WO2002076510A1 - Use of biomolecular targets in the treatment and visualization of brain tumors - Google Patents

Use of biomolecular targets in the treatment and visualization of brain tumors Download PDF

Info

Publication number
WO2002076510A1
WO2002076510A1 PCT/US2002/008992 US0208992W WO02076510A1 WO 2002076510 A1 WO2002076510 A1 WO 2002076510A1 US 0208992 W US0208992 W US 0208992W WO 02076510 A1 WO02076510 A1 WO 02076510A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cells
brain tumor
gene
brain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2002/008992
Other languages
English (en)
French (fr)
Inventor
Sabine Mueller
Thorsten Melcher
Daniel J. Chin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AGY Therapeutics Inc
Original Assignee
AGY Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/816,703 external-priority patent/US6455026B1/en
Priority claimed from US09/983,000 external-priority patent/US20030118585A1/en
Application filed by AGY Therapeutics Inc filed Critical AGY Therapeutics Inc
Priority to EP02726668A priority Critical patent/EP1383543A4/en
Priority to JP2002575022A priority patent/JP2004537282A/ja
Priority to CA002439630A priority patent/CA2439630A1/en
Publication of WO2002076510A1 publication Critical patent/WO2002076510A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/0002General or multifunctional contrast agents, e.g. chelated agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • BACKGROUND OF THE INVENTION Among tumors, those of the brain are considered to have one of the least favorable prognoses for long term survival: the average life expectancy of an individual diagnosed with a central nervous system (CNS) tumor is just eight to twelve months.
  • CNS central nervous system
  • Several unique characteristics of both the brain and its particular types of neoplastic cells create daunting challenges for the complete treatment and management of brain tumors. Among these are the physical characteristics of the intracranial space; the relative biological isolation of the brain from the rest of the body; the relatively essential and irreplaceable nature of the organ mass; and the unique nature of brain tumor cells.
  • the intracranial space and physical layout of the brain create significant obstacles to treatment and recovery.
  • the brain is primarily comprised of astrocytes, which make up the majority of the brain mass, and serve as a scaffold and support for the neurons, neurons, which carry the actual electrical impulses of the nervous system, and a minor contingent of other cells, such as insulating oligodendrocytes that produce myelin.
  • astrocytes which make up the majority of the brain mass, and serve as a scaffold and support for the neurons
  • neurons which carry the actual electrical impulses of the nervous system
  • insulating oligodendrocytes that produce myelin.
  • These cell types give rise to primary brain tumors, including astrocytomas, neuroblastomas, glioblastomas, oligodendrogliomas, and the like.
  • the brain is encased in the rigid shell of the skull, and is cushioned by the cerebrospinal fluid. Because of the relatively small volume of the skull cavity, minor changes in the volume of tissue in the brain can dramatically increase intracranial pressure, causing damage to the entire organ. Thus, even small tumors can have a profound and adverse affect on the brain's function. The cramped physical location of the cranium also makes surgery and treatment of the brain a difficult and delicate procedure. However, because of the dangers of increased intracranial pressure from the tumor, surgery is often the first strategy of attack in treating brain tumors. In addition to its physical isolation, the brain is chemically and biologically isolated from the rest of the body by the "Blood-Brain-Barrier" (or BBB).
  • BBB Backbone-Brain-Barrier
  • Neoplastic brain cells are often pervasive, and travel throughout the entire brain mass. Thus, it is impossible to define a true "tumor margin," unlike, for example, in lung or bladder cancers. Unlike reproductive (ovarian, uterine, testicular, prostate, etc.), breast, kidney, or lung cancers, the entire organ, or even significant portions, cannot be removed to prevent the growth of new tumors.
  • brain tumors are very heterogeneous, with different cell doubling times, treatment resistances, and other biochemical idiosyncrasies between the various cell populations that make up the tumor.
  • the present invention provides methods and reagents for specifically targeting brain tumor neoplastic cells for both therapeutic and imaging purposes, by targeting brain tumor protein targets (T BT )- These targets have been identified as being overexpressed in brain tumors, and thus allow for the selective inhibition of cell function or selective marking for visualization with therapeutic or visualizing compositions which have a specific affinity for these protein targets.
  • T BT brain tumor protein targets
  • the invention also provides methods for the identification of compounds that modulate the expression of genes or the activity of gene products involved in such tumors, as well as methods for the treatment of disease by administering such compounds to individuals suffering from such tumors.
  • Also included in the invention are two novel isoforms of PTP ⁇ , SMI and SM2.
  • FIGURE 1 A diagram of the two newly discovered splicing variant isoforms of PTP ⁇ . The approximate position of the domains of the isoforms is indicated underneath the isoforms, as well as the approximate exon size (for size reference, exon 12 is 3.6 kilobases.)
  • SM 1 fails to splice correctly after the 9* exon, yielding a mRNA with two extra codons followed by a stop codon after the normal terminus of exon 9.
  • SM 2 contains a 116 nucleotide insertion from between exons 23 &24.
  • Brain tumor protein targets and genes that are differentially expressed between brain tumor tissue and normal brain tissue are provided herein. Differential cloning between cancerous and normal brains has identified brain tumor protein target genes by DNA sequence analysis. Genes and their protein products that are up-regulated in glioblastoma are important because they provide a specific marker for neoplastic cells, and are expected to mediate the initiation and progression of brain tumors. Inhibition of the gene and/or protein activity can be advantageous in treating brain tumors, e.g.
  • the overexpressed brain tumor protein targets provide excellent targets for immunotherapeutic agents that either deliver cytotoxic agents to directly promote tumor cell death, or that alter the function of the brain tumor protein targets to inhibit the normal physiology of the tumor cell.
  • immunoimaging agents targeted to the brain tumor protein targets can be utilized to visualize the tumor mass in diagnostic methods, e.g. magnetic resonance imaging (MRI), radiography, etc. and/or in surgery, e.g. by the use of optically visible dye moieties in an immunoimaging agent, etc.
  • Therapeutic and prophylactic treatment methods for individuals suffering from, or at risk of a brain tumor involve administering either a therapeutic or prophylactic amount of an agent that modulates the activity of T BT protein or gene or specifically binds to a T B ⁇ protein.
  • an agent that modulates the activity of T BT protein or gene or specifically binds to a T B ⁇ protein For example, a chemotherapeutic agent can be coupled to a T BT specific binding moiety.
  • Screening methods may involve conducting various types of assays to identify agents that modulate the expression or activity of a T B ⁇ gene or protein, or may involve screening for specific binding activity to a T B ⁇ o e or protein.
  • Lead compounds and/or binding moieties identified during these screens can serve as the basis for the synthesis of more active analogs.
  • Lead compounds and/or active analogs generated therefrom can be formulated into pharmaceutical compositions effective in treating brain tumors.
  • the present methods are applicable to brain tumors, particularly glioblastoma.
  • the goals of brain tumor treatments are to remove as many tumor cells as possible, e.g. with surgery, kill as many of the cells left behind after surgery as possible with radiation and/or chemotherapy, and put remaining tumor cells into a nondividing, quiescent state for as long as possible with radiation and chemotherapy.
  • Careful imaging surveillance is a crucial part of medical care, because tumor regrowth requires alteration of current treatment, or, for patients in the observation phase, restarting treatment.
  • Brain tumors are classified according to the kind of cell from which the tumor seems to originate. Diffuse, fibrillary astrocytomas are the most common type of primary brain tumor in adults. These tumors are divided histopathologically into three grades of malignancy: World Health Organization (WHO) grade II astrocytoma, WHO grade III anaplastic astrocytoma and WHO grade TV glioblastoma multiforme (GBM). WHO grade ⁇ astocytomas are the most indolent of the diffuse astrocytoma spectrum. Astrocytomas display a remarkable tendency to infiltrate the surrounding brain, confounding therapeutic attempts at local control. These invasive abilities are often apparent in low-grade as well as high-grade tumors.
  • WHO World Health Organization
  • GBM glioblastoma multiforme
  • Glioblastoma multiforme is the most malignant stage of astrocytoma, with survival times of less than 2 years for most patients. Histologically, these tumors are characterized by dense cellularity, high proliferation indices, endothelial proliferation and focal necrosis. The highly proliferative nature of these lesions likely results from multiple mitogenic effects.
  • One of the hallmarks of GBM is endothelial proliferation. A host of angiogenic growth factors and their receptors are found in GBMs. There are biologic subsets of astrocytomas, which may reflect the clinical heterogeneity observed in these tumors.
  • brain stem gliomas which are a form of pediatric diffuse, fibrillary astrocytoma that often follow a malignant course.
  • Brain stem GBMs share genetic features with those adult GBMs that affect younger patients.
  • Pleomorphic xanthoastrocytoma (PXA) is a superficial, low-grade astrocytic tumor that predominantly affects young adults. While these tumors have a strange histological appearance, they are typically slow-growing tumors that may be amenable to surgical cure. Some PXAs, however, may recur as GBM.
  • Pilocytic astrocytoma is the most common astrocytic tumor of childhood and differs clinically and histopathologically from the diffuse, fibrillary astrocytoma that affects adults. Pilocytic astrocytomas do not have the same genomic alterations as diffuse, fibrillary astrocytomas.
  • Subependymal giant cell astrocytomas (SEGA) are periventricular, low-grade astrocytic tumors that are usually associated with tuberous sclerosis (TS), and are histologically identical to the so-called "candle-gutterings" that line the ventricles of TS patients.
  • Desmoplastic cerebral astrocytoma of infancy (DCAI) and desmoplastic infantile ganglioglioma (DIGG) are large, superficial, usually cystic, benign astrocytomas that affect children in the first year or two of life.
  • Oligodendrogliomas and oligoastrocytomas are diffuse, usually cerebral tumors that are clinically and biologically most closely related to the diffuse, fibrillary astrocytomas. The tumors, however, are far less common than astrocytomas and have generally better prognoses than the diffuse astrocytomas. Oligodendrogliomas and oligoastrocytomas may progress, either to WHO grade in anaplastic oligodendroglioma or anaplastic oligoastrocytoma, or to WHO grade TV GBM. Thus, the genetic changes that lead to oligodendroglial tumors constitute yet another pathway to GBM.
  • Ependymomas are a clinically diverse group of gliomas that vary from aggressive intraventricular tumors of children to benign spinal cord tumors in adults. Transitions of ependymoma to GBM are rare. Choroid plexus tumors are also a varied group of tumors that preferentially occur in the ventricular system, ranging from aggressive supratentorial intraventricular tumors of children to benign cerebellopontine angle tumors of adults. Choroid plexus tumors have been reported occasionally in patients with Li-Fraumeni syndrome and von Hippel-Lindau (VHL) disease.
  • VHL von Hippel-Lindau
  • Medulloblastomas are highly malignant, primitive tumors that arise in the posterior fossa, primarily in children. Meningiomas are common intracranial tumors that arise in the meninges and compress the underlying brain. Meningiomas are usually benign, but some "atypical" meningiomas may recur locally, and some meningiomas are mentally malignant and may invade the brain or metastasize. Atypical and malignant meningiomas are not as common as benign meningiomas. Schwannomas are benign tumors that arise on peripheral nerves.
  • Hemangioblastomas are tumors of uncertain origin that are composed of endothelial cells, pericytes and so-called stromal cells. These benign tumors most frequently occur in the cerebellum and spinal cord of young adults. Multiple hemangioblastomas are characteristic of von Hippel-Lindau disease (VHL). Hemangiopericytomas (HPCs) are dural tumors which may display locally aggressive behavior and may metastasize. The histogenesis of dural-based hemangiopericytoma (HPC) has long been debated, with some authors classifying it as a distinct entity and others classifying it as a subtype of meningioma.
  • VHL von Hippel-Lindau disease
  • Tumors in the frontal lobe of the brain may cause weakness and paralysis, mood disturbances, difficulty in thinking, confusion and disorientation, and wide emotional mood swings.
  • Parietal lobe tumors may cause seizures, numbness or paralysis, difficulty with handwriting, inability to perform simple mathematical problems, difficulty with certain movements, and loss of the sense of touch.
  • Tumors in the occipital lobe can cause loss of vision in half of each visual field, visual hallucinations, and seizures.
  • Temporal lobe tumors can cause seizures, perceptual and spatial disturbances, and receptive aphasia. If a tumor occurs in the cerebellum, the person may have ataxia, loss of coordination, headaches, and vomiting. Tumors in the hypothalamus may cause emotional changes, and changes in the perception of hot and cold. In addition, hypothalamic tumors may affect growth and nutrition in children. With the exception of the cerebellum, a tumor on one side of the brain causes symptoms and impairment on the opposite side of the body.
  • disorders of the nervous system include, but are not limited to ischemic stroke, brain cancer, epilepsy, schizophrenia, depression, Alzheimer's Disease, Parkinson's Disease, Huntington's Chorea, traumatic head injury, dementia, coma, stupor, headache (and other neurological pain), vertigo, weakness, myasthenia gravis (and other disorders of the neuromuscular junction), ataxia and cerebellar disorders, cranial nerve disorders (such as Bell's Palsy), cerebrovascular disorders, infectious disorders including bacterial, fungal, viral and parasitic infections, multiple sclerosis, and other complications associated with pregnancy, medical illness, alcohol and substance abuse, toxins and metabolic deficiencies.
  • T BT gene A genetic sequence that comprises all or a part of a cDNA sequence that is differentially expressed in brain tumor cells, particularly glioblastoma cells, relative to expression in normal, or non-disease conditions, is herein termed a "T BT gene", which encode "T BT proteins”.
  • T BT genes were identified by creating subtracted and normalized cDNA libraries from glioblastoma tissues. The cDNA's from control and disease states were subjected to kinetic re-annealing hybridization during which normalization of transcript abundances and enrichment for low-abundance transcripts-occurs.
  • Differential up- or down-regulated transcripts in tumors can be enriched by a subsequent "forward" or “reverse” subtraction step by using a second driver cDNA.
  • Only clones displaying a significant transcriptional induction and/or repression were sequenced and carried forward for expression profiling, using a variety of temporal, spatial and disease-related probe sets. Selected clones showing a significant transcriptional induction and/or repression were sequenced and functionally annotated in a proprietary database structure (See WO01/13105). Because large sequence fragments were utilized in the sequencing step, the data generated has a much higher fidelity and specificity than other approaches, such as SAGE.
  • Table 1 includes, in some instances, the human and animal counterparts of a sequence, as indicated by a shared internal reference designation.
  • Transcripts that represent differentially expressed genes may be identified by utilizing a variety of methods known to those of skill in the art, including differential screening, subtractive hybridization, differential display, or hybridization to an array comprising a plurality of gene sequences.
  • differential expression refers to both quantitative as well as qualitative differences in the genes' temporal and/or tissue expression patterns.
  • a differentially expressed gene may have its expression activated or inactivated in normal versus neuronal disease conditions, or in control versus experimental conditions.
  • Such a qualitatively regulated gene will exhibit an expression pattern within a given tissue or cell type that is detectable in either control or tumor samples, but is not detectable in both.
  • Detectable refers to an RNA expression pattern that is detectable via the standard techniques of differential display, reverse transcription- (RT-) PCR and/or Northern analyses, which are well known to those of skill in the art.
  • differential expression means that there is at least a 20% change, and in other instances at least a 2-, 3-, 5- or 10-fold difference between disease and control tissue expression.
  • the difference usually is one that is statistically significant, meaning that the probability of the difference occurring by chance (the P-value) is less than some predetermined level (e.g., 5%).
  • the confidence level (P value) is ⁇ 0.05, more typically ⁇ 0.01, and in other instances, ⁇ 0.001.
  • a differentially expressed gene may have its expression modulated, i.e., quantitatively increased or decreased, in normal versus neuronal disease states, or under control versus experimental conditions.
  • the difference in expression need only be large enough to be visualized via standard detection techniques as described above.
  • the difference in expression levels measured by either the presence of mRNA or the protein product, will differ from basal levels (i.e. normal tissue) by at least about 2 fold, usually at least about 5 fold, and may be 10 fold, 100 fold, or more.
  • Identification of T BT pathway genes may be performed through physical association of gene products, or through database identification of known physiological pathways.
  • the two-hybrid system detects the association of proteins in vivo, as described by Chien et al. (1991) Proc. Natl. Acad. Sci. USA 88:9578-9582.
  • the two-hybrid system or related methodology may be used to screen activation domain libraries for proteins that interact with a known "bait" gene protein.
  • a sequence can be subjected to a functional validation process to determine whether the gene plays a role in tumor initiation, progression or maintenance.
  • Such candidate genes can potentially be correlated with a wide variety of cellular states or activities.
  • the term "functional validation” as used herein refers to a process whereby one determines whether modulation of expression or function of a candidate gene or set of such genes causes a detectable change in a cellular activity or cellular state for a reference cell, which can be a population of cells such as a tissue or an entire organism. The detectable change or alteration that is detected can be any activity carried out by the reference cell.
  • alterations include, but are not limited to, phenotypic changes (e.g., cell morphology, cell proliferation, cell viability and cell death); cells acquiring resistance to a prior sensitivity or acquiring a sensitivity which previously did not exist; protein/protein interactions; cell movement; intracellular or intercellular signaling; cell/cell interactions; cell activation (e.g., T cell activation, B cell activation, mast cell degranulation); release of cellular components (e.g., hormones, chemokines and the like); and metabolic or catabolic reactions.
  • phenotypic changes e.g., cell morphology, cell proliferation, cell viability and cell death
  • cells acquiring resistance to a prior sensitivity or acquiring a sensitivity which previously did not exist
  • protein/protein interactions e.g., cell movement; intracellular or intercellular signaling; cell/cell interactions
  • cell activation e.g., T cell activation, B cell activation, mast cell degranulation
  • release of cellular components e.g.,
  • RNAi technology can be used.
  • Antisense technology can also be utilized to functionally validate a candidate gene.
  • an antisense polynucleotide that specifically hybridizes to a segment of the coding sequence for the candidate gene is administered to inhibit expression of the candidate gene in those cells into which it is introduced.
  • the functional role that a candidate gene plays in a cell can also be assessed using gene "knockout" approaches in which the candidate gene is deleted, modified, or inhibited on either a single or both alleles.
  • the cells or animals can be optionally be reconstituted with a wild-type candidate gene as part of a further analysis.
  • RNAi technology is used in functional validation.
  • RNAi technology refers to a process in which double-stranded RNA is introduced into cells expressing a candidate gene to inhibit expression of the candidate gene, i.e., to "silence" its expression.
  • the dsRNA is selected to have substantial identity with the candidate gene.
  • such methods initially involve transcribing a nucleic acids containing all or part of a candidate gene into single- or double-stranded RNA.
  • Sense and anti-sense RNA strands are allowed to anneal under appropriate conditions to form dsRNA.
  • the resulting dsRNA is introduced into reference cells via various methods and the degree of attenuation in expression of the candidate gene is measured using various techniques.
  • the dsRNA is prepared to be substantially identical to at least a segment of a candidate gene. Because only substantial sequence similarity between the candidate gene and the dsRNA is necessary, sequence variations between these two species arising from genetic mutations, evolutionary divergence and polymo ⁇ hisms can be tolerated. Moreover, the dsRNA can include various modified or nucleotide analogs. Usually the dsRNA consists of two separate complementary RNA strands. However, in some instances, the dsRNA may be formed by a single strand of RNA that is self-complementary, such that the strand loops back upon itself to form a hairpin loop.
  • RNA duplex formation can occur inside or outside of a cell.
  • dsRNA can be prepared according to any of a number of methods that are known in the art, including in vitro and in vivo methods, as well as by synthetic chemistry approaches. Examples of such methods include, but are not limited to, the methods described by Sadher et al. (Biochem. Int. 14:1015, 1987); by Bhattacharyya (Nature 343:484, 1990); and by Livache, et al. (U.S. Patent No. 5,795,715), each of which is incorporated herein by reference in its entirety.
  • Single-stranded RNA can also be produced using a combination of enzymatic and organic synthesis or by total organic synthesis.
  • dsRNA can also be prepared in vivo according to a number of established methods (see, e.g., Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed.; Transcription and Translation (B.D. Hames, and SJ. Higgins, Eds., 1984); DNA Cloning, volumes I and II (D.N. Glover, Ed., 1985); and Oligonucleotide Synthesis (M.J. Gait, Ed., 1984, each of which is incorporated herein by reference in its entirety).
  • a neuroblastoma cell line can serve as a model system for investigating the functional relevance of genes, identified by procedures described herein, to tumor growth, metabolism or metastasis.
  • a number of options can be utilized to deliver the dsRNA into a cell or population of cells such as in a cell culture, tissue or embryo.
  • RNA can be directly introduced intracellularly.
  • Various physical methods are generally utilized in such instances, such as administration by microinjection (see, e.g., Zernicka-Goetz, et al. (1997) Development 124:1133- 1137; and Wianny, et al. (1998) Chromosoma 107: 430-439).
  • cellular delivery include permeabilizing the cell membrane and electroporation in the presence of the dsRNA, liposome-mediated transfection, or transfection using chemicals such as calcium phosphate.
  • a number of established gene therapy techniques can also be utilized to introduce the dsRNA into a cell. By introducing a viral construct within a viral particle, for instance, one can achieve efficient introduction of an expression construct into the cell and transcription of the RNA encoded by the construct.
  • a number of options are available to detect interference of candidate gene expression (i.e., to detect candidate gene silencing).
  • inhibition in expression is detected by detecting a decrease in the level of the protein encoded by the candidate gene, determining the level of mRNA transcribed from the gene and/or detecting a change in phenotype associated with candidate gene expression.
  • ARP-2 (SEQ ID NO:7) is a 64 kDa, single chain, acidic, angiopoeitin-like protein that includes multiple functional domains, such as a hydrophobic signal sequence from amino acids 1-21, a coiled-coil domain at the amino terminal end from approximately amino acid sequences 22-274, and a fibrinogen-like domain, from approximately about residues 275 through 493. Two major isoforms have been observed, one 2.4 Kb in size and the other about 4 Kb. Epitopes of interest include the fibrinogen region, the coiled coil domain, extracellular region, etc. The fibrinogen domain of human ARP-2 is hypothesized to interact with one or more an unknown receptor for the purposes of angiogenesis.
  • SPARC SEQ ID NO:8
  • SPARC is an abundant 33 kDa, single chain, acidic, extracellular calcium binding protein that contains a flexible N-terminal acidic domain I ( ⁇ 50 amino acids), a follistatin- like (FS) domain (-75 residues), and a C-terminal extracellular calcium-binding (EC) domain with a pair of EF-hand loops (-150 residues).
  • the N-terminal domain shows a low affinity Ca2+ binding site, a transglutaminase cross linking site, and inhibits cell spreading in cell culture assays.
  • Isoform pl90MET is formed of a 50 kDa ⁇ -chain and a 145 kDa ⁇ -chain that are disulfide linked
  • isoform pl40Met is composed of a 50 kDa ⁇ -chain and an 85 kDa ⁇ -chain, lacking the cytoplasmic kinase domain. This 85 kDa ⁇ chain is likely a trans-membrane glycoprotein that is bound to the cell surface.
  • Truncated forms of c-MET containing the 50 kDa ⁇ -chain and a carboxyl- terminally truncated 75 kDa ⁇ sub-unit have also been described.
  • the 75 kDa form arises by post- translational proteolytic processing, lacks the trans-membrane domain, and is secreted from the cell. Both the secreted and membrane bound forms are of interest.
  • the amino acid sequence of full length c-MET consists of 1408 amino acids (Park et al. (1987) P.N.A.S. 84:6379-6383) and 1390 amino acid (Prat et al. (1991) Mol. Cell. Biol. 11:5954-5962).
  • the signal sequence is comprised of N- terminal amino acids 1-24; the ⁇ chain (amino acids 24-306) makes up the extracellular domain; and the ⁇ chain extracellular domain amino acids 306 to 932.
  • the transmembrane segment is amino acids 933 to 955, and the intracellular domain is composed of amino acids 956 to 1390.
  • BEHAB (SQ ID NO: 12) exists in two isoforms: a full-length isoform that is secreted into the extracellular matrix and a shorter isoform that has a hydrophobic carboxy terminus, which predicts a glycophosphatidylinositol (GPI) anchor.
  • BEHAB contains an N-terminal hyaluronan (HA)-binding domain, which comprises an immunoglobulin-like loop and two proteoglycan tandem repeats, a C- terminal epidermal growth factor (EGF)-like repeat, a C-type lectin-like domain, and a complement regulatory protein (CRP)-like domain.
  • HA N-terminal hyaluronan
  • the central region of the protein contains sites for glycosylation and proteolytic cleavage (between glu395-Ser396 of the mature protein, after signal peptide cleavage) by a metallo-protease.
  • the complete cDNA of the secreted isoform is 2878 bp encoding 912 amino acids of 99 kDa.
  • the GPI isoform is 2558 bp.
  • the GPI-linked form is generated by a 'no splice' event, with the transcript reading through an exon/intron junction thereby extending the open reading frame to a stop codon 74 nucleotides further downstream. Up-regulation of BEHAB may be a crucial step in returning the unmalleable mature extracellular matrix to a more immature matrix, permissive for cell growth, thereby promoting the progression of primary brain tumors.
  • CD-44 (SEQ ID NO: 10; 11) is a proteoglycan that is expressed as two major splice variants.
  • CD-44E is a 150 kDa protein isolated from epithelial cells.
  • CD-44E has a C-terminal cytoplasmic tail, a hydrophobic transmembrane domain of 23 amino acids, and an N-terminal extracellular region of 248 amino acids. The extracellular domain is O-glycosylated and also binds chondroitin sulfate.
  • CD-44E has two of the three immunodominant epitope clusters of native gp90Hermes.
  • CD-44E contains an additional 132 amino acids in the extracellular region
  • CD-44H is a 90kDa protein isolated from hematopoietic cells.
  • CD-44R1 and CD-44R2 are 2 isoforms expressed by hematopoietic cells.
  • the complete cDNA sequence of the 90 kDa CD-44H isoform consist of 1795 bps, encoding a 341 amino acid protein.
  • CD-44H protein has an overall primary structure of 90 kDa, which consist of 341 amino acids. The N-terminus is located outside of the cell and the extracellular domain consist of 248 amino acids.
  • the C-terminus is located inside of the cell and the intracellular domain consist of 72 amino acids, while the transmembrane region consist of 21 amino acids.
  • the CD-44 gene contains 20 exons, of which exons 1-5, 15-17 and 19 encode the CD44H isoform.
  • the intervening exons 6, 6a, 7-14 (also designated vl-vlO) are alternatively spliced to generate the variant isoforms with an insertion at the membrane proximal region of the extracellular domain between amino acids 202 and 203.
  • CD-44 is one of the principal receptors for hyaluronic acid. Within the normal CNS, the CD-44 protein has been localized to astrocytes in the white matter. CD-44H has been shown to be the predominant isoform in normal brain and neuroectoderm-derived tumors. Hence, the up-regulation of CD-44 may be a crucial step in brain tumor invasiveness and migration.
  • Tetraspanin (TSPAN3) (SEQ ID NO: 13) is a 253 amino acid membrane bound protein. TSPAN3 contains four transmembrane domains, comprising amino acids 12-32, 51-71, 86-106, and 213-233. The protein has two extracellular domains, amino acids 33-50 and 107-212, and three cytoplasmic domains, amino acids 1-11, 72-85, and 234-235. The cysteine residues at positions 147, 148, and 197 in the second extracellular domain are highly conserved among the tetraspanin family and are thought to be essential for proper tetraspanin function.
  • VIPR-2 (SEQ ID NO:14) is a seven transmembrane spanning G-protein receptor.
  • the complete VIPR-2 protein is encoded by 13 exons.
  • the initiator codon of the predicted 438 amino acid-encoding open reading frame is located in exon 1 and the termination signal is located in exon 13.
  • the 5' untranslated region extends 187 bp upstream of the initiator codon and is extremely GC- rich (80%).
  • the polyadenylation signal is located 2416 bp downstream of the stop codon. Intron sizes range from 68 bp (intron 11) to 45 bp (intron 4), the entire human gene spans 117 kb, while the cDNA sequence spans 1317 bp.
  • the receptor is a seven membrane spanning protein where the first 22 amino acids constitute a signal sequence, and the remaining amino acids constitute two membrane spanmng regions between amino acids 127 to 148 and 158 to 178, two more membrane spanning domains between amino acids 202 to 227 and 238 to 261, another between 278 to 303, and two final membrane spanning regions between 327 to 347 and 359 to 380, with three potential N-linked glycosylation sites found in the amino terminal extracellular domain at residues 57, 87 and 91.
  • the extracellular domain of human VIPR-2 binds PACAP-27, PACAP-38, VIP and secretin.
  • PTN or OSF-1 (SEQ ID NO: 16) is a 18 kDa, single chain, secreted protein with 10 conserved disulfide linked cysteine residues.
  • the gene sequence of human PTN consists of five exons and four introns. While exon 1 does not encode an amino acid sequence, exon 2 encodes the hydrophobic signal sequence of 32 amino acids, exons 3 and 4 code for the amino terminal and the ten cysteine residues, and exon 5 codes for the highly basic C-terminal domains.
  • the mature protein consist of 136 amino acids encoded by exons 2 to 5.
  • PTN has been shown to bind to the extracellular domain of RPTP beta and zeta.
  • OPN SEQ ID NO: 15
  • OPN-A OPN-B
  • OPN-C OPN-A and OPN-B differ by the addition of 14 amino acids at residue 58 of the protein.
  • OPN-A human bone OPN
  • OPN-B The cDNA sequence of human bone OPN
  • the cDNA transcript for OPN-A is 1.5 kb with an open reading frame of 900 nucleotides, of which the first 16 amino acids are hydrophobic in nature and constitute a signal sequence for the secreted protein.
  • the OPN gene contains 7 exons that are alternatively spliced to generate the variant isoforms, the most common variant being the addition of a 42 bp (14 amino acid) sequence located at base 280 of OPN-A.
  • the cell attachment sequence of human OPN (amino acids 144 tol48) is believed to interact with various cell surface proteins (such as CD-44) to affect cell adhesion, and a highly acidic stretch composed almost exclusively of aspartic acid residues (amino acids 72 to 81) is believed to be the mineral binding site within the protein.
  • PTP ⁇ exists in several splice variants, including two membrane bound variants (full length: PTP ⁇ - ⁇ , and shorter version PTP ⁇ - ⁇ ) and one secreted form (Phosphacan).
  • Isoform PTP ⁇ - ⁇ is the full length isoform, which contains the primary amino acid sequence aa 25-2314 (aa 1-24 are a signal polypeptide) as shown in SEQ ID NO:l and SEQ ID NO:2.
  • This full length long form of PTP ⁇ is a type I membrane protein. After the signal peptide it contains a carbonic anhydrase like (CAH) and a fibronectin type III like (FN3) domain, followed by a long cysteine free spacer (S) domain.
  • CAH carbonic anhydrase like
  • FN3 fibronectin type III like
  • Isoform PTP ⁇ -S phosphacan
  • PTP ⁇ SMI secreted isoform
  • PTP ⁇ SM2 secreted isoform
  • the amino acid sequence of full length PTP ⁇ consists of 2307 amino acids (See U.S. Patent Nos. 5,604,094, and 6,160,090, fully incorporated herein by reference), or 2314 amino acids (Krueger et al. (1992) P.N.A.S. 89:7417-7421).
  • Amino acids 1-24 of SEQ ID NO. 2 are a signal sequence which directs the proper placement of the transmembrane protein.
  • the extracellular domain of the mature PTP ⁇ protein spans amino acids 25-1635 of SEQ ID NO. 2 in the long and secreted forms, and amino acids 25-754,1615-1635 in the short isoform.
  • the transmembrane region of the protein spans amino acids 1636-1661 of SEQ ID NO.
  • the extracellular domain of human PTP ⁇ is known to bind to tenascin-C, tenascin-R, pleiotrophin (NM_ 002825), midkine (NM_002391), FGF-2 (XM_00366), Nr-CAM (NM_005010), Ll/Ng-CAM , contactin (NM_001843), N-CAM (XM_006332), and axonin-lNM_005076.)
  • the first 5 of these molecules are either components of the extracellular matrix in gliomas or are soluble factors known to be present in gliomas, and the latter 4 are neuronal surface molecules.
  • the binding of PTP ⁇ to these molecules may play a significant role in the oncogenesis and growth of neoplastic cells in the brain
  • the protein PTP ⁇ SMI (SEQ ID NO:3, 4) comprises the amino acids encoded by the first nine exons of PTP ⁇ - ⁇ , with three unique additional carboxy terminal amino acids. These are encoded by additional 3' mRNA sequence (nucleotides 1262-1272) from the intron of the gene between exons nine and ten.
  • the PTP ⁇ SMI clone was isolated from a human fetal brain cDNA library, and has been shown to be expressed in several human glioblastoma cell lines. Expression of the SMI splice variant has also been confirmed in primary brain tumor samples.
  • the protein comprises only extracellular domains of PTP ⁇ , and is expected to be secreted by the cell.
  • PTP ⁇ SMI may serve a cell signaling or messenger function, and may bind to a receptor on the surface of cells which are associated with or part of central nervous system tissues.
  • the PTP ⁇ SMI protein mainly comprises the carbonic anhydrase-like domain.
  • the protein PTP ⁇ SM2 (SEQ ID NO. 5, 6) comprises the amino acids encoded by all exons of PTP ⁇ - ⁇ , plus a 116 nucleotide "extra" exon, in the correct reading frame, between exons 23 and 24 (nucleotides 6229-6345 of SEQ ID NO. 3). This extra exon, designated exon 23a, contains a portion of the intron sequence between exons 23 and 24 of the PTP ⁇ gene.
  • PTP ⁇ SM2 expression has been verified in several human glioblastoma cell lines, and has also been confirmed in primary brain tumor samples. As PTP ⁇ SM2 comprises all the domains of PTP ⁇ ⁇ , the protein is expected to be membrane-bound.
  • the extra exon lies within the cytoplasmic domain of the protein, and thus may alter the protein tyrosine phosphatase function of PTP ⁇ SM2.
  • PTP ⁇ SMI and PTP ⁇ SM2 have been shown to be expressed in glioblastoma cell lines and primary tumors, the level of the expression of these splice variants may be useful for staging or characterizing glioblastoma cells. Such cells may be extracted, for instance, from a primary tumor.
  • the invention provides for the monitoring of the relative expression level of PTP ⁇ SMI or PTP ⁇ SM2, or both, in relation to each other or to one or more of the known PTP ⁇ splice variants.
  • the level of expression of PTP ⁇ SMI is compared to at least one other splice variant selected from PTP ⁇ SM2, PTP ⁇ ⁇ , PTP ⁇ ⁇ , and phosphacan.
  • the level of expression of PTP ⁇ SM2 is compared to at least one other splice variant selected from PTP ⁇ SMI, PTP ⁇ ⁇ , PTP ⁇ ⁇ , and phosphacan. Such comparison may be made in either a qualitative or quantitative manner.
  • the sequences of T BT genes find use in diagnostic and therapeutic methods, for the recombinant production of the encoded polypeptide, and the like.
  • the nucleic acids of the invention include nucleic acids having a high degree of sequence similarity or sequence identity to one of the sequences provided in Table 1. Sequence identity can be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0.1XSSC (9 mM NaCl/0.9 mM Na citrate). Hybridization methods and conditions are well known in the art, see, e.g., U.S. patent 5,707,829. Nucleic acids that are substantially identical to the provided nucleic acid sequence, e.g.
  • allelic variants, genetically altered versions of the gene, etc. bind to one of the sequences provided in Table 1 under stringent hybridization conditions. Further specific guidance regarding the preparation of nucleic acids is provided by Fleury et al. (1997) Nature Genetics 15:269-272; Tartaglia et al, PCT Publication No. WO 96/05861; and Chen et al., PCT Publication No. WO 00/06087, each of which is incorporated herein in its entirety.
  • the genes listed in Table 1 may be obtained using various methods well known to those skilled in the art, including but not limited to the use of appropriate probes to detect the genes within an appropriate cDNA or genomic DNA library, antibody screening of expression libraries to detect cloned DNA fragments with shared structural features, direct chemical synthesis, and amplification protocols.
  • Libraries are preferably prepared from cells or tissues of normal brains or brain tumors. Cloning methods are described in Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, 152, Academic Press, Inc. San Diego, CA; Sambrook, et al. (1989) Molecular Cloning - A Laboratory Manual (2nd ed) Vols. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY; and Current Protocols (1994), a joint venture between Greene Publishing Associates, Inc. and John Wiley and Sons, Inc.
  • the sequence obtained from clones containing partial coding sequences or non-coding sequences can be used to obtain the entire coding region by using the RACE method (Chenchik et al. (1995) CLONTECHniques (X) 1: 5-8). Oligonucleotides can be designed from the partial clone's analyzed sequence and subsequently utilized to amplify a reverse transcribed mRNA encoding the entire coding sequence. Alternatively, probes can be used to screen cDNA libraries prepared from an appropriate cell or cell line in which the gene is transcribed. Once the target nucleic acid is identified, it can be isolated and cloned using well-known amplification techniques.
  • Such techniques include, the polymerase chain reaction (PCR) the ligase chain reaction (LCR), Q ⁇ -replicase amplification, the self-sustained sequence replication system (SSR) and the transcription based amplification system (TAS).
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • SSR self-sustained sequence replication system
  • TAS transcription based amplification system
  • a suitable nucleic acid can be chemically synthesized.
  • Direct chemical synthesis methods include, for example, the phosphotriester method of Narang et al. (1979) Meth. Enzymol. 68: 90-99; the phosphodiester method of Brown et al. (1979) Meth. Enzymol. 68: 109-151; the diethylphosphoramidite method of Beaucage et al. (1981) Tetra. Lett., 22: 1859-1862; and the solid support method of U.S. Patent No. 4,458,066. Chemical synthesis produces a single stranded oligonucleotide.
  • the nucleic acids can be cDNAs or genomic DNAs, as well as fragments thereof.
  • cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3' and 5' non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns, when present, being removed by nuclear RNA splicing, to create a continuous open reading frame encoding a polypeptide of the invention.
  • a genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3' and 5' untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5' or 3' end of the transcribed region.
  • Probes specific to the nucleic acid of the invention can be generated using the nucleic acid sequence disclosed in Table 1.
  • the probes are preferably at least about 18 nt, 25 nt, 50 nt or more of the corresponding contiguous sequence of one of the sequences provided in Table 1, and are usually less than about 2, 1, or 0.5 kb in length.
  • probes are designed based on a contiguous sequence that remains unmasked following application of a masking program for masking low complexity.
  • Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc.
  • the probes can be labeled, for example, with a radioactive, biotinylated, or fluorescent tag.
  • the nucleic acids of the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome.
  • nucleic acids either as DNA or RNA
  • the nucleic acids of the invention can be provided as a linear molecule or within a circular molecule, and can be provided within autonomously replicating molecules (vectors) or within molecules without replication sequences. Expression of the nucleic acids can be regulated by their own or by other regulatory sequences known in the art.
  • the nucleic acids of the invention can be introduced into suitable host cells using a variety of techniques available in the art, such as fransferrin polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated DNA transfer, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, gene gun, calcium phosphate-mediated transfection, and the like.
  • a pair of primers will be used.
  • the exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages.
  • Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.
  • nucleic acid analogs it may be desirable to use nucleic acid analogs, in order to improve the stability and binding affinity.
  • nucleic acid shall be understood to encompass such analogs.
  • polypeptides encoded by T B ⁇ genes are of interest for screening methods, as reagents to raise antibodies, as therapeutics, and the like. Such polypeptides can be produced through isolation from natural sources, recombinant methods and chemical synthesis.
  • functionally equivalent polypeptides may find use, where the equivalent polypeptide may contain deletions, additions or substitutions of amino acid residues that result in a silent change, thus producing a functionally equivalent differentially expressed on pathway gene product. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
  • “Functionally equivalent”, as used herein, refers to a protein capable of exhibiting a substantially similar in vivo activity as the polypeptide encoded by an ischemia associated gene, as provided in Table 1.
  • the polypeptides may be produced by recombinant DNA technology using techniques well known in the art. Methods which are well known to those skilled in the art can be used to construct expression vectors containing coding sequences and appropriate transcriptional/translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. Alternatively, RNA capable of encoding the polypeptides of interest may be chemically synthesized.
  • the coding sequence is placed under the control of a promoter that is functional in the desired host cell to produce relatively large quantities of the gene product.
  • a promoter that is functional in the desired host cell to produce relatively large quantities of the gene product.
  • An extremely wide variety of promoters are well-known, and can be used in the expression vectors of the invention, depending on the particular application. Ordinarily, the promoter selected depends upon the cell in which the promoter is to be active. Other expression control sequences such as ribosome binding sites, transcription termination sites and the like are also optionally included. Constructs that include one or more of these control sequences are termed "expression cassettes." Expression can be achieved in prokaryotic and eukaryotic cells utilizing promoters and other regulatory agents appropriate for the particular host cell. Exemplary host cells include, but are not limited to, E.
  • coli other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines.
  • mammalian host cells a number of viral-based expression systems may be used, including retrovirus, lentivirus, adenovirus, adeno-associated virus, and the like.
  • the coding sequence of interest can be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing differentially expressed or pathway gene protein in infected hosts.
  • Specific initiation signals may also be required for efficient translation of the genes. These signals include the ATG initiation codon and adjacent sequences. In cases where a complete gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the gene coding sequence is inserted, exogenous translational control signals must be provided. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc.
  • a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, etc.
  • cell lines that stably express the differentially expressed or pathway gene protein may be engineered.
  • host cells can be transformed with DNA controlled by appropriate expression control elements, and a selectable marker.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines that express the target protein.
  • Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the T B ⁇ protein.
  • a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase, hypoxanthine- guanine phosphoribosyltransferase, and adenine phosphoribosyltransferase genes.
  • Antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418; and hygro, which confers resistance to hygromycin.
  • the polypeptide may be labeled, either directly or indirectly. Any of a variety of suitable labeling systems may be used, including but not limited to, radioisotopes such as 125 I; enzyme labeling systems that generate a detectable colorimetric signal or light when exposed to substrate; and fluorescent labels. Indirect labeling involves the use of a protein, such as a labeled antibody, that specifically binds to the polypeptide of interest.
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library.
  • the recombinant polypeptides can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, ion exchange and/or size exclusivity chromatography, gel electrophoresis and the like (see, generally, R. Scopes,
  • polypeptides and oligopeptides can be chemically synthesized. Such methods typically include solid-state approaches, but can also utilize solution based chemistries and combinations or combinations of solid-state and solution approaches. Examples of solid-state methodologies for synthesizing proteins are described by Merrifield (1964) J. Am. Chem. Soc. 85:2149; and Houghton (1985) Proc. Natl. Acad. Sci., 82:5132. Fragments of a T BT protein can be synthesized and then joined together. Methods for conducting such reactions are described by Grant (1992) Synthetic Peptides: A User Guide, W.H. Freeman and Co., N.Y.; and in "Principles of Peptide Synthesis,” (Bodansky and Trost, ed.), Springer-Verlag, Inc. N.Y., (1993).
  • the entire T B ⁇ polypeptide or a fragment derived therefrom may be used.
  • one or more 8-30 amino acid peptide portions e.g. of an extracellular domain may be utilized, with peptides in the range of 10-20 being a more economical choice.
  • Custom-synthesized peptides in this range are available from a multitude of vendors, and can be order conjugated to KLH or BSA.
  • peptides in excess of 30 amino acids may be synthesized by solid-phase methods, or may be recombinantly produced in a suitable recombinant protein production system.
  • an animal cell system e.g., Sf9 or other insect cells, CHO or other mammalian cells
  • an animal cell system e.g., Sf9 or other insect cells, CHO or other mammalian cells
  • binding member refers to a member of a specific binding pair, i.e. two molecules, usually two different molecules, where one of the molecules (i.e., first specific binding member) through chemical or physical means specifically binds to the other molecule (i.e., second specific binding member).
  • the complementary members of a specific binding pair are sometimes referred to as a ligand and receptor; or receptor and counter- receptor.
  • the two binding members may be known to associate with each other, for example where an assay is directed at detecting compounds that interfere with the association of a known binding pair.
  • candidate compounds suspected of being a binding partner to a compound of interest may be used.
  • Specific binding pairs of interest include carbohydrates and lectins; complementary nucleotide sequences; peptide ligands and receptor; effector and receptor molecules; hormones and hormone binding protein; enzyme cofactors and enzymes; enzyme inhibitors and enzymes; lipid and lipid-binding protein; etc.
  • the specific binding pairs may include analogs, derivatives and fragments of the original specific binding member.
  • a receptor and ligand pair may include peptide fragments, chemically synthesized peptidomimetics, labeled protein, derivatized protein, etc. h a preferred embodiment, the specific binding member is an antibody.
  • antibody or “antibody moiety” is intended to include any polypeptide chain-containing molecular structure with a specific shape that fits to and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope.
  • Antibodies that bind specifically to one of the brain tumor protein targets are referred to as anti-brain tumor protein target antibodies, or ⁇ (TBT).
  • ⁇ (TBT) anti-brain tumor protein target antibodies
  • the specific or selective fit of a given structure and its specific epitope is sometimes referred to as a "lock and key” fit.
  • the archetypal antibody molecule is the immunoglobulin, and all types of immunoglobulins, IgG, IgM, IgA, IgE, IgD, etc., from all sources, e.g. human, rodent, rabbit, cow, sheep, pig, dog, other mammal, chicken, other avians, etc., are considered to be "antibodies.”
  • Antibodies utilized in the present invention may be polyclonal antibodies, although monoclonal antibodies are preferred because they may be reproduced by cell culture or recombinantly, and can be modified to reduce their antigenicity. Polyclonal antibodies can be raised by a standard protocol by injecting a production animal with an antigenic composition, formulated as described above.
  • an T B ⁇ antigen comprising an antigenic portion of the brain tumor protein targets' polypeptide is initially injected into any of a wide variety of mammals (e.g., mice, rats, rabbits, sheep or goats).
  • antibodies When utilizing an entire protein, or a larger section of the protein, antibodies may be raised by immunizing the production animal with the protein and a suitable adjuvant (e.g., Fruend's, Fruend's complete, oil-in-water emulsions, etc.)
  • a suitable adjuvant e.g., Fruend's, Fruend's complete, oil-in-water emulsions, etc.
  • a suitable adjuvant e.g., Fruend's, Fruend's complete, oil-in-water emulsions, etc.
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • a superior immune response may be elicited if the polypeptide is joined to a carrier protein, such as ovalbumin, BSA or KLH.
  • the peptide-conjugate is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and the animals are bled periodically.
  • Polyclonal antibodies specific for the polypeptide may then be purified from such antisera by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.
  • hybridomas may be formed by isolating the stimulated immune cells, such as those from the spleen of the inoculated animal. These cells are then fused to immortalized cells, such as myeloma cells or transformed cells, which are capable of replicating indefinitely in cell culture, thereby producing an immortal, immunoglobulin-secreting cell line.
  • immortalized cells such as myeloma cells or transformed cells, which are capable of replicating indefinitely in cell culture, thereby producing an immortal, immunoglobulin-secreting cell line.
  • the immortal cell line utilized is preferably selected to be deficient in enzymes necessary for the utilization of certain nutrients.
  • Many such cell lines (such as myelomas) are known to those skilled in the art, and include, for example: thymidine kinase (TK) or hypoxanthine-guanine phosphoriboxyl transferase (HGPRT). These deficiencies allow selection for fused cells according to their ability to grow on, for example, hypoxanthine aminopter
  • the immortal fusion partners utilized are derived from a line that does not secrete immunoglobulin.
  • the resulting fused cells, or hybridomas are cultured under conditions that allow for the survival of fused, but not unfused, cells and the resulting colonies screened for the production of the desired monoclonal antibodies. Colonies producing such antibodies are cloned, expanded, and grown so as to produce large quantities of antibody, see Kohler and Milstein, 1975 Nature 256:495 (the disclosures of which are hereby incorporated by reference).
  • mice Large quantities of monoclonal antibodies from the secreting hybridomas may then be produced by injecting the clones into the peritoneal cavity of mice and harvesting the ascites fluid therefrom.
  • the mice preferably primed with pristane, or some other tumor-promoter, and immunosuppressed chemically or by irradiation, may be any of various suitable strains known to those in the art.
  • the ascites fluid is harvested from the mice and the monoclonal antibody purified therefrom, for example, by CM Sepharose column or other chromatographic means.
  • the hybridomas may be cultured in vitro or as suspension cultures. Batch, continuous culture, or other suitable culture processes may be utilized. Monoclonal antibodies are then recovered from the culture medium or supernatant.
  • a non-exclusive list of available commercial antibodies includes: for SPARC / Osteonectin, from Z ⁇ med, mouse anti-bovine MAb, Cat# 33-5500; for c-MET, from Zymed, rabbit anti-human polyclonal, and from RDI, rabbit anti- human MAb; for CD44, from RDI, mouse anti-human MAb, and from Lab vision, mouse anti-human MAb, known to block binding of hyaluronic acid to its receptor CD44, "CD44 H-CAM Ab-2"; for Brevican/BEHAB, from BD Transduction Lab., a mouse anti-human MAb; for VIP 2 receptor, from Exalpha, mouse anti-rat MAb; for Laminin receptor from Lab vision, mouse anti-human MAb "laminin receptor Ab-1"; for Osteopontin, from Chemicon, rat anti-human MAb, raised against rh-
  • Pleiotrophin from R&D goat anti-human polyclonal recognizes rh- Pleiotrophin.
  • BAF252 and from Oncogene goat anti-human polyclonal detects rh-Pleiotrophin.
  • PC187L Oncogene goat anti-human polyclonal detects rh-Pleiotrophin.
  • PTP ⁇ - ⁇ and PTP ⁇ - ⁇ from BD Transduction Labs, mouse anti-human MAb and from Chemicon, mouse anti-human MAb, which recognizes both of the transmembrane isoforms, and also recognizes the soluble isoform (phosphacan, PTP ⁇ -S).
  • antibodies are suitable for use in the compositions of the present invention, especially in Fab fragment form (which eliminates significant portions of the antigenic constant heavy and light chain regions).
  • Fab fragment form which eliminates significant portions of the antigenic constant heavy and light chain regions.
  • the antibodies or antigen binding fragments may be produced by genetic engineering. In this technique, as with the standard hybridoma procedure, antibody-producing cells are sensitized to the desired antigen or immunogen. The messenger RNA isolated from the immune spleen cells or hybridomas is used as a template to make cDNA using PCR amplification.
  • a library of vectors each containing one heavy chain gene and one light chain gene retaining the initial antigen specificity, is produced by insertion of appropriate sections of the amplified immunoglobulin cDNA into the expression vectors.
  • a combinatorial library is constructed by combining the heavy chain gene library with the light chain gene library. This results in a library of clones which co- express a heavy and light chain (resembling the Fab fragment or antigen binding fragment of an antibody molecule).
  • the vectors that carry these genes are co-transfected into a host (e.g. bacteria, insect cells, mammalian cells, or other suitable protein production host cell.). When antibody gene synthesis is induced in the transfected host, the heavy and light chain proteins self-assemble to produce active antibodies that can be detected by screening with the antigen or immunogen.
  • recombinant antibodies are produced in a recombinant protein production system which correctly glycosylates and processes the immunoglobulin chains, such as insect or mammalian cells.
  • a recombinant protein production system which correctly glycosylates and processes the immunoglobulin chains, such as insect or mammalian cells.
  • An advantage to using insect cells, which utilize recombinant baculoviruses for the production of antibodies, is that the baculovirus system allows production of mutant antibodies much more rapidly than stably transfected mammalian cell lines.
  • insect cells have been shown to correctly process and glycosylate eukaryotic proteins, which prokaryotic cells do not.
  • the baculovirus expression of foreign protein has been shown to constitute as much as 50-75% of the total cellular protein late in viral infection, making this system an excellent means of producing milligram quantities of the recombinant antibodies.
  • Antibodies with a reduced propensity to induce a violent or detrimental immune response in humans such as anaphylactic shock
  • a reduced propensity for priming an immune response which would prevent repeated dosage with the antibody therapeutic or imaging agent are preferred for use in the invention.
  • Even through the brain is relatively isolated behind the blood brain barrier, an immune response still can occur in the form of increased leukocyte infiltration, and inflammation. Although some increased immune response against the tumor is desirable, the concurrent binding and inactivation of the therapeutic or imaging agent generally outweighs this benefit.
  • humanized, chimeric, or xenogenic human antibodies which produce less of an immune response when administered to humans, are preferred for use in the present invention.
  • Chimeric antibodies may be made by recombinant means by combining the murine variable light and heavy chain regions (VK and VH), obtained from a murine (or other animal-derived) hybridoma clone, with the human constant light and heavy chain regions, in order to produce an antibody with predominantly human domains.
  • VK and VH murine variable light and heavy chain regions
  • the production of such chimeric antibodies is well known in the art, and may be achieved by standard means (as described, e.g., in U.S. Patent No. 5,624,659, incorporated fully herein by reference).
  • Humanized antibodies are engineered to contain even more human-like immunoglobulin domains, and incorporate only the complementarity- determining regions of the animal-derived antibody.
  • polyclonal or monoclonal antibodies may be produced from animals that have been genetically altered to produce human immunoglobulins. Techniques for generating such animals, and deriving antibodies therefrom, are described in U.S. Patents No. 6,162,963 and 6,150,584, incorporated fully herein by reference.
  • single chain antibodies can be produced from phage libraries containing human variable regions. See U.S. Patent No. 6,174,708.
  • Intrathecal administration of single-chain immunotoxin, LMB-7 [B3(Fv)- PE38] has been shown to cure of carcinomatous meningitis in a rat model. Proc Natl. Acad. Sci U S A 92, 2765-9, all of which are incorporated by reference fully herein.
  • immunoglobulin fragments comprising the epitope binding site (e.g., Fab', F(ab') 2 , or other fragments) are useful as antibody moieties in the present invention.
  • Such antibody fragments may be generated from whole immunoglobulins by ficin, pepsin, papain, or other protease cleavage. "Fragment,” or minimal immunoglobulins may be designed utilizing recombinant immunoglobulin techniques.
  • Fv immunoglobulins for use in the present invention may be produced by linking a variable light chain region to a variable heavy chain region via a peptide linker (e.g., poly-glycine or another sequence which does not form an alpha helix or beta sheet motif).
  • Fv fragments are heterodimers of the variable heavy chain domain (V H ) and the variable light chain domain (V L ).
  • the heterodimers of heavy and light chain domains that occur in whole IgG, for example, are connected by a disulfide bond.
  • Recombinant Fvs in which V H and V L are connected by a peptide linker are typically stable, see, for example, Huston et al., Proc. Natl. Acad, Sci.
  • any of these minimal antibodies may be utilized in the present invention, and those which are humanized to avoid HAMA reactions are preferred for use in embodiments of the invention.
  • derivatized immunoglobulins with added chemical linkers, detectable moieties, such as fluorescent dyes, enzymes, substrates, chemiluminescent moieties and the like, or specific binding moieties, such as streptavidin, avidin, or biotin, and the like may be utilized in the methods and compositions of the present invention.
  • antibody or “antibody moiety” will be used throughout to generally refer to molecules which specifically bind to an epitope of the brain tumor protein targets, although the term will encompass all immunoglobulins, derivatives, fragments, recombinant or engineered immunoglobulins, and modified immunoglobulins, as described above.
  • Candidate anti-T BT antibodies can be tested for anti-T BT activity by any suitable standard means. As a first screen, the antibodies may be tested for binding against the immunogen, or against the entire brain tumor protein target extracellular domain or protein. As a second screen, anti-T BT candidates may be tested for binding to an appropriate tumor cell line, or to primary tumor tissue samples. For these screens, the anti-T BT candidate antibody may be labeled for detection.
  • the candidate antibody, or an antibody conjugate produced as described below may be tested for appropriate activity (i.e., the ability to decrease tumor cell growth and/or to aid in visualizing tumor cells) in an in vivo model, such as an appropriate tumor cell line, or in a mouse or rat human brain tumor model, as described below.
  • appropriate activity i.e., the ability to decrease tumor cell growth and/or to aid in visualizing tumor cells
  • Antibodies that alter the biological activity of a T BT protein may be assayed in functional formats, such as glioblastoma cell culture or mouse/rat CNS tumor model studies. In glioblastoma cell models of activity, expression of the protein is first verified in the particular cell strain to be used. If necessary, the cell line may be stably transfected with a coding sequence of the protein under the control of an appropriate constituent promoter, in order to express the protein at a level comparable to that found in primary tumors. The ability of the glioblastoma cells to survive in the presence of the candidate function-altering anti-protein antibody is then determined.
  • cell migration assays may be utilized to determine the effect of the candidate antibody therapeutic agent on the tumor-like behavior of the cells.
  • assays may be utilized to determine the ability of the candidate antibody therapeutic to inhibit vascular neogenesis, an important function in tumor biology.
  • nude mice/SCID mice model or rat models have been described, for example see Antunes et al. (2000). JHistochem Cytochem 48, 847-58; Price et al. (1999) Clin Cancer Res 5, 845-54; and Senner et al. (2000). Acta Neuwpathol (Berl) 99, 603-8.
  • the effect of the candidate anti-protein antibodies on the tumor masses in these models can be evaluated, wherein the ability of the anti-protein antibody candidates to alter protein activity is indicated by a decrease in tumor growth or a reduction in the tumor mass.
  • antibodies that exhibit the appropriate anti- tumor effect may be selected without direct knowledge of the particular biomolecular role of the protein in oncogenesis.
  • Arrays provide a high throughput technique that can assay a large number of polynucleotides in a sample.
  • an array is constructed comprising one or more of the T BT genes, proteins or antibodies, preferably comprising all of these sequences, which array may further comprise other sequences known to be up- or down-regulated in tumor cells. This technology can be used as a tool to test for differential expression.
  • Arrays can be created by spotting polynucleotide probes onto a substrate (e.g., glass, nitrocellulose, etc.) in a two-dimensional matrix or array having bound probes. The probes can be bound to the substrate by either covalent bonds or by non-specific interactions, such as hydrophobic interactions.
  • the probes utilized in the arrays can be of varying types and can include, for example, synthesized probes of relatively short length (e.g., a 20-mer or a 25-mer), cDNA (full length or fragments of gene), amplified DNA, fragments of DNA (generated by restriction enzymes, for example) and reverse transcribed DNA. Both custom and generic arrays can be utilized in detecting differential expression levels. Custom arrays can be prepared using probes that hybridize to particular preselected subsequences of mRNA gene sequences or amplification products prepared from them. Arrays can be used to, for example, examine differential expression of genes and can be used to determine gene function.
  • arrays can be used to detect differential expression of T BT genes, where expression is compared between a test cell and control cell.
  • Exemplary uses of arrays are further described in, for example, Pappalarado et al. (1998) Sem. Radiation Oncol. 8:217; and Ramsay. (1998) Nature Biotechnol. 16:40.
  • many variations on methods of detection using arrays are well within the skill in the art and within the scope of the present invention.
  • the test sample can be immobilized on a solid support which is then contacted with the probe.
  • nucleic acids are obtained from a test sample, and either directly labeled, or reversed transcribed into labeled cDNA.
  • the test sample containing the labeled nucleic acids is then contacted with the array. After allowing a period sufficient for any labeled nucleic acid present in the sample to hybridize to the probes, the array is typically subjected to one or more high stringency washes to remove unbound nucleic acids and to minimize nonspecific binding to the nucleic acid probes of the arrays. Binding of labeled sequences is detected using any of a variety of commercially available scanners and accompanying software programs.
  • hybridization intensity can be determined by, for example, a scanning confocal microscope in photon counting mode.
  • Appropriate scanning devices are described by e.g., U.S. 5,578,832 to Trulson et al, and U.S. 5,631,734 to Stern et al. and are available from Affymetrix, Inc., under the GeneChipTM label.
  • Some types of label provide a signal that can be amplified by enzymatic methods (see Broude, et al. , Proc. Natl. Acad. Sci. U.S.A. 91, 3072-3076 (1994)).
  • a variety of other labels are also suitable including, for example, radioisotopes, chromophores, magnetic particles and electron dense particles.
  • the hybridization pattern can then be analyzed to determine the presence and/or relative amounts or absolute amounts of known mRNA species in samples being analyzed as described in e.g., WO 97/10365.
  • T BT genes and/or gene products in tumors indicate that these can serve as markers for diagnosis, for imaging, as well as for therapeutic applications.
  • diagnostic methods involve detecting an elevated level of expression of T BT gene transcripts or gene products in the cells or tissue of an individual or a sample therefrom.
  • a variety of different assays can be utilized to detect an increase in gene expression, including both methods that detect gene transcript and protein levels.
  • the diagnostic and prognostic methods disclosed herein involve obtaining a sample from an individual and determining at least qualitatively, and preferably quantitatively, the level of a T BT gene product expression in the sample. Usually this determined value or test value is compared against some type of reference or baseline value.
  • Nucleic acids or binding members such as antibodies that are specific for polypeptides derived from the sequence of one of the sequences provided in Table 1 are used to screen patient samples for increased expression of the corresponding mRNA or protein, or for the presence of amplified DNA in the cell.
  • Samples can be obtained from a variety of sources. Samples are typically obtained from a human subject. However, the methods can also be utilized with samples obtained from various other mammals, such as primates, e.g. apes and chimpanzees, mice, cats, rats, and other animals. Such samples are referred to as a patient sample.
  • Samples can be obtained from the tissues or fluids of an individual, as well as from cell cultures or tissue homogenates.
  • samples can be obtained from spinal fluid, or tumor biopsy samples.
  • derivatives and fractions of such cells and fluids can also be derived from in vitro cell cultures, including the growth medium, recombinant cells and cell components. Diagnostic samples are collected from an individual that has, or is suspected to have, a brain tumor. The presence of specific markers is useful in identifying and staging the tumor.
  • a nucleic acid derived from an mRNA transcript refers to a nucleic acid for whose synthesis the mRNA transcript, or a subsequence thereof, has ultimately served as a template.
  • a cDNA reverse transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA amplified from the cDNA, an RNA transcribed from the amplified DNA are all derived from the mRNA transcript and detection of such derived products is indicative of the presence and/or abundance of the original transcript in a sample.
  • nucleic acids for the presence of a specific sequence, e.g. upregulated or do nregulated expression.
  • the nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis.
  • PCR polymerase chain reaction
  • the use of the polymerase chain reaction is described in Saiki et al. (1985) Science 239:487, and a review of techniques may be found in Sambrook, et al. Molecular Cloning: A Laboratory Manual. CSH Press 1989, pp.14.2-14.33.
  • a detectable label may be included in an amplification reaction.
  • Suitable labels include fluorochromes, e.g. ALEXA dyes (available from Molecular Probes, Inc.); fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin,6-carboxyfluorescein(6-FAM),2,7- dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy- 2,4,7,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N,N-tetramethyl-6- carboxyrhodamine (TAMRA), radioactive labels, e.g.
  • fluorochromes e.g. ALEXA dyes (available from Molecular Probes, Inc.)
  • FITC flu
  • the label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label.
  • the label may be conjugated to one or both of the primers.
  • the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
  • the sample nucleic acid, e.g. amplified, labeled, cloned fragment, etc. is analyzed by one of a number of methods known in the art.
  • Probes may be hybridized to northern or dot blots, or liquid hybridization reactions performed.
  • the nucleic acid may be sequenced by dideoxy or other methods, and the sequence of bases compared to a wild-type sequence.
  • Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.
  • In situ hybridization methods are hybridization methods in which the cells are not lysed prior to hybridization. Because the method is performed in situ, it has the advantage that it is not necessary to prepare RNA from the cells.
  • the method usually involves initially fixing test cells to a support (e.g. the flat surface of a microscope slide or the walls of a microtiter well) and then permeabilizing the cells with an appropriate permeabilizing solution. A solution containing labeled probes is then contacted with the cells and the probes allowed to hybridize. Excess probe is digested, washed away and the amount of hybridized probe measured. This approach is described in greater 'detail by Nucleic Acid Hybridization: A Practical Approach (Hames, et al., eds., 1987).
  • a variety of so-called “real time amplification” methods or “real time quantitative PCR” methods can also be utilized to determine the quantity of mRNA present in a sample. Such methods involve measuring the amount of amplification product formed during an amplification process. Fluorogenic nuclease assays are one specific example of a real time quantitation method that can be used to detect and quantitate transcripts. In general such assays continuously measure PCR product accumulation using a dual-labeled fluorogenic oligonucleotide probe — an approach frequently referred to in the literature simply as the "TaqMan” method. Additional details regarding the theory and operation of fluorogenic methods for making real time determinations of the concentration of amplification products are described, for example, in U.S. Pat Nos. 5,210,015 to Gelfand, 5,538,848 to Livak, et al., and 5,863,736 to Haaland, each of which is incorporated by reference in its entirety.
  • Screening for expression of the subject sequences may be based on the functional or antigenic characteristics of the protein.
  • Various immunoassays designed to detect polymorphisms in proteins encoded by the sequences corresponding to the sequences provided in Table 1 may be used in screening. Detection may utilize staining of cells or histological sections, performed in accordance with conventional methods, using antibodies or other specific binding members that specifically bind to the T BT polypeptides.
  • the antibodies or other specific binding members of interest are added to a cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes.
  • the antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection.
  • a second stage antibody or reagent is used to amplify the signal.
  • the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent.
  • Final detection uses a substrate that undergoes a color change in the presence of the peroxidase. The absence or presence of antibody binding may be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc.
  • An alternative method for diagnosis depends on the in vitro detection of binding between antibodies and the polypeptide corresponding to a sequence of Table 1 in a lysate. Measuring the concentration of the target protein in a sample or fraction thereof may be accomplished by a variety of specific assays.
  • a conventional sandwich type assay may be used.
  • a sandwich assay may first attach specific antibodies to an insoluble surface or support. The particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non-covalently, preferably non-covalently.
  • the insoluble supports may be any compositions to which polypeptides can be bound, which is readily separated from soluble material, and which is otherwise compatible with the overall method.
  • the surface of such supports may be solid or porous and of any convenient shape.
  • suitable insoluble supports to which the receptor is bound include beads, e.g. magnetic beads, membranes and microtiter plates. These are typically made of glass, plastic (e.g. polystyrene), polysaccharides, nylon or nitrocellulose. Microtiter plates are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.
  • Patient sample lysates are then added to separately assayable supports (for example, separate wells of a microtiter plate) containing antibodies.
  • a series of standards containing known concentrations of the test protein is assayed in parallel with the samples or aliquots thereof to serve as controls.
  • each sample and standard will be added to multiple wells so that mean values can be obtained for each.
  • the incubation time should be sufficient for binding.
  • the insoluble support is generally washed of non-bound components.
  • a solution containing a second antibody is applied. The antibody will bind to one of the proteins of interest with sufficient specificity such that it can be distinguished from other components present.
  • the second antibodies may be labeled to facilitate direct, or indirect quantification of binding.
  • the antibodies are labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate.
  • suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art. The incubation time should be sufficient for the labeled ligand to bind available molecules.
  • the insoluble support is again washed free of non-specifically bound material, leaving the specific complex formed between the target protein and the specific binding member.
  • the signal produced by the bound conjugate is detected by conventional means. Where an enzyme conjugate is used, an appropriate enzyme substrate is provided so a detectable product is formed.
  • a competitive assay will be used.
  • a competitor to the targeted protein is added to the reaction mix.
  • the competitor and the target compete for binding to the specific binding partner.
  • the competitor molecule will be labeled and detected as previously described, where the amount of competitor binding will be proportional to the amount of target protein present.
  • the concentration of competitor molecule will be from about 10 times the maximum anticipated protein concentration to about equal concentration in order to make the most sensitive and linear range of detection.
  • the methods are adapted for imaging use in vivo, e.g., to locate or identify sites where tumor cells are present.
  • a detectably-labeled moiety e.g., an antibody, which is specific for the T BT polypeptide is administered to an individual (e.g., by injection), and labeled cells are located using standard imaging techniques, including, but not limited to, magnetic resonance imaging, computed tomography scanning, and the like.
  • the type of detection instrument available is a major factor in selecting a given radionuclide.
  • the radionuclide chosen must have a type of decay that is detectable by a given type of instrument.
  • any conventional method for visualizing diagnostic imaging can be utilized in accordance with this invention.
  • Another important factor in selecting a radionuclide for in vivo diagnosis is that its half-life be long enough that it is still detectable at the time of maximum uptake by the target tissue, but short enough that deleterious radiation of the host is minimized.
  • a currently used method for labeling with 99m Tc is the reduction of pertechnetate ion in the presence of a chelating precursor to form the labile 99m Tc-precursor complex, which, in turn, reacts with the metal binding group of a bifunctionally modified chemotactic peptide to form a 99m Tc-chemotactic peptide conjugate.
  • the detectably labeled T BT specific antibody is used in conjunction with imaging techniques, in order to analyze the expression of the target.
  • the imaging method is one of PET or SPECT, which are imaging techniques in which a radionuclide is synthetically or locally administered to a patient. The subsequent uptake of the radiotracer is measured over time and used to obtain information about the targeted tissue. Because of the high-energy (D-ray) emissions of the specific isotopes employed and the sensitivity and sophistication of the instruments used to detect them, the two-dimensional distribution of radioactivity may be inferred from outside of the body.
  • positron-emitting nuclides C, 13 N, 15 O, and 18 F.
  • Isotopes that decay by electron capture and/or D emission are used in SPECT, and include 123 I and 99m Tc.
  • T B ⁇ genes or proteins provide a point of therapeutic or prophylactic intervention, particularly agents that inhibit or upregulate activity of the polypeptide, or expression of the gene.
  • agents that modulate activity of T B ⁇ genes or proteins provide a point of therapeutic or prophylactic intervention, particularly agents that inhibit or upregulate activity of the polypeptide, or expression of the gene.
  • Numerous agents are useful in modulating this activity, including agents that directly modulate expression, e.g. expression vectors, antisense specific for the targeted polypeptide; and agents that act on the protein, e.g. specific antibodies and analogs thereof, small organic molecules that block catalytic activity, etc.
  • Methods can be designed to selectively deliver nucleic acids to certain cells.
  • examples of such cells include, neurons, microglia, astrocytes, endothelial cells, oligodendrocytes, etc.
  • Certain treatment methods are designed to selectively express an expression vector to neuron cells and/or target the nucleic acid for delivery to nerve cells (microglia, astrocytes, endothelial cells, oligodendrocytes)
  • One technique for achieving selective expression in nerve cells is to operably link the coding sequence to a promoter that is primarily active in nerve cells. Examples of such promoters include, but are not limited to, prion protein promoter, calcium-calmodulin dependent protein kinase promoter.
  • the nucleic acid can be administered with an agent that targets the nucleic acid to nerve cells.
  • the nucleic acid can be administered with an antibody that specifically binds to a cell-surface antigen on the nerve cells or a ligand for a receptor on neuronal cells.
  • substrates that bind to a cell-surface membrane protein associated with endocytosis can be attached to the liposome to target the liposome to nerve cells and to facilitate uptake.
  • proteins that can be attached include capsid proteins or fragments thereof that bind to nerve cells, antibodies that specifically bind to cell-surface proteins on nerve cells that undergo intemalization in cycling and proteins that target intracellular localizations within nerve cells (see, e.g., Wu et al. (1987) J. Biol. Chem. 262:4429-4432; and Wagner, et al. (1990) Proc. Natl. Acad. Sci. USA 87:3410-3414).
  • Gene marking and gene therapy protocols are reviewed by Anderson et al. (1992) Science 256:808-813.
  • Various other delivery options can also be utilized. For instance, a nucleic acid containing a sequence of interest can be injected directly into the cerebrospinal fluid. Alternatively, such nucleic acids can be administered by intraventricular injections.
  • Antisense molecules can be used to down-regulate expression in cells.
  • the antisense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such antisense molecules as RNA.
  • ODN antisense oligonucleotides
  • the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products.
  • Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance.
  • One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.
  • Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
  • the antisense molecule is a synthetic oligonucleotide.
  • Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. It has been found that short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).
  • a specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence.
  • Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in vitro or in an animal model.
  • a combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.
  • Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra, and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.
  • phosphorothioates Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
  • Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate, 3'-S-5'-O-phosphorothioate, 3'-CH2-5'-O-phosphonate and 3'- NH-5'-O-phosphoroamidate.
  • Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity.
  • the alpha, -an ⁇ mer of deoxyribose may be used, where the base is inverted with respect to the natural .beta.-anomer.
  • the 2'-OH of the ribose sugar may be altered to form 2'-O-methyl or 2'-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. 5- propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
  • COMPOUND SCREENING Compound screening may be performed using an in vitro model, a genetically altered cell or animal, or purified protein corresponding to any one of the provided T B ⁇ genes.
  • polypeptides include those encoded by T BT genes, as well as nucleic acids that, by virtue of the degeneracy of the genetic code, are not identical in sequence to the disclosed nucleic acids, and variants thereof.
  • Variant polypeptides can include amino acid (aa) substitutions, additions or deletions.
  • the amino acid substitutions can be conservative amino acid substitutions or substitutions to eliminate non-essential amino acids, such as to alter a glycosylation site, a phosphorylation site or an acetylation site, or to minimize misfolding by substitution or deletion of one or more cysteine residues that are not necessary for function.
  • Variants can be designed so as to retain or have enhanced biological activity of a particular region of the protein (e.g., a functional domain and/or, where the polypeptide is a member of a protein family, a region associated with a consensus sequence). Variants also include fragments of the polypeptides disclosed herein, particularly biologically active fragments and/or fragments corresponding to functional domains.
  • Fragments of interest will typically be at least about 10 aa to at least about 15 aa in length, usually at least about 50 aa in length, and can be as long as 300 aa in length or longer, but will usually not exceed about 500 aa in length, where the fragment will have a contiguous stretch of amino acids that is identical to a polypeptide encoded by brain tumor associated genes, or a homolog thereof.
  • Transgenic animals or cells derived therefrom are also used in compound screening.
  • Transgenic animals may be made through homologous recombination, where the normal locus corresponding to a T BT gene is altered.
  • a nucleic acid construct is randomly integrated into the genome.
  • Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like.
  • a series of small deletions and/or substitutions may be made in the coding sequence to determine the role of different exons in enzymatic activity, oncogenesis, signal transduction, etc.
  • Specific constructs of interest include antisense sequences that block expression of the targeted gene and expression of dominant negative mutations.
  • a detectable marker such as lac Z may be introduced into the locus of interest, where up-regulation of expression will result in an easily detected change in phenotype.
  • One may also provide for expression of the target gene or variants thereof in cells or tissues where it is not normally expressed or at abnormal times of development. By providing expression of the target protein in cells in which it is not normally produced, one can induce changes in cell behavior.
  • Compound screening identifies agents that modulate function of the T B ⁇ polypeptides.
  • screening assays for agents that have a low toxicity for human cells.
  • a wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
  • Knowledge of the 3-dimensional structure of the encoded protein, derived from crystallization of purified recombinant protein, could lead to the rational design of small drugs that specifically inhibit activity. These drugs may be directed at specific domains.
  • agent as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of a T BT polypeptide.
  • agent e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of a T BT polypeptide.
  • a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
  • one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
  • Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
  • Test agents can be obtained from libraries, such as natural product libraries or combinatorial libraries, for example.
  • libraries such as natural product libraries or combinatorial libraries
  • a number of different types of combinatorial libraries and methods for preparing such libraries have been described, including for example, PCT publications WO 93/06121, WO 95/12608, WO 95/35503, WO 94/08051 and WO 95/30642, each of which is incorporated herein by reference.
  • the screening assay is a binding assay
  • the label can directly or indirectly provide a detectable signal.
  • Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
  • Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin, etc.
  • the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
  • reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein- protein binding and/or reduce non-specific or background interactions. Reagents that improve the ' efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
  • Preliminary screens can be conducted by screening for compounds capable of binding to a T BT polypeptide, as at least some of the compounds so identified are likely inhibitors.
  • the binding assays usually involve contacting a T BT polypeptide with one or more test compounds and allowing sufficient time for the protein and test compounds to form a binding complex. Any binding complexes formed can be detected using any of a number of established analytical techniques. Protein binding assays include, but are not limited to, methods that measure co-precipitation, co- migration on non-denaturing SDS-polyacrylamide gels, and co-migration on Western blots (see, e.g., Bennet, J.P. and Yamamura, H.I.
  • Neurotransmitter, Hormone or Drug Receptor Binding Methods in Neurotransmitter Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89.
  • Certain screening methods involve screening for a compound that modulates the expression of a T B ⁇ gene. Such methods generally involve conducting cell-based assays in which test compounds are contacted with one or more cells expressing a T B ⁇ gene and then detecting and an increase in expression. Some assays are performed with tumor cells that express endogenous T BT genes. Other expression assays are conducted with non-neuronal cells that express an exogenous T B ⁇ gene.
  • the level of expression or activity can be compared to a baseline value.
  • the baseline value can be a value for a control sample or a statistical value that is representative of expression levels for a control population.
  • Expression levels can also be determined for cells that do not express T B ⁇ gene, as a negative control. Such cells generally are otherwise substantially genetically the same as the test cells.
  • Various controls can be conducted to ensure that an observed activity is authentic including running parallel reactions with cells that lack the reporter construct or by not contacting a cell harboring the reporter construct with test compound.
  • Compounds can also be further validated as described below. Compounds that are initially identified by any of the foregoing screening methods can be further tested to validate the apparent activity.
  • the basic format of such methods involves administering a lead compound identified during an initial screen to an animal that serves as a model for humans and then determining if T BT gene is in fact upregulated.
  • the animal models utilized in validation studies generally are mammals. Specific examples of suitable animals include, but are not limited to, primates, mice, and rats.
  • Active test agents identified by the screening methods described herein that inhibit T BT polypeptide activity and/or tumor growth can serve as lead compounds for the synthesis of analog compounds.
  • the analog compounds are synthesized to have an electronic configuration and a molecular conformation similar to that of the lead compound.
  • Identification of analog compounds can be performed through use of techniques such as self-consistent field (SCF) analysis, configuration interaction (CI) analysis, and normal mode dynamics analysis. Computer programs for implementing these techniques are available. See, e.g., Rein et al., (1989) Computer-Assisted Modeling of Receptor-Ligand Interactions (Alan Liss, New York).
  • the anti-T BT antibodies for use in the present invention may have utility without conjugation when the native activity of the brain tumor protein target is altered in the tumor cell. Such antibodies, which may be selected as described above, may be utilized without as a therapeutic agent.
  • T BT specific antibodies which may or may not alter the activity of the target polypeptide, are conjugated to cytotoxic or imaging agents, which add functionality to the antibody.
  • the anti-T B ⁇ antibodies can be coupled or conjugated to one or more therapeutic cytotoxic or imaging moieties.
  • cytotoxic moiety is a moiety that inhibits cell growth or promotes cell death when proximate to or absorbed by the cell.
  • Suitable cytotoxic moieties in this regard include radioactive isotopes (radionuclides), chemotoxic agents such as differentiation inducers and small chemotoxic drugs, toxin proteins, and derivatives thereof.
  • Imaging moiety (I) is a moiety that can be utilized to increase contrast between a tumor and the surrounding healthy tissue in a visualization technique (e.g., radiography, positron-emission tomography, magnetic resonance imaging, direct or indirect visual inspection).
  • suitable imaging moieties include radiography moieties (e.g. heavy metals and radiation emitting moieties), positron emitting moieties, magnetic resonance contrast moieties, and optically visible moieties (e.g., fluorescent or visible- spectrum dyes, visible particles, etc.). It will be appreciated by one of ordinary skill that some overlap exists between therapeutic and imaging moieties. For instance 212 Pb and 212 Bi are both useful radioisotopes for therapeutic compositions, but are also electron-dense, and thus provide contrast for
  • X-ray radiographic imaging techniques can also be utilized in scintillation imaging techniques.
  • therapeutic or imaging agents may be conjugated to the anti-T B ⁇ moiety by any suitable technique, with appropriate consideration of the need for pharmokinetic stability and reduced overall toxicity to the patient.
  • a therapeutic agent may be coupled to a suitable antibody moiety either directly or indirectly (e.g. via a linker group).
  • a direct reaction between an agent and an antibody is possible when each possesses a functional group capable of reacting with the other.
  • a nucleophilic group such as an amino or sulfhydryl group, may be capable of reacting with a carbonyl-containing group, such as an anhydride or an acid halide, or with an alkyl group containing a good leaving group (e.g., a halide).
  • a suitable chemical linker group may be used.
  • a linker group can function as a spacer to distance an antibody from an agent in order to avoid interference with binding capabilities.
  • a linker group can also serve to increase the chemical reactivity of a substituent on a moiety or an antibody, and thus increase the coupling efficiency. An increase in chemical reactivity may also facilitate the use of moieties, or functional groups on moieties, which otherwise would not be possible.
  • Suitable linkage chemistries include maleimidyl linkers and alkyl halide linkers (which react with a sulfhydryl on the antibody moiety) and succinimidyl linkers (which react with a primary amine on the antibody moiety).
  • cytotoxic or imaging moieties may be coupled to the anti-T B ⁇ antibody moiety through a an oxidized carbohydrate group at a glycosylation site, as described in U.S. Patents No. 5,057,313 and 5,156,840.
  • Yet another alternative method of coupling the antibody moiety to the cytotoxic or imaging moiety is by the use of a non-covalent binding pair, such as streptavidin/biotin, or avidin/biotin.
  • one member of the pair is covalently coupled to the antibody moiety and the other member of the binding pair is covalently coupled to the cytotoxic or imaging moiety.
  • a cytotoxic moiety is more potent when free from the antibody portion of the immunoconjugates of the present invention
  • a number of different cleavable linker groups have been described.
  • the mechanisms for the intracellular release of a cytotoxic moiety agent from these linker groups include cleavage by reduction of a disulfide bond (e.g., U.S. Patent No. 4,489,710), by irradiation of a photolabile bond (e.g., U.S. Patent No.
  • cytotoxic and/or imaging moieties may be conjugated to an antibody, where the conjugated moieties are the same or different.
  • Immunoconjugates with more than one moiety may be prepared in a variety of ways. For example, more than one moiety may be coupled directly to an antibody molecule, or linkers which provide multiple sites for attachment (e.g., dendrimers) can be used. Alternatively, a carrier with the capacity to hold more than one cytotoxic or imaging moiety can be used.
  • a carrier may bear the cytotoxic or imaging moiety in a variety of ways, including covalent bonding either directly or via a linker group, and non-covalent associations.
  • Suitable covalent-bond carriers include proteins such as albumins (e.g., U.S. Patent No. 4,507,234), peptides, and polysaccharides such as aminodextran (e.g., U.S. Patent No. 4,699,784), each of which have multiple sites for the attachment of moieties.
  • a carrier may also bear an agent by non-covalent associations, such as non-covalent bonding or by encapsulation, such as within a liposome vesicle (e.g., U.S. Patents Nos.
  • Encapsulation carriers are especially useful for imaging moiety conjugation to anti-T BT antibody moieties for use in the invention, as a sufficient amount of the imaging moiety (dye, magnetic resonance contrast reagent, etc.) for detection may be more easily associated with the antibody moiety.
  • encapsulation carriers are also useful in chemotoxic therapeutic embodiments, as they can allow the therapeutic compositions to gradually release a chemotoxic moiety over time while concentrating it in the vicinity of the tumor cells.
  • Carriers and linkers specific for radionuclide agents include radiohalogenated small molecules and chelating compounds.
  • U.S. Patent No. 4,735,792 discloses representative radiohalogenated small molecules and their synthesis.
  • a radionuclide chelate may be formed from chelating compounds that include those containing nitrogen and sulfur atoms as the donor atoms for binding the metal, or metal oxide, radionuclide.
  • U.S. Patent No. 4,673,562 to Davison et al. discloses representative chelating compounds and their synthesis.
  • Such chelation carriers are also useful for magnetic spin contrast ions for use in magnetic resonance imaging tumor visualization methods, and for the chelation of heavy metal ions for use in radiographic visualization methods.
  • radionuclides for use as cytotoxic moieties are radionuclides that are suitable for pharmacological administration.
  • Such radionuclides include 123 I, 125 I, 131 I, 90 Y, 211 At, 67 Cu, 186 Re, 188 Re, 212 Pb, and 212 Bi.
  • Iodine and astatine isotopes are more preferred radionuclides for use in the therapeutic compositions of the present invention, as a large body of literature has been accumulated regarding their use.
  • 131 I is particularly preferred, as are other ⁇ -radiation emitting nuclides, which have an effective range of several millimeters.
  • 123 1, 12S I, 131 I, or 211 At may be conjugated to antibody moieties for use in the compositions and methods utilizing any of several known conjugation reagents, including Iodogen, N-succinimidyl 3-[ 211 At]astatobenzoate, N-succinimidyl 3- [ 131 rjiodobenzoate (S7JB), and , N-succinimidyl 5-[ 131 JJiodob-3-pyridinecarboxylate (SJPC). Any iodine isotope may be utilized in the recited iodo-reagents.
  • Radionuclides can be conjugated to anti- T BT antibody moieties by suitable chelation agents known to those of skill in the nuclear medicine arts.
  • Preferred chemotoxic agents include small-molecule drugs such as carboplatin, cisplatin, vincristine, taxanes such as paclitaxel and doceltaxel, hydroxyurea, gemcitabine, vinorelbine, irinotecan, tirapazamine, matrilysin, methotrexate, pyrimidine and purine analogs, and other suitable small toxins known in the art.
  • Preferred chemotoxin differentiation inducers include phorbol esters and butyric acid. Chemotoxic moieties may be directly conjugated to the anti-T B ⁇ antibody moiety via a chemical linker, or may encapsulated in a carrier, which is in turn coupled to the anti-T B ⁇ antibody moiety.
  • Chemotherapy is helpful in controlling high-grade gliomas.
  • a common combination of chemotherapeutics is "PCV”, which refers to the three drugs: Procarbazine, CCNU, and Vincristine.
  • Temozolomide (Temodar) is approved by the FDA for treatment of anaplastic astrocytoma, and this drug is now widely used for high-grade gliomas.
  • Neupogen may be administered to patients whose white blood counts fall to very low levels after chemotherapy.
  • Preferred toxin proteins for use as cytotoxic moieties include ricins A and B, abrin, diphtheria toxin, bryodin 1 and 2, momordin, trichokirin, cholera toxin, gelonin, Pseudomonas exotoxin, Shigella toxin, pokeweed antiviral protein, and other toxin proteins known in the medicinal biochemistry arts.
  • the nontoxic ricin B chain is the moiety that binds to cells while the A chain is the toxic portion that inactivates protein synthesis- but only after delivery to the cytoplasm by the disulfide-linked B chain which binds to galactose-terminal membrane proteins.
  • radiographic moieties for use as imaging moieties in the present invention include compounds and chelates with relatively large atoms, such as gold, iridium, technetium, barium, thallium, iodine, and their isotopes. It is preferred that less toxic radiographic imaging moieties, such as iodine or iodine isotopes, be utilized in the compositions and methods of the invention. Examples of such compositions which may be utilized for x-ray radiography are described in U.S. Patent No. 5,709,846, incorporated fully herein by reference. Such moieties may be conjugated to the anti-T BT antibody moiety through an acceptable chemical linker or chelation carrier.
  • radionuclides which emit radiation capable of penetrating the scull may be useful for scintillation imaging techniques.
  • Suitable radionuclides for conjugation include 99 Tc, ⁇ In, and 67 Ga.
  • Positron emitting moieties for use in the present invention include 18 F, which can be easily conjugated by a fluorination reaction with the anti-T BT antibody moiety according to the method described in U.S. Patent No. 6,187,284.
  • Preferred magnetic resonance contrast moieties include chelates of chromium(III), manganese(II), iron(U), nickel(II), co ⁇ per(If), praseodymium(III), neodymium(III), samarium(III) and ytterbium(III) ion. Because of their very strong magnetic moment, the gadolinium(HI), terbium(III), dysprosium(UI), holmium(III), erbium(III), and iron(III) ions are especially preferred. Examples of such chelates, suitable for magnetic resonance spin imaging, are described in U.S. Patent No. 5,733,522, incorporated fully herein by reference. Nuclear spin contrast chelates may be conjugated to the anti-T B ⁇ antibody moieties through a suitable chemical linker.
  • Optically visible moieties for use as imaging moieties include fluorescent dyes, or visible- spectrum dyes, visible particles, and other visible labeling moieties.
  • Fluorescent dyes such as ALEXA dyes, fluorescein, coumarin, rhodamine, bodipy Texas red, and cyanine dyes, are useful when sufficient excitation energy can be provided to the site to be inspected visually. Endoscopic visualization procedures may be more compatible with the use of such labels.
  • visible spectrum dyes are preferred.
  • Acceptable dyes include FDA-approved food dyes and colors, which are non-toxic, although pharmaceutically acceptable dyes which have been approved for internal administration are preferred.
  • such dyes are encapsulated in carrier moieties, which are in turn conjugated to the anti-T BT antibody.
  • visible particles such as colloidal gold particles or latex particles, may be coupled to the anti-T BT antibody moiety via a suitable chemical linker.
  • BBB blood brain barrier
  • osmotic means such as mannitol or leukotrienes
  • vasoactive substances such as bradykinin.
  • a BBB disrupting agent can be co-administered with the therapeutic or imaging compositions of the invention when the compositions are administered by intravascular injection.
  • Other strategies to go through the BBB may entail the use of endogenous transport systems, including carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p- glycoprotein.
  • Active transport moieties may also be conjugated to the therapeutic or imaging compounds for use in the invention to facilitate transport across the epithelial wall of the blood vessel.
  • drug delivery behind the BBB is by intrathecal delivery of therapeutics or imaging agents directly to the cranium, as through an Ommaya reservoir.
  • compositions can include, depending on the formulation desired, pharmaceutically-acceptable, non-toxic carriers of diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration.
  • diluents are selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, buffered water, physiological saline, PBS, Ringer's solution, dextrose solution, and Hank's solution.
  • the pharmaceutical composition or formulation can include other carriers, adjuvants, or non-toxic, nontherapeutic, nonirnmunogenic stabilizers, excipients and the like.
  • the compositions can also include additional substances to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents and detergents.
  • the composition can also include any of a variety of stabilizing agents, such as an antioxidant for example.
  • the pharmaceutical composition includes a polypeptide
  • the polypeptide can be complexed with various well-known compounds that enhance the in vivo stability of the polypeptide, or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, enhance solubility or uptake). Examples of such modifications or complexing agents include sulfate, gluconate, citrate and phosphate.
  • the polypeptides of a composition can also be complexed with molecules that enhance their in vivo attributes.
  • Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, manganese), and lipids. Further guidance regarding formulations that are suitable for various types of administration can be found in Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, PA, 17th ed. (1985). For a brief review of methods for drug delivery, see, Langer, Science 249:1527- 1533 (1990).
  • the pharmaceutical compositions can be administered for prophylactic and/or therapeutic treatments.
  • Toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and/or experimental animals, including, for example, determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 5 o/ED 5 o.
  • Compounds that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture and/or animal studies can be used in formulating a range of dosages for humans.
  • the dosage of the active ingredient typically lines within a range of circulating concentrations that include the ED 50 with low toxicity.
  • the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the pharmaceutical compositions described herein can be administered in a variety of different ways. Examples include administering a composition containing a pharmaceutically acceptable carrier via oral, intranasal, rectal, topical, intraperitoneal, intravenous, intramuscular, subcutaneous, subdermal, transdermal, intrathecal, and intracranial methods.
  • the active ingredient can be administered in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as elixirs, syrups, and suspensions.
  • the active component(s) can be encapsulated in gelatin capsules together with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate.
  • inactive ingredients and powdered carriers such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate.
  • additional inactive ingredients that may be added to provide desirable color, taste, stability, buffering capacity, dispersion or other known desirable features are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, and edible white ink.
  • Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric-coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
  • the active ingredient alone or in combination with other suitable components, can be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • aqueous and non-aqueous, isotonic sterile injection solutions which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient
  • aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • compositions intended for in vivo use are usually sterile. To the extent that a given compound must be synthesized prior to use, the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxins, which may be present during the synthesis or purification process.
  • compositions for parental administration are also sterile, substantially isotonic and made under GMP conditions.
  • compositions of the invention may be administered using any medically appropriate procedure, e.g., intravascular (intravenous, intraarterial, intracapillary) administration, injection into the " cerebrospinal fluid, intracavity or direct injection in the tumor.
  • Intrathecal administration maybe carried out through the use of an Ommaya reservoir, in accordance with known techniques. (F. Balis et al., Am J. Pediatr. Hematol. Oncol. 11, 74, 76 (1989).
  • administration via intravascular injection is preferred for pre-operative visualization of the tumor.
  • Post-operative visualization or visualization concurrent with an operation may be through intrathecal or intracavity administration, as through an Ommaya reservoir, or also by intravascular administration.
  • One method for administration of the therapeutic compositions of the invention is by deposition into the inner cavity of a cystic tumor by any suitable technique, such as by direct injection (aided by stereotaxic positioning of an injection syringe, if necessary) or by placing the tip of an Ommaya reservoir into a cavity, or cyst, for administration.
  • the tumor is a solid tumor
  • the antibody may be administered by first creating a resection cavity in the location of the tumor. This procedure differs from an ordinary craniotomy and tumor resection only in a few minor respects. As tumor resection is a common treatment procedure, and is often indicated to relieve pressure, administration of the therapeutic compositions of the invention can be performed following tumor resection.
  • the cavity is preferable rinsed with saline until all bleeding is stopped by cauterization.
  • the pia-arachnoid membrane, surrounding the tumor cavity at the surface is cauterized to enhance the formation of fibroblastic reaction and scarring in the pia-arachnoid area.
  • the result is the formation of an enclosed, fluid-filled cavity within the brain tissue at the location from where the tumor was removed.
  • either the tip of an Ommaya reservoir or a micro catheter which is connected to a pump device and allows the continuos infusion of an antibody solution into the cavity, can be placed into the cavity. See, e.g., U.S. Patent No. 5,558,852, incorporated fully herein by reference.
  • a convection-enhanced delivery catheter may be implanted directly into the tumor mass, into a natural or surgically created cyst, or into the normal brain mass.
  • Such convection- enhanced pharmaceutical composition delivery devices greatly improve the diffusion of the composition throughout the brain mass.
  • the implanted catheters of these delivery devices utilize high-flow icroinfusion (with flow rates in the range of about 0.5 to 15.0 ⁇ l/minute), rather than diffusive flow, to deliver the therapeutic or imaging composition to the brain and/or tumor mass.
  • Such devices are described in U.S. Patent No. 5,720,720, incorporated fully herein by reference.
  • the effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will be different from patient to patient.
  • a competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to retard the growth and promote the death of tumor cells, or an effective amount of an imaging composition to administer to a patient to facilitate the visualization of a tumor.
  • Dosage of the antibody-conjugate will depend on the treatment of the tumor, route of administration, the nature of the therapeutics, sensitivity of the tumor to the therapeutics, etc. Utilizing LD 50 animal data, and other information available for the conjugated cytotoxic or imaging moiety, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered.
  • compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration.
  • Imaging moieties are typically less toxic than cytotoxic moieties and may be administered in higher doses in some embodiments. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic or imaging composition in the course of routine clinical trials.
  • the dosage will be 0.001 to 100 milligrams of conjugate per kilogram subject body weight. Doses in the range of 0.01 to 1 mg per kilogram of patient body weight may be utilized for a radionuclide therapeutic composition which is administered intrathecally. Relatively large doses, in the range of 0.1 to 10 mg per kilogram of patient body weight, may used for imaging conjugates with a relatively non-toxic imaging moiety. The amount utilized will depend on the sensitivity of the imaging method, and the relative toxicity of the imaging moiety. In a therapeutic example, for example where the therapeutic composition comprises a 131 I cytotoxic moiety, the dosage to the patient will typically start at a lower range of 10 mCi, and go up to 100, 300 or even 500 mCi.
  • the dosage to the patient will typically be from 5,000 Rads to 100,000 Rads (preferably at least 13,000 Rads, or even at least 50,000 Rads). Doses for other radionuclides are typically selected so that the tumoricidal dose will be equivalent to the foregoing range for 131 I. Similarly, chemotoxic or toxin protein doses may be scaled accordingly.
  • compositions can be administered to the subject in a series of more than one administration.
  • regular periodic administration e.g., every 2-3 days
  • antibody moieties which do not provoke immune responses are preferred.
  • the imaging antibody conjugate compositions may be administered at an appropriate time before the visualization technique. For example, administration within an hour before direct visual inspection may be appropriate, or administration within twelve hours before an MRI scan may be appropriate. Care should be taken, however, to not allow too much time to pass between administration and visualization, as the imaging compound may eventually be cleared from the patient's system.
  • these compositions may be utilized as a "dry run" for more toxic cytotoxic antibody conjugates.
  • the physician may first use a visualization technique to determine precisely where in the brain the cytotoxic conjugate will concentrate. If a sufficient degree of tissue selectivity is not achieved (e.g., if the tumor cells are too disperse in the normal tissue, or if the particular brain tumor protein target chosen is not sufficiently overexpressed in the particular patient's tumor cells), then the physician may choose another brain tumor protein target.
  • tissue selectivity e.g., if the tumor cells are too disperse in the normal tissue, or if the particular brain tumor protein target chosen is not sufficiently overexpressed in the particular patient's tumor cells.
  • Brain tumors tend to be heterogeneous in character, and pervasive throughout the brain tissue. This combination often makes them difficult to treat.
  • Such combination treatments may be by administering blended antibody therapeutic or imaging compositions, individually prepared as described above, and administering the blended therapeutic to the patient as described.
  • the skilled administering physician will be able to take such factors as combined toxicity, and individual agent efficacy, into account when administering such combined agents. Additionally, those of skill in the art will be able to screen for potential cross-reaction with each other, in order to assure full efficacy of each agent.
  • each individual brain tumor protein target compositions may be administered simultaneously or in succession for a combined therapy. This may be desirable to avoid accumulated toxicity from several antibody conjugate reagents, or to more closely monitor potential adverse reactions to the individual antibody reagents. Thus, cycles such as where a first antibody therapeutic agent is administered on day one, followed by a second on day two, then a period with out administration, followed by re-administration of the antibody therapeutics on different successive days, is comprehended within the present invention.
  • Brain Tumors Tumor tissue, confirmed as glioblastoma grade IV by neuropathology, from an unknown patient was snap frozen in the operation hall and served as experimental sample. Human whole brain tissue (Clontech Laboratories, Palo Alto, USA) served as control sample. Poly- A + RNA prepared from the cells was converted into double-stranded cDNA (dscDNA) and normalized. Subtractive hybridization was carried out using the dscDNA from tumors with an excess of dscDNA prepared from the same region of a non-cancerous brain. Differentially expressed gene fragments were cloned into a plasmid vector, and the resulting library was transformed into E. coli cells.
  • dscDNA double-stranded cDNA
  • Inserts of recombinant clones were amplified by the polymerase chain reaction (PCR).
  • PCR products fragments of 200-2000 bp in size
  • the resulting sequence information was compared to public databases using the BLAST (blastn) and Smith Waterman algorithms.
  • the differentially expressed sequences thus identified are listed in Table 1.
  • RNA nucleotide sequence for PTP ⁇ SMI was identified in a human fetal brain phage cDNA library, and the mRNA nucleotide sequence for PTP ⁇ SM2 was identified by PCR amplification of adult human brain cDNA. For the RT-PCR analyses perfo ⁇ ned below, total RNA was isolated from either cells
  • cDNA was generated from total RNA using the 1 st Strand synthesis kit from Gibco Life Technologies, Inc., and an oligo dT 30 anchored primer. For each RT-PCR reaction, 1 ⁇ l of cDNA was utilized. The PCR reaction was carried out using an Advantage 2 kit (Clontech) under standard conditions. The products of the PCR reactions were confirmed via sequencing.
  • RT-PCR analysis was performed, confirming expression of the SMI splice variant in 11 of 17 different glioblastoma cell lines tested, fetal brain, and adult brain, using the unique 3' end and portion of the 3' untranslated region as the hybridization target for the probe.
  • RT-PCR analysis was performed on 28 primary brain tumor samples, confirming expression of the PTP ⁇ SMI variant in 16 of the 28 tumors.
  • TTGACTGGCTCAGGAGTATAG were used, which produce a 130 bp product when the extra exon 23a is present, and a no product when the exon 23a is absent.
  • RT-PCR analysis was performed, confirming expression in 6 of 17 different glioblastoma cell lines tested.
  • RT-PCR analysis was performed on 28 primary brain tumor samples, confirming expression of the
  • RT-PCR analysis was also done for the expression of PTP ⁇ - ⁇ (primers (SEQ ID NO:21) CTGATAATGAGGGCTCCCAAC and CTCTGCACTTCCTGGTAAAACTCT) and PTP ⁇ - ⁇ (primers (SEQ ID NO:22) CAGCAGTTGGATGGAAGAGGAC and (SEQ ID NO:23)
  • Tumor cells are known to migrate more rapidly towards chemoattractants, and the ability to migrate is taken as a measure of tumorigenicity.
  • Chemoattractants generally used are fetal bovine serum, pleiotrophin, bFGF, and VEGF. This assay is used to determine migration capability of a cell in which the target gene has been knocked down or overexpressed.
  • the ChemoTx ® disposable chemotaxis system (Neuroprobe, Inc., Gaithersburg, MD) is used according to the manufacturer's instructions, with a few modifications. Briefly, glioblastoma cultured cells from cell line G55T2 are prepared by splitting the cells the day before the assay is performed. A ChemoTx ® chamber with the following specifications is used: Pore size 8 ⁇ m, exposed filter area 8 mm 2 , exposed filter area diameter 3.2 mm. The plate configuration is: 30 ⁇ l per well, 96 well plate. The membrane type is: Track-etched polycarbonate.
  • the filter membrane is coated in 100ml PBS containing 0.1% acetic acid and 3.5 ml Vitrogen 100 (from Cohesion) at 37°C overnight. About 30 minutes before starting the assay the coated membrane is washed and rinsed with PBS containing 0.1% BSA. Cells are harvested by using the standard technique (trypsin-EDTA). The cells are washed once with DMEM 10% FBS, and then spun at 1000 RPM, for 5 minutes at room temperature. The pellet is resuspended in DMEM without serum, containing 0.1% BSA (serum free medium).
  • the cells are spun and resuspended again in serum free medium, and then spun and resuspended in the amount of serum free medium needed to provide a concentration of 1 mio. cells / ml, or 25,000 cells per 25ul. Just prior to the assay, a suitable amount of the antibody to be tested for anti-target function activity is added to the cell suspension.
  • a standard chemoattractant is used to measure the mobility of the cells.
  • the chemoattractants are diluted in serum free medium.
  • a suitable nonspecific chemoattractant is DMEM with 5% FBS.
  • the chemoattractant solutions and control solutions without chemoattractant are pipetted (29 ⁇ l) into the lower plate wells. After placing and securing the filter plate over the lower wells, ensuring contact with the solution in the bottom wells, serial dilutions of the cell suspension are pipetted onto each site on the filter top. The plates are then covered and incubated at 37° C, 5% CO 2 , for 3-4 hours.
  • the upper filter side is rinsed with PBS and exposed while the upper filter areas are cleaned with wet cotton swabs.
  • the filter is stained using the Diff-QuikTM (VWR) dye kit, according to the manufacturer's instructions.
  • the migrated cells are counted on the lower filter side using a microscope (magnification 200x), by counting of 5 high power field sections per well.
  • Cell-sprouting morphology is utilized as an easily visualized assay to determine the inhibitory effect of a candidate antibody on the protein target function for protein targets that stimulate endothelial cell sprouting, such as ARP2.
  • assays have been described extensively in the literature (Nehls, V., et al., Histochem. Cell Biol. 104: 459-466 (1995); Koblizek, T. I, et al., Curr. Biol. 8: 529-532 (1988); and Kwak, H.J., et al., FEBS Lett. 448: 249-253).
  • endothelial cells from a suitable source such as HTJVECs or PPAECs (porcine pulmonary artery endothelial cells) are grown to confluence on microcarrier (MC) beads (diameter 175 ⁇ m, available from Sigma) and placed into a 2.5 mg/ml fibrinogen gel containing the protein target at an appropriate effective concentration (200ng/ml is an suitable starting concentration, which the skilled practitioner may optimize) and the antibody in an appropriate range of concentrations (this will depend on antibody titer and affinity for the target), and 200 units/ml Trasylol (available from Bayer).
  • MC microcarrier
  • Fibrin gels are incubated in M-199 with a daily supplement of the same amount of recombinant protein and antibody, 2.0% heat-inactivated fetal bovine serum, and 200 units/ml Trasylol. After three days, the extent of sprouting is determined using a phase-contrast microscope. A decrease in cell sprouting as compared to controls without antibody indicates a reduction in protein target activity by the antibody.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2002/008992 2001-03-23 2002-03-22 Use of biomolecular targets in the treatment and visualization of brain tumors Ceased WO2002076510A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP02726668A EP1383543A4 (en) 2001-03-23 2002-03-22 USE OF BIOMOLECULAR TARGETS IN THE TREATMENT AND VISUALIZATION OF BRAIN TUMORS
JP2002575022A JP2004537282A (ja) 2001-03-23 2002-03-22 脳腫瘍の処置及び可視化における生体分子標的の使用法
CA002439630A CA2439630A1 (en) 2001-03-23 2002-03-22 Use of biomolecular targets in the treatment and visualization of brain tumors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US09/816,703 US6455026B1 (en) 2001-03-23 2001-03-23 Use of protein tyrosine phosphatase zeta as a biomolecular target in the treatment and visualization of brain tumors
US09/816,703 2001-03-23
US09/983,000 2001-10-17
US09/983,000 US20030118585A1 (en) 2001-10-17 2001-10-17 Use of protein biomolecular targets in the treatment and visualization of brain tumors

Publications (1)

Publication Number Publication Date
WO2002076510A1 true WO2002076510A1 (en) 2002-10-03

Family

ID=27124105

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/008992 Ceased WO2002076510A1 (en) 2001-03-23 2002-03-22 Use of biomolecular targets in the treatment and visualization of brain tumors

Country Status (4)

Country Link
EP (1) EP1383543A4 (cg-RX-API-DMAC7.html)
JP (1) JP2004537282A (cg-RX-API-DMAC7.html)
CA (1) CA2439630A1 (cg-RX-API-DMAC7.html)
WO (1) WO2002076510A1 (cg-RX-API-DMAC7.html)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014022A1 (en) 2003-07-16 2005-02-17 Develogen Aktiengesellschaft Use of pleitrophin for preventing and treating pancreatic diseases and/or obesity and/or metabolic syndrome
WO2006029462A1 (en) * 2004-09-14 2006-03-23 Autogen Research Pty Ltd A nucleic acid molecule differentially expressed in a mouse behavioural model system and uses thereof
EP1554405A4 (en) * 2002-07-16 2006-08-30 Univ Yale COMPOSITIONS, PROCESSES AND KITS RELATED TO TREATMENT AND PRIMARY TUMORS OF THE CNS
US7678769B2 (en) * 2001-09-14 2010-03-16 Compugen, Ltd. Hepatocyte growth factor receptor splice variants and methods of using same
US7758862B2 (en) 2005-09-30 2010-07-20 Compugen Ltd. Hepatocyte growth factor receptor splice variants and methods of using same
US9018180B2 (en) 2007-07-10 2015-04-28 Neurim Pharmaceuticals (1991) Ltd. CD44 splice variants in neurodegenerative diseases
CN106046166A (zh) * 2006-04-07 2016-10-26 爱尔皮奥治疗有限公司 结合人蛋白酪氨酸磷酸酶β(HPTPβ)的抗体及其用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201319446D0 (en) * 2013-11-04 2013-12-18 Immatics Biotechnologies Gmbh Personalized immunotherapy against several neuronal and brain tumors
CN121249676B (zh) * 2025-12-05 2026-03-24 重庆医科大学附属第一医院 一种met二聚体靶向的放射性核素探针及其制备方法与应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6312686B1 (en) * 1993-11-19 2001-11-06 Eisai Co., Ltd. Modulating the permeability of a physiological barrier with an agent that modulates tyrosine phosphorylation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2411601A1 (en) * 2000-06-05 2001-12-13 Avalon Pharmaceuticals Cancer gene determination and therapeutic screening using signature gene sets

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6312686B1 (en) * 1993-11-19 2001-11-06 Eisai Co., Ltd. Modulating the permeability of a physiological barrier with an agent that modulates tyrosine phosphorylation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MAEDA, N. ET AL.: "A receptor-like protein-tyrosine phosphatase PTP/RPTP beta binds a heparin-binding growth factor midkine", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 18, 1999, pages 12474 - 12479, XP002940448 *
See also references of EP1383543A4 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7678769B2 (en) * 2001-09-14 2010-03-16 Compugen, Ltd. Hepatocyte growth factor receptor splice variants and methods of using same
EP1554405A4 (en) * 2002-07-16 2006-08-30 Univ Yale COMPOSITIONS, PROCESSES AND KITS RELATED TO TREATMENT AND PRIMARY TUMORS OF THE CNS
WO2005014022A1 (en) 2003-07-16 2005-02-17 Develogen Aktiengesellschaft Use of pleitrophin for preventing and treating pancreatic diseases and/or obesity and/or metabolic syndrome
WO2006029462A1 (en) * 2004-09-14 2006-03-23 Autogen Research Pty Ltd A nucleic acid molecule differentially expressed in a mouse behavioural model system and uses thereof
US7758862B2 (en) 2005-09-30 2010-07-20 Compugen Ltd. Hepatocyte growth factor receptor splice variants and methods of using same
CN106046166A (zh) * 2006-04-07 2016-10-26 爱尔皮奥治疗有限公司 结合人蛋白酪氨酸磷酸酶β(HPTPβ)的抗体及其用途
US9018180B2 (en) 2007-07-10 2015-04-28 Neurim Pharmaceuticals (1991) Ltd. CD44 splice variants in neurodegenerative diseases
US9416166B2 (en) 2007-07-10 2016-08-16 Neurim Pharmaceuticals (1991) Ltd. CD44 splice variants in neurodegenerative diseases

Also Published As

Publication number Publication date
EP1383543A4 (en) 2006-06-21
JP2004537282A (ja) 2004-12-16
EP1383543A1 (en) 2004-01-28
CA2439630A1 (en) 2002-10-03

Similar Documents

Publication Publication Date Title
US7368098B2 (en) Use of biomolecular targets in the treatment and visualization of tumors
AU2003230807B2 (en) Use of biomolecular targets in the treatment and visualization of brain tumors
US7060275B2 (en) Use of protein biomolecular targets in the treatment and visualization of brain tumors
JP2003521897A (ja) 前立腺癌の診断、モニタリング、ステージング、イメージングおよび処置のための新規方法
AU2009314141A1 (en) Anti-CXCR1 compositions and methods
JP2009148265A (ja) 前立腺癌および結腸癌の診断および治療に有用な腫瘍抗原
US20130210663A1 (en) Methods and compounds for the diagnosis and treatment of cancer
CN115280153B (zh) 用于诊断或治疗抗癌药物耐药性的组合物
US20090221718A1 (en) Metadherin polypeptides, encoding nucleic acids and methods of use
WO2002076510A1 (en) Use of biomolecular targets in the treatment and visualization of brain tumors
KR102503593B1 (ko) 항암제 내성 진단 또는 치료용 조성물
US20040224337A1 (en) Use of biomolecular targets in the treatment and visualization of tumors
KR101741898B1 (ko) Claudin 7을 포함하는 방사선 반응성 위암 진단용 바이오마커 조성물
US20020146370A1 (en) Use of protein tyrosine phosphatase zeta as a biomolecular target in the treatment and visualization of brain tumors
AU2002257085A1 (en) Use of biomolecular targets in the treatment and visualization of brain tumours
KR101952649B1 (ko) Lrp-1을 유효성분으로 포함하는 방사선 저항성 암 진단용 또는 방사선 치료 예후 예측용 바이오마커 조성물
US20050260132A1 (en) Monoclonal antibodies directed to receptor protein tyrosine phosphatase zeta
KR102025005B1 (ko) 전암성 병변에서 조기 간암을 진단 및 예측할 수 있는 바이오 마커 및 이의용도
KR101483335B1 (ko) 골 손실 진단 마커로서의 피브리노겐의 용도
KR102042332B1 (ko) 간암의 재발 및 예후 예측용 tcirg1 마커 및 이의 용도

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2439630

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2002257085

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2002575022

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002726668

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002726668

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2002726668

Country of ref document: EP