WO2003031934A2 - Identification of oligonucleotides for the capture, detection and quantitation of hepatitis b viral dna - Google Patents

Identification of oligonucleotides for the capture, detection and quantitation of hepatitis b viral dna Download PDF

Info

Publication number
WO2003031934A2
WO2003031934A2 PCT/US2002/032367 US0232367W WO03031934A2 WO 2003031934 A2 WO2003031934 A2 WO 2003031934A2 US 0232367 W US0232367 W US 0232367W WO 03031934 A2 WO03031934 A2 WO 03031934A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
oligonucleotide
nucleotide sequence
sequence
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2002/032367
Other languages
English (en)
French (fr)
Other versions
WO2003031934A3 (en
Inventor
Venkatakrishna Shyamala
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to EP02782145A priority Critical patent/EP1451352A4/en
Priority to JP2003534867A priority patent/JP2005505289A/ja
Publication of WO2003031934A2 publication Critical patent/WO2003031934A2/en
Publication of WO2003031934A3 publication Critical patent/WO2003031934A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/706Specific hybridization probes for hepatitis

Definitions

  • the present invention pertains generally to viral diagnostics.
  • the invention relates to nucleic acid-based assays for accurately diagnosing hepatitis B infection.
  • Hepatitis B virus is a member of a group of small DNA-containing viruses that cause persistent noncytopathic infections of the liver. HBV infection in humans can cause severe jaundice, liver degeneration and death. HBV enters predominantly by the parenteral route, has a characteristic incubation period of 60 to 160 days, and may persist in the blood for years in chronic carriers. It is estimated that about 6 to 7% of the human population is infected, with the level of infection being as high as 20% of the population in certain regions of Southeast Asia and sub- Sahara Africa.
  • Hepatitis B is of great medical importance because it is probably the most common cause of chronic liver disease, including hepatocellular carcinoma in humans. Infected hepatocytes continually secrete viral particles that accumulate to high levels in the blood. These particles are of two types: (i) noninfectious particles consisting of 22 nm spheres and filaments of excess viral coat protein (Hbs Ag) and containing no nucleic acid (in concentrations of up to 10 13 particles/ml blood) which are referred to as the Australian antigen (AU), and (ii) infectious, DNA-containing particles (Dane particle nucleocapsids) consisting of a 28 nm nucleocapsid core (Hbc Ag) around which is assembled an envelope containing the major viral coat protein, carbohydrate, and lipid, present in lower concentrations (10 9 particles/ml blood).
  • Hbs Ag noninfectious particles consisting of 22 nm spheres and filaments of excess viral coat protein (Hbs Ag) and containing no nucle
  • hepatitis B tests have been employed to detect the presence of hepatitis B virus constituents in serum and other body fluids. These tests are primarily immunological in principle and depend on the presence of antibodies produced in humans or animals to detect specific viral proteins such as hepatitis B surface antigen (HBs Ag), hepatitis B core antigen (HBc Ag) or hepatitis B "E” antigen (HBe Ag). Radioimmunoassay, considered to be the most sensitive immunological technique, employs 125 I-labeled antibody. Radioimmunoassay has sufficient sensitivity to detect nanogram quantities of HBs Ag. However, immunological tests are indirect, and nonspecific antigen- antibody reactions do occur resulting in false positive determinations.
  • the antigen-antibody tests are negative in donor serum, but the recipient of transfused blood develops hepatitis B virus infection.
  • radioimmunoassay and other immunological tests have serious drawbacks, limited utility and provide only an indirect index of potential viral infectivity.
  • the other tests used to identify potentially infectious virus in serum are the viral polymerase assay and electron microscopy. For the most part, these methods are cumbersome assays of relatively low sensitivity and would be impractical for use as a routine laboratory screening procedure.
  • Detection of Hepatitis B Virus DNA by nucleic acid hybridization is a more sensitive method for the detection of the virus (Krogsgaard (1988) Liver 8:257-283).
  • Conventional HBV DNA assays such as the one described in U.S. Patent No. 4,562,159, tests for the presence of HBV genomic DNA in human serum using a full genomic RNA probe.
  • Direct hybridization lacks adequate sensitivity to detect HBV DNA in some patients, as shown by assay of patient samples following a nucleic acid amplification step such as the polymerase chain reaction (Kaneko et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:312-316).
  • large comb-type branched polynucleotides comprising a first oligonucleotide unit and branches including second oligonucleotide units, have been developed for signal amplification in nucleic acid detection assays.
  • the branched polynucleotide is hybridized via the first oligonucleotide unit to single stranded analyte nucleic acid and then labeled oligonucleotide is hybridized to the branched polynucleotide via the second oligonucleotide units, as described in U.S. Patent Nos. 5,710,264 and 5,614,362.
  • This DNA hybridization technique has been utilized for detecting HBV.
  • Other amplification primers and detection probes for HBV are described in U.S. Patent No. 6,225,053, and oligonucleotides and hybridization probes specific for human HBV are described in
  • U.S. Patent No. 5,736,316 describes the use of two different oligonucleotide probes, where the first probe is useful as an amplifier probe and the second oligonucleotide is useful as a capture probe.
  • PCR has greater sensitivity (-100 genome copies) than immunological methods, or direct observation techniques, such as electron microscopy.
  • the critical step remains the efficient extraction of nucleic acids from the sample.
  • U.S. Patent Nos. 4,894,324 and 5,288,609 describe a method for detecting a target polynucleotide utilizing two single-stranded polynucleotide segments complementary to the same or opposite strands of the target and resulting in the formation of a double hybrid with the target polynucleotide.
  • the hybrid is captured onto a support.
  • 6,280,952 and 6,110,628 describe a method for detecting target polynucleotides in a sample by capturing it on a solid support having capture probes immobilized thereon, followed by detection or amplification of the target polynucleotide.
  • HBV in viremic samples in order to prevent transmission of the virus through blood and plasma derivatives or by close personal contact.
  • the present invention is based on the development of a sensitive, reliable nucleic acid-based diagnostic test for the detection of HBV in biological samples from potentially infected individuals.
  • the techniques described herein utilize extracted sample DNA as a template for amplification of conserved genomic regions of the HBV sequence using transcription-mediated amplification (TMA), as well as in a 5' nuclease assay, such as the TaqManTM technique.
  • TMA transcription-mediated amplification
  • the methods allow for the detection of about 100 IU of HBV in viremic samples. Accordingly, infected samples can be identified and excluded from transfusion, as well as from the preparation of blood derivatives.
  • the subject invention is directed to a method of detecting HBV infection in a biological sample. The method comprises:
  • the subject invention is directed to a method of detecting HBV infection in a biological sample.
  • the method comprises:
  • the method further comprises the step of using the probe of Seq ID No.: 7 to detect the presence of the amplified target oligonucleotides as an indication of the presence or absence of hepatitis B virus in the sample, and the use of internal controls comprising an oligonucleotide from about 10-60 nucleotides in length comprising a nucleotide sequence of Seq ID Nos: 13, 14, and 15.
  • the invention is directed to an isolated oligonucleotide not more than 60 nucleotides in length comprising a nucleotide sequence of at least 10 contiguous nucleotides from a sequence depicted in Figure 1, a nucleotide sequence having 90% sequence identity to a nucleotide sequence depicted in Figure 1, or complements thereof.
  • the subject invention is directed to an isolated oligonucleotide not more than 60 nucleotides in length comprising a nucleotide sequence of at least 10 contiguous nucleotides from a sequence depicted in Figure 2, a nucleotide sequence having 90% sequence identity to a nucleotide sequence depicted in Figure 2, or complements thereof.
  • the invention is directed to a diagnostic test kit comprising one or more capture oligonucleotides and primers described herein, and instructions for conducting the diagnostic test.
  • the test kit further comprises an oligonucleotide probe comprising an HBV specific hybridizing sequence of about 10 to about 50 nucleotides linked to a detectable label.
  • the invention is directed to a kit for detecting hepatitis B virus in a biological sample.
  • the kit comprises capture oligonucleotides consisting of Seq. ID Nos.: 1, 2, 3 and 4; primers consisting of Seq ID Nos.: 5, 6, 7, 8, 9, and 10; and an oligonucleotide probe consisting of Seq ID No.: 13.
  • the test kit further comprises a polymerase and instructions for conducting the diagnostic test.
  • Figures 1A-1D depict exemplary capture oligonucleotides for isolating HBV nucleic acids from a biological sample.
  • Figures 2A-2H depict primers and probes for use in the amplification of the isolated HBV nucleic acids, where X is 6-FAM or TET, and Z is a linker plus TAMRA, and SEQ ID NOs.: 13 and 14 are the internal control Figure 3 (SEQ ID NO: 15) depicts an exemplary internal control sequence for use as a control for target capture and amplification.
  • an oligonucleotide includes a mixture of two or more oligonucleotides, and the like.
  • polypeptide and protein refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition.
  • the terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like.
  • a "polypeptide” refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • analog and mutant refer to biologically active derivatives of the reference molecule, or fragments of such derivatives, that retain desired activity, such as immunoreactivity in diagnostic assays.
  • analog refers to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy immunogenic activity.
  • mutein refers to peptides having one or more peptide mimics ("peptoids"), such as those described in International Publication No. WO 91/04282.
  • the analog or mutein has at least the same immunoactivity as the native molecule. Methods for making polypeptide analogs and muteins are known in the art and are described further below.
  • isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro- molecules of the same type.
  • isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
  • a polynucleotide "derived from” or “specific for” a designated sequence refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence.
  • the derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide. "Homology” refers to the percent similarity between two polynucleotide or two polypeptide moieties.
  • Two DNA, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% , preferably at least about 75%, more preferably at least about 80%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence similarity over a defined length of the molecules.
  • substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.
  • identity refers to an exact nucleotide-to-nucleotide or amino acid- to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.
  • percent homology of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
  • Another method of establishing percent homology in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence homology.”
  • Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and
  • homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments.
  • DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their desired function.
  • a given promoter operably linked to a nucleic acid sequence is capable of effecting the transcription, and in the case of a coding sequence, the expression of the coding sequence when the proper transcription factors, etc., are present.
  • the promoter need not be contiguous with the nucleic acid sequence, so long as it functions to direct the transcription and/or expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence, as can transcribed introns, and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature.
  • the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
  • the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
  • control element refers to a polynucleotide sequence which aids in the transcription and/or translation of a nucleotide sequence to which it is linked.
  • the term includes promoters, transcription termination sequences, upstream regulatory domains, polyadenylation signals, untranslated regions, including 5'-UTRs and 3'- UTRs and when appropriate, leader sequences and enhancers, which collectively provide for the transcription and translation of a coding sequence in a host cell.
  • a “promoter” as used herein is a regulatory region capable of binding a polymerase and initiating transcription of a downstream (3' direction) nucleotide sequence operably linked thereto.
  • a promoter sequence includes the minimum number of bases or elements necessary to initiate transcription of a sequence of interest at levels detectable above background.
  • a transcription initiation site within the promoter sequence is a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA or DNA polymerase.
  • promoter may be a nucleic acid sequence that is recognized by a DNA-dependent RNA polymerase ("transcriptase") as a signal to bind to the nucleic acid and begin the transcription of RNA at a specific site.
  • transcriptionase DNA-dependent RNA polymerase
  • Such transcriptases generally require DNA which is double-stranded in the portion comprising the promoter sequence and its complement; the template portion (sequence to be transcribed) need not be double-stranded.
  • RNA polymerase binds to a promoter sequence to initiate transcription, that promoter sequence is not part of the sequence transcribed. Thus, the RNA transcripts produced thereby will not include that sequence.
  • a control sequence "directs the transcription" of a nucleotide sequence when
  • RNA or DNA polymerase will bind the promoter sequence and transcribe the adjacent sequence.
  • a "DNA-dependent DNA polymerase” is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli and bacteriophage T7 DNA polymerase. All known DNA-dependent DNA polymerases require a complementary primer to initiate synthesis. Under suitable conditions, a DNA-dependent DNA polymerase may synthesize a complementary DNA copy from an RNA template.
  • a "DNA-dependent RNA polymerase” or a “transcriptase” is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially-double stranded DNA molecule having a (usually double-stranded) promoter sequence.
  • RNA molecules are synthesized in the 5' to 3' direction beginning at a specific position just downstream of the promoter.
  • examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.
  • An "RNA-dependent DNA polymerase” or “reverse transcriptase” is an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases.
  • a primer is required to initiate synthesis with both RNA and DNA templates.
  • RNAse H is an enzyme that degrades the RNA portion of an RNA:DNA duplex. These enzymes may be endonucleases or exonucleases. Most reverse transcriptase enzymes normally contain an RNAse H activity in addition to their polymerase activity. However, other sources of the RNAse H are available without an associated polymerase activity. The degradation may result in separation of RNA from a RNA:DNA complex. Alternatively, the RNAse H may simply cut the RNA at various locations such that portions of the RNA melt off or permit enzymes to unwind portions of the RNA.
  • polynucleotide oligonucleotide
  • nucleic acid nucleic acid molecule
  • polynucleotide oligonucleotide
  • nucleic acid molecule a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single- stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide examples include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Nirals, Inc., Corvallis, Oregon, as ⁇ eugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in D ⁇ A and R ⁇ A.
  • PNAs peptide nucleic acids
  • polymorpholino commercially available from the Anti-Nirals, Inc., Corvallis, Oregon
  • these terms include, for example, 3'- deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' P5' phosphoramidates, 2'-O-alkyl- substituted RNA, double- and single-stranded DNA, as well as double- and single- stranded RNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalklyphosphoramidates, amino
  • target nucleic acid region or “target nucleic acid” denotes a nucleic acid molecule with a “target sequence” to be amplified.
  • the target nucleic acid may be either single-stranded or double-stranded and may include other sequences besides the target sequence, which may not be amplified.
  • target sequence refers to the particular nucleotide sequence of the target nucleic acid which is to be amplified.
  • the target sequence may include a probe-hybridizing region contained within the target molecule with which a probe will form a stable hybrid under desired conditions.
  • target sequence may also include the complexing sequences to which the oligonucleotide primers complex and be extended using the target sequence as a template.
  • target sequence also refers to the sequence complementary to the "target sequence” as present in the target nucleic acid. If the "target nucleic acid” is originally double-stranded, the term “target sequence” refers to both the plus (+) and minus (-) strands.
  • primer refers to an oligonucleotide which acts to initiate synthesis of a complementary DNA strand when placed under conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA or RNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration.
  • the primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • a "primer” is complementary to a template, and complexes by hydrogen bonding or hybridization with the template to give a primer/template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3' end complementary to the template in the process of DNA synthesis.
  • probe or "oligonucleotide probe” refers to a structure comprised of a polynucleotide, as defined above, that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte.
  • the polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs.
  • an "oligonucleotide probe" is to be used in a 5' nuclease assay, such as the TaqManTM technique, the probe will contain at least one fluorescer and at least one quencher which is digested by the 5' endonuclease activity of a polymerase used in the reaction in order to detect any amplified target oligonucleotide sequences.
  • the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' to 3' nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers.
  • an oligonucleotide probe is used in the TMA technique, it will be suitably labeled, as described below.
  • hybridizing sequences need not have perfect complementarity to provide stable hybrids. In many situations, stable hybrids will form where fewer than about 10% of the bases are mismatches, ignoring loops of four or more nucleotides. Accordingly, as used herein the term “complementary” refers to an oligonucleotide that forms a stable duplex with its "complement” under assay conditions, generally where there is about 90% or greater homology.
  • hybridize and “hybridization” refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing.
  • target template
  • such complexes (or hybrids) are sufficiently stable to serve the priming function required by, e.g., the DNA polymerase to initiate DNA synthesis.
  • binding pair refers to first and second molecules that specifically bind to each other, such as complementary polynucleotide pairs capable of forming nucleic acid duplexes. "Specific binding" of the first member of the binding pair to the second member of the binding pair in a sample is evidenced by the binding of the first member to the second member, or vice versa, with greater affinity and specificity than to other components in the sample. The binding between the members of the binding pair is typically noncovalent. Unless the context clearly indicates otherwise, the terms “affinity molecule” and “target analyte” are used herein to refer to first and second members of a binding pair, respectively.
  • selective bind is meant that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules.
  • a DNA molecule will bind to a substantially complementary sequence and not to unrelated sequences.
  • the "melting temperature” or “Tm” of double-stranded DNA is defined as the temperature at which half of the helical structure of DNA is lost due to heating or other dissociation of the hydrogen bonding between base pairs, for example, by acid or alkali treatment, or the like.
  • the T m of a DNA molecule depends on its length and on its base composition. DNA molecules rich in GC base pairs have a higher T m than those having an abundance of AT base pairs. Separated complementary strands of DNA spontaneously reassociate or anneal to form duplex DNA when the temperature is lowered below the T m . The highest rate of nucleic acid hybridization occurs approximately 25 °C below the T m .
  • a "biological sample” refers to a sample of tissue or fluid isolated from a subject, that commonly includes antibodies produced by the subject. Typical samples that include such antibodies are known in the art and include but not limited to, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components.
  • label and “detectable label” refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, ligands (e.g., biotin, avidin, strepavidin or haptens) and the like.
  • fluorescer refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range.
  • solid support refers to a solid surface such as a magnetic bead, latex bead, microtiter plate well, glass plate, nylon, agarose, acrylamide, and the like.
  • the present invention is based on the discovery of novel diagnostic methods for accurately detecting Hepatitis B virus (HBV) infection in a biological sample.
  • the methods rely on sensitive nucleic acid-based detection techniques that allow identification of HBV target nucleic acid sequences in samples containing small amounts of virus.
  • the target nucleic acids are separated from non-homologous DNA/RNA using capture oligonucleotides immobilized on a solid support.
  • the capture oligonucleotides can be specific for the organism to be detected.
  • capture nucleotides comprising Seq ID Nos. 1, 2 3 and 4 ( Figures 1A-1D, respectively) are preferably used.
  • the separated target nucleic acids can then be detected by the use of oligonucleotide probes tagged with reporter groups, or amplified.
  • the separated target nucleic acids are preferably amplified using the primers in X region comprising sequences of Seq ID Nos.
  • the biological sample potentially carrying target nucleic acid is contacted with a solid support in association with capture oligonucleotides.
  • the capture oligonucleotides may be associated with the solid support, for example, by covalent binding of the probe moiety to the solid support, by affinity association, hydrogen binding, or nonspecific association.
  • the solid support may take many forms including, for example, nitrocellulose reduced to particulate form and retrievable upon passing the sample medium containing the support through a sieve; nitrocellulose or the materials impregnated with magnetic particles or the like, allowing the nitrocellulose to migrate within the sample medium upon the application of a magnetic field; beads or particles which may be filtered or exhibit electromagnetic properties; and polystyrene beads which partition to the surface of an aqueous medium.
  • a preferred embodiment of the present invention includes a solid support comprising magnetic beads.
  • the magnetic beads contain primary amine functional groups which facilitate covalent binding or association of the capture oligonucleotides to the magnetic support particles.
  • the magnetic beads have immobilized thereon homopolymers, such as poly T or poly A sequences.
  • the magnetic beads or particles can be produced using standard techniques or obtained from commercial sources.
  • the particles or beads may be comprised of magnetic particles, although they can also be other magnetic metal or metal oxides, whether in impure, alloy, or composite form, as long as they have a reactive surface and exhibit an ability to react to a magnetic field.
  • Other materials that may be used individually or in combination with iron include, but are not limited to, cobalt, nickel, and silicon.
  • a magnetic bead suitable for the application in the present invention includes magnetic beads containing poly dT groups marketed under the trade name Sera-MagTM magnetic oligonucleotide beads by Seradyn, Indianopolis, IN.
  • the association of the capture oligonucleotides with the solid support is initiated by contacting the solid support with the medium containing the capture oligonucleotides.
  • the magnetic bead containing poly dT groups is hybridized with the target sequences that comprise poly dA contiguous with the sequence selected from the conserved single stranded region of the HBV genome.
  • the poly dA on the capture oligonucleotide and the poly dT on the solid support hybridize thereby immobilizing or associating the capture oligonucleotides with the solid support.
  • the solid support with associated capture oligonucleotides is brought into contact with the biological sample under hybridizing conditions.
  • the capture oligonucleotides hybridize to the target strands present in the biological sample.
  • hybridizations of capture oligonucleotides to the targets can be accomplished in approximately 15 minutes, but may take as long as 3 to 48 hours.
  • the solid support is then separated from the biological sample by filtering, passing through a column, or by magnetic means. As will be appreciated by one of skill in the art, the method of separation will depend on the type of solid support selected. Since the targets are hybridized to the capture oligonucleotides immobilized on the solid support, the target strands are thereby separated from the impurities in the sample.
  • extraneous nucleic acids, proteins, carbohydrates, lipids, cellular debris, and other impurities may still be bound to the support, although at much lower concentrations than initially found in the biological sample.
  • Those skilled in the art will recognize that some undesirable materials can be removed by washing the support with a washing medium.
  • the separation of the solid support from the biological sample preferably removes at least about 70%, more preferably about 90% and, most preferably, at least about 95% of the non-target nucleic acids present in the sample.
  • the methods of the present invention may also include amplifying the captured target oligonucleotide to produce amplified nucleic acids.
  • Amplifying a target nucleic acid uses a nucleic acid polymerase to produce multiple copies of the target oligonucleotide or fragments thereof.
  • Suitable amplification techniques are well known in the art, such as, for example transcription associated amplification, polymerase chain reaction (PCR), replicase mediated amplification, and ligase chain reaction (LCR).
  • the capture oligonucleotides and the primers for use with the assays of the invention are preferably unique for the organism the presence of which is to be detected.
  • the capture oligonucleotides and primers are derived from the conserved regions in the single strand region of HBV, such as those shown in Figures 1 and 2.
  • Primers and capture oligonucleotides for use in the assays are readily synthesized by standard techniques, e.g., solid phase synthesis via phosphoramidite chemistry, as disclosed in U.S. Patent Nos. 4,458,066 and 4,415,732, incorporated herein by reference; Beaucage et al. (1992) Tetrahedron 48:2223-2311 ; and Applied Biosystems User Bulletin No. 13 (1 April 1987).
  • Other chemical synthesis methods include, for example, the phosphotriester method described by Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method disclosed by Brown et al., Meth. Enzymol. (1979) 68:109.
  • Poly(A) or poly(C), or other non-complementary nucleotide extensions may be incorporated into probes using these same methods. Hexaethylene oxide extensions may be coupled to probes by methods known in the art. Cload et al. (1991) J. Am. Chem. Soc. 113:6324-6326; U.S. Patent No. 4,914,210 to Levenson et al.; Durand et al. (1990) Nucleic Acids Res. 18:6353-6359; and Horn et al. (1986) Tet. Lett. 27:4705-4708.
  • the primer sequences are in the range of between 10-75 nucleotides in length, such as 15-60, 20-40 and so on, more typically in the range of between 18-40 nucleotides long, and any length between the stated 03/031934
  • the typical probe is in the range of between 10-50 nucleotides long, such as 15-40, 18-30, and so on, and any length between the stated ranges.
  • the probes may be coupled to labels for detection.
  • labels for detection.
  • derivatizing oligonucleotides with reactive functionalities which permit the addition of a label.
  • biotinylating probes so that radioactive, fluorescent, chemiluminescent, enzymatic, or electron dense labels can be attached via avidin. See, e.g., Broken et al., Nucl. Acids Res. (1978) 5:363-384 which discloses the use of ferritin-avidin-biotin labels; and Chollet et al. Nucl. Acids Res.
  • probes may be fluorescently labeled by linking a fluorescent molecule to the non-ligating terminus of the probe.
  • Guidance for selecting appropriate fluorescent labels can be found in Smith et al., Meth. Enzymol (1987) 155:260-301 ; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland (1989) Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, OR).
  • Certain methods utilize fluorescent molecules as the labels, as a number of commercial instruments have been developed for the detection of fluorescently labeled nucleic acids.
  • fluorescent molecules can be used as labels including, for example, fluorescein and fluorescein derivatives, rhodamine and rhodamine derivatives, naphthylamine and naphthylamine derivatives, cyanine and cyanine derivatives, benzamidizoles, ethidiums, propidiums, anthracyclines, mithramycins, acridines, actinomycins, merocyanines, coumarins, pyrenes, chrysenes, stilbenes, anthracenes, naphthalenes, salicyclic acids, benz-2-oxa-l-diazoles (also called benzofurazans), fluorescamines and bodipy dyes.
  • fluorescein and fluorescein derivatives rhodamine and rhodamine derivatives, naphthylamine and naphthylamine derivatives, cyanine and cyanine derivatives
  • donor and acceptor dyes are available.
  • donor and acceptor dyes include the xanthene dyes, such as fluorescein dyes, and rhodamine dyes. A variety of derivatives of these dyes are commercially available. Often functional groups are introduced into the phenyl group of these dyes to serve as a linkage site to an oligonucleotide.
  • Another general group of dyes includes the naphthylamines which have an amino group in the alpha or beta position.
  • Dyes of this general type include 1- dimethylaminonaphthyl-5-sulfonate, l-anilino-8-naphthalene sulfonate and 2-p- toluidinyl-6-naphthalene sulfonate.
  • dyes include 3-pheniyl-7-isocyanatocoumarini, acridines, such as 9- isothiocyanatoacridine and acridine orange, pyrenes, benzoxadiazoles, and stilbenes.
  • Additional dyes include 3 -( ⁇ -carboxypentyl)-3'-ethyl-5,5'-dimethyloxa-carbocyanine (CYA); 6-carboxy fluorescein (FAM); 5,6-carboxyrhodamine-l lO (R110); 6- carboxyrhodamine-6G (R6G); N',N',N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); 6-carboxy-X-rhodamine (ROX); 2', 4', 5', T, - tetrachloro-4-7- dichlorofluorescein (TET); 2', 7- dimethoxy - 4', 5'- 6 carboxyrhodamine (JOE); 6- carboxy-2',4,4',5',7,7'-hexachlorofluorescein (HEX); ALEXA; Cy3 and Cy5.
  • fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S. Patent No. 4,318,846 and Lee et al., Cytometry (1989) 10:151-164, and 6-FAM, JOE, TAMRA, ROX, HEX-1, HEX-2, ZOE, TET-1 or NAN-2, and the like.
  • probes can be labeled with an acridinium ester (AE) using the techniques described below. Current technologies allow the AE label to be placed at any location within the probe.
  • AE acridinium ester
  • an AE molecule can be directly attached to the probe using non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439.
  • an internal control (IC) or an internal standard is added to serve as a control for target capture and amplification.
  • the IC includes a sequence that differs from the target sequences, is capable of hybridizing with the probe sequences used for separating the oligonucleotides specific for the organism from the sample, and is capable of amplification.
  • the use of the internal control permits the control of the separation process, the amplification process, and the detection system, and permits the monitoring of the assay performance and quantization for the sample(s).
  • the IC can be included at any suitable point, for example, in the lysis buffer.
  • the IC comprises the M13 ssDNA containing a part of HBV nucleotide sequence and a unique sequence that hybridizes with the probe, for example, the IC for HBV comprises the region coding for HbsAg and Protein X where the target sequence is modified by substituting 5, 10 , or 15 or any number of integer bases with other bases.
  • the substitute bases preferably are located over the entire length of the target sequence such that only 2 or 3 consecutive sequences are replaced.
  • the target sequence is AGGTGAAGCGAAGTGCACACGG (SEQ ID NO.: 11)
  • the sequence is substituted with AGCTAGACCTGCATGTCACTG (SEQ ID NO.: 12) in the IC.
  • the solid support may additionally include probes specific to the internal standard (IC probe).
  • the internal control can thus be captured using the IC probe.
  • the IC probe can optionally be coupled with a detectable label that is different from the detectable label for the target sequence.
  • the detectable label is a fluorophore
  • the IC can be quantified spectrophorometrically and by limit of detection studies.
  • the copy number of IC which does not interfere with the target detection is determined by titrating the IC with a fixed IU of target, preferably at the lower end, and a standard curve is generated by diluting a sample of internationally accepted IU.
  • a five member panel of 90 IU - 4.5 IU can be used, while for seroconverion testing, a twelve member panel of 100,000 IU - 50 IU can be used.
  • an IC as described herein, is combined with RNA isolated from the sample according to standard techniques known to those of skill in the art.
  • the RNA is then reverse transcribed using a reverse transcriptase to provide copy DNA.
  • the cDNA sequences can be optionally amplified (e.g., by PCR) using labeled primers.
  • the amplification products are separated, typically by electrophoresis, and the amount of radioactivity (proportional to the amount of amplified product) is determined.
  • the amount of mRNA in the sample is then calculated by comparison with the signal produced by the known standards.
  • the primers and probes described above may be used in polymerase chain reaction (PCR)-based techniques to detect HBV infection in biological samples.
  • PCR is a technique for amplifying a desired target nucleic acid sequence contained in a nucleic acid molecule or mixture of molecules.
  • a pair of primers is employed in excess to hybridize to the complementary strands of the target nucleic acid.
  • the primers are each extended by a polymerase using the target nucleic acid as a template.
  • the extension products become target sequences themselves after dissociation from the original target strand.
  • New primers are then hybridized and extended by a polymerase, and the cycle is repeated to geometrically increase the number of target sequence molecules.
  • the PCR method for amplifying target nucleic acid sequences in a sample is well known in the art and has been described in, e.g., Innis et al.
  • PCR uses relatively short oligonucleotide primers which flank the target nucleotide sequence to be amplified, oriented such that their 3' ends face each other, each primer extending toward the other.
  • the polynucleotide sample is extracted and denatured, preferably by heat, and hybridized with first and second primers which are present in molar excess.
  • Polymerization is catalyzed in the presence of the four deoxyribonucleotide triphosphates (dNTPs ⁇ dATP, dGTP, dCTP and dTTP) using a primer- and template-dependent polynucleotide polymerizing agent, such as any enzyme capable of producing primer extension products, for example, E.
  • dNTPs deoxyribonucleotide triphosphates
  • thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs). This results in two "long products" which contain the respective primers at their 5' ends covalently linked to the newly synthesized complements of the original strands.
  • the reaction mixture is then returned to polymerizing conditions, e.g., by lowering the temperature, inactivating a denaturing agent, or adding more polymerase, and a second cycle is initiated.
  • the second cycle provides the two original strands, the two long products from the first cycle, two new long products replicated from the original strands, and two "short products" replicated from the long products.
  • the short products have the sequence of the target sequence with a primer at each end.
  • an additional two long products are produced, and a number of short products equal to the number of long and short products remaining at the end of the previous cycle.
  • the number of short products containing the target sequence grow exponentially with each cycle.
  • PCR is carried out with a commercially available thermal cycler, e.g., Perkin Elmer.
  • RNAs may be amplified by reverse transcribing the mRNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Patent No. 5,322,770. mRNA may also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Meth. App. 4:80- 84.
  • the fluorogenic 5' nuclease assay known as the TaqManTM assay (Perkin-Elmer), is a powerful and versatile PCR-based detection system for nucleic acid targets.
  • primers and probes derived from regions of the HBV genome described herein can be used in TaqManTM analyses to detect the presence of infection in a biological sample. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals.
  • the assay system dispenses with the need for gel electrophoretic analysis, and has the capability to generate quantitative data allowing the determination of target copy numbers.
  • the fluorogenic 5' nuclease assay is conveniently performed using, for example, AmpliTaq GoldTM DNA polymerase, which has endogenous 5' nuclease activity, to digest an internal oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher (see, Holland et al., Proc. Natl AcadSci. USA (1991) 88:7276-7280; and Lee et al., Nucl. Acids Res. (1993) 21:3761-3766). Assay results are detected by measuring changes in fluorescence that occur during the amplification cycle as the fluorescent probe is digested, uncoupling the dye and quencher labels and causing an increase in the fluorescent signal that is proportional to the amplification of target DNA.
  • the amplification products can be detected in solution or using solid supports.
  • the TaqManTM probe is designed to hybridize to a target sequence within the desired PCR product.
  • the 5' end of the TaqManTM probe contains a fluorescent reporter dye.
  • the 3' end of the probe is blocked to prevent probe extension and contains a dye that will quench the fluorescence of the 5' fluorophore.
  • the 5' fluorescent label is cleaved off if a polymerase with 5' exonuclease activity is present in the reaction. Excision of the 5' fluorophore results in an increase in fluorescence which can be detected.
  • the present invention relates to methods for amplifying a target HBV nucleotide sequence using a nucleic acid polymerase having 5' to 3' nuclease activity, one or more primers capable of hybridizing to the HBV target sequence, and an oligonucleotide probe capable of hybridizing to the HBV target sequence 3' relative to the primer.
  • the polymerase digests the oligonucleotide probe when it is hybridized to the target sequence, thereby separating the reporter molecule from the quencher molecule.
  • the fluorescence of the reporter molecule is monitored, with fluorescence corresponding to the occurrence of nucleic acid amplification.
  • the reporter molecule is preferably a fluorescein dye and the quencher molecule is preferably a rhodamine dye.
  • the probe sequences are selected such that they have a higher melt temperature than the primer sequences.
  • the probe sequences have anestimated melt temperature that is about 10 °C higher than the melt temperature for the amplification primer sequences.
  • the primer, sequences are generally shorter than the probe sequences.
  • the primer sequences are in the range of between 10-75 nucleotides long, more typically in the range of 20-45.
  • the typical probe is in the range of between 10-50 nucleotides long, more typically 15-40 nucleotides in length.
  • the oligonucleotide probe may be attached to the solid support in a variety of manners.
  • the probe may be attached to the solid support by attachment of the 3' or 5' terminal nucleotide of the probe to the solid support.
  • the probe is attached to the solid support by a linker which serves to distance the probe from the solid support.
  • the linker is usually at least 15- 30 atoms in length, more preferably at least 15-50 atoms in length. The required length of the linker will depend on the particular solid support used. For example, a six atom linker is generally sufficient when high cross-linked polystyrene is used as the solid support.
  • linkers are known in the art which may be used to attach the oligonucleotide probe to the solid support.
  • the linker may be formed of any compound which does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support.
  • the linker may be formed of a homopolymeric oligonucleotide which can be readily added on to the linker by automated synthesis.
  • polymers such as functionalized polyethylene glycol can be used as the linker. Such polymers are preferred over homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probe to the target oligonucleotide. Polyethylene glycol is particularly preferred.
  • linkages between the solid support, the linker and the probe are preferably not cleaved during removal of base protecting groups under basic conditions at high temperature.
  • preferred linkages include carbamate and amide linkages.
  • Examples of preferred types of solid supports for immobilization of the oligonucleotide probe include controlled pore glass, glass plates, polystyrene, avidin- coated polystyrene beads, cellulose, nylon, acrylamide gel and activated dextran.
  • TMA transcription-mediated amplification
  • TMA is an isothemal, autocatalytic nucleic acid target amplification system that can provide more than a billion RNA copies of a target sequence.
  • the assay can be done qualitatively, to accurately detect the presence or absence of the target sequence in a biological sample.
  • the assay can also provide a quantitative measure of the amount of target sequence over a concentration range of several orders of magnitude.
  • TMA provides a method for autocatalytically synthesizing multiple copies of a target nucleic acid sequence without repetitive manipulation of reaction conditions such as temperature, ionic strength and pH.
  • TMA includes the following steps: (a) isolating nucleic acid, including RNA, from the biological sample of interest suspected of being infected with HBV; and (b) combining into a reaction mixture (i) the isolated nucleic acid, (ii) first and second oligonucleotide primers, the first primer having a complexing sequence sufficiently complementary to the 3' terminal portion of an RNA target sequence, if present (for example the (+) strand), to complex therewith, and the second primer having a complexing sequence sufficiently complementary to the 3' terminal portion of the target sequence of its complement (for example, the (-) strand) to complex therewith, wherein the first oligonucleotide further comprises a sequence 5' to the complexing sequence which includes a promoter, (iii) a reverse transcriptase 03/031934
  • RNA and DNA dependent DNA polymerases (iv) an enzyme activity which selectively degrades the RNA strand of an RNA-DNA complex (such as an RNAse H) and (v) an RNA polymerase which recognizes the promoter.
  • the components of the reaction mixture may be combined stepwise or at once.
  • the reaction mixture is incubated under conditions whereby an oligonucleotide/target sequence is formed, including DNA priming and nucleic acid synthesizing conditions (including ribonucleotide triphosphates and deoxyribonucleotide triphosphates) for a period of time sufficient to provide multiple copies of the target sequence.
  • the reaction advantageously takes place under conditions suitable for maintaining the stability of reaction components such as the component enzymes and without requiring modification or manipulation of reaction conditions during the course of the amplification reaction. Accordingly, the reaction may take place under conditions that are substantially isothermal and include substantially constant ionic strength and pH.
  • the reaction conveniently does not require a denaturation step to separate the RNA-DNA complex produced by the first DNA extension reaction.
  • Suitable DNA polymerases include reverse transcriptases, such as avian myeloblastosis virus (AMV) reverse transcriptase (available from, e.g., Seikagaku America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase (available from, e.g., Bethesda Research Laboratories).
  • AMV avian myeloblastosis virus
  • MMLV Moloney murine leukemia virus
  • Promoters or promoter sequences suitable for incorporation in the primers are nucleic acid sequences (either naturally occurring, produced synthetically or a product of a restriction digest) that are specifically recognized by an RNA polymerase that recognizes and binds to that sequence and initiates the process of transcription whereby RNA transcripts are produced.
  • the sequence may optionally include nucleotide bases extending beyond the actual recognition site for the RNA polymerase which may impart added stability or susceptibility to degradation processes or increased transcription efficiency.
  • useful promoters include those which are recognized by certain bacteriophage polymerases such as those from bacteriophage T3, T7 or SP6, or a promoter from E. coli. These RNA polymerases are readily available from commercial sources, such as New England Biolabs and Epicentre. 03/031934
  • RNAse H activity
  • AMV reverse transcriptase RNAse H activity
  • exogenous RNAse H such as E. coli RNAse H
  • RNAse H is readily available from, e.g., Bethesda Research Laboratories.
  • RNA transcripts produced by these methods may serve as templates to produce additional copies of the target sequence through the above-described mechanisms.
  • the system is autocatalytic and amplification occurs autocatalytically without the need for repeatedly modifying or changing reaction conditions such as temperature, pH, ionic strength or the like.
  • Detection may be done using a wide variety of methods, including direct sequencing, hybridization with sequence-specific oligomers, gel electrophoresis and mass spectrometry. these methods can use heterogeneous or homogeneous formats, isotopic or nonisotopic labels, as well as no labels at all.
  • One preferable method of detection is the use of target sequence-specific oligonucleotide probes described above.
  • the probes may be used in hybridization protection assays (HP A).
  • the probes are conveniently labeled with acridinium ester (AE), a highly chemiluminescent molecule. See, e.g., Nelson et al.
  • One AE molecule is directly attached to the probe using a non- nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439. Chemiluminescence is triggered by reaction with alkaline hydrogen peroxide which yields an excited N-methyl acridone that subsequently collapses to ground state with the emission of a photon.
  • the AE molecule is covalently attached to a nucleic acid probe, hydrolysis is rapid under mildly alkaline conditions.
  • the rate of AE hydrolysis is greatly reduced.
  • hybridized and unhybridized AE-labeled probe can be detected directly in solution, without the need for physical separation.
  • HPA generally consists of the following steps: (a) the AE-labeled probe is hybridized with the target nucleic acid in solution for about 15 to about 30 minutes. A mild alkaline solution is then added and AE coupled to the unhybridized probe is hydrolyzed. This reaction takes approximately 5 to 10 minutes. The remaining hybrid-associated AE is detected as a measure of the amount of target present. This step takes approximately 2 to 5 seconds.
  • the differential hydrolysis step is conducted at the same temperature as the hybridization step, typically at 50 to 70 °C. Alternatively, a second differential hydrolysis step may be conducted at room temperature.
  • HPA is described in detail in, e.g., U.S. Patent Nos. 6,004,745; 5,948,899; and 5,283,174, the disclosures of which are incorporated by reference herein in their entireties.
  • TMA is described in detail in, e.g., U.S. Patent No. 5,399,491, the disclosure of which is incorporated herein by reference in its entirety.
  • an isolated nucleic acid sample suspected of containing a HBV target sequence, is mixed with a buffer concentrate containing the buffer, salts, magnesium, nucleotide triphosphates, primers, dithiothreitol, and spermidine.
  • the reaction is optionally incubated at about 100 °C for approximately two minutes to denature any secondary structure.
  • reverse transcriptase, RNA polymerase, and RNAse H are added and the mixture is incubated for two to four hours at 37 °C.
  • the reaction can then be assayed by denaturing the product, adding a probe solution, incubating 20 minutes at 60 °C, adding a solution to selectively hydrolyze the unhybridized probe, incubating the reaction six minutes at 60 °C, and measuring the remaining chemiluminescence in a luminometer.
  • two or more of the tests described above are performed to confirm the presence of the organism.
  • TMA transcription mediated amplification
  • NAT alternative nucleic acid testing
  • Hepatitis B virus can be specifically and selectively detected even when the sample contains other organisms, such as HIV, and parvovirus B19, for example.
  • design of the assays described herein are subject to a great deal of variation, and many formats are known in the art. The above descriptions are merely provided as guidance and one of skill in the art can readily modify the described protocols, using techniques well known in the art.
  • the above-described assay reagents can be provided in kits, with suitable instructions and other necessary reagents, in order to conduct the assays as described above.
  • the kit will normally contain in separate containers the combination of primers and probes (either already bound to a solid matrix or separate with reagents for binding them to the matrix), control formulations (positive and/or negative), labeled reagents when the assay format requires same and signal generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly.
  • kit can also contain, depending on the particular assay used, other packaged reagents and materials (i.e. wash buffers and the like). Standard assays, such as those described above, can be conducted using these kits.
  • HBV nucleic acid positive serum was purchased from Acrometrix (Berkeley, CA). Two approaches were used to isolate nucleic acid from 0.5 ml of plasma/serum. In particular, DNA was extracted by (a) binding to silica; and (b) annealing to target-specific oligonucleotides.
  • the lysis buffer used was from Organon-Teknika (Durham, NC). This lysis buffer contains guanidinium isothiocyanate to solubilize proteins and inactivate RNases and DNases. The detergent Triton X-100 further facilitates the process of solubilization and disintegration of cell structure and nuclear proteins, thus releasing nucleic acid.
  • the lysis reagent was acidified to enhance nucleic acid binding, and 50 ⁇ l of alkaline elution buffer was used to elute the bound nucleic acid. Following nucleic acid isolation, the presence of HBN was determined by performing TaqManTM PCR, as described below.
  • the antisense capture oligonucleotides used were as follows: VHBVC31 - AAAAAAAAAAAAAAAAAAAAATITCCCCCACTGTTTGGCTTTCAG (nt716- 729) (Seq ID No.: 1)
  • VHBVC36 AAAAAAAAAAAAAAAAAAAATGCTGCTATGCCTCATCTTC (nt414-434) (Seq ID No.: 2)
  • VHBVC38 AAAAAAAAAAAAAAAAAAAATTCGCAGTCCCCAACCTCCA (nt310-330)
  • the magnetic beads were suspended in Novagen lysis buffer (Madison, WI) and a series of twenty capture oligonucleotides (VHBVC22 - VHBVC41 complementary to the conserved region as described above) were tested individually or in combination, to capture HBV DNA from a serum sample purchased from
  • Example 2 Bead Wash Buffer Following capture, the beads were washed with a buffer containing 10 mM Hepes buffered to pH 7.5 in 0.3 M NaCl., and 0.5% NP-40. After treatment of serum with lysis buffer, hybridization, magnetic adsorption of beads, and removal of lysis buffer, 1.5 ml of the wash buffer was added to the beads. Following the usual vortexing, magnetic adsorption, and removal of the wash buffer, the beads were washed a second time in 0.5 ml of the same buffer, so that the magnetic beads can be compacted, for easy suspension in 100 ml of Universal PCR buffer containing all the reagents for the Taqman assay. The beads with the captured DNA were transferred to a TaqManTM plate for detection by TaqManTM PCR as described below. Several oligonucleotide combinations were efficient at capturing HBV as detected by TaqManTM assay.
  • Example 3 Detection and Ouantitation of HBV DNA by TaqManTM
  • the TaqManTM technology amplifies captured target nucleic acid as DNA amplicons.
  • An alternative is amplifying the captured target as RNA.
  • amplification oligonucleotides consisted of a HBV-specific primer.
  • the primers were as follows: Amplification primers in X region VHBV1 - CCGTCTGTGCCTTCTCATCTG (sense primer nt 1549-1570) (Seq ID No.: 5)
  • VHBV23- ACCAATTTATGCCTACAGCCTCC (anti-sense primer nt 1778-1801) (Seq ID No: 8)
  • VHBV24 - GGTCTCCATGCGACGTGCAG ((anti-sense primer ntl599-1618) (Seq ID No.: 9)
  • VBV26 - GGTTTCCATGTAACGTGCAG (anti-sense primer ntl599-1618) (Seq ID No.: 10)
  • the nucleic acid from Example 1 was diluted to obtain about 100 IU/20 ⁇ l.
  • the TaqManTM reaction mix in a final volume of 50 ml contained: 25 ml of TaqManTM universal PCR master Mix, 45 pmol of each of the amplification primers, and 8 pmol of the probe.
  • the reaction conditions included 50 °C for AmpEase UNG activity, 10 min at 95 °C to activate the enzyme followed by 45 cycles of 30 seconds at 95 °C, alternating with 30 seconds at 60 °C in ABI 7900 Sequence Detector.
  • Six sets of PCR amplification primers (NHBNl - VHBV26) corresponding to conserved regions within S -antigen, core, and Region X were tested.
  • VHBV1, 24, and 26 primers were VHBV3 and 19.
  • the primers in the X region tolerated a wide range of Mg 2+ concentration (2-5 mM) and therefore were preferred.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Communicable Diseases (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
PCT/US2002/032367 2001-10-09 2002-10-09 Identification of oligonucleotides for the capture, detection and quantitation of hepatitis b viral dna Ceased WO2003031934A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP02782145A EP1451352A4 (en) 2001-10-09 2002-10-09 IDENTIFICATION OF OLIGONUCLEOTIDES FOR DETECTION, DETECTION AND QUANTIFICATION OF HEPATITIS B VIRUS DNA
JP2003534867A JP2005505289A (ja) 2001-10-09 2002-10-09 B型肝炎ウイルスdnaの捕獲、検出および定量のためのオリゴヌクレオチドの同定

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US32849201P 2001-10-09 2001-10-09
US60/328,492 2001-10-09
US36882302P 2002-03-29 2002-03-29
US60/368,823 2002-03-29
US39356102P 2002-07-02 2002-07-02
US60/393,561 2002-07-02

Publications (2)

Publication Number Publication Date
WO2003031934A2 true WO2003031934A2 (en) 2003-04-17
WO2003031934A3 WO2003031934A3 (en) 2003-08-14

Family

ID=27406605

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/032367 Ceased WO2003031934A2 (en) 2001-10-09 2002-10-09 Identification of oligonucleotides for the capture, detection and quantitation of hepatitis b viral dna

Country Status (4)

Country Link
US (1) US20030143527A1 (https=)
EP (1) EP1451352A4 (https=)
JP (1) JP2005505289A (https=)
WO (1) WO2003031934A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005071401A3 (en) * 2004-01-15 2005-12-01 Chiron Corp Homogeneous multiplex assay for nucleic acid targets
EP1513958A4 (en) * 2002-06-14 2006-05-17 Gen Probe Inc Compositions and methods for detecting hepatitis b virus
WO2010092595A3 (en) * 2009-02-13 2010-10-14 Bigtec Private Limited Oligonucleotide probes and primers for detection of hepatitis b virus
WO2010096036A3 (en) * 2008-05-14 2010-11-18 Millennium Pharmaceuticals, Inc. Methods and kits for monitoring the effects of immunomodulators on adaptive immunity
US8642752B2 (en) 2011-04-21 2014-02-04 Isis Pharmaceuticals, Inc. Modulation of Hepatitis B virus (HBV) expression
CN114107446A (zh) * 2021-12-16 2022-03-01 福建和瑞基因科技有限公司 一种核酸的检测试剂盒及其检测方法

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070077554A1 (en) * 2005-09-30 2007-04-05 Parshionikar Sandhya U Homologous viral internal controls for use in RT-PCR assays of enteric viruses
WO2007078029A1 (en) * 2006-01-05 2007-07-12 Catch By Gene Co., Ltd. A quantitative method for hbv-dna, a primer and probe for detecting hbv-dna, and a detecting kit comprising the same
EP2205617A4 (en) * 2007-11-06 2013-10-16 Siemens Healthcare Diagnostics HEPATITIS B-VIRUS-SPECIFIC OLIGONUCLEOTIDE SEQUENCES
JP2009201361A (ja) * 2008-02-26 2009-09-10 Jsr Corp B型肝炎ウイルスdna捕捉用プローブおよびプローブ固定化固相担体
US9879330B2 (en) * 2008-04-05 2018-01-30 Versitech Limited Hepatitis B variants with reduced sensitivity to therapeutic compounds, their detection and uses thereof
US9834818B2 (en) 2012-11-01 2017-12-05 Siemens Healthcare Diagnostics Inc. Method of quantitating the amount of a target nucleic acid in a sample
US10508313B2 (en) * 2016-11-21 2019-12-17 Gen-Probe Incorporated Compositions and methods for detecting or quantifying Hepatitis B virus
CN111808985A (zh) * 2019-04-11 2020-10-23 北京大学 超敏检测NAs治疗下乙型肝炎病毒DNA的寡核苷酸组合物、试剂盒、方法及用途

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4562159A (en) * 1981-03-31 1985-12-31 Albert Einstein College Of Medicine, A Division Of Yeshiva Univ. Diagnostic test for hepatitis B virus
US5288609A (en) * 1984-04-27 1994-02-22 Enzo Diagnostics, Inc. Capture sandwich hybridization method and composition
US4775619A (en) * 1984-10-16 1988-10-04 Chiron Corporation Polynucleotide determination with selectable cleavage sites
DE3708541A1 (de) * 1987-03-17 1988-10-13 Agfa Gevaert Ag Haertungsmittel fuer proteine, eine damit gehaertete bindemittelschicht und ein eine solche schicht enthaltendes fotografisches aufzeichnungsmaterial
US5359100A (en) * 1987-10-15 1994-10-25 Chiron Corporation Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers
US5780219A (en) * 1989-07-11 1998-07-14 Gen-Probe Incorporated Nucleic acid amplification oligonucleotides and probes to human hepatitis B virus
US5629153A (en) * 1990-01-10 1997-05-13 Chiron Corporation Use of DNA-dependent RNA polymerase transcripts as reporter molecules for signal amplification in nucleic acid hybridization assays
US5849481A (en) * 1990-07-27 1998-12-15 Chiron Corporation Nucleic acid hybridization assays employing large comb-type branched polynucleotides
US6136535A (en) * 1991-11-14 2000-10-24 Digene Corporation Continuous amplification reaction
EP0618924B1 (en) * 1991-12-23 2001-02-14 Bayer Corporation Hbv amplifier probes for use in solution phase sandwich hybridization assays
JPH05308999A (ja) * 1992-05-08 1993-11-22 Sumitomo Metal Ind Ltd B型肝炎ウイルスpre−C変異の判定法
US5679510A (en) * 1993-04-27 1997-10-21 Hybridon, Inc. Quantitative detection of specific nucleic acid sequences using lambdoid bacteriophages linked by oligonucleotides to solid support
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
ZA973367B (en) * 1996-04-19 1997-11-18 Innogenetics Nv Method for typing and detecting HBV.
EP0975807B1 (en) * 1997-05-02 2006-09-27 Gen-Probe Incorporated Two-step hybridization and capture of a polynucleotide
US6110628A (en) * 1997-08-01 2000-08-29 Canon Kabushiki Kaisha Electrophotographic photosensitive member, process cartridge, and electrophotographic apparatus
US6225053B1 (en) * 1997-12-12 2001-05-01 Digene Corporation Detection of hepatitis B virus
US6682884B2 (en) * 2002-01-03 2004-01-27 Vijay Sharma Method and device for the rapid clinical diagnosis of hepatitis B virus (HBV) infection in biological samples

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9109264B2 (en) 2002-06-14 2015-08-18 Gen-Probe Incorporated Compositions and methods for detecting hepatitis B virus
US10745767B2 (en) 2002-06-14 2020-08-18 Gen-Probe Incorporated Compositions and methods for detecting hepatitis B virus
US7785844B2 (en) 2002-06-14 2010-08-31 Gen-Probe Incorporated Compositions and methods for detecting hepatitis B virus
US9914982B2 (en) 2002-06-14 2018-03-13 Gen-Probe Incorporated Compositions and methods for detecting hepatitis B virus
EP2292801A3 (en) * 2002-06-14 2011-09-21 Gen-Probe Incorporated Compositions and methods for detecting hepatitis B virus
EP1513958A4 (en) * 2002-06-14 2006-05-17 Gen Probe Inc Compositions and methods for detecting hepatitis b virus
WO2005071401A3 (en) * 2004-01-15 2005-12-01 Chiron Corp Homogeneous multiplex assay for nucleic acid targets
WO2010096036A3 (en) * 2008-05-14 2010-11-18 Millennium Pharmaceuticals, Inc. Methods and kits for monitoring the effects of immunomodulators on adaptive immunity
JP2011520446A (ja) * 2008-05-14 2011-07-21 ミレニアム・ファーマシューティカルズ・インコーポレイテッド 適応免疫における免疫調節物質の効果をモニターするための方法およびキット
WO2010092595A3 (en) * 2009-02-13 2010-10-14 Bigtec Private Limited Oligonucleotide probes and primers for detection of hepatitis b virus
CN102317474A (zh) * 2009-02-13 2012-01-11 彼格泰格私人有限公司 用于检测乙型肝炎病毒的寡核苷酸探针及引物
US8642752B2 (en) 2011-04-21 2014-02-04 Isis Pharmaceuticals, Inc. Modulation of Hepatitis B virus (HBV) expression
US9677076B2 (en) 2011-04-21 2017-06-13 Ionis Pharmaceuticals, Inc. Modulation of hepatitis B virus (HBV) expression
CN114107446A (zh) * 2021-12-16 2022-03-01 福建和瑞基因科技有限公司 一种核酸的检测试剂盒及其检测方法

Also Published As

Publication number Publication date
WO2003031934A3 (en) 2003-08-14
JP2005505289A (ja) 2005-02-24
EP1451352A2 (en) 2004-09-01
EP1451352A4 (en) 2006-06-21
US20030143527A1 (en) 2003-07-31

Similar Documents

Publication Publication Date Title
US20120219941A1 (en) Identification of Oligonucleotides for the Capture, Detection and Quantitation of Hepatitis A Viral Nucleic Acid
US8551706B2 (en) Identification of oligonucleotides for the capture, detection and quantitation of West Nile Virus
AU2007231822B2 (en) Diagnostic assays for parvovirus B19
US20030143527A1 (en) Identification of oligonucleotides for the capture, detection and quantitation of hepatitis B viral DNA
AU2002348426A1 (en) Identification of oligonucleotides for the capture, detection and quantitation of hepatitis B viral DNA

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CH CN CU CZ DE DK EE ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MD MK MN MW MX NO NZ PL PT RO RU SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002348426

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003534867

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002782145

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002782145

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2002782145

Country of ref document: EP