated glucose/fiuπbse transporter),
1 3.52 2.05E-O4 64P07 415685 W788a0,W84725 1 I MQC14687 10 164 hypothetical protein MGC14697
1 3.54 7.79E-04 22D12 160372 H22304,H222632 I IPT 1 6196 tRNA isepantanylpyrophoεpriate traπefBrase I EEF1A1 6 19927 eu 3.54 9.8SE-05 13L11 36067 46396.R21351 1 I PCSK22069 proproteln convβrtasβ SUbtJITsiπ/ SXin typo - 3.55 4.38E-04 77J21 3.5B 4.41 E-05 6900000 489739 AA099735 A0997341 I RFL.36A 14249 ribosomal protein L36a 3,59 2.62E-04 11A07 28827 R 40816.R14380 21 AGTR 4220 angloteπsiπ receptor-Ilka 21 CUUA 13 333 CUHIn if 3,59 2.756-04 60C19 35Θ018 W92β4l,WB45571 I FU12921 1033 hypothetical protain FU12921 3.60 3.22E-08 S9D01 491153 AAi14a59,AAi 14660 1 MDUA 4 22iduronlda5β, alp a-L- 3.80 6.34E-04 10101 26094 R 372B2,R12356 1 ] MAOB X 95 monoamlne oxidase E 3,60 3-66E-04 5.4E+17 310349 N98761,W30SS21 1 FU14437 104θ myopBlla fin 3.62 6.69E-04 17K10 133659 R27828 1 I CALU 7764 calumenln 3.62 4,91 E-05 13 16 37109 R 4B977,R34443 1 I MG 4 9 Homo sgpianS cDNA: FU121303 fls, dona COL02107 3.65 9.86E-0S 50P04 297789 W005B4,N88907 1 I RPS27A 2 1262 ribosomal protein S27a 3.63 6,01 E-04 16B07 37799 6153B.R61593 1 I KIAA0285 11 80 KLAAOSSS garrs producl 3.69 1.60E-04 14P2Q 39836 R 53459,R5345a 1 I OSRU 3 161 oxidative-str.sS responsive 1 3.73 1.60E-04 54F16 321418 W44870.W32291 1 I ND.UFA57629 NADH dehydroganasa (υblquinonβ), 1 alpha eubcomplex, 5 (' a74 3.13E-05 55A12 322295 MA O 3,78 3.SSE-04 51F05 299497 74965.W0S6621 I OUP1 1 1372 upregulatad by 1,25-dihydrωtyvltarnin D-J 3.80 6.30E-O4 6SJ0B 601887 AA12Θ865,AA1298Θ6 1 I MS 13 2 ESTs 3.82 3.12E-04 5.4E+08 309332 W40U5 1 1 IDH3B 203B5 isocttrsla dshydroganaBβ 3 (NAD+) beta 3.82 7.03E-04 14J07 38573 R 51310,R514221 I LFL 8232 lipoprotein llpaae 3.83 6.83E-04 69102 4S0643 AA115740.AA13344621 HUMGT19ΘA 175B GT198. complete ORF I TCF 4 1727S transcription 3.85 2.42E-0450P02 297737 W00583,N88906 1 I AC02226B6 aconltasβ 2, mitochondrial 3.89 1.7SE-0420B07 147Θ10 RB1711,R81710 1 I FU10913 MC 362 hypothetical protein FU10915 3.90 1.86EO450N04 2B7722 Nθ8699,NS9θ98 1 I MG 17132 Homo sapiens, Slmilarta eπrildine/Bpθr lpe N1-acatyt transfers 3.Θ2 3.B3E-04 δoeai 359575 AA010594 1 I MG61 X 274 porctipin. 3.93 2.01 E-04 14J0S 38572 R S1421.R513091 I KIAA10778 191 KIAA1077 protθir 3.85 S.73E-04 26B16 171704 H1B246,H1B28β 1 I RPS16 19 1537 ribosomal protein S16 3.95 2.73E-04 51N18 300536 NΘ1105.W074BB 1 1 ASAH 370S N-acylaphingosIne amidohydrolase (acid cβramldaea; 4.07 3.SSE-0609J11 129505 R14860.R11362 1 1 SPAG 17 163 sparm associated antigen 7 4.08 1-81&04 65Q08 322615 W39313,W1S29S 21 MG 55 ESTa I M<3 590 Homo sapiens clone 24812 mRNA sequence 4.09 3.96E-04 S4P01 32 0Θ1 W56O20 1 1 MG 6177 Homo sapiens mRNA; cDNA DKFZp564H0764 (from clone 0KFZp564H07€ 4.11 4.0BE-04 64K03 382020 AA063071,AA063099 1 I MG 17 10 ESTs 4.19 3.08E-04 06A04 116431 T9H23,T813361 l MG 1 4 ESTa 4.25 8.Θ4EOB 22K22 156375 R74045.R74139 1 I AFQ3 2 8- 186 AFG3 (ATPase family gana 3, yeast)4ikB _ 4.33 4.B8E-04 64109 331975 AA063036ΛA0630171 1 FU201525201 hypoth tical proteir 4.33 3.30E-O5 59C01 345909 W72184,W77B30 1 I SH3D5 10223 SH3-domain protein 5 (ponsin) 4.34 B.77E-05 20814 143914 RS2a01,R8280a 1 I MG 668 Homo aapiβnS mRNA; cDNA DKF2p564B076 (from done DKFZp5f 4.35 1.89E-04 82J12 731740 AA417100.AA4172O4 1- 1 FABP3 10B fatty acid binding protein 3. muscle and heart (mammary-o 4.35 1.88E-O5 43D20 273207 N $031.N38B13 1 I MG 16 63 ESTs, Weakly Similar to ALUE_HUMArJ III! ALU CLASS WARNIt» 4.44 1.66E-06 22H14 161214 H25231 1 I LOCΞ160420376 CGI-06 prøteir 4.51 S 1E-06 47G07 283854 N52581 1 I G 19 2 ESTS 4.S2 4.16E-O443N20 273691 N33372.N448532 I SNX36462 Sorting na»π 3 I KIAA0671 4243 KIAA0871 proteir 4.53 1.19&04 17106 133519 R2Θ614.R32534 1 I KIAA061518 152 K1AA0615 gena produci 4.53 2.4 E-04 14G21 3752 R 34739.R496121 I CCT72995 chaparonin containing CP1, subunit 7 (etal 4.54 1.45E-04 B8I17 771313 AA478230.AA476231 T | C U 82528 clustβrin (complement lysis inhibitor, SP-10,40, sulfated glyα 4.86 l.aSE-O4 60M05 3S6351 W959S9,W95873 1 CS-1 4 B92 ealdneurin-binding protein calεarcin-1 4-67 1.70E-05 49M11 291658 N73454, 028S7 1 | MG 11 67 ESTa. Weakly slmltørto A43932 muclπ 2 prBOjfSor, Intaafiπal [H.sa 4.77 1.59E-05 51 08 29906S W05142.N75421 1 I CO A5 72 collagen, typa IV. alpha 6 (Alpαrtεyndromθ 4.79 1.Q1E-O6 2BC20 52167 H 24252,H24251 2 I PA1P25477 PABP-tntaracBng protein 21 POLES 945$ polymerase (DNA direct 4.80 3.94E-04 S0P06 297790 W00581,Nø8904 1 I RPU 1 1 1085 ribosomal protein L11 4.91 2.72E-04 10105 25SΘ3 R 12353.R37279 1 I PRDX1 1 1561 peroxlrβdoxin 1 4.92 l.OOE-05 17117 132429 P25B65.R26B771 I NCOA4 10 526 nuclear receplor coac vator 4 4.96 2.29E-04 13O20 35836 R 20677,R4$33a 1 I NHP2L1 22667 nOh-htetone chromosome protBin 2 (S. cerβviaiaaHike 1 4.97 1.35E M 51J20 300344 W072β3.N797851 I MS 9 62 Homo sapiens mRNA; cDNA DKFZp434C1915 (from dona DKFZp4 6.00 2.38E-04 Θ1F15 729205 AA397855ΛA3S96ΞB 21 MO 1 17 ESTs I NG.FRAP1 X 415 nerve growth factor receptor (TNFRSF 5.0S 1.10E-O4 1.4E+25 38278 H 35382.R490221 1 DAC2 10660 voltage-dependent anion channel 2 5.0S 7.29EO426A03 51807 H 22S59,H244121 I KIAA1695 1B 74 hypothetical protein FU22297 5,12 1.26E-04 54M01 309700 N94540.W30833 1 I MAD44286 Mad4 homolog 5-12 1,S9E-05 61H13 299587 W05478,N7 115 1 1 MG 7400 EBTε. Weakly similar to SFR4_HUMA SPLICING FACTOR, ARG 5.1 S 3.72E-04 16C08 43021 R S0149,R801S0 1 I HARS 5241 hisHdyt-tRNA synthθtass 5.17 4,25 E-04 51 Mθ5 280374 U74-W 1 1 PDE4DIP 1 4l2 phosρhodieetaraεθ 4D Interacting protein (myomsgalin; 5,18 4.34E-07 0ΘA15 124123 R0172B.R01729 1 I NDUFB5 3 589 NADH dehydrogenasB (ublqulnonβ) 1 b-tesuboomplai, 5 (1ΘI 5.2S 9.87E-05 82C16 730Θ07 AA411948 1 I MG 17 B GSTs 5.35 1.72E-05 51J05 299664 WO5754,N75011 1 I ATP5C1 10770 ATP synthase. H+ transporting, mitochondrial F1 complex, gj 5,38 4.34E-07 1BFΪ9 37729 59491 1 1 MG MC 2 ESTs 5.48 2.27E-04 37D17 243095 HΘ4329.H94418 1 I DMD X 145 dystrophin (muscular dystrophy, Duchanna and Becker types), Inc 5-49 8.O1 E-0S 7G15 5.51 B.81E-04 77J17 5.53 4.15E-06 60C15 357996 WΘ2628.W94555 1 I FU20156 1322t hypothetical protein KJ2016, 5.5S 4.37E-07 43F14 273394 N46124,N3685321 MG 226 ESTε I MG 220 ESTs 5.61 4.72E-07 59H05 347420 W81299,Wai300 1 1 LOC511429 81916.7Kd protein 5.63 1.83E-05 82P16 738415 AA40566 1 I MQ 11 6 ESTS 5.63 5.83E-04 11M13 29794 R 15323.R42221 1 I IDH3B 203S5 isocltratθ dahydrogenase 3 (NAD+) betϊ 5.71 1.35E-05 13C03 34607 R 19729,R44283 1 I NDUFA9 12426 NADH dshydrogenasa (ubiq lnone) 1 alpha subcαmplex, 9 (3S 5.79 6-29E-05 A 3 36951 R 4Θ305.R34913 1 I GYG2 55 glycoganin E 5-81 4.21 E-04 51103 298190 N7O308,W0i415 1 1 ATP5H 17 252 ATP synthaaa, H+ transpoping, mitochondrial F0 complex, εut 5.84 7.1SE-04 5.5E+23 322361 MAO 5.85 2-33E-04 69M04 490929 AA136746,AAl36614 1 1 PDE4DIP 1 412 phosphodiesterasβ D InteracBng protein (myomsgalln' 6-05 9.35E-04 82U7 36541 B AA025728,AA025727'1 I MSC4730 9235 slmltartα RIKEN cDNA 3110001 D03 gene (M. musculu, 6.11 9.72E-Q4 69L.13 491559 AA148548 1 1 FABP3 1 106 tatty acid binding protein 3, muscle and heart (mammary-derived gro« 8.24 8-61 E-05 81D23 72917B AA398876,M43559721 K1AA0444 1 70 K1AA0444 protein I PSMB1 6 S60 proteasoma (pfosorne, 1 B,2S 6.43E-05 64J03 416508 W80622.W787401 1 DUFB32197 NADH deriydroganase (ublqulnoπβ) 1 beta BUbcomplex, 3 (Ii
1 6.45 fi.eOE-04 27M13 174S69 H21854 1 1 MY0M1 1848 myomesin 1 (skelemin) (1B5KD)
1 6.53 1.48E-04 52D22 305082 W3Θ730,N9314S 2 1 MAP3 12 12 118 mitogBn-aettvated protein Wnasβ kinase Wnaaa 121 PCBP2
1 6.54 9.B7E-07 20H04 149199 R8249Θ,R82552 1 ADF 20445 daBϋiπ (aeon depolymβrizJng factor
1 6.84 l,aiE-05 51C20 298691 W05243.N74335 1 I ACTG1 17 9308 acϋn, gamma 1
1 6.S4 1.496-04 13L04 38797 R 34635,R4Θ1641 ) SNAP91 687 synaptosomal-associatad protein, 91 kDa (mouse) homolog
1 6,Θ7 1.18E-09 S9A21 489626 AAl019iθ,AAO99 e9 1 1 PFKM 12 327 phosphofructokinase, muscle
1 6.87 1.18E-04 54H21 320618 W31459,W319901 1 DECR1 8 211 2,4-dienoyl CoA βductase 1, mitochondrial
1 6.9Θ 1.03E-04 14 17 39044 R E4227,R51B321 1 BECN1 274 beclin 1 (coϋad^oil, myosiπ-liKβ BCL2-iπtθraetlng protein'
1 7.02 7.59E-05 11M06 30048 R 16571 ,R41 371 I UBB 1 12S6 ubiquitin B
1 7.07 2.596-04 61 13 298288 N7O4βθ,W03B301 1 SDMB 1 201 succiπata dehydrogenase complex, subon B, Iron sulfur (lp'
1 7.17 2.18E-05 45M17 27Θ533 N66159,N9B6B41 I CQXSC 8379 c tochrome c oxidase subunit Vic
1 722 4,61 E-05 3SJ20 774364 AA430209,AA446954 1 1 lM 4292 LIM protein (similar to rat pratain kinase C-binding enigma
1 7.26 1.866-05 14K13 37547 R 35172.R50831 1 1 MDH27732malate dehydrogenase 2, NAD (mitochondrial'
1 7.33 3.48E-06 14M19 37372 R 50992,R330571 I ACTB 77094 actin, bata
1 7.35 3.71 E-04 66C0S 428458 AA004452 1 1 MG 9 S ESTs
1 7,40 2.056-05 17P02 138127 R333B2.R333Θ1 1 I H11 12258 protein klnaaa H11
1 7.44 Z13E-04 26L20 172470 H20154.H2024B 1 I PRDX5 11 296 peroxiradoxin J
1 7,74 5.73E-08 08G12 116770 T89462.TB95501 I F 11026693 hypothetical protein FUl10?ξ
1 8.03 1.36E-04 27B17 178323 H46B59.H467721 1 C0X4 16691 eytochroma c oxidase subunit 1\
1 8.14 2.61 E-04 07D24 123467 R00521,R00B221 I PECl 6233 perαxJaornal D3,D2-enoyl-CoA Isomgrase
1 6.32 1.47E-04 27M1 173642 H22433.H22470 1 1 NIFU 12287 nitrogen fixation ctusrβr-lik«
1 8.33 2.56E-04 49D04 293511 N94072,N695B2 1 I COX7A26327 cytochrome c oxidase subunit Vila polypaplidθ 2 (llvet
1 9.00 2.14E-04 51L07 299732 N70881 ,W06884 1 I COX5A 15274 cytochrome c oxidase aubunit V.
1 9.24 3.26E-06 51L08 300402 W07478 1 I SMPX X 47 email musde pratain, X-llnked
1 9.33 4.81 E-05 37D05 243047 H94314.H944061 I MG 25 ESTs
1 9.38 3.59E-06 52109 301159 W15484.N811352 I MG 12 22 ESTs, Weakly similar to T23110 hypothetical protain H21P03.2 -O
1 9.98 7.00E-06 S2A14 301793 W17389 1 ITNNI319 108 trapoήih I, cardiac
-1 3.01 4.60E-05 B2G01 3637B7 M020931.AA020930 1 1 GNAT1 3 54 guaπinβ nudβoWa binding protein (G protein), alpha transd
•1 3.03 4.596-05 85H11 755781 AA496667.AA4963321 I Z F2827 103 sine finger protein 2SΪ
-1 3.03 9.S6E-Λ7 SSMOB 325946 AA037219 1 1 DR14643 WD repeat domain 1
■1 3.04 154E-10 60C04 358609 W96224,W96319 1 I NDUFV321 103 NADH dehydrogenase (ubiqulnona) Tlavoproteln 3 (10kD)
-1 3.05 2.43E-07 90P01 785169 AA4784871 1 LOC5162B 2 142 CGl-60 prolelp
-1 3.05 7.11E-O7 61C04 361550 AAθ17124 1 I MG ESTε
-1 3.05 1.866-04.61009 360875 AA011116 1 1 LOC511933 112 zinc finger protein ANC_2H01
-1 3.06 4.46E-10 33L24 234444 H94812 1 I MG 1 37 ESTs
•1 3.07 8.60E-05 62G13 363798 AAO2OB38,AA020907 1 I MG 11 7 ESTs
-1 3.11 3.6SE-0663M23 375800 AA0338321 I MG 1 5 ESTs
-1 3.11 6-95E-07 28H20 194444 RS3178,R83179 1 1 HSD17B7 10 B6 hydroxyeteroid (17-beta) dehydrogenase :
-1 3.12 6.54E-07 64P02 416452 W868S21 I G 9 ESTS
-1 3.12 3.26E-09 65L08 428005 AA00171 B.AA0O2OS4 1 1 MG 75 ESTs
-1 3.12 1.18E-06 B5P16 757246 AA426026 1 I MG 153 ESTB
-1 3.12 7.94E-06 40P15 2S9932 N32823,N420S7 1 1 IGFBP417 1123 Insulin-like growth factor-binding protein (
-1 3.13 5.S9E-08 70O01 502881 AA125908.AA127075 . 1 OAS3 12 1632--5*-ollgoadenylata synthetase 3 (100 kD
-1 3.13 2.37E-10 64A03 381500 AA057555-AA0575S6 1 I MG 11 9 ESTs
-1 3.14 1.10E-O5 B3L02 742647 AA401506 Λ400289 1 I KCNJ8 1253 potaasium inwafdly-rac_fying channel, subfamily J, marnbs
•1 3.14 1.016-07 Θ5C09 416740 W86516,W86899 1 1 K1AA11501 256 KIAA1150 protain
-1 3.15 7.75E-09 70D24 604607 AA152188,AA1501372 1 MIR16 162B4 membrane interacting protein of RGS.161 EIF4G2 11 162E
•1 3.18 1.25E-09 63G13 366859 AA02957B.AA029577 1 I REH1 1 383 Bimilar to S. cereviβiaB RER1
-1 3.18 4.02E-O4 71G0S 510403 AA055608,AA055472 1 I KIAA179B 633 KIAA1788 protein
-1 3.19 9.91E-OB 61D07 362433 AA018467 1 1TORiB 9 136 torsin family i, mamber B (lorsin B)
•1 3.1 θ 7.606-1079B09 724101 AA2S0767.AA4110642 I MG 21 7 ESTs, Wfcakty similar to Unknown [H.εapϊens] I MG 21 5 ESTs,
-1 3.20 5.18E-07 SBM17 343871 W6964Θ,W69649 1 1 MAP2K5 15 B5 mltogeπ-activatβd proteln kinase Wnase 5
•1 3.21 6.SSE-0785A1 754030 AA47905B,AA480030 1 1 CASP82152 caspasβ 8, apoptosiε-rclated cystaina protease
•1 3.22 1.916-06 65Q09 754249 AA479273.AA479369 1 I NUDE1 16 232 LIS1 -Interacting protein NUDE1, rathomoloE
-1 3.23 1.29E-05 6.2E+20 363776 AA020894 1 1 AP2280 mlcrotubulβ-assoctated protein i
-1 3.25 3.58E-0B 65C03 416711 WS8808,WΘ66071 I USP24 1 204 Ubiquitin Bpacific protease 24
•1 3.26 Θ-B9E-04 43N24 273763 N44875,N33391 2 I MG 563 ESTs I GNA127239 guanina nucleotide binding protein (G protein) J
•1 326 6.Θ1S-0S 34107 236110 H53720.H5372 1 I HDAC354344 hlεtonβ deacetylasa .
-1 3-26 4.24E-06 6.5E+15 417400 W8Θ558 1 I M 11 10 ESTS
-1 3.27 1.63E-08 42115 266732 N23047.N28711 1 1 TFDP23 241 transcription factor Dp-2 (E2F dimerizallon partner 2'
•1 3.30 1.01E-OS 7.2E+25 531 SS6 MA O
•1 3.31 2.12E-07 6.1E+12 360970 AA012903,AA013038 1 I MG 12 18 ESTs
1 3.33 4.05E-05 710000 510175 MAO
1 3.33 7.91E-08 61A10 361448 AA016298 1 I MG 42 ESTa
1 3,36 2.4BE-10 88H21 48B523 AAO4723B.AA047101 1 1 C5orf6 S 177 chromosome 5 open reading frame ε
■1 3.93 3.45E-05 64001 382275 AA0B3428,AA063SO5 1 I AP3B2 15 50 adaptor-related protein complex 3, bets 2subunt
1 3.39 2.73E-08 84D14 415806 WB4774,Wa4821 2 I AMMECR1 X 50 Alport syndrome, menial retardation, idface hypopl&aia art
1 3,40 4.04E-07 71G09 505318 AA152032.AA1521071 1 MG 9 169 ESTs. Weakly similar to S55916 ribosomal protein S3, cytosoli
1 3-40 9.11E-09 79D19 724320 AA235452,AA410790 1 I DKFZP564D047S 1 171 hypothetical protain DKPZp564D047_
1 3.41 9.30E-09 B5H12 427861 AA001918,AA001331 1 I MG 1 7 ESTs
1 3.42 6.92E.08 72M04 544637 AA07529B l l MG 3 ESTa
1 3.42 3.07E-12 63L04 3B0979 AA057328,M05740O 21 HDAC354344 hlstona deacetylase 3 I MG 104 EST?
1 3.43 5.64E-07 72012 544608 MA O
1 3.43 1.99E-11 83A10 376051 AA0393SB,AA039357 1 I MG 1527 ESTs
1 3.43 3.33E-06 28B06 193997 H51258.H51828 1 I MG 19 105 ESTs, Highly similar to R26650 1 , partial CDS [H-eapiens"
1 3.44 3.26E-09 61H01 362560 AA017245,M017281 1 I MG 7 15 ESTs
1 3.45 1.49E-11 64P11 415703 W846S7,W788B31 12NF275 X 131 2lnc fingBr protein 275
1 3.47 V63E-05 63B02 38025B AA047805,AA047729 21 MG MC 25 ESTs I HDAC3 S 4344 hlstone deacetylase 5
1 3.49 1.18E-04 03H05 29926 T77210 1 1 DMTF1 7213 cycliπ D binding Myb-Tika transcription Factor! -1 3.50 B.B7E-06 4.6E+10 260469 N5 586,N50369 1 I BSh B 1BΘ NijmBgβn breakage Syndrome 1 (nibrin;
-1 3,50 2.40E-03 58A17 343286 W67648 V67Θ03 1 1 RNPEP 1 292 arglπyi amiriopeptidasa (aminopeptidaεe B)
•1 3-51 7.20E-07 70M04 603210 AA151570.AA15171Θ 1 I MG 7 18 ESTs
-1 3.51 4-11 E-07 64F14 415870 WB6215/W68216 1 I ERF 19 114 EIS2 represser factor
-1 3.52 6.006-12 Θ4O07 382340 AA06286Θ 1 1 MG 192 ESTs
•1 3.53 5.46E-0Θ 16124 137653 R8840B,R6B403 f I MG ' 9 ESTs
-1 3.57 8.30E-O8 29N21 199367 R95691 1 1 TNRC343BB tjInucleoBde repeat containing 3
-1 3.59 S.39EOB 83B04 380263 AA047B12 1 I MG 22 ESTS
-1 3.69 5.976-08 63B12 3B0338 AAO53937,AA0478β8 1 1 DGCR222916 DiGβorge syndrome critical region gene -
-1 3.60 1.23E-07 2.4E+24 46337 Hθg702,H096β0 1 I RPA2 1 253 replication protein A2 (32kD)
-1 3.60 1.60E-O5 63H02 380599 AA054259 1 I MG 2 1 EST
-1 3,63 3.60EO6 5BB24 345305 W72531.W76499 1 1 MG 1029 Homo sapiens mRNA; cDNA DKFZp564N2464 (from clone DKFZμ
■1 3,64 1.186-03 4.4E+20 274447 MAO
-1 3.65 6.94E-08 21C20 151493 H02846,H03739 1 1 TNRC3438θ triπucleoSde repeat containing S
-1 3.65 2.07E-O7 4BK07 289223 N76401,N6B989 1 I GRLF1 19293 ghjcocortteoid receptor DNA binding factor 1
■1 3-67 1.806-08 65M23 4171 ee MAO
-1 3.68 1.84E-O53OJ06 205523 H59470 1 1 HBG2 11 2091 hemoglobin, gamma G
•1 3.72 7.79E-07 B.1E+14 3609B3 AA01315B,AA0131S7 _ | MG 16 _ ESTs
-1 9.72 1.28E-0S 83M04 740664 AA477424,AA47S585 1 I FU115832091 hyrJometical pralsin FUJ150C-
-1 3.74 β.SβE-06 30O10 203227 H54623 1 I MG 1 2 ESTs
-1 3.75 S.636-05 61122 361872 W924751 1 TERE1 1 103 transitional eprthella response protein
■1 9.75 1.70E-06 70D19 503653 AA131398,AA131556 1 1ADAM10 15201 a dtεiήtegrfn an metalloproleinaaθ domain IC
-1 3.78 8.40E-1O 92H21 795579 M4e046S,AA4634Q7 1''| CDK5R1 1791 cyclin-depeπdent kinase 5, regulatory subunit 1 (P35
-1 3.78 1.51E-08 64D09 415321 WΘ1801.W92041 1 1 FU11136 11 31 hypothetjcal protein FU1113e
•1 3.76 3.46E-09 8.6E+13 757998 AA429712.AA442742 1 1 MG 11 2B1 ESTs, Highly similar to 160307 beta-galactosidase, alpha pep
-1 3.77 6.38E-U 51F14 300174 N7B774, 07055 1 1 DKFZP586F11222 186 hypothetical protain DKFZp6a6F1122 similar to axotr
-1 3.77 3.2&E-05 61D04 9S9007 AA019175,AA0188θ71 1 AGXT2L1 32 alaπine-gyoxylata aminotransfaraεa 2-llke 1
-1 3.B5 1.92E-07 62G19 36381B AA0209SB.AA021009 1 I K1AA12S4 15 145 KIAA1254 protein
•1 3.85 2.S0E-13 85J21 756092 AA419168 1 I HLA-DQA1 6 01 major histocompatjbmty cornplex, claas II, DQ alpha 1
-1 3.86 B.eaε-12 B3io8 74041B AA478227,AA477B29 1 1 CTΞL2984 cathepsin L2
•1 3.89 1.S9E-O7 0ΘD21 430083 AAO0B069,AAθ09842 1 1 EPB41 40 eryihroeyte mambrane protein band 4.1 (elUplαcytoSis 1, RH
-1 3.91 3.89E-04 41H23 264567 N292B0.N20212 1 I PIG71$496LPS-ln0ucedTNF-alphafaWoι
-1 3,91 1.68E-07 30B06 204774 H5Θ946 1 1 MG 1 2 ESTa
-1 3.91 4.166-09 eaHos 773579 AA429310,AA426242 1 1 C2orf3285 chromosome 2 open readfrig frame £
-1 3.91 3.93E-09 85C24 754601 AA4113Θ7,AA406325 1 I PLCE 229 phpspbolipase C, epeiloπ
•1 3.S5 4.99&-09 Θ7L19 435677 AA041526ΛA039902 1 1 TNRC34368 hinucleollda repeat Containing £
-1 3,97 4.27E-12 34L24 63609 MAO
■1 4,03 5.31 E-OB 59K06 346S47 W7S316.W79396 1 I ZNF211 1936 Zinc finger protein 211
-1 4.08 3.616-10 69F12 356959 W92830(W92e87 1 I CTRP5 11 62 DKFZP5B6B0621 protein
-1 4.15 1.86E-11 B.5E+25 7S46Θ6 AA422106.AA411222 1 I PCSK7 11 229 proprotein convertase aubtilisinVKexln type 7
A 4.15 2.02E-09 56A07 324155 W46609,W46539 1 I TIP47 19296 cargo Balac 'on protein (manήose 8 phosphate receptor binding
-1 4.16 7.14E-10 64A15 381540 AA0S6082 1 I MG 42 ESTs
-1 4.18 2ΛSE-11 43024 271945 N35304,N4467621 MG 65 ESTs I MG 6 10 EST?
-1 4.19 5.82E-OΘ S3G20 307O16 N93656 1 1 RAMP2 1741 receptor (caldtonin) activity modifying protein .
■1 4.20 6-13E-11 34114 21324 MAO
-1 4.22 2.896-09 S3I07 308154 N90527.W2010 1 1 PIM1 6 178 pϊro-1 oneogene
-1 4.28 4.01E-12 85M02 755156 AA421924.AA421923 1 I DKFZP434A23Θ 359 DKFZP434A236 protein
•1 4,23 8.13E-07 70012 503338 AA1301B7,AA130278 1 T1 11 35 Wilms tumor 1
-1 4.29 3.00E-05 61 23 361327 AA017546-4A017419 1 1 MG 10 1β ESTs, Weakly similar to ALUS_HUMA ALU SUBFAMILY SX
-1 4.30 4.46E-03 1BF04 139512 RΘ2205,R645B91 1 MG 575 ESTs
-1 4.31 6.306-07 5.3E+23 308948 N9 966.W242Θ2 1 1 ANXA42336 mnsάa A4
-1 4.33 2.08E-0S 5.1E+23 290763 WO4760.N753O3 1 I FU11274 14231 hypothetical protein FU11274
■1 4.33 4.63E-10 5.1E+15 298748 AI822098,N74890,W05078 1 I MG 11 36 ESTs
-1 4.35 1.58E-09 33P16 234B45 H77734,H77733 1 I MG 33 ESTs, Moderately similar to roundabout 1 p-t.saplena
1 4.38 4.22E-06 50FO4 297110 N7387?,W03939 1 I MG 1 5 ESTs
1 4.36 1.38E-11 B3B21 741027 AA402222.AA47a411 1 1 BCAM-1 3 176vinβχin beta (SH3-ccnta!nIng adaptor molecυle-T.
■1 4.50 2 286-09 70124 503114 AA151548 1 1 T RC94368 trinudeofide repeat containing 5
-1 4.52 1.77E-10 72B21 544965 MAO
1 4.59 2.26E-06 30P05 204614 H57011 ,H5691 B 2 I EIF4A1 172338 eukaryotic translation initiation factor 4A, isofo m 1 I MG 172
■1 4.61 6.Θ3E-04 18M03 137032 R35877,R3587β 1 I WDR103 143 WD rapaat domain 10
1 4.62 3.26E-10 64B14 415769 W84Θ5S.W848572 I MG fl 2 ESTs I ANGPT1 8 5( sπgiopoia.n 1
1 4.65 2.S9E-12 70M19 502634 AA127017 1 I G 1 6 ESTS
-1 4.65 1.72E-12 64M22 415211 W95061.W919421 I MG 1 6 ESTS, Weakly simil&rto potential CDS nisapiens]
1 4.88 2.4BE-D9 03N10 6S915 T97472,T69505 1 1 PC712225 anaphaεa-promotlng complex subunit 7
1 4.63 9.OOE-10 8Θ012 773393 AA427809ΛA425756 1 1 MG 351 Homo sapiens cDNA; FU21652 fiε. Clone CQLOSδaS
1 4.71 3.09E-11 B5D04 7S6760 M424341.AA425732 1 1 GJB31 48 gap Junction protein, beta 3.31 kD (connsxiπ 31)
■1 4.74 3.54E-11 85J11 7S5908 AA496594 A498546 1 1 MG 20 129 Homo sapiens cDNA FU12683 fi3, clone NT2RM4002457
1 4-79 5.24E-09 34L1S 53603 MA O
1 4.81 3.eee-os 4IL I 294603 MA O
1 4.87 2.22E-04 B3D19 741111 A1821639,AA402713 1 I MG 74 ESTa
1 4.97 1.12E-15 5.1E+14 29B091 W01791,AI622041 MB22093,N70756 1 I MG 1279 Homo saplena, clone IMAGE.335SΘ13, mRNA
1 4.97 9.07E-07 63A08 376043 AA039304.AA039303 1 1 MG 15 19 ESTs, Moderately similar to AI_U1_HUMAN ALU SUBFAMILY
1 5,00 6.36E-17 51H23 299629 N75004.WO5747 I MG 422 ESTs
■1 5-01 1.2SE--13 30H20 205480 H58066,H58067 1 I LOC51659 16 179 HSPC037 protein
-1 5.03 1.47E-10 5ΘB02 356727 WBOB22,W80923 1 1 UBE2G221 255 ublqultin-coπjugating enzyme E2G 2 (homologous to yeast I
■1 5.04 1.4SE-OS 53H02 30Θ69S N92842.W2506B 1 I MG 9 812 Homo Sapieπa cDNA FU14028 (is, clone HEMBA10O3Θ36
■t 5.07 2.02E-11 57B08 342497 W6826β,WβS285 1 I MG 621 Homo sapiens CDNA FU14134 fis, clone MAMMA10027oe
■1 S.0B 1.266-08 61 B04 362932 AA018893,AAOl94341 1 UNRIP 12560 unr-lnteracting protelr
■1 5.17 2.00E-13 BBH21 773612 AM2e362,AA4294181 1 AHNAK 11 308 AHNAK Uclθoprotsiπ (des oyokiπ)
1 5.18 1.39E-07 62001 364028 AA021058,M021059, 1 I U6L3 13280 ubiqUltln-llkB 3 1 5.25 6.83E-10 θδAOβ 417241 W87779,W87977 1 1 MG 265 ESTS, WeaMy similar to MUC2,_HUMAN MUCIN 2 PRECURSOR [I-
-1 5.27 1.03E-10 S3A01 30577B 19932 1 1 FU146682 \_9 hypothetical protein FU1466E
■1 5.33 1.89E-10 33P22 234715 H77647,H77848 1 I MG 22 12 ESTs
-1 5.35 1.32E-08 3QK22 202838 H539B9,H54149 1 1 SMAJRCD2 17216 SWI/SNF related, matrix associated, actin dependent regul
1 5,38 2.31E-0Θ 64K11 382063 AAθ83l47,AA0625θ9 1 HMG 958 ESTs
-1 5,42 2J9E-08 64K01 3B2Qia AA063070 0830Θ3 1 .OC54103781 hypothetical protelr
■1 5,46 6.55E-15 83A0S 740007 AM7750B,AA4770a9 1 UISYNA1 19231 rnyα-inoshol 1-phosphate synthase A1
1 5.45 2.03E-07 61G11 3810Θ0 AA0172l4lAA01730a 1 ( CDO107778 CPC10 (cell division cycle 10, S. cBrevtSiae, homolog;
-1 5.46 1.19E-11 S1H02 300217 N78β04,W07233 1 1 MG 143 Homo sapiens, done IMAGB3997644, mRNA
-1 5.54 2.39E-12 83P17 741960 AA402983,AA4O5395 1 1 PAEP 975 progestagen-assoriatiid endomβtria! protein (placental proteή
■1 5.65 5.00E-10 53F13 3Q7919 W24408 1 1 PICE 1070 pancreas-enriched phospholipase C
•1 5-SS 2.02E-11 61A0B 381405 AA0175S 1 | MG 23 ESTs
■1 5.57 9,01 E- 2 04124 109914 T88897.TB4425 1 I LOCB3904 X 10 hypothetical protein IMAGE 10991'
1 5.57 7.59E-04 03O12 2354S R38161.T77O80 1 1 MG 820 Human clone 235 5 mRNA sequence
-1 5.71 1.11E-18 860000 757S81 AA436890,AA442649 1 I FPGT 1 53 fucosa-1-pboSphate gυanytyltransferaBf
-1 5.82 1.67E-14 S2F13 302B42 W1Θ381,N90903 1 1 NDUFAΘ 9 150 NADH dehydrogenase (ubiqulnone) 1 alpha subcomplex, 8 (1
1 5.97 1.56E-10 28L22 194863 R88693,R9093Θ 1 I MG MC 8 E$Ts
1 6.05 5.57E-08 34D18 51779 MA O
1 6.10 1.64E-08 34D1 50679 MAO
1 8,18 4.B3E-10 12L07 33490 R44B75.R18990 1 l K1AA0705767 atr0phln-1 Interacting prolein 1; activin receptor interacting pro
1 6.27 9.39E-15 64B12 415764 WB4750,W04506 1 I MG 154 ESTs
1 6.38 7.57E-16 63001 375601 AA033838,AAO33894 1 I FU11588 1 144 hypothetical protain Fi i 156,
-1 6.49 4-61E-11 B1B12 362972 AA01922D.AA019219 1 1 MG 2283 ESTs, Weakly similar to TRHY_HUMAN TRICHOHYALI JH.sai
1 6.5S 1.02E- 7 63B0B 3802Θ7 M047791 1 I G 107 ESTS
1 6.72 8.81E-13 12J24 34439 R449B2.R201961 1 FUS2344 putative tumor suppressoi
1 6.B9 1.67E-09 32O09 213875 MA O
-1 7,31 5.51E-13 63P11 380162 AA0469ia A0464e4 1 SF3B211 604 splicing factor 3b, subunit 2, ]45kC
1 7.39 2.14E-14 04 07 110987 T83047,TS03691 I MG MC 2 ESTs
-1 7.65 1.26E-16 61P11 362879 AA018960,AA01B959 1 1 MG 153 ESTs
•1 8.52 1.15E-04 30O09 201852 H48243,H4Θ33 1 1 ASAHL 107 N-acylsphingosine amidohydrolase (acid ceramldase)-like
1 8.76 4.84E-15 2U22 153865 R4BS24.R48640 1 1 MG 19254 ESTs, Weakly similar to T2B770 hypothetical protein W03D2.1 - C
1 9.33 2.12E-04 28P05 193S62 H51673.HS1087 I EPB41 L26330 erythrocvte membrane protein band 4.1 -like I
1 10.61 2.37E-12 53D20 308561 W25029,N95627 1 I TNNC1 3204 tropoήin C, slow
1 10,72 4.4βE-07 28H11 193106 H47080.H47164 1 I ATP5G32422 ATP synthasa, H+ transporting, mitochondrial F0 complex, sut
1 10.81 1.19E-04 90L17 785015 AA448334 1 1 MG 35 ESTs, Highly similar to CAV3.HUMAN CAVEOUN-3 [Rsaptens
1 10.98 B.42E-10 GΘH20 489173 AA056Bθ6,AAOS65821 I KIAA0372 5200 K1AA0372 gene producl
1 11,43 2.96E-07 36F24 239067 H6B596.H682382 I MG X 11 ESTs I UHFPL1 X 1 lipoma HMGIC fusion psrtπer-liKβ 1
1 11.57 9.04E-10 41P15 26S111 N20β23,N30548 1 1 SLC25A44203 soluta carrier family 25 (mitochondrial carrier, adenine nud&c
1 11.62 7.39E-00 B6I18 758110 AA426429 1 I MG S 1 6ST
1 12.19 8.30E-07 2.36+25 1S0251 H29955.H29661 1 I CRYAB 11 694 Crystals, alpha S
1 13.56 2.52E-0B 57D21 341977 W60027,W601071 I NDUFA41 678 NADH dehydrogeπaae (ubiqulnone) 1 alpha subcomplax. 4 (ϊ
1 13,65 5.006-Oa Θ.4E+08 381777 AA0S9229 1 I ATP5B 12 1185 ATP synthase, H+ transporting, mitochondrial F1 complex, beta pot
1 13.88 2.43E-05 42D03 268263 N36373,N30027 1 I H41 3353 hypothetical protair
1 14,53 6.76E-07 42D01 268281 N39372.N30026 1 1 DH1 2830 malate dahydrogenase 1, NAD (soluble)
1 13-17 5.91E-08 51P17 299994 N91524.W07136 1 I TNNI3 19 108 troponin I, cardiac
1 15.24 8.635-05 70L24 504933 AA150818,AAl507θβ 1 TH1 11 5084 ferrftln, heavy polypeptide 1
1 18,12 7.57E-04 50L02 2B7645 N94024,NS8355 1 I MYL2 12413 myosin, light polypepildβ 2. regulatory, cardiac, slov
1 1B.56 3.93E-06 6QO01 35B439 W96105.WΘ6104 1 1 ACTG2 2398 actin, gamma 2, smooth muscle, enteric
1 20.41 7-3aE-09 62109 363B67 AA021072,AA0209871 1 ATP5A1 183130 ATP synWase, H+ transporting, mitochondrial F1 comp
1 23.35 S.04E-O7 S1J07 299850 W06870,N70860 1 1 ACTA1 1 SIS serin, alpha 1, skeletal muscle
1 3.00 4.98E-04 24G13 46355 H 09934,H099331 I LOC57146 1695 hypothetical protein from done 2479E
1 3.02 7.45E-04 32H6 214565 H73727 1 I RPS145 1379 ήbosomal pratain S14
1 3.02 2.19E-07 63G12 376347 AA0413031 1 MG 2 1 EST
1 3.02 1.39E-OS S8N21 34313S W72173.W76459 1 I F /14743 1 107 hypothetical protein FU14743
1 3,02 8.7BE-04 53110 307119 N93715.W211021 I RPS29 14775 ribosomal protein S2S
1 3.03 1.2B6-04 21H05 152BB7 R50S61,R50B61 1 1 CRMP1 4337 collapsin response mediator protein 1
1 3.03 3.98E-03 50P04 297789 WOO5B4.NΘ3907 1 1 RPS27A 21262 ribosomal protein S27a
1 3.05 4.50E-O5 57D22 342664 W6S282,W6S2fl3 1 I RPLP1 15 1515 ribosomal protein, large, P1
1 3.05 3.60E-O4 51M05 2BB374 N741041 1 PDE4DIP 1 12 phosphodlesteraaβ 4D interacting protein (myomeπalin,'
1 3.05 3.68E-04 43L09 272679 N36173,N441621 I MG 11 275 Homo sapiens cDNA: FU21300 lls, done COL0206t
1 3.05 9.76E-05 16K01 138891 R3S451.R38532 1 GNAS1 2025B2 guanine nucleotida binding protein (G protein), alpha stimulat
1 3.08 2.61 E-04 59N08 357498 W94033.W94032 1 1 MG 55 ESTε
1 3.05 2.40E-05 21P06 1S4196 R52041.FtS2042 1 IATP6M 14286 ATPasa, H+ transporting fysosoma' (vacuolar proton pump), rr
1 3.07 1.46E-04 25122 50145 H 17084,H17700 1 I K1AA11024240 KlAA1102 pr0teir
1 3,08 4.54E-04 38L14 249242 H83345 1 I BLCAP 20372 bladder cancer associated protein
1 3.03 S.60E-04 58111 343626 WΘ9636,W696371 I CUUA 13333 cullin 4A
1 3.08 9.26E-05 03F07 23B06 T 77S01.R3B385 1 I CDH2 18 125 cadherin 2, type 1, N-cadhβrln (πsuronal'
1 3.09 5.2ΘE-07 62H21 365227 AA0249Θ8 Λ024897 1 1 MG 19 5 6STs
1 3.09 9.76E-05 62010 354818 AA02Θ204.AA035611 1 1 KIAA1002 MO 141 KIAA1002 prαtair
1 3.0Θ 1.02E-05 S3 11 739459 AA477251 477252 1 1KIAA0864 1 143 KIM06B4 protein
1 3.10 8,S3E-05 SEH17 7^552 AA49δ30θrAA496642 1 TNS 2264 tertslπ
1 3,10 3.29E-05 25B22 S0B3O H 19129.H19128 2 1 FGF12379 fibroblast growth factor 121 FGF12B 3 51 fibroblast growth factor 1
1 3.11 1.06E-04 61A23 360B41 AA011015.AA010960 1 1 BTN2A1 6 102 butyrophUln, subfamily 2, member A1
1 3.11 8.47E-0S 67N03 4B5702 AA039910,AA0415332 1 LOC64182 1 115slmIlarlo rat myomegalin 1 PD64D1P 1 412 hosphodiij
1 3.11 6.57E-05 68J17 488590 AA044842 1 I FAMBAl β 162 family With sequence similarity θ, ember Al
1 3.11 1.57E-04 30M03 20171 J R99921.R99742 1 I MGC14288 12193 hypothetical protein MGC1426S
1 3,11 2.45E-05 92B10 79SB82 AA4631B0,AA46327a 1 I MGC2747 196B4 hypothetical protein MGC2747
1 3.12 2.98E-05 86N22 7603SB AA426294 1 I PAPA-11296 PAP- inding protein
1 3.12 5.27E-04 42K17 266983 N31675.N241B22 |KtAA1111 X 134 KIAA1111 protein I RPL13A 19 4930 nbosomal protein 13i
1 3.12 1.11E-0S B3A19 738508 AA405906 1 1 MG32 ESTS 3.13 5.73E-04 62B21 364923 AA024667,AA025277 1 I MG MC 100 Homo sapiens. Similar to phoSphOllpasa C, delta, clone MG'
3.14 8.30E-05 41C22 263283 H99952 1 1 HIBADH 727|23-hydroκylsoblΛyrata detiydrogaπasi
3.15 2.52E-0448G17 289067 N63607 1 I PDE4DIP 1 4*12 phosphodiβsterass 4D Interacting protein (myomegs)iπ'
3.15 1.32E-04 62012 364620 AA02θ205,M0357222 i:MG 644 Homθ Sap!ens rΛNA: FUa3176fis, cfonθLNG10452 I LAMA2-
3.16 1.85E-04 29N20 2QQ796 R9815β,R96850 1 I RPSJ145 1379 ribosomal protein S14
3.16 4.38E-05 89N04 7B2665 AA4480BO.AA447581 1 JRPS235714 ribosomal protein S23
3.17 8.41 E-04 41014 2Θ4229 N20.65,N290421 1 BRPF36311 bromodomaln and PHD finger containing, 5
3.17 1.94E- 4 8BJ11 773661 AA433902,AA434Sei 1 |' L0C5164 12491 CGI-120 rotelr
3.1B 2.36E-04 03J13 23747 T 78Θ241 1 CREB 12239 cAMP responsive efamant binding protein-like 2
3,19 1.03E-04 36G13 5B764 M A O
3.18 9.85E-04 40B05 253650 N30205,N40ΘS321 HI-VDOAT 8401 major histocompa-bilrty complex, class II, DQ alpha 1 I MG
3.19 4.5SE-05 86124 758126 AA426498,AA4371701 1 MG MC 15 ESTs, Weakly similar to S33990 linger protein _WF33A [H.sa 3,19 1.09E-04 B300OOO 366749 AA029S45, 0297131 I M63 16 1B3 frve-span transmembrane protein MSS
3.19 6.32E-05 70P17 504352 AAiaiθ79,AA131932 1 1 AUP1 2391 ancient ubiquitous protein 1
3.20 1.17E-04 43F24 273437 N46154,N38S83 1 I LOC51248 237 hypothetical protelr 3,20 B.03E-04 Θ2 03 3639H AA021185,AA02118β 1 I MG 11 5 6STg
3.20 7.17E-04 21M13 1 S2263 H04756.H04B471 I NDUFB6 9 163 NADH dβhydroganaSB (ublcftllnona) 1 beta subcomplex, 6 (171
3.20 1.64E-04 19A21 140205 R67β18,RB781θ 1 I NDUFB7 19 137 NADH dehydrogenase (ubiquioone) 1 beta Subcomplex, 7 (1!
3.21 1.10E-04 56F21 327297 AA2842β9,W32366,W01375 1 1 MGEA6 70686 menlngtoms expressed antigen 5 (hyaluraπidase;
3.21 5.19E-05 83J21 741450 AA401043,AA400991 21 MAN2S1 19 227 mannosldasa, alpha, class 2B, member 1 i FU20494X
3.22 6.86E-0S 62P17 965S6B AA009781.AAOO9890 1 I MGC176525 132 hypothetical protein MGC1755Σ
3.23 2.71E-04 25G13 49352 H 15504.H15446 1 IANXA7 10341 aήήSxin A?
3^4 5.596-05 41N1S 285027 N21087.N279232 I LOC64ia21 115 slmlter to rat myomeqafiπ I PDE4DIP 1 412 phosphαdϊβstera
9.24 i57E-06 64P23 415737 W7B908,WΘ4731 1 1 FLNC 7 155 filamln O, gamma (actin-binding protein-2B0)
3.25 1.43E-04 43017 270922 N42725.N32510 1 I PMP2217331 peripheral myelin protein 22 3.27 2.61E-04 23MH 43847 H O4601.HO49O 1 I CD2AP B 176 CD2-asso ated protein
3.27 2.Q1E-05 79K22 723849 AA235471ΛA29251 1 1 SEH" 8896 SET tranelocatton (myeloid leukemla-assαciatad)
3.2B 4.39E-06 63K23 376670 AA033ΘΘ9,AA033700 1 I MG 1 24 ESTs, Moderately similar to MAS2_HUMAN MANNAN-BINDINt
3.29 3.05E-Q4 46P14 2B3412 NS0628,N553891 I T FRSF1 A 12212 tumor necroais factor receptor Superfamily, member 1.Λ
3.30 4.096-07 62B03 364863 AA034459,AA 53971 1 I POP2369 popeya protein 2
3.30 2.24E-0S 62K09 364683 AA025262.AA02534Λ T | 224 ESTs. Weakly similar to ZN91_HUMA ZINC FINGER PROTEI
3.32 1.79E-05 48O01 289382 N73799,N9942$ 1 I COX7C 5563 cytochrome c oxidase subunit Vile
3.33 2.SOE-04 12K11 32319 R 17444.R42791 1 I UCH l 4741 ubiquitin carboxyi-termiπal BSterase 1 (ubiquih'n thlolestarase.
3.33 1.77E-05 41P14 266161 N21592 1 I MG 22 ESTs
333 3.35E--04 60H16 300433
3.34 Θ.01 E-06 B3K11 375575
3.35 3.826-08 46P23 2B2607
3.35 1.Θ5E- 9 S8014 344614
3.38 9.57E-04 21F13 1S273B
3.36 3.B0E- 5 31C07 206262
3.37 1.B9E-0S 12A18 32516 R
3.37 4.67E-04 53104 307055
3.38 2.49E-04 21H19 152950
3.3a 1.906-04 90A24 734065
3,40 6.55E-05 25A15 49191 H
3.40 B.11E-04 Θ5J05 418102
3.41 1.63E-05 SE+10 113608
3,41 4.33E-04 24P08 49131 H
3.41 B.32E-05 23P06 46166 H
3.42 2.42E-0S 92B23 7963S6 3,42 1.69E-04 Θ2C23 363734
3.42 2.15E-06 51D24 300103
3.43 2.04E-OS 60 03 359942
3.43 3.66E-05 51103 293190
3.44 7.68E-05 52P17 3O4Θ60
3.45 3.97E-04 43D20 273207 3.4S 5.63E-05 71G07 505316
3.48 8.82E-0B 40L23 259624
3.47 S.10E-O5 66F16 469688
3.47 7.50E-06 28F20 194350
3.48 4.52E-0425 23 50973 H
3.49 1-056-05 59J01 347487 3.B0 7.42E-04 60P09 360137
3.52 3.50E-04 35B21 56295 M
3.53 B.39E-04 42102 269943
3.54 2.78E-07 63K19 375650 3,53 1 -17E-04 63K07 37S534
3.56 3.376-06 88H17 773B02
3.57 1.59E-05 50L12 297671
3.58 1.35E-04 3SC23 53956 M
3.58 6.61E-0B 39G22 252519
3.59 8.99E-04 24H21 47843 H
3.60 1.34E-05 41N12 266042
3.60 1.52E-07 51D21 299459
3.60 4-27E-06 BOM05 358351
3.60 2.91E-08 63022 307582
3.61 2.16E-07 31P06 212308 3.83 4.80E-04 B0D20 360303
3.63 3.43E-09 EβKOB 344412
3.65 5.12E-05 79H20 725700
Figure imgf000034_0001
3.65 1.S1E-O4 42K10 267762 N23289,N326S41 | LOC51335 15594 mβsBπehymal Stem call protein DSC9Σ
3.63 1.62&O4 30G11 201366 R9Θ712,R99907 1 I BCKDHA 19 264 branched chain kβto acid dehydrogenase E1, alpha polypepi
3.65 1.036-04 67J17 485199 AA039421.AA03932021 IOCB41B21 115 similar to rat myomegalirt I PDE4DIP 1 412 phosphodie
3.66 1,22E-O4 70N22 505031 AA1513J1.AA151310 1 | CPV 715 carboxypeptldase, vitsltoβsnlc-llks
3.67 7.35E-04 32K02 214628 H71244.H71243 1 I RPL27A 11 1427 ribosomal protein L27Θ
3.67 3.94E--05 51P11 299980 NBOD59,VVθ70l9 ) MG 449 ESTs
3.68 3.15S-04 23B19 44707 H 07195,H08627 1 1 MAPRE2 18267 microtubula-associated protein, RP/EB family. members
3.69 3.B3E-05 70B1O 504475 AA151323.AA151322 1 1 H 10789 13240 hypothetical protain RJ1076ξ
3.70 3,2ΘE-08 31B23 209116 H639lθ,H6351 1 I RPLβ 42324 ribosomal protein LS
3.71 4.65E-08 94L09 841769 AA487Q15 1 1 M 1060 Homo sapiens mRNA; cDNA DKF2p586lQ120 (from dona D FZp566LO' 3.71 7.82E-09 63HOS 380713 AA0542a7,AAQ540S0 1 ( ZFP36 19659 zinc linger protein homologous lo 2fp-36 in mouse
3,71 1.75E-05 70AO9 5021B4 AA1268S7,AA128133 I I MG 1 14Θ Homo sapiens done HH409 unknown mRNA
3,71 1.81 e-05 46012 2B1763 N480B7,N532e5 1 I AKL3L 9305 adenylate klnaaa 3 alpha like
3.73 1.39E-05 24123 6596 H 09975,H09976 1 1 ATP5F1 1 797 ATP synthaaa, H+ transporting, milochondrisl FO complex, εubul
174 2.976-04 25113 49691 H 16254,H1S255 1 I PRNP 2051 B prlon protein (J327-30) (Creutefel ktakob disease, GβrstmBήn-Stø
3,75 1,386-04 44K20 278777 N40542 1 1 MG 7400 ESTs, WaaWy similar to SFR4_HUMAN SPLICING FACTOR, ARGININE Sf.
3.75 2.16E-04 25A16 4S966 H 29298,H2S3βB 1 I OPA1 3227 Optic atrophy 1 (autosomal dominant]
&76 4.056-054βM 14 2B1659 N53248,N430502 1 PDE1A 251 phoBphodiasterase 1A, calmodulln-depβndent I MG 28 ESTs, W
3.76 1.Sβeϊ-0490F21 784746 AA47B527,AA4765261 1 PP591 1 193 hypothetical protein PPS91
3.77 6.766-05 44120 276677 N40454 1 1 MG 1028 ESTs
3.78 5.Θ1 E-04 340000 65225 M AO
3.79 8.09E-05 29H11 188895 HS3197,HB29651 I CPC27 17 482 cell division cycle 27
3.79 4.06E-04 66H01 430190 AA010190,AA010089 1 I MG 8 20 Hojrø Sapiens cDNA: FLJ22090 rts, clone HEP160B4
3.80 1.396-04 62L17 385418 AAO25728,AA0J5?27 1 I MGC47309235 similar to RIKEN CDNA 3110001 D03 gena (M. mtiSCUlu.
3.81 2.76S-05 23N18 46147 H O9 13,H09S$01 ) COX7A2L 2361 cytochrome o oxidase subunit Vila polypepWβ 2 lite
3.81 8.08E-04 70G19 502415 AA134697,AA134β9821 18AN 1 351 niban ratfiln | C1orf24MC 15 chromosome 1 open raadin
3.82 3.22E-04 62Q09 364033 021106,M02160 1 1 GAPD 12 1135 glyceraldehyde»3-phosphata dehydrogenaat
3.82 5.906-06 S3G02 308980 N7S08δ,W2160621 ATP11 1 27B hypothetical protein F 22351 1 DKFZpS47M07219271 hy oth 3.84 2.43E-04 51H03 2995S9 N74995.W05898 1 I RAB3512 112 RAB35, memBer HAS uncogene family
3.BS 2.65E-05 51M06 299149 W05280.N75471 1 I PAIP2 S 477 PABP^nteractJng protein 2
3.B8 2-SaE-04 88A05 770836 AA43450SΛA434407 1 1 ALDH212392 aldehyde dehydrogenase 2 family (mitochondrial
3.86 3.74E-05 23A03 16304B H272S6,H398702 I MGMC 1 EST I UM 12963 lumicar
3.B7 B.53E-05 12014 3905S R 1f349Θ,R43a44 1 I OXCT5 1633-oxoacld CoAtransferas€
3.66 2.04E-04 48101 2S9107 N63623 1 1 MG 1 27 Homo sapiens, dona MGC:20O57 IMAG6;466l 943, mRNA, complata cd£
3.83 2.15E-0S 60K0S 358291 W95754,W9S797 1 I FN5 11 40 FN5 protein
3.91 1.346-04 6BB18 466889 MO46350,AAQ4BO6721 MG 226STs I UGP22474 UDP-glUcosβ pyrophosphorylase ϊ
3.91 2.58E-0S B9N20 7826S9 M4476C4.AA4481032ϊ SLC8A8 X 328 solute carrier family β (neurotransmitter transporter, ereat
3,93 5.486-04 3E+1Θ 201275 R99319.R99413 1 I PSMBβ 17331 proteasome (proaome, macropaiπ) εubαnlt, beta type, t
3.93 1.72E-0 46121 2808S9 N5057β,N5052Ω 1 1 COX7B X 292 cytochrome c oxidase subunit Vllt
3.96 2,096-04 30D14 205089 H58042,H57S4a 1 1 MYU 17300 myosln, light. pαlypeptMβ 4, alkali; atria), embryonϊ<
3.97 7.476-07 94P01 B43335 AA4a9575,AA4S59e5 1 1 SUCLG1 2320 εuCcinate-CoA ligase. GDP-formiπg, alpha sυbunil 3.99 2.886-0442P17 269200 N36689,N24707 1 1MGP 121279 mshϊX Gla proteir
4.00 1,066-04 SBFD2 774117 AA442l5β_AA4421591 ( FLN29 12229 FLN29 ge e product
4,00 1.336-043.9E+15 252347 Ha7194,H87703 1 I ORF1-FL49 6274 putative nucleβr protein ORF1-FL4S
4.02 2.046-04 B9A04 7811 SI AA429922,AA4460771 I DNAJA1 9458 DnaJ (Hεp40) homolog, subfamily A, member 1
4.02 2.386-05 63G05 366B42 AA029449 AA0295142 )MG 1H2 ESTS I NCAM1 H 190 neural cell adhesion molecule 1
4.04 2.71 E-07 42O08 288126 N27409 1 I RPS235714 ribosomal proleln S23
4,06 3,906-05 03J04 25207 T 80550.R3905S 1 I FU14054561 hypothetical protein FUJ1405^
4.06 3.726-0444K04 278700 N40460.N46544 21 HINT 548$ hiβti ina Inad wleotids-uindinα protein I MG 235 ESTϊ
4.07 1.296-04 51 J20 300344 W07283,N797B5 1 1 MG 962 Homo sapiens mRNA; cDNA DKFZp434Cl 915 (from done D FZp4 4.10 MS6-04 7900 714057 AA284870.AA2β4a07 1 1 CYC1 8466 cytochrome 0-1
4.10 1.556-07 05A03 112364 T8S832,T9094S 1 I K1AA02633 189 WAA02δ3 gena produd
4.11 8.B2E-07 59K13 34β*22 W79a80,W74266 1 1 D FZP566L151 1 73 DKFZP586L151 protain
4.11 3.11E-04 12L17 33389 Fl 43361^19511 1 1 K1AA1128 10 187 KIAA1128 protelr
4.12 8.92E-09 59H05 347420 WβT299,WB13001 1 L.OC511429819 16.7Kd protein
4.12 1.74E-08 33FU 232661 H73513.H7331 1 1 ATP5G212501 ATP synthase, H+ transporting, mitochondrial FO complex, St.
4.13 1.12E-08 88P03 773871 AA427608 1 I MG 11 63 Homo sapiBrtS mRNA; cDNA DKFZpS86Fl322 (from cloπa DKF2p5β$F1; 4.13 4.67E-04 92HDB S09428 AA4429e3,AA459913 1 1 SPG1Θ 15445 signal pepfidase complex (18KD)
4.13 4.41E-0S 41H8 263938 HΘ9865,N28550 1 MG 1526 ESTs
4.14 2.3ΘE-03 64J03 415503 WB0622,W78740 1 1 NDUFB32 197 NADH dθhydroBanase (ubiqulnone) 1 beta subcomplex, 3 (1i
4.14 5.50E-06 51C20 296691 W05243.N743351 1 ACTG1 179308actln, gamma 1
4.15 4.00E-04 19O02 141837 R70695,R7O694 1 I MG 124 ESTS
4.15 8.50E-06 6ΘL15 48884S AAO4S937,AA045S22 1 RHQEF57 131 Rho guaniπa nu eotWβ exchange factor (GEF) £
4.17 3.49E-07 1SP21 143060 R71332.R713331 1 LCP 14262 host cell factor homolog
4-21 S.53E-05 51L19 300438 N802B0.WO741O 1 1 CTN2 1 175 actinin, alpha 2
4.21 1.B8E-06 70N10 504991 AA1S0720.AA150609 1 1 ARPC1B7627 acliπ ralatad protein 2/3 complex, subunit 1A (41 kD)
4.21 5,246-04 33P04 234543 H78436,H7Θ23S 1 1 JWA 3616 Vitamin A responsive; cytoskelaton 'elated
4.22 3.03E-04 24P04 49281 H 15530.H15587 1 I PPIF 1036B peptldylprolyi isomerase F (CyClophHln F
4.23 1.116-05 Θ 109 331975 M06303S,AAOΘ3017 1 | FU201525201 hypothetical prøtøir
4,23 4.5B6-08 51L07 299732 N7Q981 ,Wθ68841 1 COX5A IS 274 cytochrome c oxidasa subunit Vs
4.23 9,036-04 43N20 273691 N33372,N448S32 I SNX3 6462 sorting nβxln 31 KIAA0B71 4 243 WAA0S71 proteir
4.25 7.346-05 70B23 503577 AA131237 1 1 MG 12 1 EST
4.25 3.636-05 1200 32849 R 20216,R433041 ) ATP6E 22454 ATPaSe, H+ transporting, lyso3omat (vacilolar proton pump) 31k 55 2.81 E-04 23H06 45 93 H 08475^09757 1 1 NDUFAiO 2278 NADH dehydrogenase (ubiquinαne) 1 alpha subcomplex, 10 f
4.28 2.13E-OS 29L.14 200605 R991?2,H484752 I RPL37A 21651 ribosomal protein 1.37a I MG 273 Homo sapiens cDNA F U
4.2Θ 1.42E-0B 64 13 382070 AA0631441AAOΘ2549 1 1 RTfiDN 1944 rstbindln
4.31 5,825-07 83F17 741233 AA402711,AA402312 1 1 RARA 17 170 retlnota acid receptor, hβ
4,31 2.596-05 57J09 342129 W609S1.W63731 1 I ACTN2 1 175 actinin, alpha 2
4.31 1.22E-04 21A22 151416 H03590.H03492 1 I JWA 3616 vHamin A re3ponsivs; cytoskeleton related
4.32 8.096-05 87P22 486535 M044422.AA043066 1 1 DDX1 2421 DEAD/H (Asp-βlu-Ala-Asp/Hts) box polypeptide 1 1 4.34 2.57E-06 29J08 200529 R99135.H4S435 1 1 ALDH9A1 1 273 aldehyde dehydrogenase 9 family, member A1
1 4.34 7.45E-04 92P24 809850 AA455108,AA464292 1 I GABARAPL2 16271 GABA(A) receptor-assαdated prptain-lika 2
1 4.36 3.876-05 50N2O 297780 N98534.N69932 1 1 BAS 7270 gltoblastoma amplified sequence
1 4.37 4.04E-05 2SJ16 51408 H 19440.H19439 1 1 DSCR1 L1 6 109 Down syndrome critical region gene 1 -like 1
1 4.38 2.13E-06 83F14 742542 AA401546,AA400010 1 1 CDC10777B CDC10 (cell division cycle 10, B. cerevlslaβ, homolog;
1 4.39 1-02E-07 51J06 300310 N75816.W0719521 RPS23 S 714 ribosomal protein S23 1 H2AV 7447 histone H2A.F/Z variant
1 4-39 7.14E-04 O3P08 66967 T 69549,T67553 1 1 PDUM1 10 455 POZ and UM domain 1 (elfin;
1 4.39 8.87E-04 88G04 773158 AA42540O,AA425510 1 1 HSPC051 22230 ublqulnol-cyiochrome c reductsss complex (7.2 kD
1 4.41 1.9SE-06 510000 298700 W05040.N74G7B 1 1 EIF4G2 1 1628 eukaryotic translation Initiation factor 4 gamma, _
1 4.42 8.616-08 53K10 307257 W21483.N93441 1 I HSPB3547 heat βhock-27kD protein 3
1 4.43 4.21E-05 51J05 299354 W05754,N76011 1 ATP5C1 10770 ATP synthase, H+ transporting, rηπp-hόndri'al F1 complex, g;
1 ,49 1.97E-04 5lNia 30053S N81105.W074661 1 ASAH θ 708 N-acylsphlngosiπe amidohydrolasβ (acid ceramidasB;
1 4,49 5.466-06 58O07 343916 W69956,W69955 1 1 IAA1280 X 88 KIAA1280 protein
1 4.49 2.30E-05 44H05 277131 N40923 1 1 PSMB1 6 560 proteasomβ (proso e, macropain) subunit, beta type, 1
1 4,49 5.27E-04 62F17 365072 AAθ260θθ,AA025179 1 (VDAC1 5594 VoKaga-depβήdβnt anfon channel 1
1 4.50 8.14E-07 51L04 300373 N80251.W07377 1 I PTGD5 9 523 prostaglandin D2 synthaea (21 kD, brain)
1 4,50 9.29E-0672L1 5470S6 AA085058 1 1 TPM1 15 1008 tropDmyoεin 1 (alpha'
1 4.51 1.53E-07 12A22 32726 R 43068,Ri874B 1 1 SUH 19 1569 putative translation initiation factqi
1 4.SS 4.33E-08 51K18 299100 N75434,W05155 1 1 MGC2574 11 212 hypothetical protein MGC2574
1 4-57 2.306-04 43314 271438 N31747,N424532 I RPS18 6 2030 ribosomal protein S191 DNAJC3 13236 DnaJ (Hsp40) homolo
1 4.57 2.72E-0S 43A13 270188 N40714.N27949- 1 I MG 3 28 ESTa
1 4.58 4.96E-07 67G15 470S29 AA031591,AAQ3176021 DAC2 10660 voltage-depaπdent anion channel 2 1 ARHGEFS 131 Rf
1 4.59 222E-04 25P14 51358 H 2106θ,H21O67 1 1 MG 1530 Homo sapiens mRNA full length Insert cDNA clone EUROIMAGS 515
1 4,63 3.a3E-03 53A08 306510 N91$03,W31237 1 1 NDUFAS 22281 NADH dehydrogenase (ubϊquϊnone) 1 alpha subcomplex, 6 (
1 4.68 1.42E-04 25I06 50341 H 16998,H169991 I ZFP1032 153 zlnctingBT protein homologous to Zfpl03 in moust
1 4.70 2.12E-07 88H08 774 6S AA452026ΛA429Θ21 1 1 ATP5J 21 328 ATP synthase, H+ transporting, mitochondrial FO complex
1 4.70 1.13E-05 86I06 75S084 MAO
1 4.71 3.80E-0564K03 382020 AA063071.AA0630991 I MG 17 10 ESTs
1 4.78 8.18.E-QB 33016 230106 H74288,H7428921 SUCLGt 2320 sUCClnate-CoA Bgase, GDP-forming, alpha subunit 1 MG 2 6 Ei
1 4,78 6.79E-07 50M17 295141 N7165S,W01682 1 I CS 12790 dtrata synthase
1 4.B0 6-40E-Q7 53H05 307988 W2455δ,N95281 21 MKI67 JO 324 antigen Identified by monoclonal antibody Kl-671 IPT 1 6186 tF
1 4.61 4.786-05 40O22 258822 N32413.N568331 I NGFRAP1 X 415 nerva growth (actor receptor {TNFRSF16} associated proteir
1 4.B2 1.33E-07 63K05 375531 AA026793 1 1 SLO7A10 1932 solute carrier family 7, (cationic a ino acid transporter, y+ system)
1 4.8$ 9.SSE-05 41L13 264887 N21056.N278G6 1 I FLH07073248 hypothetical protein FU10707
1 4.86 9.Q1E-06 43C23 270294 N33560.N41542 1 I FU13322 1746 hypothetical protein FU1332Σ
1 4.92 B.90E-0Θ 42K24 267820 N34061.N2552321 HBGP25L2G 5434 gp2SL2 protein I NFE2L1 17437 nudear factor terythrpid'
1 4.94 3.236-04 39M21 251479 H98011 1 1 MGC274719 634 hypothetical protein MGC274;
1 4.95 1.17E-04 44L04 277768 N46100 1 I MG 51 EST
1 4.97 6.05E-06 41I0S 263914 N23535,H99854 1 S0D1 21 759 superoxida diεmUtase l. aolublθ (aroyotrophic lateral sclerosis 1
1 4.99 7.34E-05 29L02 200579 H48453 1 I WAA1554 17 658 KIAA1S54 protein
1 4,99 Θ.10E-04 51L02 300369 N80249.W07376 1 1 DNAJBS 9 134 DnaJ (Hsp40) homotog, subfamily B, member 5
1 4-99 8.936-05 79B17 724128 AA411261,AA4111Θ6 1 I SEPW1 1θ$30 salβπeproteln W, 1
1 4.99 8.30E-07 04H15 110772 TB3147,T90$21 1 I C14orf2 14248 chromosome 14 open reading IratriB 2
1 5-03 4.5SE-07 70O1S 502705 AAl27246.AA12β528 1 1 MG 411 ESTs
1 5.03 3.45E-07 21J18 153648 R48379,R4θ27a 1 I UQCRB θ 350 ubiquinol-cytochroma c reductase binding proteir
1 5,04 7.54E-06 51M21 29Θ467 N74160 1 1 FLJ12Θ799220 hypothetical protein FLJ1287S
1 5.06 3.4OE-06 50P06 297790 W005ai,N68904 1 | RPL11 1 1085 ribosomal protein Lit
1 5.09 2.79E-06 48J09 282221 N51926 1 I ZNF-US92743 63 zinc finger protelr
1 5.10 9.266-05 57J10 342880 W67767,W6776β 1 1 PSAP 102308 prosapoεiπ (variant Gauchβr disease and variant rrtelachromε
1 5-12 9.40E-07 29L20 200667 R99259,R990$221 K1AA185Θ 7779 K1AA1B58 protein I PMP24204924 Da intrinsic membrane
1 5.13 1.6ΘE-0B 56P05 327776 W35270.W23S92 1 1 FJF2C1 1 136 eukaryotic translation initiation factor 2C, 1
1 5.18 5-33E-05 43B03 271961 N31927.N42763 1 I PTGER4 581 prostaglandin E receptor 4 (aubtype EP4)
1 5.22 7.506-04 36M14 21230 M A O
1 5.25 3.87E-04 41A15 261781 H991S0,N244δ3 1 1 FKP2 12 168 plakophiliή 2
1 5.32 7.64E-04 67K21 470764 AA031840rAA 31797 1' I PAM 5377 peptidyigtycina alpha-amldaϋng monooxygenast
1 5.34 Ϊ-21E-05 51K13 2Θ62Θ8 N7046e,W03830 1 1 SDHB 1 201 εucdnate dehydrogenase complex, subunit B, iron sulfur (lp;
1 6,36 5.03E-05 40L21 25S601 N29771,N57190 1 I HSXQ280FIF X 114 Xq28. 2000bp sequence contg, ORF
1 5.36 1.39E-06 51L08 300402 W0747B 1 1 SMPX X 47 small mυsda protein, X-flnked
1 5.33 1.55E-05 50N04 297722 N98B89,N$98SB 1 1 MG 17 132 Homo sapiens, Similar to sperrnidins spermlne N1-acβtyi transfers
1 5.41 3.206-04 24N01 4791 H 11506.H118662 I FLJ205465 119 hypothetical protein F 20S461 DON 12 1093 decorif
1 5.43 2.39E-04 44P05 277375 N47657,N5751221 MG 62 ESTs, Weakly SimllartO T42689 hypothetical protein DKFZp434J1027
1 5,43 6.40E-07 85021 7S4478 AA410312 A41053 1 1 GJA1 637B gap Junction protein, alpha 1, 43KD (connexin 3;
1 5.43 3.14E-04 05G24 113701 T79713.T7S62Θ 21 SBF1 22260 SET binding factor 1 I MG 22 1 EST, Weakly similar to nuclear di
1 5.44 5.57E-0S 41G22 263881 N28523.H99844 1 I DKFZP664K24712 1232 DKF2PSS4K247 proteir
1 5.43 4.29E-05 34B20 44957 M A O
1 5.50 1.O3E-07 3ON22 205884 H58691,H58301 21 PGK1 X 1375 phoaphoglycerate kinase 1 1 STRBP 9 127 εpermaik) perinuclet
1 5.50 7.47E-06 Θ6B10 759827 AA423910,AA423845 1 I COXS 11 471 cytochrome c oxidase Subunit VII
1 5.51 9.68E-05 41121 2Θ2375 N26357.H99234 1 1 GS37B6 7263 predicted osteoblasl protelr
1 5.58 2.53E-05 42017 267201 N23977.N31678 1 1 PP.DX3 10 1213 psroxlredoxin -
1 5.53 6.08E-04 fSOKlO 295B13 N74591.W02S29 1 1 ZASP 10 132Z-band alternatively spliced PDZ-rήotrl
1 5.SB 2.48E-07 53N11 30B18Θ W24S82,N92387 1 I MG 7400 ESTs, Weakly Similar to SFR4_HUMAN SPUCING FACTOR, ARG
1 5.74 1.1ΘE- S6M05 324735 W472S0.W47152 1 1 MGC5338 1 41 hypothetical protein MGC5336
1 5.76 4-26E-04 88G17 486747 AA044614,AA042802 1 ) APR-32303 apoptoais related protein APR-2
1 5.77 5.106-08 53018 307552 W21087.N952462 I E FiAi 6 19927 eukaryoBe translation elongation lactor l alpha 1 I MGC130
1 5.7B 3.80E-O7 4BB05 289933 N79937.N64610 1 1TPT1 134570 tumor protein, tranalationally-controlled 1
1 5.79 2.60E-11 87B13 472109 AA057351-AA0966381 1 FABP3 1 108 fatty add binding protain 3, muscle and heart (mammary-^ i 5.83 2.41E-0S 24O08 47558 H 11901,H11902 1 1ATP11 1 273 hypothetical protein FU223S1
1 5.94 7.57E-07 1BL05 138649 R63eβ6,R62731 1 I MGC5363 1466 hypothetical protein MGC53S1
1 5.97 1.41E-09 SOA14 295409 N70363.W0500S 1 I FEN1 11 310 flap structure-spedflc eπdonudeaββ 1
1 6.00 9.79E-07 56L10 329059 W43028,W4478a 1 I RAP1 16384 YRF2-lπt.βracl g telomerlc RAP1 protein 5.0Θ. 2.32B04 41G16 263860 H9Θ77Θ,N28507 1 I MG 1 189 Homo saplenB cDNA FU20750 Ba, clone HEP05174
6.0Θ 2,36£O6 21D1S 152834 R49848,R4984 1 1 NDUFB27183 NADH dBhydrogenasa (ubiqulnone) 1 beta subcomplex, 2 (8W
6.08 8.12E-06 68B09 483196 AAO5729OM058735 1 I C0X6C 8 379 cytochrome c oxidase subunit Vlς
8.10 7,33E-C6 79L08 725934 AA394039 1 1 MG 978 ESTs
5.21 1.D4E-04 38C03 245197 N54477,N7β5Sa 1 1 PRDX2 19705 perow'redoxiπ .
6-23 2.19EO5 S6J02 32BB48 W45271.W40425 1 I ]LB 418 |nterteukin 8
S.35 3.16E.-04 S8G10 3442Θ3 W69968.W701181 1 PGM1 1 262 pho≤phoglucomutasa 1
659 7.1SE-06 71G03 505295 AA152029,AA1S2103 1 I NDUFAB1 18270 NADH dehydrogβnaes (ubiqulnone) 1, alpha/beta sut>
6.33 8.76E-C6 51018 3B2245 AA0011Θ5,AAOOH29 1 I MG β 5 ESTs
6.43 1.HE-05 0SB08 114532 T7871 1 I MG 4 11 ESTS
8,47 6J31E-07 88P01 773869 AA427605 1 1 MYBPC3 \ 1 44 rnyoεin-blndlng protein C, cardiac
B.S0 1.92E-06 S3P13 30B273 W24825.N9380821 BPNT1 1 873'(21), 5,-bisphosphate nuclaotidase 1 I MG MO 466STs, eaWj
6.51 1.65E-08 29A22 193619 R92931,R92Θ30 1 I PGK1 X 1375 phosphogrycerate kinase 1
Θ.63 6.72E-06 24115 46S83 H 09969,H0Θfl63 1 I G T2 IS 680 glutamlc-oxaloacatic transaml aaθ 2, mitochondrial (aεpartate anr
6.58 1.79E-06 57D10 342614 W68761,W6Sel5 1 I CSRP3 11 1l2cysteirls and glydπe-rich protein 3 (cardiac UM protein,' β.79 2.13E- S 32A0B 213969 H72Θ34,H72388 1 1 ACQX1 17210 aeyl-CoerβymB A oxidase 1, palmitoy
6.32 1 J59E-08 04P20 112335 T85727,T90822 1 I NDUF 9 B 3B0 NADH dehydrogenase (ubiquiπonB) 1 beta subcomplex, 9 (22I-
6-01 4.62E-0S 25M15 49820 H 29180.H29179 1 1 PDE4DIP 412 phosphodiesterase 4D interacting protein (rπyorήegalin;
6.93 1.64E-05 8SJ22 760183 AA424418,AA424460 1 I DKK3 H 25l dickkOpf (Xenopus laevis) homolog 2
7.11 7.51E-04 31A20 207554 H60212.H60171 1 1 ELC29A1 6289 Solute carrier family 29 (nudeosida transporters), mambsrl 7.13 9.33E-11 59A07 345876 W720201 1 MG 10 1 EST
7.24 B.02E-08 80J09 3S9B72 AA011336,AA010729 1 I QP-C 5457 tow molecular mass ubiquinone-bindlng protein (9.5k ;
7.35 5.2BE-09 57D16 342658 W6B785,W88692 1 I CASQ2 1 54 calsequβstriή 2 (cardiac muscle)
7.36 4.76E-05 70D11 503301 AA131302.AA13154521 MG 12 14 ESTs I MG 12 ESTε 7.42 4.85E-07 29018 198038 R9460Θ.R9424S 1 I WAA16Θ7 C 190 IAA18B7 proteir
7.49 7.44E-04 59D24 35B934 W92820.W927381 I MG 1 169 Homo sapiens, Similar to complement component 1 , q subcompoπ
7.52 1.25E-05 67HQ8 4ΘΘ 0 AA040715,AA040714 1 I DUFAl X 270 NADH dehydrogenase (ublquinoπθ) 1 alpha subcomplex 7.S6 3.72E-10 19H05 142S 1 R70135,R701361 1 ATPSO 21 487 ATP synthaae, H+ transporting, mitochondrial F1 complex, O a
7.59 2.33E-05 56J17 32483$ W46933.W4883S 1 f FHL22206 four and a half LIM domains 2
7.82 S.24E-09 88J20 774364 AA430209,AA44S9541 I UM 4292 LIM protein (similar to ral protein WπaSΘ C-blndlng anigma'
7.6S 5.91 E-03 35F13 56698 M O
7.89 1-75E-08 62N14 3663 1 AA025679,AA0256781 I CKMT2587 eroallne Wnaae. mitochondrlai 2 (saroomefk
7.75 2.49E-0B 12H02 33880 R 24318.R449131 I HCS 7 1891 cytochrome c
7.95 1.29E-04 61P03 382B51 AA019457,AA019459 1 1 PGK1 1375 phosphoglycerate Wπaεβ 1
7.96 2.93E-04 23M18 44565 H 05446,H069931 I RYR2 1 65 ryanodiπe receptor 2 fcaπSae' 8,04 1. 0E-05 1ΘN04 138930 R84171.R642B61 I LOC616606233 HSPC040 protein 6.06 1.Θ3E-09 79L 1 724840 MAO
8.25 3.80E-09 48N0Θ 291 02 W00344,N720β62 I MG 227 ESTs, Highly similar to RPC1_HUMAN DNA-DIRECTED RNA POL't 8.27 1.6SE-OS 44C23 274333 MAO
8.30 3.24E-09 66F10 469654 AA0279541 1 MG 383 Homo sapiens mRNA for KIAA1190 protein, partial eds
8.41 1.19E-08 8ΘL20 782835 AA4485S3M447S69 1 I NDUFAB1 16270 NADH dehydroganase ( biqulnone) 1, alpha/beta sub,
8.50 1.11E-04 43001 270Θ75 N32965,N42649 1 I ATP2A2 12682 ATPase, Ca++ traπεporti'ng. cardiac muscle, slow twitch 2 8-66 2.256-05 35J19 57090 M AO
9.03 1.8ΘE-06 04D04 111440 T83204,T9θ757 1 I ARPC5 1 504 actin related protein 2/3 complex, subunit 5 (16 kD)
9-13 4.79E-07 63022 376885 AA047654 1 1 ATP5B 12 1185 ATP synrhase, H+ transporting, mitochondrial F1 complex, beta ot
9.20 3.27E-07 5ΘO0S 344560 W73663,W73β1« 1 I DLB 17231 low density lipoprotein racsptor defect B cαmplementlπc
9.41 1.27E-06 53015 307796 N93064,W24717 1 I AGA 4 105 aεpaπytalucosarninidasβ
9.68 2.75E-09 e6NQ9 773771 AA427940,AA434eSΘ 1 1 PLN 8308 phosphotamban
9.73 1.33E-06 S3B13 307667 W21430.N929121 I MYL33314 myosftl, light potypeptidB 3, alkali; ventricular, skeletal, alow
9.93 1.46E-05 B.5E+24 754224 AA473604,AA4789242>l CKM 19 3S9 creatfne kinase, musde I MARKL1 19699 MAP/miCTOtUbuls
9.98 4.B0E-0742122 267717 N32656.N2319 1 I SLG2SA312 1703 solulβ carter family 25 (milcύhondrtel carrier; phosphate «
The majority of the differentially expressed cDNA clones represent genes involved in the oxidative phosphorylation in mitochondria or sarcomeric/cytoskeletal components. A few others are implicated in calcium cycling or cell energy metabolism (e.g. phospholamban, calsarcin-1, fatty acid binding protein 3, creatine kinase, succinate dehydrogenase) . Interestingly, also genes related to immune interactions and apoptosis (CD81, interleukin 1 receptor like protein, beclin, apoptosis related protein 3) were found.
To validate the cDNA array results, two independent RT-PCR- based protocols were used. By this method 14 genes, all of which showed regulation ratios similar to those obtained by the cDNA array method (Figure 1) could be validated. These results could be confirmed for 10 genes using real-time PCR and Sybergreen. Altogether, not only highly expressed genes (e.g. skeletal and cardiac actin, myosin light chain 2), but also those producing relatively low signal intensities on the arrays were validated (e.g. requiem, GDP dissociation inhibitor 1, lipoprotein lipase and CD81) .
Example 3: Clustering gene expression patterns
To visualise gene expression patterns from large data sets the widely recognised hierarchical clustering algorithm CLUSTER was employed (Eisen, 1998) . The mean regulation ratios of the 655 differentially expressed cDNAs were log-transformed and global expression trends related to each- DCM patient were obtained. A graphical representation of the resulting gene clusters is depicted in Figure 2. Some gene clusters displayed strong upregulation in all ten patients. These clusters mainly contained genes involved in cellular metabolism (ATP synthesis, TCA cycle) , sarcomere components and proteins involved in force transmission. Example 4 : Functional clusters
Many of the genes showing differential expression in the experiments have been functionally annotated. Based on the published scheme (Hwang et al., Circulation 9j5 (1997), 4146) they were grouped into 7 functional categories. The composition of the functional categories was as follows: protein expression: 6,5% (43 genes), gene expression: 6,5% (43 genes), metabolism: 18,2% (119 genes), cell signalling/communication: 12,2% (79 genes), cell/organism defence: 2,4% (16 genes), cell cycle: 2,3% (15 genes), cell structure/ otility: 6,7% (44 genes). From the 655 differentially expressed genes 45,2% (296 genes) represent ESTs or genes with no defined function.
To analyse the gene expression patterns from a functional point of view, groups were hierarchically clustered using the CLUSTER programme. The three largest categories consisted of genes involved in metabolism, cell structure/motility and cell signalling/communication (Figure 3) . Sarcomere components, e.g. several actin isoforms, gelsolin, dystrophin, and titin were strongly upregulated in DCM samples. The same was the case concerning genes involved in linkage of the sarcomere to the cytoskeleton and the extracellular matrix or genes involved in force transmission and signalling, e.g. yomesin, a-actinin, filamin, plakoglobin, small muscle protein, and actin-binding LIM protein (Figure 3) .
The types of proteins differentially expressed in DCM tissues and potentially involved in the pathogenesis of DCM are additionally shown in Table 3. These include several proteins involved in Z-disc formation, sarcomere stabilisation and muscle-cell signalling (Table 3A) . Some of these were common to all DCM-samples (e.g. cardiac alpha actin, troponin and dystrophin, Table 2) . It is reasonable to speculate that among these differentially expressed genes, some may represent new valuable candidates for genetic studies. The failure of cell-survival pathways to inhibit myocyte apoptosis is a critical step in the initiation of dilation and heart failure. Several genes involved in the balance between apoptotic signals and cell survival have been identified: gpl30, calcineurin, Gq and the itogen activated protein kinases p38 a, b, JNK and TAK. Although these genes could not be detected as differentially expressed in the approach described above, several other genes could be identified, which might participate in these signalling events (Table 3B) . In addition to apoptosis, also the calcineurin-mediated hypertrophic gene programme and the dysregulation of calcium cycling have been implicated in DCM pathology. Several genes involved in either of these processes were identified in this study (Table 3C) .
It is reasonable to assume that genes exhibiting a concerted regulation in all DCM samples might directly be involved in the pathogenesis of DCM. Among the known genes phospholamban, cardiac actin, FGF receptor 4, integrin beta 8 and gelsolin were found to be upregulated in all patients samples. Several ESTs were also identified in this context. These may therefore represent new valuable candidates as diagnostic and therapeutic targets.
Example 5: Extended studies on monitoring the progression of dilated cardiomyopathy by gene expression profiling using cardiac biopsies
The experiments shown in Examples 1 to 4, above were extended. In summary, a genome-wide screen of clinically stable DCM patients was performed using a normalised human UniGene library containing 34,176 cDNA clones. When comparing normal and DCM samples, global changes in gene expression involving thousands of transcripts were observed. By setting stringent selection criteria 655 differentially expressed cDNA clones were identified with a false discovery rate <0.001. Several genes and ESTs were identified representing known and novel DCM-associated transcripts. 70% of them were found to be upregulated and involved in cardiomyocyte energetics, muscle contraction and signaling. Many transcripts (222) could be grouped according to their functional annotation and arranged into clusters putatively correlating with the clinical parameters associated to disease progression. Since they indicate global changes in lipid metabolism, calmodulin- related cell signaling and apoptosis, these processes may be essential for dilative remodelling and DCM progression.
(A) Gene expression analysis in human DCM
For gene expression profiling biopsies from 10 stable and well-characterised idiopathic DCM patients were collected. Several clinical parameters were measured as an indication of different degrees of disease severity: NYHA (New York Heart Association) class, ejection fraction, fraction shortening and left ventricular end-diastolic dimension. The percentages of deviation from the normal values were calculated and summed as Disease Index' . The patients were ordered in ascending order reflecting the progression of DCM (Table 5) .
Table 5
Figure imgf000041_0001
Figure imgf000042_0001
All amplified DCM and control RNA samples showed the required concentration, size-range and integrity after amplification. In addition, the linearity and reproducibility of the T7 amplification protocol was assessed and the gene expression profiles obtained using total versus amplified RNA from two different human cell lines were compared. Adequate levels of reproducibility and linearity of the amplification protocol were found in the experiments, which agrees with previous reports using similar protocols (Wang et al., Nature Biotechnology 3J3 (2000), 457-9).
To measure differences in gene expression between DCM and normal tissues, cDNA arrays carrying the Unigene set 1 (UniGene 950 RZPDl, http://www.rzpd.de) were used. 34,176 cDNA clones were PCR-amplified using vector-specific primers and single-spotted onto two nylon membranes. 3,840 overlapping clones between both arrays provided internal controls for the reproducibility and the experimental variation. Radioactively labelled cDNA probes prepared from each patient's and pooled control aRNAs were hybridised in parallel onto arrays from the same batch. Each hybridisation was performed twice using independently labelled cDNA targets from the same aRNA sample. In total 20 DCM and 10 control arrays were hybridised, resulting in 20 independent gene expression comparisons (Figure 4) . For each of the 10 patients the mean expression ratio for each gene was calculated.
(B) Selection of differentially expressed genes The expected number of differentially expressed genes was calculated by comparing the distribution of the expression data to distributions obtained by randomly permuting the class labels (DCM vs. controls) . Global changes in gene expression levels between control hearts and DCM biopsies were observed. An expected 56% of the expressed genes an the array were found to be either up- or down-regulated. In other words, about 56% of the genes must be induced to explain the differences in the distribution of the original sample and the permutated samples .
This is a global comparison, which does not imply that 56% of the genes were identified to be significantly up- or down- regulated. This is more difficult, since the "gray zone" is large. Very stringent criteria were used to produce a much smaller- list of transcripts that are believed are significantly up- or down-regulated: The criteria used insure that the transcript is present (signal/background ratio >3) , that there is a sufficiently high fold change in expression
(>3) and a sufficiently high absolute change measured by the p-value of a gene wise t-test (p<0.001) . Applied to the data from 10 DCM patients, this stringent procedure yielded 655
(about 1.9%) differentially expressed genes, from which 459 were up-regulated and 196 downregulated. To verify that the criteria chosen were stringent enough, and that it could be safely assumed that the majority of the transcripts in this list are genuinely differentially expressed, the false discovery rate of each transcript was calculated using the permutation approach outlined in Tusher et al., PNAS 98
(2001), 5116-5121. This yielded a false discovery rate off 0.0006 after 2000 permutations, which is equivalent to an expectation of about 2 artifacts in this list. The approach used is a minor modification of the widely used SAM-Programme
(Tusher et al., 2001), accounting for the characteristics of expression data from nylon membranes. A detailed description of the statistical analysis is given in Example 1. The 655 differentially expressed genes were resequenced, and after excluding redundant clones representing the same gene and clones with incorrect annotation, a list of 364 differentially expressed transcripts was assembled. From these 144 represent ESTs and therefore putative novel (i.e. not related to the disease so far) transcripts associated to DCM (the table containing ESTs is shown below as Table 6A) . To annotate these ESTs, they were blasted against several public databases: human ensembl, unigene (human, mouse and rat) , and swplus (swissprot plus trembl) and human dbest. 118 showed high BLAST scores (<10e-10) (see Table 6B) r and approximately 50% of these were found in the human Ensembl gene collection, providing additional information, e.g. locus, disease information, gene ontology etc.
(C) Validation of array data by real time quantitative PCR
Using real time quantitative PCR (Q-PCR) the expression levels of 23 genes in pooled DCM and control samples, respectively, were determined. Primarily genes were chosen which showed deregulation in the present study (Z-band alternatively spliced protein, enigma, CD81, small muscle protein; see Table 6) . The differential expression observed was confirmed for all genes tested. Subsequently, several other transcripts were tested, that although differentially regulated, were not included in the initial list due to the stringent selection criteria. These represent interesting candidate genes involved in essential cardiomyocyte cell processes (requiem, four-and- half domain protein 1 and 2) . As before, similar regulation ratios as in the array approach (Figure 10A) could be confirmed. Not only genes with remarkably high expression levels were validated (e.g. skeletal and cardiac actin, myosin light chain 2), but also those producing low signal intensities an the arrays (e.g. requiem, GDP dissociation inhibitor 1, lipoprotein lipase and CD81) indicating effective sensitivity of our array approach. As positive controls, genes already reported to be deregulated in DCM (cardiac troponin, myosin) were selected. For these, similar expression levels were observed. As an additional validation of the array data and analysis, real time Q-PCR measurements an MLP knockout mice were performed. These mice exhibit a disruption of the cardiac cytoarchitecture and represent a well-established model for DCM and heart failure. Using total RNA from MLP-deficient and wild type animals, differential regulation of the selected transcripts was further confirmed (Figure 10B) .
(D) DCM expression patterns
From 364 differentially expressed transcripts in the list, a functional annotation (Gene Ontology) was found for 222 genes. These genes were classified into cell process categories using the nomenclature of the Gene Ontology Consortium. The classification was mainly based an the information available in Gene Cards (http : //bioinfo .weizmann. ac . iI/cards/index . html) and in the Celera Discovery System (http://cds.celera.com). This allowed a global view an cellular processes deregulated in human DCM heart (Figure 11) .
As expected the largest group of genes consistently upregulated in DCM were those involved in general cell energetics: energy pathways (glycolysis, TCA cycle, ATP synthesis), electron transport and lipid metabolism (fatty acid oxidation, lipid hydrolysis) . Similar degree of up- regulation was also observed for genes contained in the "muscle contraction" group, e.g. cytoskeletal components and several proteins involved in the regulation of calcium oscillations. Processes within the "cell communication" group were also activated: intracellular signalling and Gell adhesion.
Cellular responses like activation of energy production and enhanced assembly of the contractile apparatus lead to an initial improvement of heart contractility and function. These compensatory responses are however followed by processes known to deteriorate cell and organ function. Accordingly, up- regulation of several genes related to apoptosis was observed (voltage dependent anion channel 1 and 2, prostaglandin synthase D, kallikrein 11) and defense response (major histocompatibility complex I A, complement 1Q, peroxiredoxin 1, 3 and 5, annexin) , with a simultaneous inhibition of several cell-cycle control genes (PIG7, DMTF1, CDK5R1) . A detailed table containing 222 genes with their Gene Ontology annotation is shown Table 6C.
(E) Exploring expression patterns of genes involved in specific cellular processes
To gain an insight into the cellular processes related to the progression of DCM, the expression patterns were clustered according to disease severity. The log-transformed expression levels of each patients profile are displayed in the standard red / green color coding (Figure 12A; further gene clusters of cell processes are shown in Figure 12B) . Cellular energetics and muscle contraction appear to be the major processes activated in human DCM showing strong upregulation in all 10 patients. The largest number of up-regulated genes is found in the "energy pathways" group: enzymes involved in glycolysis (P-fruktokinase, triose isomerase, P-glycerate kinase) and in the TCA cycle (succinate dehydrogenase units, succinate CoA lipase) , and numerous proteins involved in oxidative phosphorylation. Likewise overexpression of various mitochondrial carriers was observed: SLC25A4, SLC25A1, SLC25A11.
The "lipid metabolism" group contained genes involved in lipid degradation and fatty acid catabolism: lipoprotein lipase, fatty acid binding protein, acyl CoA isomerase, CoA reductase etc. Strikingly, a gradual increase in expression levels of almost all transcripts was observed in this group correlating with the progression of DCM.
Calcium flux disregulation has been for a long time speculated to play a pivotal role in DCM pathology. In the "muscle contraction group", apart from known genes like calmodulin or phospholamban, several others related to calcium homeostasis were found. Calumenin, which may participate in the immunological defence system, and could be involved in the pathological process of amyloid deposits formation seen in different types of tissues is also upregulated. These findings add further evidence to the involvement of amyloidosis in the aetiology of cardiomyopathy. Calsarcin, a member of the novel calcineurin interacting protein family, has been shown to interact with the Z-disc protein a-actinin linking the calcineurin signalling pathway with the contractie apparatus. Interestingly, gene profiles of certain genes (calmodulin 1 and 2, myomesin, calumenin, protein kinase Hll, and small muscle protein) show a progressive increase in expression levels, and may therefore be directly associated with the development of DCM.
Members of the LIM protein family have been shown to be essential for the formation and maintenance of the Z-disc structure and function - i.e. the key structure for sarcomere integrity and ventricular dilation. One of them, enigma, was shown to interact with some sarcomeric components as well as with tyrosine kinase receptors, it is therefore reasonable to speculate that enigma might be a convergence point between the sarcomere and signaling pathways, being involved in conveying mechanical stress into mechanisms responsible for ventricular dilation. Other lim-domain family members were found in the present study: four and a half lim domain protein 1, actin associated lim protein and Z-band alternatively spliced PDZ motif (ZASP) , representing further putative DCM-associated candidate genes. Intriguing is also snαpx, a novel stretch- responsive protein, which has been shown to regulate transcription and myocyte muscle hypertrophy. An important component of the hypertrophic gene program is the calcineurin- mediated signaling pathway. Several genes related to this cascade were included in the "intracellular signaling" group: e.g. GDP dissociation inhibitor 1, RAB 35 and novel gene calsarcin.
Since cell death has been speculated to play a significant role in heart failure, the observed increase in expression levels of apoptosis-related genes may help to confirm this hypothesis. Several profiles of pro-apoptotic genes correlate with disease progression: small edrk-rich factor 2, voltage- dependent anion channel 1 and 2, kallikrein 11 and prostaglandin D2 synthase. On the other hand genes controlling cell cycle were down-regulated in DCM patients: anaphase- promoting complex subunit 7, cyclin-dependent kinase 5, cyclin D binding myb-like transcription factor 1 and fms-related tyrosine kinase 1.
Supplementary material
A) ESTs differentially regulated in DCM. 144 ESTs are ordered by regulation ratio. RZPD accession and clone numbers are presented. +/- up or down-regulation.
Figure imgf000049_0001
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
B). ESTs Blast results. For each clone hits with high score in several databases are presehted. Results are ordered by RZPD clone number
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
C) 222 differentially expressed genes with GO annotation. Clones are ordered by Cell process. Colours represent primary GO cell processes: Cell communication, Cell growth and maintenance, Developmental processes. +/- up or down regulation, Reg - regulation ratio.
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001

Claims

What Is Claimed Is:
1. A diagnostic composition comprising at least one nucleic acid molecule which (a) each comprises a gene listed in Table 2, Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) is capable of specifically hybridizing to the mRNA of at least one gene listed in Table 2 , Table 4, Table 6A or Table 6C.
2. The diagnostic composition of claim 1 comprising at least 50 nucleic acid molecules which (a) each comprises a gene listed in Table 2 , Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 50 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
3. The diagnostic composition of claim 2 comprising at least 150 nucleic acid molecules which (a) each comprises a gene listed in Table 2 , Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 150 genes listed in Table 2, Table 4, Table 6A and/or Table 6C.
4. The diagnostic composition of claim 3 comprising at least 300 nucleic acid molecules which (a) each comprises a gene listed in Table 2 , Table 4, Table 6A and/or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of at least 300 genes listed in Table 2 , Table 4, Table 6A and/or Table 6C.
5. The diagnostic composition of claim 1 comprising 40 nucleic acid molecules which (a) each comprises a gene listed in Table 2 or Table 6C or a fragment thereof or (b) are capable of specifically hybridizing to the mRNAs of the genes listed in Table 2.
6. The diagnostic composition of any one of claims 1 to 5, wherein the nucleic acid molecules are bound to a solid support.
7. The diagnostic composition of claim 6, wherein the solid support is a microarray.
8. The diagnostic composition of any one of claims 1 to 7, wherein the nucleic acid molecule has a length of 16 to 25 nucleotides.
9. A method for diagnosing a cardiopathy or a disposition to a cardiopathy comprising contacting a target sample with (a) nucleic molecule (s) as defined in any one of claims 1 to 8 and comparing the concentration of individual mRNA(s) with the concentration of the corresponding mRNA(s) from at least one healthy donor.
10. Use of (a) nucleic acid molecule (s) as defined in any one of claims 1 to 8 for the preparation of a diagnostic composition for the diagnosis of a cardiopathy or a disposition to a cardiopathy.
11. Use of (a) nucleic acid molecule (s) as defined in any one of claims 1 to 8 for the isolation or development of a compound useful for therapy or prevention of a cardiopathy.
12. Method according to claim 9 or use according to claim 10 or 11, wherein the cardiopathy is a cardiomyopathy.
13. Method or use according to claim 12, wherein the cardiomyopathy is dilated cardiomyopathy (DCM) .
PCT/EP2002/012522 2001-11-09 2002-11-08 Novel markers for cardiopathies Ceased WO2003040407A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP01126800 2001-11-09
EP01126800.0 2001-11-09

Publications (2)

Publication Number Publication Date
WO2003040407A2 true WO2003040407A2 (en) 2003-05-15
WO2003040407A3 WO2003040407A3 (en) 2004-03-04

Family

ID=8179210

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/012522 Ceased WO2003040407A2 (en) 2001-11-09 2002-11-08 Novel markers for cardiopathies

Country Status (1)

Country Link
WO (1) WO2003040407A2 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008053358A3 (en) * 2006-07-25 2008-11-20 Deutsches Krebsforsch A common gene expression signature in dilated cardiomyopathy
WO2009036976A1 (en) * 2007-09-18 2009-03-26 Helmholtz Zentrum München-Deutsches Forschungszentrum Für Gesundheit Und Umwelt (Gmbh) Use of the human photomedin-2 / olfactomedin-like 2b gene (olfml2b), its gene variants and its protein for diagnostic and therapeutic approaches to heart diseases
US7608458B2 (en) 2004-02-05 2009-10-27 Medtronic, Inc. Identifying patients at risk for life threatening arrhythmias
US7622303B2 (en) 2004-02-05 2009-11-24 Medtronic, Inc. Methods for identifying patients at risk for life threatening arrhythmias
US8027791B2 (en) 2004-06-23 2011-09-27 Medtronic, Inc. Self-improving classification system
US8335652B2 (en) 2004-06-23 2012-12-18 Yougene Corp. Self-improving identification method
CN113621698A (en) * 2021-08-08 2021-11-09 华中科技大学同济医学院附属协和医院 FLNC gene mutants and their applications

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2292046C2 (en) * 2005-04-04 2007-01-20 Государственное образовательное учреждение высшего профессионального образования Санкт-Петербургская государственная академия физической культуры им. П.Ф. Лесгафта Diagnosis of stress cardiomyopathy

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6063576A (en) * 1998-06-29 2000-05-16 University Of Utah Research Foundation Actin mutations in dilated cardiomyopathy, a heritable form of heart failure
US6201168B1 (en) * 1999-08-20 2001-03-13 University Of Iowa Research Foundation Pathogenesis of cardiomyopathy
AU2001241707A1 (en) * 2000-02-24 2001-09-03 Gene Logic, Inc. Identification of a cdna associated with ventricular function in human myocardial tissue

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7608458B2 (en) 2004-02-05 2009-10-27 Medtronic, Inc. Identifying patients at risk for life threatening arrhythmias
US7622303B2 (en) 2004-02-05 2009-11-24 Medtronic, Inc. Methods for identifying patients at risk for life threatening arrhythmias
US8027791B2 (en) 2004-06-23 2011-09-27 Medtronic, Inc. Self-improving classification system
US8335652B2 (en) 2004-06-23 2012-12-18 Yougene Corp. Self-improving identification method
WO2008053358A3 (en) * 2006-07-25 2008-11-20 Deutsches Krebsforsch A common gene expression signature in dilated cardiomyopathy
WO2009036976A1 (en) * 2007-09-18 2009-03-26 Helmholtz Zentrum München-Deutsches Forschungszentrum Für Gesundheit Und Umwelt (Gmbh) Use of the human photomedin-2 / olfactomedin-like 2b gene (olfml2b), its gene variants and its protein for diagnostic and therapeutic approaches to heart diseases
CN113621698A (en) * 2021-08-08 2021-11-09 华中科技大学同济医学院附属协和医院 FLNC gene mutants and their applications

Also Published As

Publication number Publication date
WO2003040407A3 (en) 2004-03-04

Similar Documents

Publication Publication Date Title
US11591655B2 (en) Diagnostic transcriptomic biomarkers in inflammatory cardiomyopathies
US20060246436A1 (en) Method for judging sensibility to imatinib
US10131948B2 (en) Transcriptomic biomarkers for individual risk assessment in new onset heart failure
US20090258002A1 (en) Biomarkers for Tissue Status
US20050202421A1 (en) Method for diagnosis and treatment of rheumatoid arthritis
US20210302437A1 (en) Transcriptomic biomarker of myocarditis
KR20110020853A (en) Diagnosis of Renal Allograft Rejection Using Gene or Protein Expression Profiles
US20120172251A1 (en) Methods and compositions for diagnosing heart failure
KR20110057188A (en) Biomarker Profile Measurement System and Method
US20140213638A1 (en) Compositions and Biomarkers for Heart Disease, Injury and Failure and Methods of Use
EP1592811A2 (en) Methods for monitoring drug activities in vivo
WO2008124428A1 (en) Blood biomarkers for mood disorders
Thompson et al. Identification and confirmation of a module of coexpressed genes
CN101180407A (en) Leukemia disease gene and use thereof
US20060019272A1 (en) Diagnosis of disease and monitoring of therapy using gene expression analysis of peripheral blood cells
WO2006034356A2 (en) Cardiac pressure overload associated genes
Dai et al. Core transcriptional networks in Williams syndrome: IGF1-PI3K-AKT-mTOR, MAPK and actin signaling at the synapse echo autism
EP2643477A2 (en) Multimarker panel
WO2005074540A2 (en) Novel predictors of transplant rejection determined by peripheral blood gene-expression profiling
US20050123966A1 (en) Diagnostic and prognostic methods and compositions for seizure- and plasticity-related disorders
US20130040846A1 (en) Signatures for Kidney Aging
WO2008053358A2 (en) A common gene expression signature in dilated cardiomyopathy
WO2006132983A2 (en) Differential expression of molecules associated with vascular disease risk
AU2014259525B2 (en) A transcriptomic biomarker of myocarditis
HK1107709A1 (en) Association of protein polymorphisms with coronary heart disease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP