WO2002092128A1 - Compositions et procedes permettant de reguler le phosphate de serum - Google Patents

Compositions et procedes permettant de reguler le phosphate de serum Download PDF

Info

Publication number
WO2002092128A1
WO2002092128A1 PCT/US2002/018609 US0218609W WO02092128A1 WO 2002092128 A1 WO2002092128 A1 WO 2002092128A1 US 0218609 W US0218609 W US 0218609W WO 02092128 A1 WO02092128 A1 WO 02092128A1
Authority
WO
WIPO (PCT)
Prior art keywords
fgf
phex
frp
agent
polynucleotide encoding
Prior art date
Application number
PCT/US2002/018609
Other languages
English (en)
Inventor
Susan C. Schiavi
Richard Finnegan
Original Assignee
Genzyme Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corporation filed Critical Genzyme Corporation
Publication of WO2002092128A1 publication Critical patent/WO2002092128A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6489—Metalloendopeptidases (3.4.24)
    • C12N9/6494—Neprilysin (3.4.24.11), i.e. enkephalinase or neutral-endopeptidase 24.11
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/24—Metalloendopeptidases (3.4.24)
    • C12Y304/24011—Neprilysin (3.4.24.11), i.e. enkephalinase or neutral endopeptidase 24.11
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to methods and compositions for regulating serum phosphate or phosphate homeostasis. More specifically, the present invention relates to methods and compositions for increasing or decreasing serum phosphate levels for the treatment and/or prevention of a variety of phosphate-related diseases and disorders in subjects, such as warm-blooded animals including humans.
  • Oncogenic osteomalacia is an acquired hypophosphatemic syndrome associated with a variety of mesenchymal tumors and is characterized by low serum levels of phosphate and calcitriol, inappropriate phosphaturia secondary to inhibition of proximal renal tubular phosphate reabsorption, and defective bone demineralization.
  • OOM is caused by a humoral factor, termed phosphatonin (PTN), that is produced by these mesenchymal tumors.
  • PTN humoral factor
  • Tumor extracts can inhibit phosphate transport in vitro and produce phosphaturia and hypophosphatemia in vivo.
  • surgical removal of tumor tissue results in normalization of serum phosphorous and calcitriol, reverses phosphaturia and eventually results in remineralization of bone.
  • the mesenchymal tumors that are associated with OOM are characteristically slow- growing, complex, polymo ⁇ hous neoplasms. Many of these mesenchymal tumors contain areas of dystrophic calcification, osseous metaplasia, poorly differentiated foci of chondroid tissue and osteoclast-like giant cells. The presence of these bony elements and calcification suggest these tumors express genes that have important functions in bone formation and mineralization. OOM is clinically and biochemically similar to inherited disorders of phosphate wasting, X-linked Hypophosphatemic Rickets (XLH) and Autosomal Dominant Hypophosphatemic Rickets (ADHR).
  • XLH X-linked Hypophosphatemic Rickets
  • ADHR Autosomal Dominant Hypophosphatemic Rickets
  • XLH is caused by haploinsufficency of PHEX, an endopeptidase whose substrate is yet undefined.
  • FGF 23 a novel member of the fibroblast growth factor family
  • the PHEX gene (formerly PEX; Phosphate regulating gene with homologies to Endopeptidases on the X chromosome) was identified by a positional cloning approach as the candidate gene for X-linked hypophosphatemia (XLH), Francis et al. (1995) Nat. Genetics 11:130-136.
  • XLH X-linked hypophosphatemia
  • Francis et al. (1995) Nat. Genetics 11:130-136 Several groups have cloned and sequenced the human and mouse PHEX/phex cD ⁇ As. Du et al. (1996) Genomics 36:22-28; Lipman et al. (1998) J. Biol. Chem.
  • the present invention provides methods for modulating the phenotype of a neoplastic cell associated with oncogenic osteomalacia or a cell associated with phosphate homeostasis, comprising delivering an agent that alters the activity of FRP 4, FGF 23 or PHEX polypeptide within the cell.
  • the present invention provides methods for increasing phosphate re- abso ⁇ tion or increasing serum phosphate in a subject comprising delivering to the subject an effective amount of an agent that inhibits the activity of FRP 4 or FGF 23.
  • the invention also provides methods for decreasing phosphate re-abso ⁇ tion or decreasing serum phosphate in a subject comprising delivering to the subject an effective amount of an agent that enhances the activity of FRP 4 or FGF 23 or inhibits the activity of PHEX.
  • a method of inhibiting the activity of FGF 23 and FRP 4 proteins in a subject may comprise delivering to the subject an effective amount of soluble PHEX protein, PHEX protein, a polynucleotide encoding soluble PHEX, a polynucleotide encoding PHEX, a polynucleotide encoding anti-FGF 23 and/or anti-FRP 4 antibodies, or a composition comprising anti-FGF 23 and/or anti-FRP 4 antibodies.
  • the present invention provides a method of enhancing the biological activity of FGF 23 and or FRP 4 proteins in a subject, comprising delivering to the subject an effective amount of an anti-PHEX antibody, a polynucleotide encoding an anti-PHEX antibody, a polynucleotide encoding FGF 23 or FRP 4 proteins, or a composition comprising an effective amount of FGF 23 and or FRP 4 proteins.
  • aspects of the invention include methods of enhancing the biological activity of FGF 23 and FRP 4 proteins in a subject comprising delivering to the subject an effective amount of an agent that inhibits transcription and/or translation of PHEX genes in the subject, methods for modulating renal phosphate transport in a subject comprising delivering to the subject an effective amount of an agent that alters the activity of FRP 4 and FGF 23 or PHEX, in the subject, and methods of modulating renal phosphate transport comprising delivering to the subject an effective amount of an agent that alters the expression of FRP 4 and/or FGF 23 polynucleotides or PHEX polynucleotide.
  • This invention also provides methods for decreasing the biological activity of FRP 4 and FGF 23 proteins by delivering an effective amount of PHEX, or an agent that modulates PHEX gene expression and/or the biological activity of PHEX protein or stabilizes the PHEX protein.
  • PHEX can be delivered as a polynucleotide encoding for PHEX or soluble PHEX protein. Soluble PHEX and/or PHEX proteins can also be utilized to regulate FRP 4 and FGF 23.
  • This invention further provides methods for modulating phosphate homeostasis and/or renal phosphate transport by delivering agents that alter the expression or activity of PHEX, or stabilizes PHEX or the soluble PHEX protein which in turn alters the activity of FRP 4 and FGF 23 proteins.
  • Pathologies such as XLH and ADHR, that are caused by genetic disregulation of these genes, are also ameliorated or treated.
  • Other therapeutic benefits include, but are not limited to modulating bone mineralization, modulating renal phosphate transport, alleviating oncogenic osteomalacia-associated symptoms, treating phosphate homeostasis-related disease and FRP 4 related apoptosis and osteoarthritis (OA).
  • the invention further provides methods for increasing phosphate re-abso ⁇ tion or increasing serum phosphate by delivering to a subject one or more of PHEX protein, soluble PHEX protein, polynucleotides encoding PHEX and/or soluble PHEX, anti-FGF 23 and - FRP 4 antibodies and polynucleotides encoding anti-FGF 23 and -FRP 4 antibodies.
  • the invention further provides methods for increasing phosphate re-abso ⁇ tion or increasing serum phosphate by delivering to a subject PHEX and/or soluble PHEX and/or one or more agents that inhibit the stability (e.g., promote degradation or inactivation) of the FGF 23 and FRP 4 proteins.
  • This invention provides isolated polynucleotides useful in the methods identified herein.
  • the polynucleotides encode FRP 4 protein, PHEX, and FGF 23, ADHR mutant, FGF 23, (hereinafter “mutant FGF 23") as well as antibodies that specifically recognize and bind these proteins, and are intended to include DNA, cDNA, RNA and genomic DNA.
  • Expression systems including gene delivery vehicles such as liposomes and vectors, and host cells containing the polynucleotides are further provided by this invention.
  • the present invention also provides proteins encoded by the polynucleotides. Additionally, nucleic acid probes and primers that hybridize to invention polynucleotides are provided, as well as isolated nucleic acids comprising unique, expressed gene sequences.
  • the present invention further includes antisense oligonucleotides (e.g., antisense FGF-23 or antisense FRP-4), antibodies (e.g., anti FGF-23 or anti FRP-4), hybridoma cell lines and compositions containing same.
  • antisense oligonucleotides e.g., antisense FGF-23 or antisense FRP-4
  • antibodies e.g., anti FGF-23 or anti FRP-4
  • hybridoma cell lines and compositions containing same e.g., antisense FGF-23 or antisense FRP-4
  • the present invention also provides methods of monitoring gene expression using invention polynucleotides.
  • the methods of monitoring gene expression are useful for detecting a cell expressing oncogenic osteomalacia-related polypeptide and for detecting a neoplastic cell associated with oncogenic osteomalacia.
  • This invention further provides methods for modulating the expression of the inventive polynucleotides, for altering the activity of the proteins encoded by the polynucleotides, and for treating symptoms of phosphate transport related diseases and diseases characterized by abnormal bone mineralization.
  • diseases include but are not limited to, oncogenic osteomalacia, X-linked hypophosphataemia rickets, rhabdomyolysis, osteoporosis, cardiamyopathy, tumoral calcinosis, osteoarthritis, renal failure and bone mineralization.
  • This invention also provides a method for screening for candidate agents that modulate the expression of a polynucleotide or its complement, or modulate the level, activity or stability of the polypeptide of the invention, by contacting a test agent with a neoplastic cell associated with oncogenic osteomalacia or a cell associated with phosphate homeostasis and monitoring expression of the polynucleotide, wherein the test agent which modifies the expression of the polynucleotide or modifies the level, activity or stability of the polypeptide is a candidate agent.
  • This invention also provides a method for screening for candidate agents that inhibit the protein stability (e.g., enhances degradation) of the FGF-23 or FRP-4 protein, by contacting a test agent with a neoplastic cell associated with oncogenic osteomalacia or a cell associated with phosphate homeostasis and monitoring expression of the polynucleotide, wherein the test agent which results in an inhibition of stability (e.g., promote degradation or inactivation) of the FGF-23 or FRP-4 protein is a candidate agent.
  • the test agent which results in an inhibition of stability (e.g., promote degradation or inactivation) of the FGF-23 or FRP-4 protein is a candidate agent.
  • Sequence ID NO. 1 is a polynucleotide encoding FRP 4. Genbank Accession No.
  • Sequence ID NO. 2 is an amino acid sequence of an FRP 4 protein.
  • Sequence ID NO. 3 is a polynucleotide encoding FGF 23. See also Genbank
  • Sequence ID NO. 4 is an amino acid sequence of an FGF 23 protein. See also
  • Sequence ID NO. 5 is a polynucleotide encoding PHEX. See also Francis, et al.
  • Sequence ID NO. 6 is an amino acid sequence of a PHEX protein. See also Francis et al. (1995), supra.
  • Sequence ID NO. 7 is a primer for GNAS1.
  • Sequence ID NO. 8 is a second primer for GNAS1.
  • Sequence ID NO. 9 is a primer for MEPE.
  • Sequence ID NO. 10 is a second primer for MEPE.
  • Sequence ID NO. 11 is a primer for FRP 4.
  • Sequence ID NO. 12 is a second primer for FRP 4.
  • Sequence ID NO. 13 is a primer for PHEX.
  • Sequence ID NO. 14 is a second primer for PHEX.
  • the amino acid sequence for soluble PHEX polypeptide is published as Figure 2 of
  • WO 00/50580 Polynucleotide sequence encoding the polypeptide are available by reverse translation of the peptide. Computer software is available on the web to reverse translate proteins. See http://arbl.cvmbs.colostate.edu/molkit/rtranslate.
  • compositions and methods include the recited elements, but not excluding others.
  • Consisting essentially of when used to define compositions and methods shall mean excluding other elements of any essential significance to the combination.
  • a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like.
  • Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.
  • polynucleotide and “nucleic acid molecule” are used interchangeably to refer to polymeric forms of nucleotides of any length.
  • the polynucleotides may contain deoxyribonucleotides, ribonucleotides, and/or their analogs.
  • Nucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • polynucleotide includes, for example, single-, double-stranded and triple helical molecules, a gene or gene fragment, exons, introns, rriRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a nucleic acid molecule may also comprise modified nucleic acid molecules.
  • a “gene” refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated.
  • An “FRP 4 gene” is a polynucleotide comprising an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a polypeptide, such as the amino acid sequence shown in SEQ ID NO 2.
  • the term gene is intended to include contiguous polynucleotide sequences such as promoters and enhancers that modulate expression.
  • FRP 4 gene refers to all orthologous sequences from divergent species, ie. homologous sequences encoding polypeptides that have the same activity in different species. It is particularly intended to include the FRP 4 genes of humans, simians and rodents.
  • FRP 4 polynucleotide means any ordered sequence of polynucleotides that encode polypeptide, a portion of such a peptide, or a portion of the FRP 4 gene.
  • An "FRP 4 polynucleotide” thus include cDNA's, probes, primers, and other molecules comprising polynucleotide sequences derived from the complete FRP 4 gene, eg. biologically equivalent polynucleotides.
  • FGF 23 gene is a polynucleotide comprising an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a polypeptide, such as the amino acid sequence shown in SEQ ID NO 4.
  • the term gene is intended to include contiguous polynucleotide sequences such as promoters and enhancers that modulate expression.
  • FGF 23 gene refers to all orthologous sequences from divergent species, ie. homologous sequences encoding polypeptides that have the same activity in different species. It is particularly intended to include the FGF 23 genes of humans, simians and rodents.
  • FGF 23 polynucleotide means any ordered sequence of polynucleotides that encode polypeptide, a portion of such a peptide, or a portion of the FGF 23 gene.
  • An "FGF 23 polynucleotide” thus include cDNA's, probes, primers, and other molecules comprising polynucleotide sequences derived from the complete FGF 23 gene, eg. biologically equivalent polynucleotides.
  • a “mutant FGF 23 polynucleotide” means any ordered sequence of polynucleotides that encode polypeptide, a portion of a peptide, or a portion of a mutant FGF 23 polypeptide that retains the ability to inhibit phosphate uptake in renal epithelial cells, but is not cleaved by PHEX. Examples include, but are not limited to R179Q (amino acid 179 is mutated to Q); R179W (amino acid 179 is mutated to W) and R176Q (amino acid 176 is mutated to Q).
  • a "PHEX gene” is a polynucleotide comprising an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a polypeptide, such as the amino acid sequence shown in SEQ ID NO 6.
  • the term gene is intended to include contiguous polynucleotide sequences such as promoters and enhancers that modulate expression.
  • PHEX gene refers to all orthologous sequences from divergent species, ie.
  • PHEX polynucleotide means any ordered sequence of polynucleotides that encode polypeptide, a portion of such a peptide, eg., soluble PHEX or a portion of the PHEX gene.
  • An "PHEX polynucleotide” thus include cDNA's, probes, primers, and other molecules comprising polynucleotide sequences derived from the complete PHEX gene, eg. biologically equivalent polynucleotides.
  • Biologically equivalent polynucleotides are polynucleotides which differ from the polynucleotides described above, but produce the same phenotypic effect, such as the allele, splice variant and homolog. These altered, but phenotypically equivalent polynucleotides are referred to as "biologically equivalent polynucleotide” and "equivalent nucleic acids.”
  • the methods of the invention also encompasses polynucleotides characterized by changes in non- coding regions that do not alter the phenotype of the polypeptide produced therefrom when compared to the polynucleotide herein.
  • This invention further envisions the use of polynucleotides, which hybridize to the polynucleotides of the subject invention under conditions of moderate or high stringency.
  • Biologically equivalent polynucleotides useful in the methods of this invention are identified using sequence homology searches.
  • polynucleotides are within the scope of this invention, e.g., those characterized by possessing at least 75%, or at least 80%, or at least 90% or at least 95% sequence homology as determined using a sequence alignment program under default parameters correcting for ambiguities in the sequence data, changes in nucleotide sequence that do not alter the amino acid sequence because of degeneracy of the genetic code, conservative amino acid substitutions and corresponding changes in nucleotide sequence, and variations in the lengths of the aligned sequences due to splicing variants or small deletions or insertions between sequences that do not affect function.
  • a variety of software programs are available in the art.
  • Non-limiting examples of these programs are BLAST family programs including BLASTN, BLASTP, BLASTX, TBLASTN, and TBLASTX (BLAST is available from the worldwide web at http://www.ncbi.nlm.nih.gov/BLAST/), FastA, Compare, DotPlot, BestFit, GAP, FrameAlign, ClustalW, and PileUp. These programs can be obtained commercially in a comprehensive package of sequence analysis software such as GCG Inc.'s Wisconsin Package. Other similar analysis and alignment programs can be purchased from various providers such as DNA Star's MegAlign, or the alignment programs in GeneJockey.
  • sequence analysis and alignment programs can be accessed through the world wide web at sites such as the CMS Molecular Biology Resource at http://www.sdsc.edu/ResTools/cmshp.html.
  • Any sequence database that contains DNA or protein sequences corresponding to a gene or a segment thereof can be used for sequence analysis. Commonly employed databases include but are not limited to GenBank, EMBL, DDBJ, PDB, SWISS-PROT, EST, STS, GSS, and HTGS. Sequence similarity can be discerned by aligning the tag sequence against a DNA sequence database.
  • the tag sequence can be translated into six reading frames; the predicted peptide sequences of all possible reading frames are then compared to individual sequences stored in a protein database such as s done using the BLASTX program.
  • Parameters for determining the extent of homology set forth by one or more of the aforementioned alignment programs are well established in the art. They include but are not limited to p value, percent sequence identity and the percent sequence similarity. P value is the probability that the alignment is produced by chance. For a single alignment, the p value can be calculated according to Karlin et al. (1990) PNAS 87: 2246. For multiple alignments, the p value can be calculated using a heuristic approach such as the one programmed in BLAST. Percent sequence identify is defined by the ratio of the number of nucleotide or amino acid matches between the query sequence and the known sequence when the two are optimally aligned.
  • the percent sequence similarity is calculated in the same way as percent identity except one scores amino acids that are different but similar as positive when calculating the percent similarity.
  • conservative changes that occur frequently without altering function such as a change from one basic amino acid to another or a change from one hydrophobic amino acid to another are scored as if they were identical.
  • a tag sequence is considered to lack substantial homology with any known sequences when the regions of alignment of comparable length exhibit less than 30% of sequence identity, more preferably less than 20% identity, even more preferably less than 10% identity.
  • fragments of the gene or the full length coding sequence of the corresponding transcript or gene can be identified using various cloning methods known to artisans in the art.
  • Polynucleotides useful for practicing the methods of the invention can comprise additional sequences, such as additional coding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, and polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.
  • FRP 4 polypeptide is a molecule comprising an ordered sequence of amino acids specified by translation of a FRP 4 cDNA, such as is shown in SEQ ID NO 2.
  • the term is used to refer to the complete FRP 4 amino acid sequence of FRP 4 (SEQ ID NO 2) as well as to alternatively spliced polypeptide molecules, and other portions of the complete molecule, such as protease cleavage products and synthetic peptides derived from the complete sequence. It also refers to orthologous FRP 4 polypeptides derived from various species including, but not limited to humans, simians, and rodents.
  • FGF 23 polypeptide is a molecule comprising an ordered sequence of amino acids specified by translation of a FGF 23 cDNA, such as is shown in SEQ ID NO 4.
  • the term is used to refer to the complete FGF 23 amino acid sequence of FGF 23 (SEQ ID NO 4) as well as to alternatively spliced polypeptide molecules, and other portions of the complete molecule, such as protease cleavage products and synthetic peptides derived from the complete sequence. It also refers to orthologous FGF 23 polypeptides derived from various species including, but not limited to humans, simians, and rodents.
  • mutant FGF 23 in a mutated form of FGF 23 polypeptide that retains the ability to inhibit phosphate uptake in renal epithelial cells, but is not a substrate for PHEX.
  • a "mutant FGF 23 polynucleotide” means any ordered sequence of polynucleotides that encode polypeptide, a portion of a peptide, or a portion of a mutant FGF 23 polypeptide that retains the ability to inhibit phosphate uptake in renal epithelial cells, but is not cleaved by PHEX.
  • Examples include, but are not limited to R179Q (amino acid 179 is mutated to Q); R179W (amino acid 179 is mutated to W) and R176Q (amino acid 176 is mutated to Q). These are described in Nature (2000) 26:345-348 and can be obtained by modification of wild-type FGF 23 shown in SEQ ID NO 3 (polynucleotide) and SEQ ID NO 4 (polypeptide).
  • a "PHEX polypeptide” is a molecule comprising an ordered sequence of amino acids specified by translation of a PHEX cDNA, such as is shown in SEQ ID NO 6.
  • the term is used to refer to the complete amino acid sequence of PHEX, soluble PHEX, (SEQ ID NO 6) as well as to alternatively spliced polypeptide molecules, and other portions of the complete molecule, such as protease cleavage products and synthetic peptides derived from the complete sequence. It also refers to orthologous PHEX polypeptides derived from various species including, but not limited to humans, simians, and rodents.
  • a "gene product” refers to the amino acid (e.g., peptide or polypeptide) generated when a gene is transcribed and translated.
  • a “sequence tag” or “tag” or “SAGE tag” is a short oligonucleotide containing defined nucleotide sequence that occurs in a certain position of a gene transcript.
  • the length of a tag is generally under about 20 nucleotides, preferably between 9 to 15 nucleotides, and more preferably 10 nucleotides.
  • the tag can be used to identify the corresponding transcript and gene from which it was transcribed.
  • a tag can further comprise exogenous nucleotide sequences to facilitate the identification and utility of the tag.
  • auxiliary sequences include, but are not limited to, restriction endonuclease cleavage sites and well known primer sequences for sequencing and cloning.
  • a sequence is the complement or is complementary to another sequence if they are related by the base-pairing rules. For example, in DNA, a sequence A-G-T in one strand is complementary to T-C-A in the other strand. A given sequence defines the complementary sequence.
  • the term "modulate" means to alter or modify an identified process or biological function, e.g., phosphate transport, phosphate reabso ⁇ tion, FRP 4-regulated apoptosis and osteoarthritis.
  • peptide is used in its broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs, or peptidomimetics.
  • the subunits may be linked by peptide bonds. In another embodiment, the subunit may be linked by other bonds, e.g. ester, ether, etc.
  • amino acid refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
  • a peptide of three or more amino acids is commonly called an oligopeptide if the peptide chain is short. If the peptide chain is long, the peptide is commonly called a polypeptide or a protein.
  • cDNAs refers to complementary DNA, that is mRNA molecules present in a cell or organism made in to cDNA with an enzyme such as reverse transcriptase.
  • a "cDNA library” is a collection of all of the mRNA molecules present in a cell or organism, all turned into cDNA molecules with the enzyme reverse transcriptase, then inserted into “vectors”.
  • a "probe” when used in the context of polynucleotide manipulation refers to an oligonucleotide that is provided as a reagent to detect a target potentially present in a sample of interest by hybridizing with the target.
  • a probe will comprise a label or a means by which a label can be attached, either before or subsequent to the hybridization reaction.
  • Suitable labels include, but are not limited to radioisotopes, fluorochromes, chemiluminescent compounds, dyes, and proteins, including enzymes.
  • a “primer” is a short polynucleotide, generally with a free 3' -OH group that binds to a target or "template” potentially present in a sample of interest by hybridizing with the target, and thereafter promoting polymerization of a polynucleotide complementary to the target.
  • a “polymerase chain reaction” (“PCR”) is a reaction in which replicate copies are made of a target polynucleotide using a "pair of primers” or a “set of primers” consisting of an "upstream” and a “downstream” primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally-stable polymerase enzyme. Methods for PCR are well known in the art, and taught, for example in “PCR: A PRACTICAL APPROACH” (M.
  • a primer can also be used as a probe in hybridization reactions, such as Southern or Northern blot analyses. Sambrook et al., supra.
  • a "promoter” is a region on a DNA molecule to which an RNA polymerase binds and initiates transcription. In an operon, the promoter is usually located at the operator end, adjacent but external to the operator. The nucleotide sequence of the promoter determines both the nature of the enzyme that attaches to it and the rate of RNA synthesis.
  • genetically modified means containing and/or expressing a foreign gene or nucleic acid sequence which in turn, modifies the genotype or phenotype of the cell or its progeny.
  • Form nucleic acid includes, but is not limited to promoters, enhancers and gene activators.
  • a genetically modified cell includes a cell that contains a polynucleotide encoding PHEX polypeptide in its native environment but not expressed and expression has been turned on or the level of expression has been enhanced or lowered by the upstream insertion of a gene activator.
  • expression refers to the process by which polynucleotides are transcribed into mRNA or by which transcription is enhanced.
  • the RNA is translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eukaryotic host is selected.
  • Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PCR reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
  • Hybridization reactions can be performed using traditional hybridization techniques under different stringency.
  • a low stringency hybridization reaction is carried out at about 40°C in 10 X SSC or a solution of equivalent ionic strength/temperature.
  • a moderate stringency hybridization is typically performed at about 50°C in 6 X SSC, and a high stringency hybridization reaction is generally performed at about 60°C in 1 X SSC.
  • TMAC hybridization technology can be used for hybridization reactions probed with pooled oligonucleotides such as the SAGE tags. The advantage of using TMAC hybridization is that the reaction condition is not dependent on the G+C content of the oligonucleotide, and the melting temperature is determined only by the length of the oligomers to be used.
  • a double-stranded polynucleotide can be “complementary” or “homologous” to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second.
  • “Complementarity” or “homology” is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonding with each other, according to generally accepted base-pairing rules.
  • a polynucleotide that is 100% complementary to a second polynucleotide are understood to be “complements" of each other.
  • composition is intended to mean a combination of active agent and another compound or composition, inert (for example, a detectable agent or label or a pharmaceutically acceptable carrier) or active, such as an adjuvant.
  • a “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.
  • the term "pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the compositions also can include stabilizers and preservatives.
  • stabilizers and adjuvants see Martin, REMINGTON'S PHARM. SCI., 15th Ed. (Mack Publ. Co., Easton (1975)).
  • an "effective amount” is an amount sufficient to effect beneficial or desired results.
  • An effective amount can be administered in one or more administrations, applications or dosages. Examples of beneficial or desired results include, but are not limited to an increase in phosphate reabso ⁇ tion or an increase in serum phosphate.
  • a "subject,” “individual” or “patient” is used interchangeably herein, which refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
  • a “control” is an alternative subject or sample used in an experiment for comparison pu ⁇ ose. A control can be "positive” or "negative”.
  • the pu ⁇ ose of the experiment is to determine a correlation of an altered expression level of a gene with a particular type of cancer
  • a positive control a subject or a sample from a subject, carrying such alteration and exhibiting syndromes characteristic of that disease
  • a negative control a subject or a sample from a subject lacking the altered expression and clinical syndrome of that disease
  • a “gene delivery vehicle” is defined as any molecule that can carry inserted polynucleotides into a host cell.
  • Examples of gene delivery vehicles are liposomes, cationic liposomes, viruses, such as baculovirus, adenovirus, adeno-associated virus, and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
  • a "viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro.
  • viral vectors include retro viral vectors, adenovirus vectors, adeno-associated virus vectors and the like.
  • a vector construct refers to the polynucleotide comprising the retroviral genome or part thereof, and the inserted polynucleotide.
  • retroviral mediated gene transfer or “retroviral transduction” carries the same meaning and refers to the process by which a gene or nucleic acid sequences are stably transferred into the host cell by virtue of the virus entering the cell and integrating its genome into the host cell genome.
  • the virus can enter the host cell via its normal mechanism of infection or be modified such that it binds to a different host cell surface receptor or ligand to enter the cell.
  • retroviral vector refers to a viral particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
  • Retroviruses carry their genetic information in the form of RNA; however, once the virus infects a cell, the RNA is reverse-transcribed into the DNA form that integrates into the genomic DNA of the infected cell.
  • the integrated DNA form is called a provirus.
  • a vector construct refers to the polynucleotide comprising the viral genome or part thereof, and a polynucleotide to be inserted.
  • Ads adenoviruses
  • Adenoviruses are a relatively well characterized, homogenous group of viruses, including over 50 serotypes. (see, e.g., WO 95/27071).
  • Ads are easy to grow and do not require integration into the host cell genome.
  • Recombinant Ad-derived vectors particularly those that reduce the potential for recombination and generation of wild-type virus, have also been constructed, (see, WO 95/00655; WO 95/11984). Wild-type AAV has high infectivity and specificity integrating into the host cells genome. (Hermonat and Muzyczka (1984) PNAS USA 81:6466-6470; Lebkowski, et al. (1988) Mol. Cell. Biol. 8:3988-3996).
  • Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from sources such as Stratagene (La Jolla, CA) and Promega Biotech (Madison, WI). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression.
  • Gene delivery vehicles also include several non- viral vectors, including DNA/liposome complexes, and targeted viral protein DNA complexes. Liposomes that also comprise a targeting antibody or fragment thereof can be used in the methods of this invention.
  • the nucleic acid or proteins of this invention can be conjugated to antibodies or binding fragments thereof which bind cell surface antigens, e.g., TCR, CD3 or CD4.
  • Polynucleotides are inserted into vector genomes using methods well known in the art.
  • insert and vector DNA can be contacted, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule that can pair with each other and be joined together with a ligase.
  • synthetic nucleic acid linkers can be ligated to the termini of restricted polynucleotide. These synthetic linkers contain nucleic acid sequences that correspond to a particular restriction site in the vector DNA.
  • an oligonucleotide containing a termination codon and an appropriate restriction site can be ligated for insertion into a vector containing, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in mammalian cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; SV40 polyoma origins of replication and ColEl for proper episomal replication; versatile multiple cloning sites; stabilizing elements 3' to the inserted polynucleotide, and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA.
  • a selectable marker gene such as the neomycin gene for selection of stable or transient transfectants in mammalian cells
  • enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription
  • “Host cell” is intended to include any individual cell or cell culture that can be or have been recipients for vectors or the inco ⁇ oration of exogenous polynucleotides, polypeptides and/or proteins. It also is intended to include progeny of a single cell, and the progeny may not necessarily be completely identical (in mo ⁇ hology or in genomic or total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation.
  • the cells may be prokaryotic or eukaryotic, and include but are not limited to bacterial cells, yeast cells, plant cells, insect cells, animal cells, and mammalian cells, e.g., murine, rat, simian or human.
  • an “antibody” is an immunoglobulin molecule capable of binding an antigen.
  • the term encompasses not only intact immunoglobulin molecules, but also anti- idiotypic antibodies, mutants, fragments, fusion proteins, humanized proteins and modifications of the immunoglobulin molecule that comprise an antigen recognition site of the required specificity.
  • expression refers to the process by which polynucleotides are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eukaryotic host is selected. Regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding.
  • a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG (Sambrook, et al. (1989) supra).
  • an eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase ⁇ , a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome.
  • a heterologous or homologous promoter for RNA polymerase ⁇ for example, the methods described below for constructing vectors in general.
  • a “subject” is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
  • a “control” is an alternative subject or sample used in an experiment for comparison pu ⁇ ose. A control can be "positive” or "negative. "
  • culture refers to the in vitro propagation of cells or organisms on or in media of various kinds. It is understood that the descendants of a cell grown in culture may not be completely identical (i.e., mo ⁇ hologically, genetically, or phenotypically) to the parent cell. By “expanded” is meant any proliferation or division of cells.
  • cancer refers to cells that have undergone a malignant transformation that makes them pathological to the host organism.
  • Primary cancer cells that is, cells obtained from near the site of malignant transformation
  • the definition of a cancer cell includes not only a primary cancer cell, but any cell derived from a cancer cell ancestor. This includes metastasized cancer cells, and in vitro cultures and cell lines derived from cancer cells.
  • a "clinically detectable" tumor is one that is detectable on the basis of tumor mass; e.g., by such procedures as CAT scan, magnetic resonance imaging (MRJ), X-ray, ultrasound or palpation. Biochemical or immunologic findings alone may be insufficient to meet this definition.
  • Tumor cells often express antigens which are tumor specific.
  • the term "tumor associated antigen” or “TAA” refers to an antigen that is associated with or specific to a tumor.
  • Solid phase support is not limited to a specific type of support. Rather a large number of supports are available and are known to one of ordinary skill in the art. Solid phase supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, alumina gels. A suitable solid phase support may be selected on the basis of desired end use and suitability for various synthetic protocols.
  • solid phase support may refer to resins such as polystyrene (e.g., PAM- resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE ® resin (obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TentaGelTM, Rapp Polymere, Tubingen, Germany) or polydimethylacrylamide resin (obtained from Milligen/Biosearch, California).
  • solid phase support refers to polydimethylacrylamide resin.
  • a “transgenic animal” refers to a genetically engineered animal or offspring of genetically engineered animals.
  • the transgenic animal may contain genetic material from at least one unrelated organism (such as from a bacteria, virus, plant, or other animal) or may contain a mutation which interferes with expression of a gene product.
  • OOM oncogenic osteomalacia
  • OHO oncogenic hypophosphatemic osteomalacia
  • tumor-associated osteomalacia refers to a tumor-acquired syndrome characterized mainly by hypophosphatemia, hype ⁇ hosphaturia, abnormally low serum level of 1,25-dihydroxyvitamin D, and osteomalacia.
  • Tumors associated with OOM are mainly of mesenchymal origin such as hemangiopericytomas, although carcinoma of prostate and lung, fibrous dysplasia of bone, linear sebaceous naevus syndrome, neurofibromatosis, and oat cell carcinoma are also associated with OOM.
  • the OOM syndrome can be described as having a paraneoplastic etiology. Surgical removal of the tumor in a patient often results in a complete or near-complete resolution of biochemical and clinical defects associated with OOM.
  • Oncogenic osteomalacia-related genes include genes that have been identified to be over-expressed or under-expressed relative to control tumors (histologically similar tumors that are not associated with OOM). Genes that are up-regulated or down-regulated in oncogenic osteomalacia may encode proteins involved in several distinct biochemical pathways. These include phosphate regulation, bone mineralization, and protein synthesis, processing and secretion.
  • the regulation of phosphate metabolism plays a central role in mediating the symptoms of oncogenic osteomalacia.
  • Genes whose expression is altered in OOM tumors can affect phosphate metabolism through a variety of mechanisms.
  • the tumor may directly produce increased amounts of phosphatonin, a secreted humoral factor whose activity includes inhibition of phosphate re-abso ⁇ tion in the kidney.
  • the OOM tumor cells could produce a factor or factors that alter the expression in the kidney of accessory polypeptides required for mediating the effects of phosphatonin such as the phosphatonin receptor and intracellular proteins responsible for eliciting the effects of phosphatonin.
  • FRP 4, FGF 23, both of which exhibit phosphatonin activity, and PHEX are genes involved in the regulation of the phosphatonin pathway.
  • OOM tumor cells can also alter phosphate metabolism by more complex mechanisms.
  • tumor produced factors could up-regulate expression of genes normally controlled directly by phosphatonin or in response to phosphatonin.
  • OOM tumor produced factors could increase expression of phosphate transport molecules and other cellular proteins necessary for regulating either phosphate uptake or secretion of phosphate.
  • OOM tumor factors could alter expression of extracellular regulators or carriers of phosphate or phosphatonin.
  • OOM-related genes that modulate phosphate metabolism are useful candidates for developing therapeutic agents for a variety of disease conditions related to abnormal phosphate metabolism.
  • renal conditions such as renal osteodystrophy, changes in phosphate homeostasis after kidney transplant, end stage renal disease (ESRD), and acute renal disease, bone defects, hypophosphataemia, hype ⁇ hosphataemia, hypoparathyroidism, and pseudohypoparathyroidism.
  • ESRD end stage renal disease
  • Phosphate metabolism related factors could provide useful mediators of disease conditions through a variety of alternative mechanisms. For example, during ESRD, phosphatonin or other proteins in its pathway may inhibit abso ⁇ tion of phosphate in the small intestine. Such factors may also enhance phosphate uptake in the proximal tubules of the kidney. Modulation of the activity of these factors could therefore be used to control the symptoms of this disease.
  • FGF 23 and FRP 4 are substrates for PHEX; PHEX inactivates these proteins.
  • Mutant FGF 23 inhibits phosphate uptake in renal epithelial cells but it is not cleaved by PHEX. This type of therapy is useful for a range of conditions including hype ⁇ arathyroidism, X-linked hypophosphatemic rickets, vitamin D dependent rickets, Franconi Syndrome, post kidney transplant condition, and oncogenic osteomalacia.
  • Serum phosphate levels can be increased, or alternatively, phosphate re-abso ⁇ tion can be increased by inhibiting FRP 4 and FGF 23 or by delivering or enhancing PHEX expression, or by delivering agents that produce this effect in the subject.
  • FGF 23 and FRP-4 can be inhibited by administering an agent that inhibits, decreases or represses the protein stability (e.g., promotes degradation or inactivation) of FGF 23 and FRP-4.
  • agents include, but are not limited to, proteases, such as PHEX or soluble PHEX.
  • Diseases characterized by increased phosphate levels or hype ⁇ hosphatemia could be affected by treatment directed towards any protein that acts in the phosphatonin pathway to lower serum phosphate levels or to reduce phophate re-abso ⁇ tion.
  • Diseases related to hype ⁇ hosphatemia include: hypoparathyroidism (levels of PTH secreted are insufficient to maintain extracellular calcium and phosphate levels-leads to hypocalcemia and hype ⁇ hosphatemia); pseudohypoparathyroidism (a group of disorders characterized by biochemical hypoparathyroidism, hypocalcemia and hype ⁇ hosphatemia, increased secretion of PTH and resistance to the biological actions of PTH); transcellular phosphate shift from cells into the extracellular fluid caused by systemic infections, severe hyperthermia, crush injuries, non-traumatic rhabdomyoloysis, and tumor lysis syndrome after cytotoxic therapies for hematologic malignancies; and renal disease.
  • hypoparathyroidism levels of PTH secreted are in
  • Serum phosphate levels can be decreased, or alternatively, phosphate re-abso ⁇ tion can be decreased by enhancing FRP 4 and FGF 23 activity or protein stability (e.g., inhibit degradation, such as by using a mutant FGF 23 resistant to degradation) or by inhibiting PHEX expression, or activity.
  • factors whose expression is altered in OOM tumor cells can include genes whose polypeptide products act directly on osteogenic cells to mediate bone mineralization.
  • Such proteins associated with OOM may either promote or inhibit diseases associated with defective mineralization.
  • Possible functions of proteins in the bone mineralization pathway include: inhibition of bone mineralization, regulation of the early stages of bone mineralization, and control of bone cell differentiation and bone development.
  • a variety of types of polypeptide factors may be found to modulate bone mineralization.
  • extracellular matrix proteins are an important constituent of bone. In bone, cartilage and the tissues forming the teeth, unlike those in other connective tissues, the matrices have the unique ability to become calcified.
  • OOM tumor produced ECM proteins could alter the natural process of bone mineral homeostasis by acting directly on bone cells.
  • OOM tumor cells could produce diffusable soluble factors that regulate bone cell differentiation, growth and metabolism. Such factors also provide useful targets for development of therapeutic agents to regulate bone mineralization. A number of serious pathological conditions are related to defects in bone mineralization.
  • osteoporosis a metabolic bone disease characterized by low bone mass and microarchitectural deterioration of bone tissue
  • osteomalacia a defect in bone mineralization that occurs after the cessation of growth and involves only the bone and not the growth plate
  • rickets a disorder of mineralization of the bone matrix, or osteoid, in growing bones; that involves both the growth plate (epiphysis) and newly formed traebacular and cortical bone
  • hypophosphatasis a rare heritable type of rickets or osteomalacia (1 in 100,000 births) characterized by a reduction of activity of the tissue non-specific isoenzyme of alkaline phosphatase
  • Fanconi syndrome and renal tubular acidosis a generalized defect in renal proximal tubule transport capacity that includes impaired reabso ⁇ tion of glucose, phosphate, amino acids, bicarbonate, uric acid, citrate and other organic acids, and low-molecular weight proteins and that is associated with
  • OOM tumor produced factors that are found to modulate fundamental processes involved in bone formation, mineralization and maintenance could provide useful targets to inhibit the progression of these diseases.
  • pathological conditions of the bone include defects in bone remodeling such as Paget's disease, osteomyeloitis, osteosarcoma and stress fracture.
  • polypeptide factors identified from OOM tumor cells that directly modulate bone metabolism and bone cell development are useful targets for developing novel therapeutic agents to treat diseases characterized by alternative bone pathologies.
  • expression of OOM tumor associated factors may be found to be diagnostic of bone disease making these genes useful markers for diagnostic tests to identify such conditions.
  • This invention provides a method of modulating phosphate homeostasis in a subject by altering the activity of FRP 4 and FGF 23 or PHEX proteins or polynucleotides, within the subject.
  • the activity of FRP 4 and FGF 23 is altered by delivering an effective amount of a polynucleotide selected from the group consisting of a polynucleotide encoding anti-FRP 4 and anti-FGF 23 antibody, a polynucleotide encoding anti-PHEX antibody, a polynucleotide encoding FRP 4 and FGF 23 or mutant FGF 23, a polynucleotide encoding PHEX and a polynucleotide encoding soluble PHEX.
  • a method of inhibiting the activity of FGF 23, and FRP 4 proteins in a subject by delivering to the subject an effective amount of an agent selected from the group consisting of soluble PHEX protein, PHEX protein, a polynucleotide encoding soluble PHEX, a polynucleotide encoding PHEX, a polynucleotide encoding anti-FGF 23, and anti- FRP 4 antibodies, a composition comprising anti-FGF 23, and anti-FRP 4 antibodies or any agent that inhibits or decreases the protein stability of the FGF-23 protein or FRP-4 protein.
  • an agent selected from the group consisting of soluble PHEX protein, PHEX protein, a polynucleotide encoding soluble PHEX, a polynucleotide encoding PHEX, a polynucleotide encoding anti-FGF 23, and anti- FRP 4 antibodies, a composition comprising anti-FGF 23, and anti-FRP 4 antibodies or any
  • This method treats phosphate homeostasis-related diseases, for example, X-linked hypophosphatemia rickets, oncogenic osteomalacia, rhabdomyolysis, cardiomyopathy, tumoral calcinosis, renal failure and bone mineralization.
  • This invention provides a method of inhibiting the activity of FGF 23 and FRP 4 proteins in a subject by delivering to the subject an effective amount of an agent that inhibits, or decreases the protein stability of the FRP 4 protein and FGF 23 protein.
  • protein stability may be inhibited by a variety of methods known in the art, such as enhancing a protein's susceptibility to cleavage by a protease. Examples of such agents include, but are not limited proteases which cleave FGF-23 and FRP-4 such as PHEX, or soluble PHEX.
  • a method of enhancing the biological activity of FGF 23 and FRP 4 proteins in a subject is further provided by this invention, which in turn, reduces serum phosphate and phosphate re-abso ⁇ tion.
  • an effective amount of a PHEX enzyme inhibitor is delivered to the subject. See pages 33 to 39 of WO 00/50580 for methods for making PHEX enzyme inhibitors.
  • a method of enhancing the biological activity of FGF 23 and FRP 4 proteins in a subject by delivering to the subject an effective amount of an agent that inhibits transcription and/or translation of PHEX genes in the subject or mutant FGF 23 which is not cleaved by PHEX.
  • agents include, but are not limited to antisense PHEX polynucleotides and ribozymes that selectively cleave PHEX mRNA, mutant FGF 23 polypeptide and mutant FGF 23 polynucleotides.
  • hypophosphatemia disorders such as, but not limited to XLH or ADHR
  • FRP 4 and FGF 23 polynucleotides or PHEX polynucleotide are also provided provided.
  • symptoms include, but are not limited to hypophosphatemia, phosphaturia, low serum concentrations of 1,25-dihydroxyvitamin D, and osteomalacia.
  • the term "elevated levels” means a greater than normal concentration of the protein or proteins systemically or locally.
  • Methods to determine FGF 23, FRP 4 and PHEX protein levels are known in the art and include Western Blot Analysis to detect and determine protein levels and quantitative PCR or Northern Blot Analysis to detect and determine mRNA levels. These methods are well known in the art. See for example, WO 00/50580, WO 00/18954 and Shimada, et al. (2001) PNAS Early Edition, www.pnas.org/cgi/doe/10.1073/pnas.101545198.
  • a pharmaceutical composition comprising a PHEX and/or soluble PHEX polypeptides are delivered to a subject in an effective amount to reduce phosphate re-abso ⁇ tion or reduce serum phosphate levels.
  • the pharmaceutical composition contains a polypeptide and is capable of increasing the abnormally depressed serum phosphate levels in patients with phosphate homeostasis-related disease.
  • the PHEX polypeptide-containing pharmaceutical composition further comprises active agents that promote the desired function in regulating phosphate homeostasis.
  • Suitable active agents include, but are not limited to, enzymes or co-factors that are involved in the post-translational modification and processing of the mature FRP 4 and FGF 23 proteins, or factors responsible for decreasing the biological activity of FRP 4 and FGF 23 polypeptides in circulation and at the site of abnormal phosphate homeostasis.
  • Various delivery systems are known and can be used to administer a therapeutic agent, e.g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis (see, e.g., Wu and Wu (1987) J. Biol. Chem.
  • Methods of delivery include but are not limited to transdermally, gene therapy, intra-arterial, intra-muscular, intravenous, intranasal, and oral routes, and include sustained delivery systems.
  • compositions identified herein as effective for their intended pu ⁇ ose can be administered to subjects or individuals susceptible to or at risk of developing diseases associated with abnormal phosphate transport in the kidney.
  • the agent When the agent is administered to a subject such as a mouse, a rat or a human patient, the agent can be added to a pharmaceutically acceptable carrier and systemically or topically administered to the subject.
  • Therapeutic amounts can be empirically determined and will vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent.
  • Administration in vivo can be effected in one dose, continuously or intermittently throughout the course of treatment.
  • Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the composition used for therapy, the pu ⁇ ose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. Suitable dosage formulations and methods of administering the agents can be found below.
  • the agents and compositions useful for practicing the methods of the present invention can be used in the manufacture of medicaments and for the treatment of humans and other animals by administration in accordance with conventional procedures, such as an active ingredient in pharmaceutical compositions.
  • the pharmaceutical compositions can be administered orally, intranasally, parenterally, transdermally or by inhalation therapy, and may take the form of tablets, lozenges, granules, capsules, pills, ampoules, suppositories or aerosol form. They may also take the form of gene therapy, suspensions, solutions and emulsions of the active ingredient in aqueous or nonaqueous diluents, syrups, granulates or powders.
  • the pharmaceutical compositions can be combined with other therapeutically useful agents.
  • the present invention also provides methods for detecting a cell expressing a polypeptide encoded by the FRP 4 and FGF 23 or PHEX genes by contacting a suitable sample with suitable polynucleotide probes under conditions of moderate hybridization stringency and detecting any complementary nucleotides, thereby detecting the cell.
  • a suitable polynucleotide probe can be derived from the sequence of the FRP 4 and FGF 23 cDNA shown in SEQ ID NOS 1 and 3 or PHEX sequences shown in SEQ ID NO. 5 by preparing an oligonucleotide or polynucleotide molecule that is complementary to a portion of the cDNAs.
  • An oligonucleotide probe ranging in size from 10 or 20 nucleotides to about 50 nucleotides can be produced using an automated DNA synthesizer.
  • polynucleotide probes can be prepared from an isolated polynucleotide that comprises the FRP 4 and FGF 23 or PHEX cDNA sequence using methods well known in the art such as PCR or nick translation using various DNA polymerase enzymes. Such probes typically range in size from 50 to 500 base pairs in length. Suitable polynucleotide probes should not contain repeated DNA motifs and should not have high homology to genes other than the target FRP 4 and FGF 23 or PHEX sequences.
  • the invention further provides a method of detecting a cell expressing polypeptide encoded by the FRP 4 and FGF 23 or PHEX gene(s) by performing RT-PCR on a suitable sample using a primer pair derived from the FRP 4 and FGF 23 or a PHEX cDNA sequence.
  • RT-PCR can be performed using methods well established in the art.
  • a suitable primer pair will be oligonucleotides of similar annealing temperatures that are complementary to sequences on opposite strands of the FRP 4 and FGF 23 or PHEX cDNA.
  • the primers should amplify a portion of the FRP 4 and FGF 23 or PHEX cDNA ranging from 50 to 1 ,000 base pairs, preferably 250 to 750 base pairs in length.
  • Optimal conditions for performing PCR can be determined without undue experimentation by comparing a series of alternative reaction conditions in which reaction conditions such as primer concentration, magnesium concentration, annealing temperature and cycle number are varied, to identify appropriate PCR conditions.
  • Methods of detecting and monitoring FRP 4 and FGF 23 or PHEX expression are useful for detecting a neoplastic cell associated with oncogenic osteomalacia.
  • a suitable sample for such analysis can be obtained from a tissue sample removed from subject.
  • the methods are useful for localizing an osteogenic osteomalacia inducing tumor.
  • the methods of detecting FRP 4 and FGF 23 or PHEX expression levels can be used to quantitate FRP 4 and FGF 23 or PHEX expression levels.
  • the present invention envisions using these methods to identify subjects that are appropriate candidates for treatment using the methods of this- invention.
  • the methods of detecting FRP 4 and FGF 23 or PHEX genes expression are also useful for monitoring the efficiency of a gene delivery vehicle comprising the FRP 4 and FGF 23 or PHEX genes sequence when such a gene delivery vehicle is administered to a subject.
  • the present invention further provides a method for modulating the phenotype of a neoplastic cell associated with oncogenic osteomalacia comprising delivering an agent that alters the expression of polynucleotides encoding FRP 4 and FGF 23 polypeptides or PHEX polypeptides.
  • an agent that alters the expression of polynucleotides encoding FRP 4 and FGF 23 polypeptides or PHEX polypeptides.
  • Appropriate subjects for receiving such an agent can be identified by performing the FRP 4, FGF 23 or PHEX gene expression analysis detecting the level of the proteins methods described above.
  • the present invention also provides a method for modulating the phenotype of a neoplastic cell associated with oncogenic osteomalacia comprising delivering an agent that alters the level of the FRP 4 and FGF 23 polypeptides or PHEX polypeptides or alters the stability of the FRP 4 and FGF 23 polypeptides or PHEX polypeptides or modulates the activity of FRP 4 and FGF 23 polypeptides or PHEX polypeptides.
  • the invention provides methods for modulating the phenotype of a cell associated with phosphate homeostasis comprising delivering an agent that alters the expression of the FRP 4 and FGF 23 or PHEX gene(s).
  • This method is useful for modulating FRP 4 and FGF 23 or PHEX expression or activity and phosphate homeostasis in a subject.
  • Agents that enhance the expression or activity of FRP 4 and FGF 23 are useful for reducing the re-abso ⁇ tion of phosphate in the kidney and serum phosphate levels while agents that inhibits the expression or activity of FRP 4 and FGF 23 are useful for increasing phosphate re-abso ⁇ tion, and serum phosphate levels.
  • These agents include but are not limited to PHEX polynucleotides or proteins.
  • the present invention further provides a method for modulating the phenotype of a cell associated with phosphate homeostasis comprising delivering an agent that alters the level of the FRP 4 and FGF 23 polypeptides or PHEX polypeptides or alters the stability of the FRP 4 and FGF 23 polypeptides or PHEX polypeptides or modulates the activity of FRP 4 and FGF 23 polypeptides or PHEX polypeptides.
  • the present invention provides methods for screening various agents that modulate the expression of the FRP 4 and FGF 23 genes or PHEX gene or the activity of the FRP 4 and FGF 23 proteins or PHEX protein. These agents are useful for modulating phosphate homeostasis in a subject, for modulating renal phosphate transport, or alleviating the symptoms associated with oncogenic osteomalacia, for treating phosphate homeostasis- related disease and for altering the phenotype of a neoplastic cell associated with oncogenic osteomalacia or a cell associated with phosphate homeostasis or bone mineralization.
  • an "agent” is intended to include, but not be limited to a biological or chemical compound such as a simple or complex organic or inorganic molecule, a peptide, a protein (e.g. antibody), a polynucleotide (e.g. anti-sense) or a ribozyme.
  • a biological or chemical compound such as a simple or complex organic or inorganic molecule, a peptide, a protein (e.g. antibody), a polynucleotide (e.g. anti-sense) or a ribozyme.
  • a vast array of compounds can be synthesized, for example polymers, such as polypeptides and polynucleotides, and synthetic organic compounds based on various core structures, and these are also included in the term "agent".
  • various natural sources can provide compounds for screening, such as plant or animal extracts, and the like. It should be understood, although not always explicitly stated that the agent is used alone or in combination with another agent, having the same or different
  • small molecules are molecules having low molecular weights (MW) that are, in one embodiment, capable of binding to a protein of interest such as FRP 4 and FGF 23 or PHEX polypeptides, and thereby altering the function of the protein.
  • the small molecule may directly or indirectly modulate the stability of the proteins of interest.
  • the MW of a small molecule is no more than 1,000.
  • a miniaturized arrayed assay for detecting small molecule-protein interactions in cells is discussed by You et al. (1997) Chem. Biol. 4:961-968.
  • suitable cell cultures or tissue cultures containing this type of neoplastic cell are first provided.
  • the cell can be a cultured cell or a genetically modified cell in which FRP 4 and FGF 23 or mutant FGF 23 or PHEX, or its complement is expressed.
  • the cells can be from a tissue biopsy.
  • the cells are cultured under conditions (temperature, growth or culture medium and gas (CO 2 )) and for an appropriate amount of time to attain exponential proliferation without density dependent constraints.
  • suitable cells may be cultured in microtiter plates and several agents may be assayed at the same time by noting genotypic changes, phenotypic changes or cell death.
  • the agent when the agent is a composition other than a DNA or RNA, such as a small molecule as described above, the agent may be directly added to the cell culture or added to culture medium for addition. As is apparent to those skilled in the art, an "effective" amount must be added which can be empirically determined.
  • the agent when it is a polynucleotide, it may be directly added by use of a gene gun or electroporation. Alternatively, it may be inserted into the cell using a gene delivery vehicle or other method as described herein.
  • Kits containing the agents and instructions necessary to perform the screen and in vitro method as described herein also are claimed.
  • the assays also can be performed in a subject.
  • the subject is an animal such as a rat, mouse or simian
  • the method provides a convenient animal model system that can be used prior to clinical testing of an agent.
  • a candidate agent is a potential drug if transcript expression is altered, i.e., upregulated (such as restoring tumor suppressor function), downregulated or eliminated as with drug resistant genes or oncogenes, or if symptoms associated or correlated to the presence of cells containing transcript expression are ameliorated, each as compared to untreated, animal having the pathological cells.
  • a candidate agent is also a potential drug for diseases associated with decreased phosphate re-abso ⁇ tion or decreased serum phosphate if it modulates the activity of FGF-23 or FRP-4, by for example, inhibiting protein stability.
  • An isolated polynucleotide encoding FRP 4 and FGF 23 or mutant FGF 23, PHEX as well as antibodies that specifically recognize and bind these proteins are provided by this invention.
  • Polynucleotides comprising the sequence of the FRP 4 and FGF 23 or mutant FGF 23 or PHEX genes are useful for practicing various embodiments of the present invention.
  • Polynucleotides comprising the sequence of the PHEX gene also is useful for practicing various embodiments of the present invention.
  • polynucleotides include, but are not limited to probes for detecting and monitoring gene expression, primers for performing polymerase chain reaction (PCR), cDNA molecules encoding one or more of polypeptide selected from the group consisting of FRP 4, FGF 23, mutant FGF 23, soluble PHEX and PHEX, antibodies that specifically recognize and bind these proteins, gene delivery vehicles to deliver the polynucleotides to a cell, expression vectors for the production of the protein products, and anti-sense polynucleotides and ribozymes to modulate expression of a protein selected from the group consisting of FRP 4, FGF 23, mutant FGF 23, soluble PHEX and PHEX as well as antibodies that specifically recognize and bind these proteins.
  • PCR polymerase chain reaction
  • sequences of cDNAs encoding these proteins are provided in SEQ ID NOS. 1, 3 and 5, respectively.
  • Three embodiments of mutant FGF 23 are provided in Nature (2000) 26:345-348.
  • One of skill in the art will be familiar with a variety of means by which to detect and obtain such an isolated polynucleotide. Descriptions of several of these methods are provided below.
  • anti-sense polynucleotides e.g. antisense RNA
  • the polynucleotides can be introduced by any suitable gene delivery method or vector. They also can be expressed in a suitable host cell for generating a cell-based therapy. These methods are described in more detail below.
  • This invention can also utilize genetically modified cells that produce enhanced expression of one or more polypeptides selected from the group consisting of FRP 4, FGF 23, mutant FGF 23 soluble PHEX and PHEX, as compared to wild-type cells.
  • the genetically modified cells can be produced by insertion of upstream regulatory sequences such as promoters or gene activators (see U.S. Patent No. 5,733,761).
  • the polynucleotides and sequences identified above can be conjugated to a detectable marker, e.g., an enzymatic label or a radioisotope for detection of nucleic acid and/or expression of the gene in a cell.
  • a detectable marker e.g., an enzymatic label or a radioisotope for detection of nucleic acid and/or expression of the gene in a cell.
  • detectable markers e.g., an enzymatic label or a radioisotope for detection of nucleic acid and/or expression of the gene in a cell.
  • detectable marker e.g., an enzymatic label or a radioisotope for detection of nucleic acid and/or expression of the gene in a cell.
  • detectable markers include fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal.
  • a fluorescent label or an enzyme tag such as urease
  • this invention further provides a method for detecting a single-stranded polynucleotide encoding a protein selected from the group consisting of FRP 4, FGF 23, mutant FGF 23, and PHEX, or its complement(s), by contacting target single-stranded polynucleotides with a labeled, single-stranded polynucleotide (a probe) which is a portion of the nucleotides shown in SEQ ID NOS.
  • hybridized polynucleotide pairs are separated from un-hybridized, single-stranded polynucleotides. The hybridized polynucleotide pairs are detected using methods well known to those of skill in the art and set forth, for example, in Sambrook, et al. (1989) supra.
  • the isolated polynucleotide encodes an oncogenic osteomalacia-related polypeptide, the polypeptide having one or more of the sequences shown in SEQ ED NOS: 2, 4, or 6, or an analog thereof having conservative amino acid substitutions.
  • the isolated polynucleotide of this invention encodes oncogenic osteomalacia-related mutein polypeptide, the mutein polypeptide having the amino acid sequence of one or more of SEQ ID NOS: 2, 4, or 6, or an analog thereof having non- conservative amino acid substitutions.
  • polynucleotides and sequences used to practice the methods of this invention can be obtained using chemical synthesis, recombinant cloning methods, PCR, or any combination thereof. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequence data provided herein to obtain a desired polynucleotide by employing a DNA synthesizer or ordering from a commercial service.
  • compositions containing the polynucleotides and sequences encoding one or more of the FRP 4, FGF 23, mutant FGF 23 and/or PHEX and soluble PHEX proteins, as well as the antibodies that specifically recognize and bind these proteins and polypeptides, in isolated form or contained within a vector or host cell may be delivered.
  • these compositions are to be used pharmaceutically, they are combined with a pharmaceutically acceptable carrier.
  • Suitable cell or tissue samples used for the methods of this invention encompass body fluid, solid tissue samples, tissue cultures or cells derived therefrom and the progeny thereof, and sections or smears prepared from any of these sources, or any other samples that may contain a neoplastic tumor tissue.
  • Polynucleotides of the invention can be isolated using the techniques described herein or replicated using PCR.
  • the PCR technology is the subject matter of United States Patent Nos. 4,683,195, 4,800,159, 4,754,065, and 4,683,202 and described in PCR: THE POLYMERASE CHAIN REACTION (Mullis et al. eds, Birkhauser Press, Boston (1994)) or MacPherson, et al. (1991) and (1994), supra, and references cited therein.
  • one of skill in the art can use the sequences provided herein and a commercial DNA synthesizer to replicate the DNA.
  • one of skill in the art can insert the polynucleotide into a suitable replication vector and insert the vector into a suitable host cell (prokaryotic or eukaryotic) for replication and amplification.
  • the DNA so amplified can be isolated from the cell by methods well known to those of skill in the art.
  • a process for obtaining polynucleotides by this method is further provided herein as well as the polynucleotides so obtained.
  • RNA can be obtained by first inserting a DNA polynucleotide into a suitable host cell.
  • the DNA can be inserted by any appropriate method, e.g., by the use of an appropriate gene delivery vehicle (e.g., liposome, plasmid or vector) or by electroporation.
  • an appropriate gene delivery vehicle e.g., liposome, plasmid or vector
  • electroporation e.g., liposome, plasmid or vector
  • the RNA can then be isolated using methods well known to those of skill in the art, for example, as set forth in Sambrook, et al. (1989) supra.
  • mRNA can be isolated using various lytic enzymes or chemical solutions according to the procedures set forth in Sambrook, et al. (1989), supra or extracted by nucleic-acid-binding resins following the accompanying instructions provided by manufactures.
  • a "perfectly matched" probe is not needed for a specific hybridization. Minor changes in probe sequence achieved by substitution, deletion or insertion of a small number of bases do not affect the hybridization specificity. In general, as much as 20% base-pair mismatch (when optimally aligned) can be tolerated.
  • a probe useful for detecting the aforementioned mRNA is at least about 80% identical to the homologous region More preferably, the probe is 85% identical to the corresponding gene sequence after alignment of the homologous region; even more preferably, it exhibits 90% identity.
  • probes can be used in radioassays (e.g. Southern and Northern blot analysis) to detect, prognose, diagnose or monitor various neoplastic cells or tumor tissues containing these cells.
  • the probes also can be attached to a solid support or an array such as a chip for use in high throughput screening assays for the detection of expression of the gene corresponding a polynucleotide of this invention.
  • this invention also provides a probe comprising or corresponding to one or more polynucleotides selected from the group consisting of SEQ ED NOS. 1, 3, or 5 or its complement, or a fragment thereof as well as one or more polynucleotides selected from the group consisting of SEQ ED NOS.
  • the total size of fragment, as well as the size of the complementary stretches, will depend on the intended use or application of the particular nucleic acid segment. Smaller fragments will generally find use in hybridization embodiments, wherein the length of the complementary region may be varied, such as between at least 5 to 10 to about 100 nucleotides, or even full length according to the complementary sequences one wishes to detect.
  • Nucleotide probes having complementary sequences over stretches greater than 5 to 10 nucleotides in length are generally preferred, so as to increase stability and selectivity of the hybrid, and thereby improving the specificity of particular hybrid molecules obtained. More preferably, one can design polynucleotides having gene-complementary stretches of 10 or more or more than 50 nucleotides in length, or even longer where desired. Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, by application of nucleic acid reproduction technology, such as the PCR technology with two priming oligonucleotides as described in U.S. Pat. No. 4,603,102 or by introducing selected sequences into recombinant vectors for recombinant production. A preferred probe is about 50-75 or more preferably, 50-100, nucleotides in length.
  • amplification means any method employing a primer- dependent polymerase capable of replicating a target sequence with reasonable fidelity.
  • Amplification may be carried out by natural or recombinant DNA-polymerases such as T7 DNA polymerase, Klenow fragment of E.coli DNA polymerase, and reverse transcriptase.
  • a preferred length of the primer is the same as that identified for probes, above.
  • a preferred amplification method is PCR. However, PCR conditions used for each reaction are empirically determined. A number of parameters influence the success of a reaction.
  • annealing temperature and time annealing temperature and time
  • extension time extension time
  • Mg 2+ concentration e.g., adenosine triphosphate
  • pH e.g., adenosine sodium sulfate
  • relative concentration of primers, templates, and deoxyribonucleotides e.g., adenosine sodium sulfate
  • deoxyribonucleotides ethidium bromide staining and ultraviolet illumination.
  • the methods of the invention can also employ the isolated polynucleotide encoding the proteins described herein operatively linked to a promoter of RNA transcription, as well as other regulatory sequences for replication and/or transient or stable expression of the DNA or RNA.
  • a promoter of RNA transcription as well as other regulatory sequences for replication and/or transient or stable expression of the DNA or RNA.
  • operatively linked means positioned in such a manner that the promoter will direct transcription of RNA off the DNA molecule. Examples of such promoters are SP6, T4 and T7.
  • cell-specific promoters are used for cell-specific expression of the inserted polynucleotide.
  • Vectors which contain a promoter or a promoter/enhancer, with termination codons and selectable marker sequences, as well as a cloning site into which an inserted piece of DNA can be operatively linked to that promoter are well known in the art and commercially available.
  • GENE EXPRESSION TECHNOLOGY Goeddel ed., Academic Press, Inc. (1991)) and references cited therein and VECTORS: ESSENTIAL DATA SERIES (Gacesa and Ramji, eds., John Wiley & Sons, N.Y. (1994)), which contains maps, functional properties, commercial suppliers and a reference to GenEMBL accession numbers for various suitable vectors.
  • these vectors are capable of transcribing RNA in vitro or in vivo.
  • Expression vectors containing these nucleic acids are useful to obtain host vector systems to produce proteins and polypeptides. It is implied that these expression vectors must be replicable in the host organisms either as episomes or as an integral part of the chromosomal DNA. Suitable expression vectors include plasmids, viral vectors, including adenoviruses, adeno-associated viruses, retroviruses, cosmids, etc. Adenoviral vectors are particularly useful for introducing genes into tissues in vivo because of their high levels of expression and efficient transformation of cells both in vitro and in vivo.
  • a suitable host cell e.g., a prokaryotic or a eukaryotic cell and the host cell replicates
  • the protein can be recombinantly produced.
  • suitable host cells will depend on the vector and can include mammalian cells, animal cells, human cells, simian cells, insect cells, yeast cells, and bacterial cells constructed using well known methods. See Sambrook, et al. (1989) supra.
  • the nucleic acid can be inserted into the host cell by methods well known in the art such as transformation for bacterial cells; transfection using calcium phosphate precipitation for mammalian cells; or DEAE-dextran; electroporation; or microinjection. See Sambrook, et al. (1989) supra for this methodology.
  • this invention also provides a host cell, e.g. a mammalian cell, an animal cell (rat or mouse), a human cell, or a procaryotic cell such as a bacterial cell, containing a polynucleotide encoding a protein or polypeptide or antibody.
  • a pharmaceutically acceptable vector such as a replication-incompetent retroviral or adenoviral vector.
  • Pharmaceutically acceptable vectors containing the nucleic acids of this invention can be further modified for transient or stable expression of the inserted polynucleotide.
  • the term "pharmaceutically acceptable vector” includes, but is not limited to, a vector or delivery vehicle having the ability to selectively target and introduce the nucleic acid into dividing cells.
  • An example of such a vector is a "replication-incompetent" vector defined by its inability to produce viral proteins, precluding spread of the vector in the infected host cell.
  • LNL6 An example of a replication-incompetent retroviral vector is LNL6 (Miller, A.D. et al. (1989) BioTechniques 7:980-990).
  • the methodology of using replication- incompetent retroviruses for retro viral-mediated gene transfer of gene markers is well established (Correll, et al. (1989) PNAS USA 86:8912; Bordignon (1989) PNAS USA 86:8912-52; Culver, K. (1991) PNAS USA 88:3155; and Rill, D.R. (1991) Blood 79(10):2694-700. Clinical investigations have shown that there are few or no adverse effects associated with the viral vectors, see Anderson (1992) Science 256:808-13.
  • compositions containing the polynucleotides of this invention, in isolated form or contained within a vector or host cell are further provided herein. When these compositions are to be used pharmaceutically, they are combined with a pharmaceutically acceptable carrier. Proteins
  • This invention provides uses for one or more protein selected from the group consisting of FRP 4, FGF 23, mutant FGF 23, and PHEX and soluble PHEX polypeptides expressed from the polynucleotides described above, which is intended to include wild-type and recombinantly produced polypeptides and proteins from prokaryotic and eukaryotic host cells, as well as muteins, analogs and fragments thereof. En some embodiments, the term also includes antibodies and anti-idiotypic antibodies. In one embodiment, these proteins or polypeptides are a phophatonin-related factor which modulates phosphatonin activity, an example of which is PHEX. Such polypeptides can be isolated or produced using the methods identified below.
  • Proteins can be purified by methods such as immunoprecipitation with antibody, and standard techniques such as gel filtration, ion-exchange, reversed-phase, and affinity chromatography using a fusion protein as shown herein.
  • standard techniques such as gel filtration, ion-exchange, reversed-phase, and affinity chromatography using a fusion protein as shown herein.
  • this invention also provides the processes for obtaining these proteins and polypeptides as well as the products obtainable and obtained by these processes.
  • the proteins and polypeptides also can be obtained by chemical synthesis using a commercially available automated peptide synthesizer such as those manufactured by Perkin Elmer/ Applied Biosystems, Inc., Model 430A or 431 A, Foster City, CA, USA.
  • the synthesized protein or polypeptide can be precipitated and further purified, for example by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • this invention also provides a process for chemically synthesizing the proteins of this invention by providing the sequence of the protein and reagents, such as amino acids and enzymes and linking together the amino acids in the proper orientation and linear sequence.
  • the proteins and polypeptides can be obtained by well-known recombinant methods as described, for example, in Sambrook, et al., (1989), supra, using the host cell and vector systems described above.
  • detectably labeled proteins and polypeptides can be bound to a column and used for the detection and purification of antibodies. They also are useful as immunogens for the production of antibodies as described below.
  • the proteins and fragments of this invention are useful in an in vitro assay system to screen for agents or drugs, which modulate cellular processes.
  • PHEX and soluble PHEX also can be combined with various liquid phase carriers, such as sterile or aqueous solutions, pharmaceutically acceptable carriers, suspensions and emulsions.
  • suitable adjuvants include, but are not limited to Freund's Complete and Incomplete, mineral salts and polynucleotides.
  • This invention also provides methods of using a pharmaceutical composition
  • a pharmaceutical composition comprising any of a protein, analog, mutein, polypeptide fragment, antibody, antibody fragment or anti-idiotypic antibody of this invention, alone or in combination with each other or other agents, and an acceptable carrier. These compositions are useful for various diagnostic and therapeutic methods as described herein.
  • Antibodies The present invention also envisions utilizing an antibody capable of specifically forming a complex with one or more protein selected from the group consisting of FRP 4, FGF 23, mutant FGF 23, soluble PHEX and PHEX proteins or polypeptides as described above.
  • the term "antibody” includes polyclonal antibodies and monoclonal antibodies. The antibodies include, but are not limited to mouse, rat, and rabbit or human antibodies. Laboratory methods for producing polyclonal antibodies and monoclonal antibodies, as well as deducing their corresponding nucleic acid sequences, are known in the art, see Harlow and Lane (1988) supra and Sambrook, et al. (1989) supra.
  • the monoclonal antibodies of this invention can be biologically produced by introducing protein or a fragment thereof into an animal, e.g., a mouse or a rabbit.
  • the antibody producing cells in the animal are isolated and fused with myeloma cells or hetero-myeloma cells to produce hybrid cells or hybridomas.
  • the hybridoma cells producing the monoclonal antibodies of this invention also are provided.
  • one of skill in the art can produce and screen the hybridoma cells and antibodies of this invention for antibodies having the ability to bind the proteins or polypeptides.
  • a monoclonal antibody being tested binds with the protein or polypeptide, then the antibody being tested and the antibodies provided by the hybridomas of this invention are equivalent. It also is possible to determine without undue experimentation, whether an antibody has the same specificity as the monoclonal antibody of this invention by determining whether the antibody being tested prevents a monoclonal antibody of this invention from binding the protein or polypeptide with which the monoclonal antibody is normally reactive. If the antibody being tested competes with the monoclonal antibody of the invention as shown by a decrease in binding by the monoclonal antibody of this invention, then it is likely that the two antibodies bind to the same or a closely related epitope.
  • antibody also is intended to include antibodies of all isotypes. Particular isotypes of a monoclonal antibody can be prepared either directly by selecting from the initial fusion, or prepared secondarily, from a parental hybridoma secreting a monoclonal antibody of different isotype by using the sib selection technique to isolate class switch variants using the procedure described in Steplewski et al. (1985) PNAS 82:8653 or Spira et al. (1984) J. Immunol. Methods 74:307.
  • antibody fragments retain some ability to selectively bind with its antigen or immunogen.
  • antibody fragments can include, but are not limited to: Fab; Fab'; F(ab') 2 , Fv; and SCA.
  • a biologically active antibody fragment is a CDR region of the antibody. Methods of making these fragments are known in the art, see for example, Harlow and Lane, (1988) supra.
  • the antibodies utilized in practicing this invention also can be modified to create chimeric antibodies. Chimeric antibodies are those in which the various domains of the antibodies' heavy and light chains are coded for by DNA from more than one species making the antibody compositions more compatible with a host system by minimizing potential adverse immune system responses. This may be accomplished in a variety of ways, including modifying the antibodies to create chimeric antibodies (e.g., antibodies in which the various domains of the antibodies' heavy and light chains are coded for by DNA from more than one species), such as humanized antibodies (Oi, et al.
  • chimeric antibodies include but are not limited to, non-human mammal- human chimeras, rodent-human chimeras, murine-human and rat-human chimeras (Robinson et al., International Patent Application 184,187; Taniguchi M., European Patent Application 171,496; Morrison et al., European Patent Application 173, 494; Neuberger et al., PCT Application WO 86/01533; Cabilly et al., 1987 Proc. Natl. Acad. Sci. USA 84:3439;
  • the antibodies or antigen binding fragments may also be produced by genetic engineering.
  • the technology for expression of both heavy and light chain genes in E. coli is the subject the PCT patent applications; publication number WO 901443, WO901443, and WO 9014424 and in Huse et al., 1989 Science 246:1275-1281.
  • techniques described for the production of single chain antibodies U.S. Pat. 4,946,778; Bird, 1988, Science 242, 423-426; Huston, et al., 1988, Proc. Natl. Acad. Sci. USA 85, 5879-5883; and Ward, et al., 1989, Nature 334, 544-546
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • the isolation of other hybridomas secreting monoclonal antibodies with the specificity of the monoclonal antibodies of the invention can also be accomplished by one of ordinary skill in the art by producing anti-idiotypic antibodies (Herlyn, et al. (1986) Science 232:100).
  • An anti-idiotypic antibody is an antibody which recognizes unique determinants present on the monoclonal antibody produced by the hybridoma of interest.
  • Idiotypic identity between monoclonal antibodies of two hybridomas demonstrates that the two monoclonal antibodies are the same with respect to their recognition of the same epitopic determinant.
  • antibodies to the epitopic determinants on a monoclonal antibody it is possible to identify other hybridomas expressing monoclonal antibodies of the same epitopic specificity.
  • an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region that is the mirror image of the epitope bound by the first monoclonal antibody.
  • the anti-idiotypic monoclonal antibody could be used for immunization for production of these antibodies.
  • epitopic determinants are meant to include any determinant having specific affinity for the monoclonal antibodies of the invention.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • the antibodies utilized in this invention can be linked to a detectable agent or label.
  • a detectable agent or label There are many different labels and methods of labeling known to those of ordinary skill in the art.
  • the antibody-label complex is useful to detect the protein or fragments in a sample, using standard immunochemical techniques such as immunohistochemistry as described by Harlow and Lane (1988) supra.
  • Competitive and non-competitive immunoassays in either a direct or indirect format are examples of such assays, e.g., enzyme linked immunoassay
  • ELISA radioimmunoassay
  • sandwich immunometric assay
  • haptens such as biotin, which reacts avidin, or dinitropherryl, pyridoxal, and fluorescein, which can react with specific anti-hapten antibodies. See Harlow and Lane (1988) supra.
  • Monoclonal antibodies also can be bound to many different carriers.
  • this invention also envisions employing compositions containing the antibodies and another substance, active or inert.
  • examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite.
  • the nature of the carrier can be either soluble or insoluble for pu ⁇ oses of the invention.
  • suitable carriers for binding monoclonal antibodies or will be able to ascertain such, using routine experimentation.
  • compositions containing the antibodies, fragments thereof or cell lines which produce the antibodies are encompassed by this invention.
  • compositions are to be used pharmaceutically, they are combined with a pharmaceutically acceptable carrier.
  • the invention provides methods for identification, characterization and modulation of a selected phenotype of a tumor mass isolated from a patient with oncogenic osteomalacia. Manipulation of selected cells is useful for practicing these methods of the invention.
  • Tumors from which sample cells can be obtained for use in the present invention are tumors originated from patients with symptoms of oncogenic osteomalacia. These include, but are not limited to, hemangiopericytomas and other tumors of mesenchymal origin, carcinoma of prostate and lung, fibrous dysplasia of bone, linear sebaceous naevus syndrome, neurofibromatosis, and oat cell carcinoma.
  • Tumor cells are typically obtained from a cancer patient by resection, biopsy, or endoscopic sampling; the cells may be used directly, stored frozen, or maintained or expanded in culture. Samples of both the tumor and the patient's blood or blood fraction should be thoroughly tested to ensure sterility before co-culturing of the cells. Standard sterility tests are known to those of skill in the art and are not described in detail herein.
  • the tumor cells can be cultured in vitro to generate a cell line. Conditions for reliably establishing short-term cultures and obtaining at least 10 8 cells from a variety of tumor types is described in Dillmar, et al. (1993) J. Immunother. 14:65-69. Alternatively, tumor cells can be dispersed from, for example, a biopsy sample, by standard mechanical means before use.
  • One aspect of the invention involves the comparison of transcript expression pattern between a sample cell and a control cell.
  • the selection of the control cell is determined by the sample cell initially selected and the phenotype of interest.
  • the control cell can be any of a counte ⁇ art normal cell type, a counte ⁇ art benign cell type, a counte ⁇ art non-neoplastic cell type and a non-neoplastic precursor of the neoplastic cell.
  • the sample cell can be a hemangiopencytoma cell isolated from a patient with oncogenic osteomalacia;
  • the counte ⁇ art control cell can be a hemangiopericytoma cell isolated from a patient who does not have oncogenic osteomalacia.
  • tumor cells can be dispersed from, for example, a biopsy sample, by standard mechanical means before use.
  • One aspect of the invention involves the comparison of transcript expression pattern between a sample cell and a control cell.
  • the selection of the control cell is determined by the sample cell initially selected and the phenotype of interest.
  • the control cell can be any of a counte ⁇ art normal cell type, a counte ⁇ art benign cell type, a counte ⁇ art non-neoplastic cell type and a non-neoplastic precursor of the neoplastic cell.
  • the sample cell can be a hemangiopericytoma cell isolated from a patient with oncogenic osteomalacia;
  • the counte ⁇ art control cell can be a hemangiopericytoma cell isolated from a patient who does not have oncogenic osteomalacia.
  • An isolated gene of one or more of a gene selected from the group consisting of FRP 4, FGF 23, soluble PHEX and PHEX genes can be used to search for and identify single nucleotide polymo ⁇ hisms (SNP's), which are mutant variants of the gene in the human population. Identification of such polymo ⁇ hisms is useful to define human diseases to which mutations in the genes contribute and to perfect therapies for disease processes in which the protein encoded by the genes participates. Mutant variants of the genes identified in this manner can then be employed in the development, screening, and analysis of pharmaceutical agents to treat these diseases. Methods to detect such SNP's can be formatted to create diagnostic tests.
  • SNP's identified in the genes can provide useful sequence markers for genetic tests to analyze other genes and mutations in the region of the genome where the gene(s) is located. Thus it is useful to inco ⁇ orate these SNP's into polymo ⁇ hism databases.
  • OOM tumors included in this study were resected from patients who met the following criteria: 1) acquired hypophosphatemia with no family history of hypophosphatemia or other medical illnesses predisposing to hypophosphatemia 2) low serum 1,25 (OH) 2 vitamin D 3 3) inappropriate phosphaturia (suppressed tubular reabso ⁇ tion of phosphate (TRP)) 4) evidence of osteomalacia 5) normalization of biochemical parameters after tumor resection 6) tumor type previously reported to be associated with OOM (Table 1).
  • Tissue RNA Extraction Tissues were obtained immediately after surgical resection and frozen in liquid nitrogen and stored at -80°C. Tissue samples (0.5-1.0 gram) were diced into small fragments with a sterile scalpel and homogenized in Trizol (Life Technologies, Gaithersburg, MD). Total cytoplasmic RNA was extracted in Trizol or Stat-100 (Biotecx Laboratories, Inc., Houston, TX), according to the directions of the manufacturer. Poly (A)+ RNA was extracted using the Oligotex mRNA Midi Kit (Qiagen Inc., CA).
  • cDNA Isolation Partial cDNAs encompassing the 3' end of selected candidates were isolated using three independent methods. When possible, plasmids containing ESTs or full- length cDNAs representing genes identified by SAGE were purchased from commercial sources (Image Consortium or Genome Systems) and used as templates for amplification via polymerase chain reaction to create partial cDNAs. Alternatively, fragments were isolated using an anchored PCR technique that employed a forward primer complementary to the SAGE tag and oligo dT as the reverse primer. In both cases, amplicons were inserted into vectors using the TA cloning kit (Envitrogen) and sequenced to confirm the identity of the amplicon.
  • TA cloning kit Endoscopic cloning kit
  • cDNAs were isolated directly from OOM lambda phage libraries using a 15-mer oligo complimentary to the SAGE tag of interest.
  • Custom Array Generation and Analysis PCR amplified cDNA target sequences were purified using QIAquick PCR purification kit or QIAQuick Gel extraction kit (Qiagen, Inc., CA).
  • Microarrays were prepared by spotting the target cDNA sequences in quadruplicae onto replicate nylon membranes (Biotrans; ICN, Costa Mesa, CA) at a concentration of 2 ng of DNA/spot using a BOMEK 2000 robot (Beckman Coulter, Inc., Fullerton, CA). For probes, poly (A)+ RNA was isolated from tumor tissue as described above.
  • RNA was converted to cDNA and labeled with [ 32 P]-dCTP by reverse transcription using Superscript II RT (Life Technologies, Inc.). Hybridization intensities were quantitated on a STORM Phosphorlmager (Molecular Dynamics, Sunnyvale, CA), and an average signal for each set of four targets was determined. Results of these assays are shown in Figures 1 and 2.
  • RT-PCR was performed with 1 ⁇ g total RNA as previously described (Ringel JCEM (1998)). PCR was performed using 2 ⁇ l of cDNA in a 25 ⁇ l volume containing 7 ⁇ polymerase buffer (1.5 mmol/L magnesium chloride), 1 mmol/L of each primer, 0.1 mmol/L of each deoxyribonucleotide triphosphate, and 2.5 U Taq polymerase (Perkin-Elmer, Foster City, CA). The following sets of sense and antisense primers were used for PCR: 5'GAGAAGGCAACCAAAGTGCAG3' (Seq. ED No. 7) and 5'GAAGCACTGGATCCACTTGCGGCG3' (Seq. ED No. 8) for GNAS1 , 5 'GTATGCCACAAGGGAAAGG3 ' (Seq. ED No. 9) and
  • 5'TTCTATTAAAGGCTATAATG3' (Seq. ED No. 10) for MEPE, 5'CCAATGACTTCAGTTTCTGTT3' (Seq. ED No. 11) and 5 AAGCTTGTCAAATTATTCTCAG3' (Seq. ED No. 12)for FRP 4, and 5 ⁇ TTGAGTGGATGGATGCAGGAA3' (Seq. ED No. 13) and 5 ' AGGAAAGGCTTCTGGAGCTC3 ' (Seq. ED No. 14) for PHEX.
  • the PCR cycling profile consisted of an initial 15 minute denaturation at 94°C, followed by 29 cycles of annealing (50°C for FRP-4 and GNAS1, 55°C for PHEX, 47°C for MEPE, 45 seconds), extension(72°C, 60 seconds) and denaturation(94°C, 20 seconds), with a final 5 minute extension.
  • PCR reactions without added reverse transcriptase were performed in parallel to exclude DNA contamination.
  • RT-PCR products were electrophoresed on 6% polyacrylamide gels, stained with ethidium bromide and visualized with UV light.
  • PHEX Assay The ability of PHEX to enhance the degradation of candidate genes was analyzed using methods and techniques known in the art.
  • Membranes were probed with 15 ng/ml anti-V5 antibody conjugated to HRP (Invitrogen) and visualized by ECL (Pierce). PHEX enhanced degradation was measured as a reduction in immunoreactive band in PHEX containing lysates relative to control lysates. Results demonstrated FGF 23 and FRP-4 protein levels were decreased in the presence of PHEX. In contrast, levels of full length mutant FGF 23, MEPE (matrix extracellular phosphoglycoprotein) or DMP-1 (dentin matrix protein I) were not affected by the presence of PHEX.
  • the phosphate transport modulating activity of the FRP 4 and FGF 23 or PHEX proteins are analyzed using methods and techniques known in the art. Specifically, sodium-dependent phosphate uptake is measured in opossum kidney (OK) cells according to the methods described in Cai et al. (1994) New Engl. J. Med. 330:1645-1649. Briefly, OK cells are cultured until becoming confluent, harvested and then re-seeded at a density of 1 X 10 5 cells per 24 well dish. The cells are then re- grown for several days past the time they become confluent and then re-fed with medium containing the 4 proteins as well as medium containing a variety of alternative experimental and control factors.
  • OK opossum kidney
  • the medium is removed and the plated cells are re-fed with transport medium containing ⁇ P-labeled dibasic potassium phosphate and incubated at 37°C for 5 minutes. The cells are then washed, harvested and radioactivity measured via a scintillation counter to monitor uptake of 32 P.
  • Results of the OK phosphate transport assay performed on conditioned medium containing the FGF-23 protein and control samples showed that conditioned medium that contained the FGF 23 protein induced a statistically significant reduction in phosphate uptake by the OK cells in comparison with control samples that did not contain this factor (Bowe et al (2001) Biochemical and Biophysical Research Communication 284: 977-981, herein inco ⁇ orated by reference).

Abstract

L'invention se rapporte à des procédés et des compositions permettant de réguler l'homéostasie de phosphate de sérum ou de phosphate. L'invention se rapporte plus particulièrement à des procédés et des compositions permettant d'augmenter ou de diminuer les niveaux de phosphate de sérum lors du traitement et/ou de la prévention d'une grande variété de maladies associées au phosphate par la modulation de l'activité ou de l'expression de FRP 4, FGF 23 et PHEX. Les procédés de cette invention sont utiles pour augmenter la réabsorption de phosphate ou de phosphate de sérum par l'apport à un sujet d'un agent inhibant l'activité de FGF 23 ou FRP-4 ou pour diminuer la réabsorption de phosphate ou phosphate sérum par l'apport à un sujet d'un agent stimulant l'activité de FGF 23 ou FRP-4 ou inhibant l'activité de PHEX. Font aussi l'objet de cette invention des procédés de modulation du transport du phosphate dans les reins, de soulagement des symptômes associés à l'ostéomalacie oncogène, de traitement de maladies associées à l'homostasie de phosphate et de modulation du phénotype d'une cellule néoplasique associée à une cellule OOM ou d'une cellule associée à l'homéostasie de phosphate. Par ailleurs, l'invention se rapporte à des procédés de détection et de monitorage de l'expression d'un(e) ou plusieurs des gène(s) ou protéine(s) FRP 4, FGF 23 et PHEX. L'invention se rapporte finalement à des procédés de criblage d'agents candidats permettant d'identifier les compositions modifiant l'activité ou l'expression de FRP 4, FGF 23 et PHEX.
PCT/US2002/018609 2001-05-11 2002-05-13 Compositions et procedes permettant de reguler le phosphate de serum WO2002092128A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US29048301P 2001-05-11 2001-05-11
US60/290,483 2001-05-11
US29629801P 2001-06-06 2001-06-06
US60/296,298 2001-06-06

Publications (1)

Publication Number Publication Date
WO2002092128A1 true WO2002092128A1 (fr) 2002-11-21

Family

ID=26966213

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/018609 WO2002092128A1 (fr) 2001-05-11 2002-05-13 Compositions et procedes permettant de reguler le phosphate de serum

Country Status (1)

Country Link
WO (1) WO2002092128A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6576426B2 (en) 1993-07-30 2003-06-10 Oxford Gene Technology Limited Tag reagent and assay method
WO2004050620A2 (fr) * 2002-12-03 2004-06-17 Enobia Pharma Derives d'acides succinique et glutarique et leurs analogues utilises comme inhibiteurs de phex
WO2007066708A1 (fr) * 2005-12-07 2007-06-14 Osaka Industrial Promotion Organization Induction de la formation de tissu dur sur la base d’un systeme de signalisation wnt5a/sfrp4
WO2007090872A2 (fr) * 2006-02-09 2007-08-16 Novartis Ag Agents de liaison de la proteine-4 apparentee a frizzled (sfrp-4)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000050580A2 (fr) * 1999-02-24 2000-08-31 Universite De Montreal Composition, procedes et reactifs pour la synthese de forme soluble du phex humain

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000050580A2 (fr) * 1999-02-24 2000-08-31 Universite De Montreal Composition, procedes et reactifs pour la synthese de forme soluble du phex humain

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"The ADHR consortium. Autosomal dominant hypophosphatemic rickets is associated with mutations in FGF23", NATURE GENETICS, vol. 26, November 2000 (2000-11-01), pages 345 - 348, XP002955729 *
JOHN ET AL.: "A case of neuroendocrine oncogenic osteomalacia associated with PHEX and fibroblast growth factor-23 expressing sinusidal malignant schwannoma", BONE, vol. 29, no. 4, October 2001 (2001-10-01), pages 393 - 402, XP002955730 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6576426B2 (en) 1993-07-30 2003-06-10 Oxford Gene Technology Limited Tag reagent and assay method
WO2004050620A2 (fr) * 2002-12-03 2004-06-17 Enobia Pharma Derives d'acides succinique et glutarique et leurs analogues utilises comme inhibiteurs de phex
WO2004050620A3 (fr) * 2002-12-03 2004-08-19 Biomep Inc Derives d'acides succinique et glutarique et leurs analogues utilises comme inhibiteurs de phex
US7105539B2 (en) 2002-12-03 2006-09-12 Enobia Pharma Derivatives of succinic and glutaric acids and analogs thereof useful as inhibitors of phex
US7365091B2 (en) 2002-12-03 2008-04-29 Enobia Pharma Derivatives of succinic and glutaric acids and analogs thereof useful as inhibitors of PHEX
WO2007066708A1 (fr) * 2005-12-07 2007-06-14 Osaka Industrial Promotion Organization Induction de la formation de tissu dur sur la base d’un systeme de signalisation wnt5a/sfrp4
JPWO2007066708A1 (ja) * 2005-12-07 2009-05-21 財団法人大阪産業振興機構 Ｗｎｔ５ａ／ＳＦＲＰ４シグナル系に基づく硬組織形成誘導
WO2007090872A2 (fr) * 2006-02-09 2007-08-16 Novartis Ag Agents de liaison de la proteine-4 apparentee a frizzled (sfrp-4)
WO2007090872A3 (fr) * 2006-02-09 2007-11-29 Novartis Ag Agents de liaison de la proteine-4 apparentee a frizzled (sfrp-4)

Similar Documents

Publication Publication Date Title
US6124104A (en) Chromosome 13-linked breast cancer susceptibility gene
EP1260520A2 (fr) Gène BRCA2 lié au chromosome 13, de la susceptibilité au cancer du sein
US20040175744A1 (en) Polynucleotide sequences and corresponding encoded polypeptides of particular secreted and membrane-bound proteins overexpressed in certain cancers
WO1998040475A1 (fr) Gene humain de metalloprotease matricielle, proteines codees a partir de ce dernier, et procedes d'utilisation associes
US20040241646A1 (en) Novel serine protease reagents and methods useful for detecting and treating diseases of the prostate
JP2002536995A (ja) 結腸の疾患に関連する遺伝子
JP2002538789A (ja) 新規なヒトカリクレイン−様遺伝子
US5989885A (en) Specific mutations of map kinase 4 (MKK4) in human tumor cell lines identify it as a tumor suppressor in various types of cancer
US20020102641A1 (en) Oncogenic osteomalacia-related gene 1
WO2002092128A1 (fr) Compositions et procedes permettant de reguler le phosphate de serum
WO2002076467A1 (fr) Compositions et procedes de regulation du metabolisme osseux et mineral
US20020115627A1 (en) Phosphatonin-related gene and methods of use thereof
US6333403B1 (en) Chromosome 17p-linked prostate cancer susceptibility gene and a paralog and orthologous genes
US6063576A (en) Actin mutations in dilated cardiomyopathy, a heritable form of heart failure
US6844189B1 (en) Chromosome 17P-linked prostate cancer susceptibility gene
US7005290B1 (en) Best's macular dystrophy gene
MXPA02004241A (es) Regulacion de la expresion de genes por agentes neurolepticos.
WO2003025197A2 (fr) Compositions a base de proteine mutante de liaison a sh3 et methodes associees
WO2001073062A1 (fr) Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO1999058560A2 (fr) Gene et proteine prostapine ainsi que leurs applications
WO2004092198A2 (fr) Compositions et procedes permettant de modifier la regulation du gene induit par l'hypoxie
WO2001064734A1 (fr) Nouveau polypeptide, cathepsine humaine 18, et polynucleotide codant pour ce polypeptide
WO2001040480A1 (fr) Nouveau polypeptide, endopolypeptidase humaine 6, et polynucleotide codant pour ce polypeptide
WO2000012694A1 (fr) Gene de susceptibilite du cancer de la prostate lie au chromosome 1 et suppresseur tumoral multi-site

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP