CN113621698A

CN113621698A - FLNC gene mutant and application thereof

Info

Publication number: CN113621698A
Application number: CN202110905147.5A
Authority: CN
Inventors: 程翔; 查灵凤; 董江涛
Original assignee: Tongji Medical College of Huazhong University of Science and Technology
Current assignee: Tongji Medical College of Huazhong University of Science and Technology; Union Hospital Tongji Medical College Huazhong University of Science and Technology
Priority date: 2021-08-08
Filing date: 2021-08-08
Publication date: 2021-11-09

Abstract

The invention belongs to the technical field of genes, and discloses an FLNC gene mutant and application thereof. Specifically, a nucleic acid having a fragment of interest with a c.6451g > a mutation compared to the wild type FLNC gene; preferably, the nucleic acid is DNA; a polypeptide having a p.G2151S mutation compared to wild type FLNC; a gene mutation, the mutant gene having a c.6451g > a mutation compared to the wild-type FLNC gene; the application of the mutation inhibitor in preparing the medicament for preventing and treating the restrictive cardiomyopathy; the medicine for preventing and treating cardiomyopathy comprises a gene vector, wherein the gene vector contains a gene segment which can replace mononucleotide A at a c.6451 site of an FLNC gene with mononucleotide G and express the mononucleotide G, and preferably, the cardiomyopathy is restrictive cardiomyopathy. The FLNC mutation is related to the restrictive cardiomyopathy, and the knowledge of the genetic etiology of the restrictive cardiomyopathy is widened by the discovery in the research; provides a new diagnosis mode for cardiomyopathy, especially restrictive cardiomyopathy, and also provides a new way for preventing and treating cardiomyopathy.

Description

FLNC gene mutant and application thereof

Technical Field

The invention belongs to the technical field of genes, and particularly relates to an FLNC gene mutant and application thereof.

Background

Restrictive Cardiomyopathy (RCM) is a type of cardiomyopathy characterized primarily by restricted diastolic dysfunction, in which the diastolic filling of the ventricles is often restricted; RCM characteristics include expanded double chamber, normal wall thickness, often manifested as symptoms and signs of heart failure, the diagnosis of which lacks well-recognized standards, needs to be combined with clinical manifestations, comprehensive diagnosis of imaging examination, echocardiogram and cardiac nuclear magnetic resonance as important auxiliary examinations. Restrictive cardiomyopathy is mostly secondary to systemic diseases, and is commonly seen in amyloidosis, hemosiderosis, hypereosinophilic syndrome and the like; some genetic mutations in sarcomere or desmin proteins can lead to idiopathic restrictive cardiomyopathy.

Patients with restrictive cardiomyopathy have poor prognosis and do not have effective drug treatment because of poor prognosis, early diagnosis of RCM, early initiation of an interference strategy, and benefit to improve the quality of RCM patients. While there has been some exploration of the genetic causes of cardiomyopathy in the past decade, genetic research for RCM remains lacking. It is well known that RCM can be caused by mutations in genes encoding sarcomeric protein related classes such as TNNI3, TNNT2, DES, MYH7, TTN and BAG 3. However, due to the phenotypic complexity of RCM, some patients with restrictive cardiomyopathy cannot be diagnosed clearly, and many clinically confirmed patients cannot be explained by known pathogenic genes, suggesting the possible existence of undetected pathogenic genes. Therefore, the discovery and proposal of any one or a group of related genes of restrictive cardiomyopathy will be an important technical contribution to the art.

Disclosure of Invention

Aiming at the problems, the invention provides the FLNC gene mutant and the application thereof, mainly finds a new pathogenic gene aiming at cardiomyopathy such as restrictive cardiomyopathy, and provides a new direction for subsequent diagnosis and treatment.

In order to solve the problems, the invention adopts the following technical scheme:

a nucleic acid having the following target fragment,

the target fragment has a c.6451G > A mutation compared to the wild-type FLNC gene; preferably, the nucleic acid is DNA.

A polypeptide having a p.G2151S mutation compared to wild type FLNC.

A gene mutation, said mutant gene having a c.6451g > a mutation compared to the wild-type FLNC gene.

Use of a biological model for preparing a cardiomyopathy screening reagent, the biological model comprising at least one of

a. The aforementioned nucleic acid having the c.6451G > A mutation,

b. the aforementioned polypeptide having a p.G2151S mutation,

c. the aforementioned gene having a c.6451g > a mutation;

preferably, the cardiomyopathy in the present invention is a restrictive cardiomyopathy.

An agent for screening a biological sample for cardiomyopathy comprising

An agent capable of detecting a mutant FLNC gene having a c.6451G > A mutation compared to the wild-type FLNC gene;

preferably, the FLNC gene mutant is at least one of

a. The aforementioned nucleic acid having the c.6451G > A mutation,

b. the aforementioned polypeptide having a p.G2151S mutation,

c. the aforementioned gene having a c.6451g > a mutation;

preferably, the cardiomyopathy is a restrictive cardiomyopathy.

In some embodiments, the reagent comprises a nucleic acid probe or primer;

preferably, the primer comprises

A forward primer of sequence GGCACCTACATCATCAACATCAA, and/or

The sequence is CCATCAGTTAAACCTCCTCCTCTG reverse primer.

A construct comprising a nucleic acid as described above or a mutation in a gene as described above.

Recombinant cells obtained by transforming a recipient cell with the aforementioned construct or expressing the aforementioned polypeptide.

The recombinant protein for preparing the medicine for preventing and treating the restrictive cardiomyopathy is expressed by the recombinant cell.

The application of an inhibitor in preparing a medicament for preventing and treating restrictive cardiomyopathy, wherein the inhibitor has an inhibiting effect on at least one of the following components:

a c.6451G > A mutation of FLNC gene,

p.G2151S mutation in FLNC gene polypeptide.

A medicine for preventing and treating myocardial diseases contains at least one of the following medicines

a c.6451G > A mutation inhibitor of FLNC gene,

a p.G2151S mutation inhibitor of FLNC gene polypeptide;

preferably, the cardiomyopathy is a restrictive cardiomyopathy.

The application of the gene segment in preparing the medicine for preventing and treating the cardiomyopathy is that the c.6451 site mononucleotide of the FLNC gene is G, preferably, the cardiomyopathy is restrictive cardiomyopathy.

The medicine for preventing and treating cardiomyopathy comprises a gene carrier containing

A gene fragment capable of replacing mononucleotide A at site c.6451 of FLNC gene with mononucleotide G and expressing, preferably, the cardiomyopathy is restrictive cardiomyopathy;

some expression forms of the gene vector are plasmid and adenovirus vectors.

The invention has the beneficial effects that:

FLNC mutation (c.6451G > A, p.G2151S) is related to RCM, and the invention widens the understanding of RCM genetic etiology; provides a new diagnosis mode for cardiomyopathy, especially restrictive cardiomyopathy, and also provides a new way for preventing and treating cardiomyopathy.

Drawings

FIG. 1 is a family map of a study of the present invention,

figure 2 is a Sanger sequencing graph of the present invention,

FIG. 3 is a graph showing prediction of the harmfulness and conservation of the mutation according to the present invention.

FIG. 4 shows a PCR amplification step.

Detailed Description

The invention is further illustrated below:

a nucleic acid having the following target fragment,

the target fragment has a c.6451G > A mutation compared to the wild type FLNC gene (one as SEQ ID NO. 1); preferably, the nucleic acid is DNA, and in some cases RNA containing the target fragment is also within the scope of the invention.

A polypeptide having a p.g2151s mutation compared to wild type FLNC (one as SEQ ID No. 2).

When the single nucleotide or amino acid sequence site of other sites of the FLNC gene is mutated, the protection of the detection site related to the invention is not influenced, and under the premise that the target site mutation is the same as the invention, other sites are changed relative to SEQ ID NO.1 or SEQ ID NO.2 and are also in the scope of the invention.

Use of a biological model for the preparation of a reagent for cardiomyopathy and/or prevention and/or treatment, said biological model comprising at least one of

a. The aforementioned nucleic acid having the c.6451G > A mutation,

b. the aforementioned polypeptide having a p.G2151S mutation,

c. the aforementioned gene having a c.6451g > a mutation;

preferably, the cardiomyopathy is a restrictive cardiomyopathy.

When used in the preparation of screening reagents, reference is made to the subsequent specific use; when the inhibitor is used in preparation of a prevention and treatment agent, some modes are used as an action target of a medicament, or other modes are used in steps of testing, extracting and the like in the preparation process of other biological medicaments, and the inhibitor is mainly used as some auxiliary agents in the pharmaceutical process, for example, in the step of testing the action effect of the inhibitor in the pharmaceutical process.

An agent for screening a biological sample for cardiomyopathy comprising

preferably, the FLNC gene mutant is at least one of

a. The aforementioned nucleic acid having the c.6451G > A mutation,

b. the aforementioned polypeptide having a p.G2151S mutation,

c. the aforementioned gene having a c.6451g > a mutation;

preferably, the cardiomyopathy is a restrictive cardiomyopathy.

In some embodiments, the reagent comprises a nucleic acid probe or primer;

preferably, the primer comprises

A forward primer of sequence GGCACCTACATCATCAACATCAA, and/or

A reverse primer of sequence CCATCAGTTAAACCTCCTCCTCTG;

the nucleic acid probe may be a proximal gene detection probe, and is not particularly limited as long as it is possible.

a c.6451G > A mutation of FLNC gene,

p.G2151S mutation in FLNC gene polypeptide.

a c.6451G > A mutation inhibitor of FLNC gene,

a p.G2151S mutation inhibitor of FLNC gene polypeptide;

preferably, the cardiomyopathy is a restrictive cardiomyopathy, more preferably a restrictive diastolic dysfunction.

Where the aforementioned inhibitors comprise existing objectively feasible pharmaceutical agents, they should also comprise some pharmaceutical agents that are newly developed later.

The application of the gene segment in preparing the medicine for treating the cardiomyopathy comprises the gene segment of which the mononucleotide at the c.6451 site of the FLNC gene is G, preferably, the cardiomyopathy is restrictive cardiomyopathy.

A gene fragment capable of replacing mononucleotide A at site c.6451 of FLNC gene with mononucleotide G and expressing, preferably, the cardiomyopathy is restrictive cardiomyopathy; some expression forms of gene vectors are plasmid, adenoviral vectors. The mutant gene is replaced to restore the normal gene sequence to realize treatment, thereby achieving the purposes of prevention and treatment. At present, the gene vector is preferably considered to be known and mature, although future emergence will gain approval and should be within the scope of the present invention.

The following is described in connection with a specific case: RCM pedigrees including 1 clinically confirmed RCM patient. Firstly, RCM is diagnosed by the examination methods of medical history acquisition, electrocardiogram, echocardiogram and the like, the proband, namely, RCM patients, carry out whole exon sequencing, and the mutation obtained by sequencing is screened: (1) performing primary screening according to the quality of sequencing data and mutation positions and functions; (2) further screening was performed by the thousand human genome project database (http:// www.1000genomes.org /), ESP6500 database, ExAC (outer Aggregation Consortium) database according to mutation frequency; (3) performing function prediction and conservation annotation on the Mutation by software SIFT, Mutation Taster, PolyPhen-2 and the like, and screening out the highly pathogenic Mutation; (4) screening for mutations in other members of the pedigree by Sanger sequencing; (5) and (4) searching the pathogenic mutation of the family by querying databases such as OMIM, PubMed and the like.

First, collect the clinical and peripheral blood sample of family

After obtaining informed consent of all family members, collecting 5-10mL of peripheral blood of all family members by using disposable blood collection needles and sodium citrate blood collection tubes, marking the tube walls, and placing a 4-degree refrigerator for subsequent extraction of genome DNA. The pedigree map is shown in FIG. 1, wherein the square represents male, the circle represents female, the black represents patient, the arrow represents proband, and the oblique line represents off-lying.

Second, whole genome DNA extraction and quality detection

Peripheral blood genomic DNA was extracted using the TIANAmp blood genomic DNA extraction kit from Tiangen according to the instructions.

The concentration and purity of the extracted DNA sample were determined using a NanoDrop2000 spectrophotometer.

Sequencing of three, all exons

Selecting peripheral blood genome DNA of RCM patients, delivering to Shanghai Bohao biotechnology limited for whole exon sequencing, wherein the main sequencing process comprises DNA quality detection, sequencing library construction and sequencing original data processing. The method comprises the following specific steps: purified DNA is subjected to

2.0Fluorometer and 1% agarose gel electrophoresis, analyzing the degradation degree of DNA and whether the DNA is polluted, after the DNA sample is qualified, crushing the DNA to about 180bp-300bp by using an ultrasonic crushing method, connecting a joint, constructing a capture library by PCR, sequencing the double end of 150bp by using an Illumina HiSeq X sequencer, controlling the sequencing process by using data collection software provided by Illumina, comparing high-quality reads obtained after filtering with a human reference genome sequence (UCSC hg19) by using mainstream genome comparison software BWA, and performing variation detection by using GAKT software.

Fourth, data analysis

Further screening was performed by using various databases such as the thousand human genome project database (http:// www.1000genomes.org /), ESP6500 database, ExAC (outer Aggregation Consortium) Kaviar database, etc., according to mutation frequency.

Five, Sanger sequencing verification

The Sanger sequencing is utilized to screen candidate mutation sites obtained by sequencing the whole exons in family members, so that the pathogenicity of the mutation in the family can be further determined, and the early diagnosis of individuals with normal phenotype carrying pathogenic gene mutation in the family can be realized. The main experimental procedures of Sanger sequencing are as follows:

1. mutant primer design

According to the position of the gene mutation in the genome, the Ensembl database (http:// www.ensembl.org /) was searched for the human genome sequence in which the mutation was located, and the obtained mutation sequence was used to perform primer design in primer design software PrimerPremier 5. The designed primers are used for carrying out electronic PCR on the UCSC website, and the PCR result shows that the target fragment can be amplified and has a single band, thereby indicating that the primer has better specificity.

Primer sequences

Forward direction: GGCACCTACATCATCAACATCAA the flow of the air in the air conditioner,

and (3) reversing: CCATCAGTTAAACCTCCTCCTCTG are provided.

Length of product: 773.

PCR amplification

The amplification system was as follows:

the amplification step is shown in FIG. 4.

3. Sequencing

The amplified target DNA fragment was subjected to Sanger sequencing by Okagaku Biotech. Sequencing results were analyzed using Chromas2 to find gene mutations by comparison with normal sequences. The results are shown in FIG. 2.

Sixth, mutation analysis

Through system query, relevant records of gene mutation FLNC (c.6451G > A, p.G2151S) are not found in HGMD databases, thousand human genome planning databases (http:// www.1000genomes.org /), ESP6500 databases and ExAC (outer Aggregation Consortium) Kaviar databases, and the Pubmed databases also have no relevant literature reports of the mutation and RCM, and the parents of patients do not carry the mutation. Indicating that the mutation is a new mutation. As in fig. 3, glycine at position 2151 of FLNC protein is changed to serine, and this mutation is conserved across species. As shown in FIG. 3, the Mutation was found to be pathogenic by functional prediction of the Mutation by software SIFT, Mutation Taster, and PolyPhen-2, etc.

The american society for medical genetics and genomics (ACMG) combined with the society for molecular pathology (AMP) issued open standards and guidelines for the interpretation of genetic variations. The recommendations presented by the guidelines may be applied to various genetic testing methods in clinical laboratories, including genotyping, monogenic, genetic panel, exome, and genome. The present guidelines suggest the use of certain standard terms to describe mendelian disease-associated genetic variations- "pathogenic", "potentially pathogenic", "ambiguous", "potentially benign", and "benign". Furthermore, the present disclosure describes a standard process for five-level classification of variants based on typical data types (e.g., demographic data, computational data, functional data, co-segregation data). The current guideline is an important standard for issuing gene detection reports by genetic detection organizations at home and abroad. Clinical evaluation of the genetic mutations of the invention by this ACMG/AMP 2015 guideline is pathogenic. The evaluation criterion is as follows: the invention relates to a new mutation of PS2 PM6, wherein the new mutation refers to a mutation carried by a patient, and the patient does not carry the mutation by parents.

It will be apparent to those skilled in the art that various modifications may be made to the above embodiments without departing from the general spirit and concept of the invention. All falling within the scope of the present invention. The protection scheme of the invention is subject to the appended claims.

Sequence listing

<110> affiliated cooperation hospital of college of Tongji medical college of Huazhong university of science and technology

<120> FLNC gene mutant and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2520

<212> DNA

<213> person (Huma)

<400> 1

aactccccca ccaggtgatg actccatgag gacctcacag ctgaatgtgg gcacctccac 60

ggacgtgtca ctgaagatca ccgagagtga tctgagccag ctgaccgcca gcatccgtgc 120

cccctcgggc aacgaggagc cctgcctgct gaagcgcctg cccaaccggc acattggtga 180

gcgtggggcc tcacggggac ctcaggggtg ggggcccaca ggatgctctg cctaacaccc 240

actttccaca gggatctcct tcacccccaa ggaggtcggg gagcacgtgg tgagcgtgcg 300

caagagtggc aagcatgtca ccaacagccc cttcaagatc ctggtggggc catctgagat 360

cggggacgcc agcaaggtgc gggtctgggg caaggggctt tccgagggac acacattcca 420

ggtggcagag ttcatcgtgg acactcgcaa tgcaggtacc tcctgcccca gagagccccc 480

attccagcgg gtgcctccca caggcacttg tcctcgtcct gcccagcacc cccttggccg 540

cactctctcc tccctgaaac ttcctgacca gtctgcgtca ggattcgcat tctggggccc 600

cttgcgggaa agtgaatggc cccgcatcag ttctctccct tttaagagaa agctcagctg 660

tcctgagttt ctgtccctcc cttgctcact ggaatccaag aggcttacct tagggaattt 720

tccagaccgc ctgtcccgtg gtgcccccgc tcctcccact gagccatttt tgttagtggt 780

cactacacac atcggtgccc attctgggtg gagcctgcag tctggggaga ggaaagcatt 840

gtggcttggc cagcctagga ctgagggaga tgtgttcctt gctttccccc aggttatggg 900

ggcttggggc tgagtattga aggcccaagc aaggtggaca tcaactgtga ggacatggag 960

gacgggacat gcaaagtcac ctactgcccc accgagcccg gcacctacat catcaacatc 1020

aagtttgctg acaagcacgt gcctggtaag gctctgggca gaggtcggtg gcgagagaca 1080

gggaggccag gaggctgggg ctctgaggtt cctgacccac cctttgtccc cacttcagga 1140

agccccttca ctgtgaaggt gaccggcgag ggccgcatga aggagagcat cacccggcgg 1200

agacaggcac cttccatcgc caccatcggc agcacctgtg acctcaacct caagatccca 1260

ggtagaagcc tggaggaccc tgggtggggc gggtggtggg agagggctgg cccgggccag 1320

agcccacctg tcgggcctcc accctgcttc ctcacccctc gcttccctcc ctcaccctgg 1380

ctcccttgac cacacaggaa actggttcca gatggtgtct gcccaggagc gcctgacacg 1440

caccttcaca cgcagcagcc acacctacac ccgcacggag cgcacggaga tcagcaagac 1500

gcggggcggg gagacaaagc gcgaggtgcg ggtggaggag tccacccagg tcggcgggga 1560

ccccttccct gctgtgtttg gggacttcct gggccgggag cgcctgggat ccttcggcag 1620

catcacccgg cagcaggagg gtgagcaccg cacactgggc cggccgggtc ctcacggcgg 1680

gatgggaggg tgctgcggac caggcttgat gctggcagac tggccccgaa ggccagggca 1740

ggtctgagca gaggaggagg tttaactgat gggggaggga agggccaggg ctaggaggaa 1800

tcccagtgtt gccctgacat cccccaaacc ctgcaggtga ggccagctct caggacatga 1860

ctgcacaggt gaccagccca tcgggcaagg tggaagccgc agagatcgtc gagggcgagg 1920

acagcgccta cagcgtgcgc tttgtgcccc aggaaatggg gccccatacg gtcgctgtca 1980

agtaccgtgg ccagcacgtg cccggcagcc cctttcagtt cactgtgggg ccgctgggtg 2040

aaggtggtgc ccacaaggtg cgggccggag gcacagggct ggagcgaggt gtggccggcg 2100

tgccaggtaa ggggcaggtg gccaggagtg gggatgaagt cagggcagcc agtgtgaggg 2160

gcgatgatgc tgaagtccac taccttgcct gtccccagcc gagttcagca tctggacccg 2220

ggaggctggc gctgggggcc tgtccattgc tgtggagggt cctagcaaag cggagattgc 2280

atttgaggat cgcaaagatg gctcctgcgg cgtctcctat gtcgtccagg aaccaggtgg 2340

gcgtccacac tggcagtggg gctgggcctg cctgaccttc cagactgggt ttctgcccac 2400

tggccaggca ggagatgctt ggggccacag aactcccctc cccggagccc cctgctcttc 2460

ctctgccccg tctccctcta ccccacaccc tcagaaacat gtgtctgcct ccagatctga 2520

<210> 2

<211> 2692

<212> PRT

<213> person (Huma)

<400> 2

Met Met Asn Asn Ser Gly Tyr Ser Asp Ala Gly Leu Gly Leu Gly Asp

1 5 10 15

Glu Thr Asp Glu Met Pro Ser Thr Glu Lys Asp Leu Ala Glu Asp Ala

20 25 30

Pro Trp Lys Lys Ile Gln Gln Asn Thr Phe Thr Arg Trp Cys Asn Glu

35 40 45

His Leu Lys Cys Val Gly Lys Arg Leu Thr Asp Leu Gln Arg Asp Leu

50 55 60

Ser Asp Gly Leu Arg Leu Ile Ala Leu Leu Glu Val Leu Ser Gln Lys

65 70 75 80

Arg Met Tyr Arg Lys Phe His Pro Arg Pro Asn Phe Arg Gln Met Lys

85 90 95

Leu Glu Asn Val Ser Val Ala Leu Glu Phe Leu Glu Arg Glu His Ile

100 105 110

Lys Leu Val Ser Ile Asp Ser Lys Ala Ile Val Asp Gly Asn Leu Lys

115 120 125

Leu Ile Leu Gly Leu Ile Trp Thr Leu Ile Leu His Tyr Ser Ile Ser

130 135 140

Met Pro Met Trp Glu Asp Glu Asp Asp Glu Asp Ala Arg Lys Gln Thr

145 150 155 160

Pro Lys Gln Arg Leu Leu Gly Trp Ile Gln Asn Lys Val Pro Gln Leu

165 170 175

Pro Ile Thr Asn Phe Asn Arg Asp Trp Gln Asp Gly Lys Ala Leu Gly

180 185 190

Ala Leu Val Asp Asn Cys Ala Pro Gly Leu Cys Pro Asp Trp Glu Ala

195 200 205

Trp Asp Pro Asn Gln Pro Val Glu Asn Ala Arg Glu Ala Met Gln Gln

210 215 220

Ala Asp Asp Trp Leu Gly Val Pro Gln Val Ile Ala Pro Glu Glu Ile

225 230 235 240

Val Asp Pro Asn Val Asp Glu His Ser Val Met Thr Tyr Leu Ser Gln

245 250 255

Phe Pro Lys Ala Lys Leu Lys Pro Gly Ala Pro Val Arg Ser Lys Gln

260 265 270

Leu Asn Pro Lys Lys Ala Ile Ala Tyr Gly Pro Gly Ile Glu Pro Gln

275 280 285

Gly Asn Thr Val Leu Gln Pro Ala His Phe Thr Val Gln Thr Val Asp

290 295 300

Ala Gly Val Gly Glu Val Leu Val Tyr Ile Glu Asp Pro Glu Gly His

305 310 315 320

Thr Glu Glu Ala Lys Val Val Pro Asn Asn Asp Lys Asp Arg Thr Tyr

325 330 335

Ala Val Ser Tyr Val Pro Lys Val Ala Gly Leu His Lys Val Thr Val

340 345 350

Leu Phe Ala Gly Gln Asn Ile Glu Arg Ser Pro Phe Glu Val Asn Val

355 360 365

Gly Met Ala Leu Gly Asp Ala Asn Lys Val Ser Ala Arg Gly Pro Gly

370 375 380

Leu Glu Pro Val Gly Asn Val Ala Asn Lys Pro Thr Tyr Phe Asp Ile

385 390 395 400

Tyr Thr Ala Gly Ala Gly Thr Gly Asp Val Ala Val Val Ile Val Asp

405 410 415

Pro Gln Gly Arg Arg Asp Thr Val Glu Val Ala Leu Glu Asp Lys Gly

420 425 430

Asp Ser Thr Phe Arg Cys Thr Tyr Arg Pro Ala Met Glu Gly Pro His

435 440 445

Thr Val His Val Ala Phe Ala Gly Ala Pro Ile Thr Arg Ser Pro Phe

450 455 460

Pro Val His Val Ser Glu Ala Cys Asn Pro Asn Ala Cys Arg Ala Ser

465 470 475 480

Gly Arg Gly Leu Gln Pro Lys Gly Val Arg Val Lys Glu Val Ala Asp

485 490 495

Phe Lys Val Phe Thr Lys Gly Ala Gly Ser Gly Glu Leu Lys Val Thr

500 505 510

Val Lys Gly Pro Lys Gly Thr Glu Glu Pro Val Lys Val Arg Glu Ala

515 520 525

Gly Asp Gly Val Phe Glu Cys Glu Tyr Tyr Pro Val Val Pro Gly Lys

530 535 540

Tyr Val Val Thr Ile Thr Trp Gly Gly Tyr Ala Ile Pro Arg Ser Pro

545 550 555 560

Phe Glu Val Gln Val Ser Pro Glu Ala Gly Val Gln Lys Val Arg Ala

565 570 575

Trp Gly Pro Gly Leu Glu Thr Gly Gln Val Gly Lys Ser Ala Asp Phe

580 585 590

Val Val Glu Ala Ile Gly Thr Glu Val Gly Thr Leu Gly Phe Ser Ile

595 600 605

Glu Gly Pro Ser Gln Ala Lys Ile Glu Cys Asp Asp Lys Gly Asp Gly

610 615 620

Ser Cys Asp Val Arg Tyr Trp Pro Thr Glu Pro Gly Glu Tyr Ala Val

625 630 635 640

His Val Ile Cys Asp Asp Glu Asp Ile Arg Asp Ser Pro Phe Ile Ala

645 650 655

His Ile Leu Pro Ala Pro Pro Asp Cys Phe Pro Asp Lys Val Lys Ala

660 665 670

Phe Gly Pro Gly Leu Glu Pro Thr Gly Cys Ile Val Asp Lys Pro Ala

675 680 685

Glu Phe Thr Ile Asp Ala Arg Ala Ala Gly Lys Gly Asp Leu Lys Leu

690 695 700

Tyr Ala Gln Asp Ala Asp Gly Cys Pro Ile Asp Ile Lys Val Ile Pro

705 710 715 720

Asn Gly Asp Gly Thr Phe Arg Cys Ser Tyr Val Pro Thr Lys Pro Ile

725 730 735

Lys His Thr Ile Ile Ile Ser Trp Gly Gly Val Asn Val Pro Lys Ser

740 745 750

Pro Phe Arg Val Asn Val Gly Glu Gly Ser His Pro Glu Arg Val Lys

755 760 765

Val Tyr Gly Pro Gly Val Glu Lys Thr Gly Leu Lys Ala Asn Glu Pro

770 775 780

Thr Tyr Phe Thr Val Asp Cys Ser Glu Ala Gly Gln Gly Asp Val Ser

785 790 795 800

Ile Gly Ile Lys Cys Ala Pro Gly Val Val Gly Pro Ala Glu Ala Asp

805 810 815

Ile Asp Phe Asp Ile Ile Lys Asn Asp Asn Asp Thr Phe Thr Val Lys

820 825 830

Tyr Thr Pro Pro Gly Ala Gly Arg Tyr Thr Ile Met Val Leu Phe Ala

835 840 845

Asn Gln Glu Ile Pro Ala Ser Pro Phe His Ile Lys Val Asp Pro Ser

850 855 860

His Asp Ala Ser Lys Val Lys Ala Glu Gly Pro Gly Leu Asn Arg Thr

865 870 875 880

Gly Val Glu Val Gly Lys Pro Thr His Phe Thr Val Leu Thr Lys Gly

885 890 895

Ala Gly Lys Ala Lys Leu Asp Val Gln Phe Ala Gly Thr Ala Lys Gly

900 905 910

Glu Val Val Arg Asp Phe Glu Ile Ile Asp Asn His Asp Tyr Ser Tyr

915 920 925

Thr Val Lys Tyr Thr Ala Val Gln Gln Gly Asn Met Ala Val Thr Val

930 935 940

Thr Tyr Gly Gly Asp Pro Val Pro Lys Ser Pro Phe Val Val Asn Val

945 950 955 960

Ala Pro Pro Leu Asp Leu Ser Lys Ile Lys Val Gln Gly Leu Asn Ser

965 970 975

Lys Val Ala Val Gly Gln Glu Gln Ala Phe Ser Val Asn Thr Arg Gly

980 985 990

Ala Gly Gly Gln Gly Gln Leu Asp Val Arg Met Thr Ser Pro Ser Arg

995 1000 1005

Arg Pro Ile Pro Cys Lys Leu Glu Pro Gly Gly Gly Ala Glu Ala Gln

1010 1015 1020

Ala Val Arg Tyr Met Pro Pro Glu Glu Gly Pro Tyr Lys Val Asp Ile

1025 1030 1035 1040

Thr Tyr Asp Gly His Pro Val Pro Gly Ser Pro Phe Ala Val Glu Gly

1045 1050 1055

Val Leu Pro Pro Asp Pro Ser Lys Val Cys Ala Tyr Gly Pro Gly Leu

1060 1065 1070

Lys Gly Gly Leu Val Gly Thr Pro Ala Pro Phe Ser Ile Asp Thr Lys

1075 1080 1085

Gly Ala Gly Thr Gly Gly Leu Gly Leu Thr Val Glu Gly Pro Cys Glu

1090 1095 1100

Ala Lys Ile Glu Cys Gln Asp Asn Gly Asp Gly Ser Cys Ala Val Ser

1105 1110 1115 1120

Tyr Leu Pro Thr Glu Pro Gly Glu Tyr Thr Ile Asn Ile Leu Phe Ala

1125 1130 1135

Glu Ala His Ile Pro Gly Ser Pro Phe Lys Ala Thr Ile Arg Pro Val

1140 1145 1150

Phe Asp Pro Ser Lys Val Arg Ala Ser Gly Pro Gly Leu Glu Arg Gly

1155 1160 1165

Lys Val Gly Glu Ala Ala Thr Phe Thr Val Asp Cys Ser Glu Ala Gly

1170 1175 1180

Glu Ala Glu Leu Thr Ile Glu Ile Leu Ser Asp Ala Gly Val Lys Ala

1185 1190 1195 1200

Glu Val Leu Ile His Asn Asn Ala Asp Gly Thr Tyr His Ile Thr Tyr

1205 1210 1215

Ser Pro Ala Phe Pro Gly Thr Tyr Thr Ile Thr Ile Lys Tyr Gly Gly

1220 1225 1230

His Pro Val Pro Lys Phe Pro Thr Arg Val His Val Gln Pro Ala Val

1235 1240 1245

Asp Thr Ser Gly Val Lys Val Ser Gly Pro Gly Val Glu Pro His Gly

1250 1255 1260

Val Leu Arg Glu Val Thr Thr Glu Phe Thr Val Asp Ala Arg Ser Leu

1265 1270 1275 1280

Thr Ala Thr Gly Gly Asn His Val Thr Ala Arg Val Leu Asn Pro Ser

1285 1290 1295

Gly Ala Lys Thr Asp Thr Tyr Val Thr Asp Asn Gly Asp Gly Thr Tyr

1300 1305 1310

Arg Val Gln Tyr Thr Ala Tyr Glu Glu Gly Val His Leu Val Glu Val

1315 1320 1325

Leu Tyr Asp Glu Val Ala Val Pro Lys Ser Pro Phe Arg Val Gly Val

1330 1335 1340

Thr Glu Gly Cys Asp Pro Thr Arg Val Arg Ala Phe Gly Pro Gly Leu

1345 1350 1355 1360

Glu Gly Gly Leu Val Asn Lys Ala Asn Arg Phe Thr Val Glu Thr Arg

1365 1370 1375

Gly Ala Gly Thr Gly Gly Leu Gly Leu Ala Ile Glu Gly Pro Ser Glu

1380 1385 1390

Ala Lys Met Ser Cys Lys Asp Asn Lys Asp Gly Ser Cys Thr Val Glu

1395 1400 1405

Tyr Ile Pro Phe Thr Pro Gly Asp Tyr Asp Val Asn Ile Thr Phe Gly

1410 1415 1420

Gly Arg Pro Ile Pro Gly Ser Pro Phe Arg Val Pro Val Lys Asp Val

1425 1430 1435 1440

Val Asp Pro Gly Lys Val Lys Cys Ser Gly Pro Gly Leu Gly Ala Gly

1445 1450 1455

Val Arg Ala Arg Val Pro Gln Thr Phe Thr Val Asp Cys Ser Gln Ala

1460 1465 1470

Gly Arg Ala Pro Leu Gln Val Ala Val Leu Gly Pro Thr Gly Val Ala

1475 1480 1485

Glu Pro Val Glu Val Arg Asp Asn Gly Asp Gly Thr His Thr Val His

1490 1495 1500

Tyr Thr Pro Ala Thr Asp Gly Pro Tyr Thr Val Ala Val Lys Tyr Ala

1505 1510 1515 1520

Asp Gln Glu Val Pro Arg Ser Pro Phe Lys Ile Lys Val Leu Pro Ala

1525 1530 1535

His Asp Ala Ser Lys Val Arg Ala Ser Gly Pro Gly Leu Asn Ala Ser

1540 1545 1550

Gly Ile Pro Ala Ser Leu Pro Val Glu Phe Thr Ile Asp Ala Arg Asp

1555 1560 1565

Ala Gly Glu Gly Leu Leu Thr Val Gln Ile Leu Asp Pro Glu Gly Lys

1570 1575 1580

Pro Lys Lys Ala Asn Ile Arg Asp Asn Gly Asp Gly Thr Tyr Thr Val

1585 1590 1595 1600

Ser Tyr Leu Pro Asp Met Ser Gly Arg Tyr Thr Ile Thr Ile Lys Tyr

1605 1610 1615

Gly Gly Asp Glu Ile Pro Tyr Ser Pro Phe Arg Ile His Ala Leu Pro

1620 1625 1630

Thr Gly Asp Ala Ser Lys Cys Leu Val Thr Val Ser Ile Gly Gly His

1635 1640 1645

Gly Leu Gly Ala Cys Leu Gly Pro Arg Ile Gln Ile Gly Gln Glu Thr

1650 1655 1660

Val Ile Thr Val Asp Ala Lys Ala Ala Gly Glu Gly Lys Val Thr Cys

1665 1670 1675 1680

Thr Val Ser Thr Pro Asp Gly Ala Glu Leu Asp Val Asp Val Val Glu

1685 1690 1695

Asn His Asp Gly Thr Phe Asp Ile Tyr Tyr Thr Ala Pro Glu Pro Gly

1700 1705 1710

Lys Tyr Val Ile Thr Ile Arg Phe Gly Gly Glu His Ile Pro Asn Ser

1715 1720 1725

Pro Phe His Val Leu Ala Thr Glu Glu Pro Val Val Pro Val Glu Pro

1730 1735 1740

Met Glu Ser Met Leu Arg Pro Phe Asn Leu Val Ile Pro Phe Ala Val

1745 1750 1755 1760

Gln Lys Gly Glu Leu Thr Gly Glu Val Arg Met Pro Ser Gly Lys Thr

1765 1770 1775

Ala Arg Pro Asn Ile Thr Asp Asn Lys Asp Gly Thr Ile Thr Val Arg

1780 1785 1790

Tyr Ala Pro Thr Glu Lys Gly Leu His Gln Met Gly Ile Lys Tyr Asp

1795 1800 1805

Gly Asn His Ile Pro Gly Ser Pro Leu Gln Phe Tyr Val Asp Ala Ile

1810 1815 1820

Asn Ser Arg His Val Ser Ala Tyr Gly Pro Gly Leu Ser His Gly Met

1825 1830 1835 1840

Val Asn Lys Pro Ala Thr Phe Thr Ile Val Thr Lys Asp Ala Gly Glu

1845 1850 1855

Gly Gly Leu Ser Leu Ala Val Glu Gly Pro Ser Lys Ala Glu Ile Thr

1860 1865 1870

Cys Lys Asp Asn Lys Asp Gly Thr Cys Thr Val Ser Tyr Leu Pro Thr

1875 1880 1885

Ala Pro Gly Asp Tyr Ser Ile Ile Val Arg Phe Asp Asp Lys His Ile

1890 1895 1900

Pro Gly Ser Pro Phe Thr Ala Lys Ile Thr Gly Asp Asp Ser Met Arg

1905 1910 1915 1920

Thr Ser Gln Leu Asn Val Gly Thr Ser Thr Asp Val Ser Leu Lys Ile

1925 1930 1935

Thr Glu Ser Asp Leu Ser Gln Leu Thr Ala Ser Ile Arg Ala Pro Ser

1940 1945 1950

Gly Asn Glu Glu Pro Cys Leu Leu Lys Arg Leu Pro Asn Arg His Ile

1955 1960 1965

Gly Ile Ser Phe Thr Pro Lys Glu Val Gly Glu His Val Val Ser Val

1970 1975 1980

Arg Lys Ser Gly Lys His Val Thr Asn Ser Pro Phe Lys Ile Leu Val

1985 1990 1995 2000

Gly Pro Ser Glu Ile Gly Asp Ala Ser Lys Val Arg Val Trp Gly Lys

2005 2010 2015

Gly Leu Ser Glu Gly His Thr Phe Gln Val Ala Glu Phe Ile Val Asp

2020 2025 2030

Thr Arg Asn Ala Gly Tyr Gly Gly Leu Gly Leu Ser Ile Glu Gly Pro

2035 2040 2045

Ser Lys Val Asp Ile Asn Cys Glu Asp Met Glu Asp Gly Thr Cys Lys

2050 2055 2060

Val Thr Tyr Cys Pro Thr Glu Pro Gly Thr Tyr Ile Ile Asn Ile Lys

2065 2070 2075 2080

Phe Ala Asp Lys His Val Pro Gly Ser Pro Phe Thr Val Lys Val Thr

2085 2090 2095

Gly Glu Gly Arg Met Lys Glu Ser Ile Thr Arg Arg Arg Gln Ala Pro

2100 2105 2110

Ser Ile Ala Thr Ile Gly Ser Thr Cys Asp Leu Asn Leu Lys Ile Pro

2115 2120 2125

Gly Asn Trp Phe Gln Met Val Ser Ala Gln Glu Arg Leu Thr Arg Thr

2130 2135 2140

Phe Thr Arg Ser Ser His Thr Tyr Thr Arg Thr Glu Arg Thr Glu Ile

2145 2150 2155 2160

Ser Lys Thr Arg Gly Gly Glu Thr Lys Arg Glu Val Arg Val Glu Glu

2165 2170 2175

Ser Thr Gln Val Gly Gly Asp Pro Phe Pro Ala Val Phe Gly Asp Phe

2180 2185 2190

Leu Gly Arg Glu Arg Leu Gly Ser Phe Gly Ser Ile Thr Arg Gln Gln

2195 2200 2205

Glu Gly Glu Ala Ser Ser Gln Asp Met Thr Ala Gln Val Thr Ser Pro

2210 2215 2220

Ser Gly Lys Val Glu Ala Ala Glu Ile Val Glu Gly Glu Asp Ser Ala

2225 2230 2235 2240

Tyr Ser Val Arg Phe Val Pro Gln Glu Met Gly Pro His Thr Val Ala

2245 2250 2255

Val Lys Tyr Arg Gly Gln His Val Pro Gly Ser Pro Phe Gln Phe Thr

2260 2265 2270

Val Gly Pro Leu Gly Glu Gly Gly Ala His Lys Val Arg Ala Gly Gly

2275 2280 2285

Thr Gly Leu Glu Arg Gly Val Ala Gly Val Pro Ala Glu Phe Ser Ile

2290 2295 2300

Trp Thr Arg Glu Ala Gly Ala Gly Gly Leu Ser Ile Ala Val Glu Gly

2305 2310 2315 2320

Pro Ser Lys Ala Glu Ile Ala Phe Glu Asp Arg Lys Asp Gly Ser Cys

2325 2330 2335

Gly Val Ser Tyr Val Val Gln Glu Pro Gly Asp Tyr Glu Val Ser Ile

2340 2345 2350

Lys Phe Asn Asp Glu His Ile Pro Asp Ser Pro Phe Val Val Pro Val

2355 2360 2365

Ala Ser Leu Ser Asp Asp Ala Arg Arg Leu Thr Val Thr Ser Leu Gln

2370 2375 2380

Glu Thr Gly Leu Lys Val Asn Gln Pro Ala Ser Phe Ala Val Gln Leu

2385 2390 2395 2400

Asn Gly Ala Arg Gly Val Ile Asp Ala Arg Val His Thr Pro Ser Gly

2405 2410 2415

Ala Val Glu Glu Cys Tyr Val Ser Glu Leu Asp Ser Asp Lys His Thr

2420 2425 2430

Ile Arg Phe Ile Pro His Glu Asn Gly Val His Ser Ile Asp Val Lys

2435 2440 2445

Phe Asn Gly Ala His Ile Pro Gly Ser Pro Phe Lys Ile Arg Val Gly

2450 2455 2460

Glu Gln Ser Gln Ala Gly Asp Pro Gly Leu Val Ser Ala Tyr Gly Pro

2465 2470 2475 2480

Gly Leu Glu Gly Gly Thr Thr Gly Val Ser Ser Glu Phe Ile Val Asn

2485 2490 2495

Thr Leu Asn Ala Gly Ser Gly Ala Leu Ser Val Thr Ile Asp Gly Pro

2500 2505 2510

Ser Lys Val Gln Leu Asp Cys Arg Glu Cys Pro Glu Gly His Val Val

2515 2520 2525

Thr Tyr Thr Pro Met Ala Pro Gly Asn Tyr Leu Ile Ala Ile Lys Tyr

2530 2535 2540

Gly Gly Pro Gln His Ile Val Gly Ser Pro Phe Lys Ala Lys Val Thr

2545 2550 2555 2560

Gly Pro Arg Leu Ser Gly Gly His Ser Leu His Glu Thr Ser Thr Val

2565 2570 2575

Leu Val Glu Thr Val Thr Lys Ser Ser Ser Ser Arg Gly Ser Ser Tyr

2580 2585 2590

Ser Ser Ile Pro Lys Phe Ser Ser Asp Ala Ser Lys Val Val Thr Arg

2595 2600 2605

Gly Pro Gly Leu Ser Gln Ala Phe Val Gly Gln Lys Asn Ser Phe Thr

2610 2615 2620

Val Asp Cys Ser Lys Ala Gly Thr Asn Met Met Met Val Gly Val His

2625 2630 2635 2640

Gly Pro Lys Thr Pro Cys Glu Glu Val Tyr Val Lys His Met Gly Asn

2645 2650 2655

Arg Val Tyr Asn Val Thr Tyr Thr Val Lys Glu Lys Gly Asp Tyr Ile

2660 2665 2670

Leu Ile Val Lys Trp Gly Asp Glu Ser Val Pro Gly Ser Pro Phe Lys

2675 2680 2685

Val Lys Val Pro

2690

Claims

1. A nucleic acid having the following target fragment,

2. A polypeptide characterized by having a sequence selected from the group consisting of,

the polypeptide has a p.g2151s mutation compared to wild type FLNC.

3. A gene mutation characterized in that said mutant gene has a c.6451g > a mutation compared to the wild type FLNC gene.

4. The application of the biological model in preparing the reagent for screening and preventing cardiomyopathy is characterized in that the biological model at least comprises one of the following components

a. The nucleic acid according to claim 1, wherein said nucleic acid is a nucleic acid,

b. the polypeptide of claim 2, wherein said polypeptide is,

c. a mutation of the gene of claim 3;

5. An agent for screening a biological sample for cardiomyopathy comprising

preferably, the FLNC gene mutant is at least one of

b. the polypeptide of claim 2, wherein said polypeptide is,

c. a mutation of the gene of claim 3;

6. The agent for screening a biological sample for cardiomyopathy of claim 5 wherein the agent comprises a nucleic acid probe or primer;

preferably, the primer comprises

A forward primer of sequence GGCACCTACATCATCAACATCAA,

the reverse primer of sequence CCATCAGTTAAACCTCCTCCTCTG.

7. A construct comprising the nucleic acid of claim 1 or the genetic mutation of claim 3.

8. Recombinant cell obtained by transforming a recipient cell with the construct according to claim 7 or expressing the polypeptide according to claim 2.

9. The application of a mutation inhibitor in preparing a medicament for preventing and treating restrictive cardiomyopathy is characterized in that the mutation inhibitor has an inhibiting effect on at least one of the following diseases:

a c.6451G > A mutation of FLNC gene,

p.G2151S mutation in FLNC gene polypeptide.

10. A pharmaceutical composition for preventing and treating myocardial infarction, which comprises at least one of the following drugs

a c.6451G > A mutation inhibitor of FLNC gene,

a p.G2151S mutation inhibitor of FLNC gene polypeptide;

11. The application of the gene segment in preparing the medicine for preventing and treating the cardiomyopathy is characterized in that the gene segment is a gene segment of which the c.6451 site mononucleotide of an FLNC gene is G, and preferably, the cardiomyopathy is restrictive cardiomyopathy.

12. The medicine for preventing and treating myocardial diseases is characterized by comprising a gene carrier containing

A gene fragment capable of replacing mononucleotide A to mononucleotide G at site c.6451 of FLNC gene and expressing, preferably, the cardiomyopathy is restrictive cardiomyopathy.