WO2006029462A1

WO2006029462A1 - A nucleic acid molecule differentially expressed in a mouse behavioural model system and uses thereof

Info

Publication number: WO2006029462A1
Application number: PCT/AU2005/001402
Authority: WO
Inventors: Gregory Royce Collier; Kenneth Russell Walder; David S. Segal
Original assignee: Autogen Research Pty Ltd
Priority date: 2004-09-14
Filing date: 2005-09-14
Publication date: 2006-03-23

Abstract

The present invention relates generally to a nucleic acid molecule which is differentially expressed under particular degrees of behavioral modifying conditions including anxiety or depression. The subject nucleic acid molecule and/or its expression product are considered as therapeutic and diagnostic targets for conditions such as treating, controlling or preventing anxiety or depression such as arising from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral conditions and/or disorders in a mammal and in particular a human.

Description

A NUCLEIC ACID MOLECULE DIFFERENTIALLY EXPRESSED IN A MOUSE BEHAVIOURAL

MODEL SYSTEM AND USES THEREOF

BACKGROUND OF THE INVENTION

5 FIELD OF THE INVENTION

The present invention relates generally to a nucleic acid molecule which is differentially expressed under particular degrees of behavioral modifying conditions including anxiety or depression. The subject nucleic acid molecule and/or its expression product are considered 10 as therapeutic and diagnostic targets for conditions such as treating, controlling or preventing anxiety or depression such as arising from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral conditions and/or disorders in a mammal and in particular a human.

15 DESCRIPTION OF THE PRIOR ART

Bibliographic details of references provided in the subject specification are listed at the end of the specification.

20 Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

Stress-related disorders have become increasingly common throughout the last 50 years. 25 Noticeably, the prevalence rates of psychiatric diseases such as anxiety and depression have steadily increased. Indeed, the World Health Organization has estimated that by 2020 depression will be second only to ischemic heart disease as a cause of disability worldwide (Murray and Lopez, Lancet 349: 1498-1504, 1997).

30 Depression refers to a variety of human behavioral states related to feelings of sadness, apathy, futility and despair. The American Psychiatric Association characterizes depression as a dysphoric mood or loss of interest in activities that would normally be enjoyed (American Psychiatric Association, Diagnostic and statistical manual of mental disorders. Washington, D.C. Assoc. Am. Psychiatr. 4^th edition, 1994). Symptoms include loss of energy, reduced appetite and sleep disturbance. As with most psychological states, the definition of clinical depression is complicated by a variety of factors. Depression is a complex disorder with contributions from both genetic and environmental factors that are not well defined.

The neurobiology of depression is complex and features the involvement of many anatomical regions of the brain. Magnetic resonance and other imaging studies suggest that loci such as the amygdala, hypothalamus and prefrontal cortex exhibit altered activation during anxiety and depression (reviewed in Drevets, Ann. Rev. Med. 49: 341-361, 1998).

Although much is known regarding the role of neurotransmitters such as serotonin and norepinephrine in depression, underlying genetic changes associated with the depressive state and their role in depression is largely unclear. The finding that chronic treatment of patients with anti-depressive drugs is typically required to lessen the severity of symptoms suggests that changes in gene expression may be important to therapeutic outcomes.

The evaluation of animal models of depression has been based on three criteria. Face validity refers to the degree of symptomatic resemblance between the model and the clinical condition; predictive validity concerns the extent to which the model responds appropriately to drugs that are clinically effective and those that are not; construct validity addresses the theoretical rationale of the model.

Several approaches have been used to generate animal models of depression, with varying degrees of success. These include:-

(1) Non-simulation models:-

(a) Reserpine reversal; (b) Amphetamine potentiation;

(c) Waiting behavior models; (d) Orcadian rhythm models;

(2) Stress models :-

(a) Learned helplessness; (b) Behavioral despair;

(c) Failure to adapt to stress;

(d) Chronic unpredictable stress;

(e) Chronic mild stress;

(f) Amphetamine withdrawal;

(3) Separation models:-

(a) Non-human primate models;

(b) Distress calling in isolated chicks;

(c) Separation in pair-bonded hamsters; (d) Social isolation in rats;

(4) Brain damage models :-

(a) Olfactory bulbectomy;

(5) Genetic model:-

(a) Flinders sensitive line rats.

Each of these animal models has both positive and negative aspects when evaluated using the above criteria (reviewed by Willner, Handbook of Depression and Anxiety, (J. A. den Boer and J. M. Ad. Sisten, eds.)₅ Marcek Dekker, New York, pp. 291 -316, 1994).

Separation models have been used to investigate aspects of depression. Studies of separation-induced depression in monkeys, hamsters, chickens and rats have identified a range of atypical behaviors including reduced motor activity, decreased appetite and sleep disturbances (Jesberger and Richardson, Biol Psychiatry 20: 764-784, 1985). Separation models, especially when conducted in non-human primates, show a significant symptomatic resemblance with clinical depression, however, the extent to which the model responds to drugs that are clinically effective has not been well studied. There is a need to develop more definitive separation models.

International Patent Application No. PCT/AU02/01254 [WO 03/024206] describes an animal model of inter alia depression comprising Psammomys obesus. In accordance with the present invention, this animal model is used to identify differentially expressed genetic material.

SUMMARY OF THE INVENTION

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

A summary of genes identified in accordance with the present invention is provided in Table 1.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>l (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 2. A sequence listing is provided after the claims.

Communally-raised P. obesus exhibit a depression-like response when separated into individual cages, as shown by a reduction in food intake and body weight for a period of approximately one week. This anorexia and loss of body weight is used as a marker for the depression phenotype. Assessment of animal behavior using an Open-Field Test (OFT) showed significant differences in behavior between separated and communally-housed animals. The separated animals spent more time near the edges of the OFT apparatus and less time in the center. This effect was independent of weight loss or gain in separated animals. Other parameters such as the number of jumps and rears, the time spent moving or the number of ambulations were not significantly different in separated or communally- housed animals. The behavioral changes seen in separated animals are consistent with a depression phenotype.

The depression phenotype is classified as non-response, temporary response or constant response phenotype. A non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight. A temporary-response animal, upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks. A constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks. The data from the P. obesus separation model of depression indicate that the model has both face and construct validity.

Microarray analysis was used in time course studies using the P. obesus animal model to identify changes in expression of genetic material.

cDNA microarray technology provides a powerful technical means to generate a gene expression database of both known genes and unknown transcripts. Using cDNA microarrays, comparative estimates can be obtained of the level of gene expression of large numbers of genes (up to 20,000 per microarray) in each sample. cDNA microarrays generally involve a large number of DNA "spots" in an orderly array chemically coupled to the surface of a solid substrate, usually but not exclusively an optically flat glass microscope slide. Fluorescently labeled cDNAs are generated from experimental and reference RNA samples and then competitively hybridized to the gene chip. The experimental and reference cDNAs are labeled with a different fluorescent dye and the intensity of each fluor at each DNA spot gives an indication of the level of that particular RNA species in the experimental sample relative to the reference RNA. The ratio of fluorescence can be taken as a measure of the expression level of the gene corresponding to that spot in the experimental sample.

In a preferred embodiment, five expressed sequences were identified designated herein AGT-307 [SEQ ID NO:1], AGT-308 [SEQ ID NO.2], AGT-309 [SEQ ID NO:3], AGT-310 [SEQ ID NO:4] andAGT-311 [SEQ ID NO:5] .

A summary of the AGT genes is provided in Table 1.

The present invention contemplates the use of these sequences or mammalian including human homologs thereof or their expression products in the manufacture of medicaments and diagnostic agents for a range of behavior conditions including anxiety and/or depression.

The present invention provides, therefore, a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule or its homolog is differentially expressed in hypothalamus of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.

The present invention further provides a nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein the nucleotide sequence is as substantially set forth in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO: 5 or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NO: 1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 and/or is capable of hybridizing to one or more of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or a complementary form thereof under low stringency conditions at 42°C and wherein the nucleic acid molecule is differentially expressed in hypothalmus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.

The present invention also provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which expression product is encoded by a nucleotide sequence which is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.

More particularly, the present invention is directed to an isolated expression product or a derivative, homolog, analog or mimetic thereof wherein the expression product is encoded by a nucleotide sequence substantially as set forth in SEQ ID NO:1 or SEQ ID NO:2 or

SEQ ED NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or a nucleotide sequence having at least 30% similarity to all or part of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 and/or is capable of hybridizing to SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or a complementary form thereof under low stringency conditions at 42⁰C.

Reference to "homolog" includes other mammalian homologs such as from a human.

The preferred genetic sequence of the present invention are referred to herein as AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311. The expression products encoded by AGT- 507, AGT-308, AGT-309, AGT-310 and AGT-311 are referred to herein as AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311, respectively. The expression product may be an RNA (e.g. mRNA) or a protein. Where the expression product is an RNA, the present invention extends to RNA-related molecules associated thereto such as RNAi or intron or exon sequences therefrom or short, interfering RNA (si-RNA) or complexes comprising same.

Even yet another aspect of the present invention relates to a composition comprising AGT- 307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or its derivatives, homologs, analogs or mimetics or agonists or antagonists of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 together with one or more pharmaceutically acceptable carriers and/or diluents.

The present invention is particularly directed to human homologs of the genes identified in P. obesus and their use in therapy and diagnosis.

Another aspect of the present invention contemplates, therefore, a method for treating a subject comprising administering to said subject a treatment effective amount of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or a derivative, homolog, analog or mimetic thereof or a genetic sequence encoding same or an agonist or antagonist of AGT- 307, AGT-308, AGT-309, AGT-310 and/or AGT-311 activity or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 gene expression for a time and under conditions sufficient to effect treatment. In accordance with this and other aspects of the present invention, treatments contemplated herein include but are not limited to behavioral disorders or conditions such as anxiety and/or depression. Such disorders may result from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral condition or disorder. Treatment may be by the administration of a pharmaceutical composition or genetic sequences via gene therapy, antisense therapy or sense or RNAi- or si-RNA-mediated therapy. Treatment is contemplated for human subjects as well as animals such as animals important to livestock industry.

A further aspect of the present invention is directed to a diagnostic agent for use in monitoring or diagnosing conditions such as but not limited to behavioral conditions or disorders including anxiety or depression, said diagnostic agent selected from an antibody to AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or its derivatives, homologs, analogs or mimetics and a genetic sequence comprising or capable of annealing to a nucleotide strand associated with AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 useful inter alia in PCR, hybridization, RFLP analysis or AFLP analysis.

TABLE 1

Summary of AGT Genes

A summary of sequence identifiers used throughout the subject specification is provided in Table 2.

TABLE 2 Summary of Sequence Identifiers

BRIEF DESCRIPTION OF THE DRAWINGS

Figures Ia and Ib are graphical representations of the level of AGT310 gene expression correlated with either (a) movement or (b) number of jumps.

Figure 2 is a graphical representation of the level of AGT311 gene expression correlated with time spent in the inner region of the open field test.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is predicated in part on the phenotypes exhibited by communally- reared or maintained P. obesus animals after separation from each other. Such separation is referred to as "social separation". The phenotypes are classified as non-response, temporary response or constant response phenotype. A non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight. A temporary-response animal, upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks. A constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks.

Such animals represent an animal model for behavioral conditions such as anxiety or depression.

The present invention provides genetic material associated inter alia with such behavioral conditions. The genes are identified following differential screening of mRNA from hypothalamus tissue at various times following separation and isolation of communally- reared P. obesus animals. The selection of hypothalamus tissue is not intended to imply that differential expression does not occur in other tissue. The present invention further extends to homologs in other mammals and in particular humans as well as in other animals or organisms.

Accordingly, one aspect of the present invention provides a differentially expressed isolated nucleic acid molecule from a P. obesus animal, which animal is subjected to separation or isolation from other P. obesus animals from the same community and which animal exhibits at least one phenotype selected from a non-response, temporary response or constant response phenotype. Reference to a behavioral condition or disorder includes conditions such as anxiety, depression, change in eating patterns such as leading to weight loss or weight gain, stress or despair amongst a range of other conditions. It is proposed, therefore, that the subject nucleic acid molecule is useful in the study of and development of treatment and diagnostic protocols for conditions such as anxiety, depression, drug addiction and chemical substance dependence, anti-social behavior and various forms of attention deficit disorders.

The present invention provides, therefore, a method for assessing a behavioral disorder in P. obesus animals, said method comprising subjecting a plurality of communally-reared or maintained animals to social isolation from each other for a time and under conditions sufficient for one of three phenotypes to become apparent when said phenotypes are selected from non-response, temporary response and constant response phenotype and then screening for changes in expression of one or more nucleic acid molecules.

Reference to "communally-reared or maintained" means the animals have been maintained together since birth or since shortly after birth (i.e. within days or weeks or months of birth) or have been maintained with at least one other animal shortly after birth. The "other animal" may be the same type of animal or a different type of animal. The term "communally" generally means that two or more animals are maintained in a single enclosure but also extends to enclosures where the animals are physically separated from each other but are able to at least view each other or more preferably are able to engage in some form of body contact with each other such as touching, licking or grooming.

A "plurality" of animals means two or more animals preferably three or more and even more preferably from about four to about 500 or from about five to about 100 or from about six to 80 animals.

As stated above, the subject animal model may be used to screen for the presence of nucleic acid molecules whose expression is altered under adverse behavioral-modifying conditions such as separation. Accordingly, another aspect of the present invention contemplates a method for identifying a nucleic acid molecule whose expression is altered following a behavioral-modifying protocol applied to a P. obesus animal model, said method comprising subjecting a plurality of communally-reared or maintained P. obesus animals to said protocol comprising socially separating said animals and determining whether there is any alteration in expression of a nucleic acid molecule.

In particular, the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule is differentially expressed in hypothalamus tissue of communally-reared P. obesus animals subjected to isolation from other P. obesus animals from the same community.

The term "differentially expressed" is used in its most general sense and includes elevated levels of an expression product such as mRNA or protein or a secondary product such as cDNA in one tissue compared to another tissue or in the same tissue but under different conditions. Examples of different conditions includes differential expression in tissue from fed and fasted animals or in exercise trained and control animals. Differential expression is conveniently determined by a range of techniques including polymerase chain reaction (PCR) such as real-time PCR. Other techniques include suppression subtractive hyridization (SSH) and amplified fragment length polymorphism (AFLP) analysis. Microarray analysis of cDNA is particularly preferred.

A homolog refers to a genetic sequence in another animal or organism which has at least about 20% identity to the reference sequence. A preferred homolog is a human homolog.

In accordance with the present invention, a number of differentially expressed genetic sequences were identified in hypothalamus tissue in P. obesus under behavioral-modifying conditions such as isolation and/or separation. Another aspect of the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NO:1 (AGT-307) or SEQ ID NO:2 (AGT- 308) or SEQ ID NO:3 (AGT-309) or SEQ ID NO:4 (AGT-310) or SEQ ID NO:5 (AGT- 311) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 and/or is capable of hybridizing to one or more of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO: 5 or a complementary form thereof under low stringency conditions at 42⁰C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.

Higher similarities are also contemplated by the present invention such as greater than about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% or above.

An expression product includes an RNA molecule such as an mRNA transcript as well as a protein. Some genes are non-protein encoding genes and produce mRNA or other RNA molecules and are involved in regulation by RNA:DNA, RNA:RNA or RNA:protein interaction. The RNA (e.g. mRNA) may act directly or via the induction of other molecules such as RNAi or via products mediated from splicing events (e.g. exons or introns). Short, interfering RNA (si-RNA) is also contemplated by the present invention. Other genes encode mRNA transcripts which are then translated into proteins. A protein includes a polypeptide. The differentially expressed nucleic acid molecules, therefore, may encode niRNAs only or, in addition, proteins. Both mRNAs and proteins are forms of "expression products".

Reference herein to similarity is generally at a level of comparison of at least 15 consecutive or substantially consecutive nucleotides. It is particularly convenient, however, to determine similarity by comparing a total or complete sequence, after optimal alignment.

The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which may encode different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide sequence comparisons are made at the level of identity rather than similarity.

Terms used to describe sequence relationships between two or more polynucleotides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al. (Nucl Acids Res. 25: 3389, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et άl. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, Chapter 15, 1994-1998). A range of other algorithms may be used to compare the nucleotide and amino acid sequences such as but not limited to PILEUP, CLUSTALW, SEQUENCHER or VectorNTI.

The terms "sequence similarity" and "sequence identity" as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- nucleotide basis over a window of comparison. Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.

Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions. Generally, low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out T_m = 69.3 + 0.41 (G+C)% (Marmur and Doty, J. MoI. Biol. 5: 109, 1962). However, the T_m of a duplex DNA decreases by I⁰C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42⁰C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 2O⁰C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C.

The nucleotide sequence or amino acid sequence of the present invention may correspond to exactly the same sequence of the naturally occurring gene (or corresponding cDNA) or protein or other expression product or may carry one or more nucleotide or amino acid substitutions, additions and/or deletions. The nucleotide sequences set forth in SEQ ID NO.-l (AGT-307), SEQ ID NO:2 (AGT-308), SEQ ID NO:3 (AGT-309) SEQ ID NO:4 (AGT-310) or SEQ ID NO:5 (AGT-311) correspond to novel genes referred to in parenthesis. The corresponding expression products are AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311, respectively. Reference herein to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 includes, where appropriate, reference to the genomic gene or cDNA as well as any naturally occurring or induced derivatives. Apart from the substitutions, deletions and/or additions to the nucleotide sequence, the present invention further encompasses mutants, fragments, parts and portions of the nucleotide sequence corresponding to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

Another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:1 (AGT-307) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO:1 or a nucleotide sequence capable of hybridizing to SEQ ID NO:1 or its complementary form under low stringency conditions.

Yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:2 (AGT-308) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO:2 or a nucleotide sequence capable of hybridizing to SEQ ID NO:2 or its complementary form under low stringency conditions.

Still yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:3 (AGT-309) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.

Even yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:4 [AGT-SlO) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO:4 or a nucleotide sequence capable of hybridizing to SEQ ID NO:4 or its complementary form under low stringency conditions.

Even still another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 5 (AGT-311) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO:5 or a nucleotide sequence capable of hybridizing to SEQ ID NO:5 or its complementary form under low stringency conditions.

The expression pattern of AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 has been determined, inter alia, to indicate an involvement in or associated with a behavioral condition or disorder such as anxiety or depression. In addition to the differential expression of AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 in hypothalamus of communally-reared P. obesus animals versus separated animals, these genes may also be differentially expressed in other tissues including but not limited to brain, muscle, adipose tissue, pancreas or gastrointestinal tissue. The nucleic acid molecule corresponding to each of AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 is preferably a DNA such as a cDNA sequence or a genomic DNA. A genomic sequence may also comprise exons and introns. A genomic sequence may also include a promoter region or other regulatory regions.

A homolog is considered to be a gene from another animal species which has the same or greater than 30% similarity to one of AGT-307, AGT-308, AGT-309, AGT-310 andAGT- 311 and/or which has a similar function. The above-mentioned genes are exemplified herein from P. obesus hypothalamus. The present invention extends, however, to the homologous gene, as determined by nucleotide sequence and/or function, from humans, primates (lower and higher primates), livestock animals (e.g. cows, sheep, pigs, horses, donkeys), laboratory test animals (e.g. mice, guinea pigs, hamsters, rabbits), companion animals (e.g. cats, dogs) and captured wild animals (e.g. rodents, foxes, deer, kangaroos). Homologs may also be present in microorganisms and C. elegans.

The nucleic acids of the present invention and in particular AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 and their derivatives and homologs may be in isolated or purified form and/or may be ligated to a vector such as an expression vector. Expression may be in a eukaryotic cell line (e.g. mammalian, insect or yeast cells) or in prokaryote cells (e.g. E. coli) or in both. By "isolated" is meant a nucleic acid molecule having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject nucleic acid molecule, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject nucleic acid molecule relative to other components as determined by molecular weight, encoding activity, nucleotide sequence, base composition or other convenient means. The nucleic acid molecule of the present invention may also be considered, in a preferred embodiment, to be biologically pure. The nucleic acid molecule may be ligated to an expression vector capable of expression in a prokaryotic cell (e.g. E. coli) or a eukaryotic cell (e.g. yeast cells, fungal cells, insect cells, mammalian cells or plant cells). The nucleic acid molecule may be ligated or fused or otherwise associated with a nucleic acid molecule encoding another entity such as, for example, a signal peptide. It may also comprise additional nucleotide sequence information fused, linked or otherwise associated with it either at the 3' or 5' terminal portions or at both the 3' and 5' terminal portions. The nucleic acid molecule may also be part of a vector, such as an expression vector.

The derivatives of the nucleic acid molecule of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in co- suppression (including sense RNA or DNA, RNAi and si-RNA) and fusion nucleic acid molecules. Ribozymes and DNAzymes are also contemplated by the present invention directed to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or their mRNAs. Derivatives and homologs of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 are conveniently encompassed by those nucleotide sequences capable of hybridizing to one or more of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO.3 or SEQ ID NO:4 or SEQ ID NO: 5 or a complementary form thereof under low stringency conditions.

Derivatives include fragments, parts, portions, mutants, variants and mimetics from natural, synthetic or recombinant sources including fusion nucleic acid molecules. Derivatives may be derived from insertion, deletion or substitution of nucleotides. Another aspect of the present invention provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which is produced in larger or lesser amounts in hypothalamus tissue of a communally-reared P. obesus animal separated from other P. obesus animals from the same community.

An expression product, as indicated above, may be RNA or protein. Insofar as the product is a protein, derivatives include amino acid insertional derivatives such as amino and/or carboxylic terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in a protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. An example of substitutional amino acid variants are conservative amino acid substitutions. Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins.

Chemical and functional equivalents of protein forms of the expression products AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 should be understood as molecules exhibiting any one or more of the functional activities of these molecules and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening or screening of chemical libraries.

The derivatives include fragments having particular epitopes or parts of the entire protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules. Reference herein to AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 includes reference to isolated or purified naturally occurring AGT-307, AGT-308, AGT-309, AGT- 310 or AGT-311 as well as any derivatives, homologs, analogs and mimetics thereof. Derivatives include parts, fragments and portions of AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 as well as single and multiple amino acid substitutions, deletions and/or additions to AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 when the expression products are proteins. A derivative of AGT-307, AGT-308, AGT-309, AGT- 310 or AGT-311 is conveniently encompassed by molecules encoded by a nucleotide sequence capable of hybridizing to SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 under low stringency conditions.

Other derivatives of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 include chemical analogs. Analogs of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 contemplated herein include, but are not limited to, modifications to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose confirmational constraints on the proteinaceous molecule or their analogs.

Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH₄; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulfonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH₄.

The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal. The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.

Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.

Tryptophan residues may be modified by, for example, oxidation with N- bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.

Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate .

Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids. A list of unnatural amino acid, contemplated herein is shown in Table 3. TABLE 3 Codes for non-conventional amino acids

Non-conventional Code Non-conventional Code amino acid amino acid

α-ammobutyπc acid Abu L-N-methylalanme Nmala α-amino-α-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-Nmethylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile

D-alanine Dal L-N-methylleucine Nmleu

D-arginine Darg L-N-methyllysine Nmlys

D-aspartic acid Dasp L-N-methylmethionine Nmmet

D-cysteine Dcys L-N-methylnorleucine Nmnle

D-glutamine DgIn L-N-methylnorvaline Nmnva

D-glutamic acid DgIu L-N-methylornithine Nmorn

D-histidine Dhis L-N-methylphenylalanine Nmphe

D-isoleucine DiIe L-N-methylproline Nmpro

D-leucine Dleu L-N-methylserine Nmser

D-lysine Dlys L-N-niethylthreonine Nmthr

D-methionine Dmet L-N-methyltryptophan Nmtrp

D-ornithine Dorn L-N-methyltyrosine Nmtyr

D-phenylalanine Dphe L-N-methylvaline Nmval

D-proline Dpro L-N-methylethylglycine Nmetg

D-serine Dser L-N-methyl-t-butylglycine Nmtbug Non-conventional Code Non-conventional Code amino acid amino acid

D-threonine Dthr L-norleucine NIe

D-tryptophan Dtrp L-norvaline Nva

D-tyrosine Dtyr α-methyl-aminoisobutyrate Maib

D-valine Dval α-methyl-γ-aminobutyrate Mgabu

D-α-methylalanine Dmala α-methylcyclohexylalanine Mchexa

D-α-methylarginine Dmarg α-methylcylcoρentylalanine Mcpen

D-α-methylasparagine Dmasn α-methyl-α-napthylalanine Manap

D-α-methylaspartate Dmasp α-methylpenicillamine Mpen

D-α-methylcysteine Dmcys N-(4-aminobutyl)glycine NgIu

D-α-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg

D-α-methylhistidine Dmhis N-(3-aminoρropyl)glycine Norn

D-α-methylisoleucine Dmile N-amino-α-methylbutyrate Nmaabu

D-α-methylleucine Dmleu α-napthylalanine Anap

D-α-methyllysine Dmlys N-benzylglycine Nphe

D-α-methylmethionine Dmmet N-(2-carbamylethyl)glycine NgIn

D-α-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn

D-α-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine NgIu

D-α-methylproline Dmpro N-(carboxymethyl)glycine Nasp

D-α-methylserine Dmser N-cyclobutylglycine Ncbut

D-α-methylthreonine Dmthr N-cycloheptylglycine Nchep

D-α-methyltryptophan Dnitrp N-cyclohexylglycine Nchex

D-α-methyltyrosine Dmty N-cyclodecylglycine Ncdec

D-α-methylvaline Dmval N-cylcododecylglycine Ncdod

D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct

D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro

D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund

D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm Non-conventional Code Non-conventional Code amino acid amino acid

D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe

D-N-methylglutamine Dnmgln N-(3 -guanidinopropyl)glycine Narg

D-N-methylglutamate Dnmglu N-(I -hydroxyethyl)glycine Nthr

D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser

D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis

D-N-methylleucine Dnmleu N-(3 -indolylyethyl)glycine Nhtrp

D-N-methyllysine Dnmlys N-methyl-γ-aminobutyrate Nmgabu

N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet

D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen

N-methylglycine NaIa D-N-methylphenylalanine Dnmphe

N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro

N-(I -methylpropyl) glycine Nile D-N-methylserine Dnmser

N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr

D-N-methyltryptophan Dnmtrp N-(I -methylethyl)glycine Nval

D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap

D-N-methylvaline Dnmval N-methylpenicillamine Nmpen γ-aminobutyric acid Gabu N-(/?-hydroxyphenyl)glycine Nhtyr

L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys

L-ethylglycine Etg penicillamine Pen

L-homophenylalanine Hphe L-α-methylalanine Mala

L-α-methylarginine Marg L-α-methylasparagine Masn

L-α-methylaspartate Masp L-α-methyl-t-butylglycine Mtbug

L-α-methylcysteine Mcys L-methylethylglycine Metg

L-α-methylglutamine MgIn L-α-methylglutamate MgIu

L-α-methylhistidine MMs L-α-methylhomophenylalanine Mhphe

L-α-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet

L-α-methylleucine Mleu L-α-methyllysine Mlys Non-conventional Code Non-conventional Code amino acid amino acid

L-α-methylmethionine Mmet L-α-methylnorleucine MnIe

L-α-methylnorvaline Mnva L-α-methylornithine Morn

L-α-methylphenylalanine Mphe L-α-methylproline Mpro

L-α-methylserine Mser L-α-methylthreonine Mthr

L-α-methyltryptophan Mtrp L-α-methyltyrosine Mtyr

L-α-methylvaline Mval L-N-methylhomophenylalanine Nmhphe

N-(N-(2₅2-diρhenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine

1 -carboxy- 1 -(2,2-diphenyl- Nmbc ethylamino)cyclopropane

Crosslinkers can be used, for example, to stabilize 3D conformations, using homo- bifunctional crosslinkers such as the bifunctional imido esters having (CH₂)_n spacer groups with n=l to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). In addition, peptides can be conformationally constrained by, for example, incorporation of C_α and N_α-methylamino acids, introduction of double bonds between C_α and C_β atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.

All such modifications may also be useful in stabilizing the AGT-307, AGT-308, AGT- 309, AGT-310 and AGT-311 molecule for use in in vivo administration protocols or for diagnostic purposes.

As stated above, the expression product may be a RNA or protein. The term "protein" should be understood to encompass peptides, polypeptides and proteins. The protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins. Reference hereinafter to a "protein" includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.

In a particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO:1 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO:1 or a nucleotide sequence capable of hybridizing to SEQ ID NO:1 or its complementary form under low stringency conditions.

In another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO:2 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO:2 or a nucleotide sequence capable of hybridizing to SEQ ID NO:2 or its complementary form under low stringency conditions.

In still another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO.3 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO:3 or a nucleotide sequence capable of hybridizing to SEQ ID NO:3 or their complementary form under low stringency conditions.

In yet another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO:4 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO :4 or a nucleotide sequence capable of hybridizing to SEQ ID NO:4 or their complementary form under low stringency conditions.

In another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO.5 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO: 5 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 5 or its complementary form under low stringency conditions.

Higher similarities are also contemplated by the present invention such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 10, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%.

Another aspect of the present invention is directed to an isolated expression product selected from the list consisting of:-

(i) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of communally-reard P. obesus animal subjected to isolation from other P. obesus animals from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;

(ii) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus aniamls from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;

(iii) AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 or a derivative, homolog, analog, chemical equivalent or mimetic thereof; (iv) a protein encoded by a nucleotide sequence comprising SEQ ID NO:1 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog., analog, chemical equivalent or mimetic of said protein;

(vi) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO:2 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(vii) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO: 3 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(viii) a protein comprising an amino acid sequence substantially as set forth in SEQ ID NO:4 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(ix) a protein comprising an amino acid sequence substantially as set forth in SEQ ID NO: 5 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(x) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:1 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions; (xi) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO. -2 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;

(xii) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:3 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions;

(xiii) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:4 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions; and

(xiv) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO: 5 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions.

The protein of the present invention is preferably in isolated form. By "isolated" is meant a protein having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject protein, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject protein relative to other components as determined by molecular weight, amino acid sequence or other convenient means. The protein of the present invention may also be considered, in a preferred embodiment, to be biologically pure.

Without limiting the theory or mode of action of the present invention, the expression or non-expression of AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 is considered to be associated with anxiety or depression amongst other disorders. Modulation of expression of these genes is proposed to be useful in the treatment or prophylaxis of behavioral conditions such as anxiety or depression. Alternatively or in addition, the level of expression represents a useful diagnostic marker of various behavioral conditions.

The identification of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 permits the generation of a range of therapeutic molecules capable of modulating expression of A GT- 307, AGT-308, AGT-309, AGT-310 and AGT-311 or modulating the activity of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311. Modulators contemplated by the present invention include agonists and antagonists of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 expression. Antagonists of AGT-307, AGT-308, AGT-309, AGT-310 and AGT- 311 expression include antisense molecules, ribozymes and co-suppression molecules (including si-RNA and any molecule which induce RNAi). Agonists include molecules which increase promoter activity or which interfere with negative regulatory mechanisms. Antagonists of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 include antibodies and inhibitor peptide fragments. All such molecules may first need to be modified to enable such molecules to penetrate cell membranes. Alternatively, viral agents may be employed to introduce genetic elements to modulate expression of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311. In so far as AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 act in association with other genes the therapeutic molecules may target AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 and other genes or their translation products.

The present invention contemplates, therefore, a method for modulating expression of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 in a mammal, said method comprising contacting the AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 gene with an effective amount of a modulator of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 expression for a time and under conditions sufficient to up-regulate or down- regulate or otherwise modulate expression of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

For example, a nucleic acid molecule encoding AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or a derivative or homolog thereof may be introduced into a cell to enhance the ability of that cell to produce AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311₅ conversely, AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 sense and/or antisense sequences such as oligonucleotides may be introduced to decrease expression of the genes at the level of transcription, post-transcription or translation. Sense sequences preferably encode hair pin RNA molecules or double-stranded RNA molecules.

Another aspect of the present invention contemplates a method of modulating activity of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 in a mammal, said method comprising administering to said mammal a modulating effective amount of a molecule for a time and under conditions sufficient to increase or decrease AGT-307, AGT-308, AGT- 309, AGT-310 and AGT-311 activity. The molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or its ligand.

Modulating levels of AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 expression or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 activity or function is important in the treatment of a range of conditions such as anxiety and depression. It may also be useful in the agricultural industry to assist in the generation of animals capable of existence in solitude. Accordingly, mammals contemplated by the present invention include but are not limited to humans, primates, livestock animals (e.g. pigs, sheep, cows, horses, donkeys), laboratory test animals (e.g. mice, rats, guinea pigs, hamsters, rabbits), companion animals (e.g. dogs, cats) and captured wild animals (e.g. foxes, kangaroos, deer). A particularly preferred host is a human, primate or livestock animal.

Accordingly, the present invention contemplates therapeutic and prophylactic use of AGT- 307, AGT-308, AGT-309, AGT-310 and/or AGT-311 expression products or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 genetic mutants and/or agonists or antagonists agents thereof.

The present invention contemplates, therefore, a method of modulating expression of AGT- 307, AGT-308, AGT-309, AGT-310 and/or AGT-311 in a mammal, said method comprising contacting the AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 genes with an effective amount of an agent for a time and under conditions sufficient to up- regulate, down-regulate or otherwise modulate expression of AGT-307, AGT-308, AGT- 309, AGT-310 andAGT-311.

Another aspect of the present invention contemplates a method of modulating activity of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 in a subject, said method comprising administering to said subject a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease AGT-307, AGT-308, AGT- 309, AGT-310 and/or AGT-311 activity or function.

Modulation of activity by the administration of an agent to a mammal can be achieved by one of several techniques, including, but in no way limited to, introducing into a mammal a proteinaceous or non-proteinaceous molecule which:

(i) modulates expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311;

(ii) functions as an antagonist of AGT-307, AGT-308, AGT-309, AGT-310 and/or

AGT-311; and/or

(iii) functions as an agonist of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT- 311.

The molecules which may be administered to a mammal in accordance with the present invention may also be linked to a targeting means such as a monoclonal antibody, which provides specific delivery of these molecules to the target cells.

A further aspect of the present invention relates to the use of the invention in relation to mammalian disease conditions. For example, the present invention is particularly useful in treating behavioral conditions or disorders such as anxiety and/or depression. Accordingly, another aspect of the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or sufficient to modulate the activity of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311.

In another aspect, the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 ox AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311.

An agent includes proteinaceous or non-proteinaceous molecules such as antibodies, natural products, chemical entities or nucleic acid molecules (including antisense molecules, sense molecules, ribozymes, ds-RNA, ss-RNA molecules or DNA-targeting molecules).

In accordance with these methods, AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT- 311 or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or agents capable of modulating the expression or activity of said molecules may be co-administered with one or more other compounds or other molecules. By "co-administered" is meant simultaneous administration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes. By "sequential" administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two types of molecules. These molecules may be administered in any order.

In yet another aspect, the present invention relates to the use of an agent capable of modulating the expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or a derivative, homolog or analog thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.

In still yet another aspect, the present invention relates to the use of an agent capable of modulating the activity of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or a derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.

A further aspect of the present invention relates to agents for use in modulating the expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-3 U or a derivative, homolog or analog thereof.

Yet another aspect relates to agents for use in modulating AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 activity or a derivative, homolog, analog, chemical equivalent or mimetic thereof.

Still another aspect of the present invention relates to AGT-307, AGT-308, AGT-309, AGT- 310 and/or AGT-3 U or derivative, homolog or analog thereof or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or derivative, homolog, analog, chemical equivalent or mimetic thereof for use in treating a behavioral condition or disorder.

In a related aspect of the present invention, the mammal undergoing treatment may be a human or an animal in need of therapeutic or prophylactic treatment.

Accordingly, the present invention contemplates in one embodiment a composition comprising a modulator of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 expression or AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 activity and one or more pharmaceutically acceptable carriers and/or diluents. In another embodiment, the composition comprises AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or a derivative, homolog, analog or mimetic thereof and one or more pharmaceutically acceptable carriers and/or diluents. For brevity, all such components of such a composition are referred to as "active components".

The compositions of active components in a form suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. In all cases, the foπn must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

The carrier can be a solvent or other medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.

The preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active components in the required amount in the appropriate solvent with optionally other ingredients, as required, followed by sterilization by, for example, filter sterilization, irradiation or other convenient means. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof. When AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 are suitably protected, they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 μg and 2000 mg of active compound.

The tablets, troches, pills, capsules and the like may also contain the following: A binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and formulations. Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired as herein disclosed in detail.

The principal active component may be compounded for convenient and effective administration in sufficient amounts with a suitable pharmaceutically acceptable carrier in dosage unit form. A unit dosage form can, for example, contain the principal active component in amounts ranging from 0.5 μg to about 2000 mg. Expressed in proportions, the active compound is generally present in from about 0.5 μg to about 2000 mg/ml of carrier. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.

In general terms, effective amounts of AGT-307, AGT-308, AGT-309, AGT-310 and AGT- 311 or AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 will range from 0.01 ng/kg/body weight to above 10,000 mg/kg/body weight. Alternative amounts range from 0.1 ng/kg/body weight to above 1000 mg/kg/body weight. The active ingredients may be administered per minute, hour, day, week, month or year depending on the condition being treated. The route of administration may vary and includes intravenous, intraperitoneal, sub-cutaneous, intramuscular, buccal, intranasal, via suppository, via infusion, via drip, orally or via other convenient means.

The pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of modulating AGT-307, AGT-308, AGT-309, AGT-310 andAGT-311 expression or AGT- 307, AGT-308, AGT-309, AGT-310 and AGT-311 activity. The vector may, for example, be a viral vector.

Still another aspect of the present invention is directed to antibodies to AGT-307, AGT- 308, AGT-309, AGT-310 and AGT-311 and their derivatives and homologs insofar as AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 are proteins. Such antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or may be specifically raised to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or derivatives or homologs thereof. In the case of the latter, AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or their derivatives or homologs may first need to be associated with a carrier molecule. The antibodies and/or recombinant AGT-307, AGT-308, AGT-309, AGT-310 and AGT- 311 or their derivatives of the present invention are particularly useful as therapeutic or diagnostic agents. An antibody "to" a molecule includes an antibody specific for said molecule.

AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 and their derivatives can be used to screen for naturally occurring antibodies to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 which may occur in certain autoimmune diseases. Alternatively, specific antibodies can be used to screen for AGT-307, AGT-308, AGT-309, AGT-310 and AGT- 311. Techniques for such assays are well known in the art and include, for example, sandwich assays and ELISA. Antibodies to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 of the present invention may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to the AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or may be specifically raised to these gene products. In the case of the latter, the AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 protein may need first to be associated with a carrier molecule. Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies. The antibodies of this aspect of the present invention are particularly useful for immunotherapy and may also be used as a diagnostic tool or as a means for purifying AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

For example, specific antibodies can be used to screen for AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 proteins. The latter would be important, for example, as a means for screening for levels of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 in a cell extract or other biological fluid or purifying AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 made by recombinant means from culture supernatant fluid. Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays and ELISA.

It is within the scope of this invention to include any second antibodies (monoclonal, polyclonal or fragments of antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available antiimmunoglobulin antibody. An antibody as contemplated herein includes any antibody specific to any region of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

Both polyclonal and monoclonal antibodies are obtainable by immunization with the enzyme or protein and either type is utilizable for immunoassays. The methods of obtaining both types of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311, or antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any of the known immunoadsorbent techniques. Although antibodies produced by this method are utilizable in virtually any type of immunoassay, they are generally less favoured because of the potential heterogeneity of the product.

The use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art. (See, for example, Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981; Kohler and Milstein, Nature 256: 495-499, 1975; Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976.)

Another aspect of the present invention contemplates a method for detecting AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or a derivative or homolog thereof in a biological sample from a subject, said method comprising contacting said biological sample with an antibody specific for AGT-307, AGT-308, AGT-309, AGT-310 and AGT- 311 or their antigenic derivatives or homologs for a time and under conditions sufficient for a complex to form, and then detecting said complex.

The presence of the complex is indicative of the presence of AGT-307, AGT-308, AGT- 309, AGT-310 and AGT-311. This assay may be quantitated or semi-quantitated to determine a propensity to develop obesity or other conditions or to monitor a therapeutic regimen.

The presence of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 may be accomplished in a number of ways such as by Western blotting and ELISA procedures. A wide range of immunoassay techniques are available as can be seen by reference to U.S. Patent Nos. 4,016,043, 4,424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.

Sandwich assays are among the most useful and commonly used assays. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody- AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 complex, a second antibody specific to the AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 , labeled with a reporter molecule capable of producing a detectable signal, is then added and incubated, allowing time sufficient for the formation of another complex of antibody-AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 -labeled antibody. Any unreacted material is washed away, and the presence of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of hapten. Variations on the forward assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, including any minor variations as will be readily apparent. In accordance with the present invention, the sample is one which might contain AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 including cell extract, tissue biopsy or possibly serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid. The sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.

The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs or microplates, or any other surface suitable for conducting an immunoassay. The binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex to the solid surface which is then washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g. from room temperature to about 37°C) to allow binding of any subunit present in the antibody. Following the incubation period, the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311. The second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the antibody. Alternatively, a second labelled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.

By "reporter molecule" as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative. The most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.

In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, β-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labelled antibody is added to the first antibody hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen- antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample. A "reporter molecule" also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.

Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody absorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope. As in the EIA, the fluorescent-labelled antibody is allowed to bind to the first antibody- hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength. The fluorescence observed indicates the presence of the hapten of interest. Immunofluorescence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.

Suitable fluorochromes include, but are not limited to, fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC)₅ R-Phycoerythrin (RPE), and Texas Red. Other exemplary fluorochromes include those discussed by International Patent

Publication No. WO 93/06121. Reference also may be made to the fluorochromes described in U.S. Patent Nos. 5,573,909 and 5,326,692. Alternatively, reference may be made to the fluorochromes described in U.S. Patent Nos. 5,227,487, 5,274,113, 5,405,975, 5,433,896, 5,442,045, 5,451,663, 5,453,517, 5,459,276, 5,516,864, 5,648,270 and 5,723,218. The most convenient fluorochome up to the present time is SYBR green.

The present invention also contemplates genetic assays such as involving, for example, PCR analysis to detect AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or their derivatives.

Real-time PCR is also particularly useful for assaying for particular genetic molecules.

SYBR green real-time PCR is particularly useful.

It is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of components, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

It must be noted that, as used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to a "compound" includes a single compound, as well as two or more compounds; reference to "an active agent" includes a single active agent, as well as two or more active agents; and so forth.

In describing and claiming the present invention, the following terminology are used in accordance with the definitions set forth below.

The terms "compound", "active agent", "pharmacologically active agent", "medicament",

"active" and "drug" are used interchangeably herein to refer to a chemical compound that induces a desired pharmacological and/or physiological effect. The terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" are used, then it is to be understood that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc. The term "compound" is not to be construed as a chemical compound only but extends to peptides, polypeptides and proteins as well as genetic molecules such as RNA, DNA and chemical analogs thereof. Reference to a "peptide", "polypeptide" or "protein" includes molecules with a polysaccharide or lipopolysaccharide component. The term "potentiator" is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which modulates the level of expression or level of activity of a nucleic acid molecule or its expression product differentially expressed or present in a communally-reared P. obesus separated from other P. obesus animals from the same community. The term "modulates" includes "up- regulating" and "down-regulating" expression or activity. Up-regulation encompasses increasing expression of a nucleic acid molecule as well as manipulating a component of the downstream signaling pathway. The term "antagonist" is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which down- regulates the level of expression of a nucleic acid molecule or the activity of its expression product. Down-regulation involves decreasing expression or the level of activity.

The present invention contemplates, therefore, compounds useful in up-regulating or down-regulating expression of a nucleic acid molecule or the activity of its expression product. The terms "modulating" or its derivatives, such as "modulate" or "modulation", are used to describe up- or down-regulation. The compounds are proposed to have an effect on modifying behavioral conditions such as anxiety or depression. Reference to a "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" includes combinations of two or more actives. A "combination" also includes multi-part such as a two-part pharmaceutical composition where the agents are provided separately and given or dispensed separately or admixed together prior to dispensation. The terms "effective amount" and "therapeutically effective amount" of an agent as used herein mean a sufficient amount of the agent to provide the desired therapeutic or physiological effect such as elevating or reducing the level of expression or activity. Undesirable effects, e.g. side effects, are sometimes manifested along with the desired therapeutic effect; hence, a practitioner balances the potential benefits against the potential risks in determining what is an appropriate "effective amount". The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, mode of administration and the like. Thus, it may not be possible to specify an exact "effective amount". However, an appropriate "effective amount" in any individual case may be determined by one of ordinary skill in the art using only routine experimentation.

By "pharmaceutically acceptable" carrier, excipient or diluent is meant a pharmaceutical vehicle comprised of a material that is not biologically or otherwise undesirable, i.e. the material may be administered to a subject along with the selected active agent without causing any or a substantial adverse reaction. Carriers may include excipients and other additives such as diluents, detergents, coloring agents, wetting or emulsifying agents, pH buffering agents, preservatives, and the like.

Similarly, a "pharmacologically acceptable" salt, ester, emide, prodrug or derivative of a compound as provided herein is a salt, ester, amide, prodrug or derivative that this not biologically or otherwise undesirable.

The terms "treating" and "treatment" as used herein refer to reduction in severity of the behavioral disorder or condition, prevention of the occurrence of symptoms of a behavioral disorder and improvement or remediation of conditions such as anxiety or depression.

The present invention provides, therefore, agents which antagonize or agonize (i.e. potentiate or activate) the subject differentially expressed nucleic acid molecules or their expression products. The present invention contemplates methods of screening for such agents comprising, for example, contacting a candidate drug with an expression product or mRNA or DNA encoding same. Such a molecule is referred to herein as a "target" or "target molecule". The screening procedure includes assaying (i) for the presence of a complex between the drug and the target, or (ii) an alteration in the expression levels of nucleic acid molecules encoding the target. One form of assay involves competitive binding assays. In such competitive binding assays, the target is typically labeled. Free target is separated from any putative complex and the amount of free (i.e. uncomplexed) label is a measure of the binding of the agent being tested to target molecule. One may also measure the amount of bound, rather than free, target. It is also possible to label the compound rather than the target and to measure the amount of compound binding to target in the presence and in the absence of the drug being tested.

Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a target and is described in detail in Geysen

(International Patent Publication No. WO 84/03564). Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with a target and washed. Bound target molecule is then detected by methods well known in the art. This method may be adapted for screening for non-peptide, chemical entities. This aspect, therefore, extends to combinatorial approaches to screening for target antagonists or agonists of the target.

Purified target can be coated directly onto plates for use in the aforementioned drug screening techniques. However, non-neutralizing antibodies to the target may also be used to immobilize the target on the solid phase. Antibodies specific for a target may also be useful as inhibitors such as in the treatment of anxiety or depression.

The present invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of specifically binding the target compete with a test compound for binding to the target or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants of the target.

Antibodies to a target may be polyclonal or monoclonal as described above although monoclonal antibodies are preferred. Antibodies may be prepared by any of a number of means. For the detection of a target, antibodies are generally but not necessarily derived from non-human animals such as primates, livestock animals (e.g. sheep, cows, pigs, goats, horses), laboratory test animals (e.g. mice, rats, guinea pigs, rabbits) and companion animals (e.g. dogs, cats). Generally, antibody based assays are conducted in vitro on cell or tissue biopsies. However, if an antibody is suitably deimmunized or, in the case of human use, humanized, then the antibody can be labeled with, for example, a nuclear tag, administered to a subject and the site of nuclear label accumulation determined by radiological techniques. The target antibody is regarded, therefore, as a marker targeting agent. Accordingly, the present invention extends to deimmunized forms of the antibodies for use in target imaging in human and non-human subjects.

Where an antibody is destined for use as a therapeutic agent such as to inhibit a target, it will need to be deimmunized with respect to the host into which it will be introduced (e.g. a human). The deimmunization process may take any of a number of forms including the preparation of chimeric antibodies which have the same or similar specificity as the monoclonal antibodies prepared according to the present invention. Chimeric antibodies are antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from immunoglobulin variable and constant region genes belonging to different species. Thus, in accordance with the present invention, once a hybridoma producing the desired monoclonal antibody is obtained, techniques are used to produce interspecific monoclonal antibodies wherein the binding region of one species is combined with a non-binding region of the antibody of another species (Liu et ah, Proc. Natl. Acad. Sci. USA 84: 3439-3443, 1987). For example, complementary determining regions (CDRs) from a non-human (e.g. murine) monoclonal antibody can be grafted onto a human antibody, thereby "humanizing" the murine antibody (European Patent No. 0 239 400; Jones et al, Nature 321: 522-525, 1986; Verhoeyen et al, Science 239: 1534-1536, 1988; Richmann et al, Nature 332: 323-327, 1988). In this case, the deimmunizing process is specific for humans. More particularly, the CDRs can be grafted onto a human antibody variable region with or without human constant regions. The non-human antibody providing the CDRs is typically referred to as the "donor" and the human antibody providing the framework is typically referred to as the "acceptor". Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e. at least about 85-90%, preferably about 95% or more identical. Hence, all parts of a humanized antibody, except possibly the CDRs, are substantially identical to corresponding parts of natural human immunoglobulin sequences. Thus, a "humanized antibody" is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin. A donor antibody is said to be "humanized", by the process of "humanization", because the resultant humanized antibody is expected to bind to the same antigen as the donor antibody that provides the CDRs. Reference herein to "humanized" includes reference to an antibody deimmunized to a particular host, in this case, a human host.

It will be understood that the deimmunized antibodies may have additional conservative amino acid substitutions which have substantially no effect on antigen binding or other immunoglobulin functions. Exemplary conservative substitutions may be made according to Table 4.

TABLE 4

Exemplary methods which may be employed to produce deimmunized antibodies according to the present invention are described, for example, in Richmann et ah, 1988, supra; European Patent No. 0 239 400; U.S. Patent No. 6,056,957, U.S. Patent No. 6,180,370, U.S. Patent No. 6,180,377.

Thus, in one embodiment, the present invention contemplates a deimmunized antibody molecule having specificity for an epitope recognized by a monoclonal antibody to a target wherein at least one of the CDRs of the variable domain of said deimmunized antibody is derived from the said monoclonal antibody to said target and the remaining immunoglobulin-derived parts of the deimmunized antibody molecule are derived from an immunoglobulin or an analog thereof from the host for which the antibody is to be deimmunized.

This aspect of the present invention involves manipulation of the framework region of a non-human antibody.

The present invention extends to mutants and derivatives of the subject antibodies but which still retain specificity for the target.

The terms "mutant" or "derivatives" includes one or more amino acid substitutions, additions and/or deletions.

As used herein, the term "CDR" includes CDR structural loops which covers to the three light chain and the three heavy chain regions in the variable portion of an antibody framework region which bridge β strands on the binding portion of the molecule. These loops have characteristic canonical structures (Chothia et al, J. MoI Biol. 196: 901, 1987; Chothia et al, J. MoI. Biol. 227: 799, 1992).

By "framework region" is meant region of an immunoglobulin light or heavy chain variable region, which is interrupted by three hypervariable regions, also called CDRs. The extent of the framework region and CDRs have been precisely defined (see, for example, Kabat et al, "Sequences of Proteins of Immunological Interest", U.S. Department of Health and Human Sciences, 1983). The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. As used herein, a "human framework region" is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework region of a naturally occurring human immunoglobulin. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs. The CDRs are primarily responsible for binding to an epitope of the target. As used herein, the term "heavy chain variable region" means a polypeptide which is from about 110 to 125 amino acid residues in length, the amino acid sequence of which corresponds to that of a heavy chain of a monoclonal antibody of the invention, starting from the amino-terminal (N-terminal) amino acid residue of the heavy chain. Likewise, the term "light chain variable region" means a polypeptide which is from about 95 to 130 amino acid residues in length, the amino acid sequence of which corresponds to that of a light chain of a monoclonal antibody of the invention, starting from the N-terminal amino acid residue of the light chain. Full-length immunoglobulin "light chains" (about 25 Kd or 214 amino acids) are encoded by a variable region gene at the NH₂-terminus (about 110 amino acids) and a K or λ constant region gene at the COOH-terminus. Full-length immunoglobulin "heavy chains" (about 50 Kd or 446 amino acids), are similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes, e.g. γ (encoding about 330 amino acids).

The term "immunoglobulin" or "antibody" is used herein to refer to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognized immunoglobulin genes include the K. λ, α. γ (IgG₁, IgG₂, IgG₃, IgG₄), δ. ε and μ constant region genes, as well as the myriad immunoglobulin variable region genes. One form of immunoglobulin constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of immunoglobulin chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to an antigen, and the constant regions are responsible for the antibody effector functions. In addition to antibodies, immunoglobulins may exist in a variety of other forms including, for example, Fv, Fab, Fab' and (Fab')₂.

The present invention also contemplates the use and generation of fragments of monoclonal antibodies produced by the method of the present invention including, for example, Fv, Fab, Fab' and F(ab')₂ fragments. Such fragments may be prepared by standard methods as for example described by Coligan et al. (1991-1997, supra). The present invention also contemplates synthetic or recombinant antigen-binding molecules with the same or similar specificity as the monoclonal antibodies of the invention. Antigen-binding molecules of this type may comprise a synthetic stabilized Fv fragment. Exemplary fragments of this type include single chain Fv fragments (sFv, frequently termed scFv) in which a peptide linker is used to bridge the N terminus or C terminus of a V_# domain with the C terminus or N-terminus, respectively, of a Vx, domain. ScFv lack all constant parts of whole antibodies and are not able to activate complement. Suitable peptide linkers for joining the V_# and Vi domains are those which allow the V_# and Y_L domains to fold into a single polypeptide chain having an antigen binding site with a three dimensional structure similar to that of the antigen binding site of a whole antibody from which the Fv fragment is derived. Linkers having the desired properties may be obtained by the method disclosed in U.S. Patent No 4,946,778. However, in some cases a linker is absent. ScFvs may be prepared, for example, in accordance with methods outlined in Krebber et al (J. Immunol. Methods 201(1): 35-55,1997). Alternatively, they may be prepared by methods described in U.S. Patent No 5,091,513, European Patent No 239,400 or the articles by Winter and Milstein (Nature 349: 293, 1991) and Plϋckthun et al. (In Antibody engineering: A practical approach, 203-252, 1996).

Alternatively, the synthetic stabilized Fv fragment comprises a disulphide stabilized Fv (dsFv) in which cysteine residues are introduced into the V_# and Vi domains such that in the fully folded Fv molecule the two residues will form a disulphide bond therebetween.

Suitable methods of producing dsFv are described, for example, in (Glockshuber et al,

Biochem. 29: 1363-1367, 1990; Reiter et al, J. Biol. Chem. 269: 18327-18331, 1994;

Reiter et al, Biochem. 33: 5451-5459, 1994; Reiter et al, Cancer Res. 54: 2714-2718, 1994; Webber et al, MoI. Immunol. 32: 249-258, 1995).

Also contemplated as synthetic or recombinant antigen-binding molecules are single variable region domains (termed dAbs) as, for example, disclosed in (Ward et al, Nature 341: 544-546, 1989; Hamers-Casterman et al, Nature 363: 446-448, 1993; Davies & Riechmann, FEBS Lett. 339: 285-290, 1994). Alternatively, the synthetic or recombinant antigen-binding molecule may comprise a "minibody". In this regard, minibodies are small versions of whole antibodies, which encode in a single chain the essential elements of a whole antibody. Suitably, the minibody is comprised of the V_# and V^ domains of a native antibody fused to the hinge region and CH3 domain of the immunoglobulin molecule as, for example, disclosed in U.S. Patent No 5,837,821.

In an alternate embodiment, the synthetic or recombinant antigen binding molecule may comprise non-immunoglobulin derived, protein frameworks. For example, reference may be made to (Ku & Schutz, Proc. Natl. Acad. ScI USA 92: 6552-6556, 1995) which discloses a four-helix bundle protein cytochrome b562 having two loops randomized to create CDRs, which have been selected for antigen binding.

The synthetic or recombinant antigen-binding molecule may be multivalent (i.e. having more than one antigen binding site). Such multivalent molecules may be specific for one or more antigens. Multivalent molecules of this type may be prepared by dimerization of two antibody fragments through a cysteinyl-containing peptide as, for example disclosed by (Adams et al, Cancer Res. 53: 4026-4034, 1993; Cumber et al, J. Immunol. 149: 120- 126, 1992). Alternatively, dimerization may be facilitated by fusion of the antibody fragments to amphiphilic helices that naturally dimerize (Plϋnckthun, Biochem 31: 1579- 1584, 1992) or by use of domains (such as leucine zippers jun and fos) that preferentially heterodimerize (Kostelny et al, J. Immunol. 148: 1547-1553, 1992). Multivalent antibodies are useful, for example, in detecting different forms of target.

The present invention contemplates any compound which binds or otherwise interacts with a target, or a component of a target signaling pathway resulting in potentiation, activation or uρ-regulation or antagonism or down-regulation of the target.

Another useful group of compounds is a mimetic. The terms "peptide mimetic", "target mimetic" or "mimetic" are intended to refer to a substance which has some chemical similarity to the target but which antagonizes or agonizes or mimics the target. The target in this case may be an expression product of a differentially expressed nucleic acid molecule. A peptide mimetic may be a peptide-containing molecule that mimics elements of protein secondary structure (Johnson et ah, "Peptide Turn Mimetics" in Biotechnology and Pharmacy, Pezzuto et ah, Eds., Chapman and Hall, New York, 1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions such as those of antibody and antigen, enzyme and substrate or scaffolding proteins. A peptide mimetic is designed to permit molecular interactions similar to the natural molecule. Peptide or non-peptide mimetics may be useful, for example, to activate a target or to competitively inhibit a target.

Again, the compounds of the present invention may be selected to interact with a target alone or single or multiple compounds may be used to affect multiple targets.

The target or fragment employed in screening assays may either be free in solution, affixed to a solid support, or borne on a cell surface. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant polynucleotides expressing the target or fragment, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. One may measure, for example, the formation of complexes between a target or fragment and the agent being tested, or examine the degree to which the formation of a complex between a target or fragment and a ligand is aided or interfered with by the agent being tested.

A substance identified as a modulator of target function or gene activity may be a peptide or non-peptide in nature. Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.

The designing of mimetics to a pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration, e.g. peptides are unsuitable active agents for oral compositions as they tend to he quickly degraded by proteases in the alimentary canal. Mimetic design, synthesis and testing is generally used to avoid randomly screening large numbers of molecules for a target property.

There are several steps commonly taken in the design of a mimetic from a compound having a given target property. First, the particular parts of the compound that are critical and/or important in deteπnining the target property are determined. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. Alanine scans of peptides are commonly used to refine such peptide motifs. These parts or residues constituting the active region of the compound are known as its "pharmacophore".

Once the pharmacophore has been found, its structure is modeled according to its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, x-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modeling process.

In a variant of this approach, the three-dimensional structure of a target is modeled. Modeling can be used to generate inhibitors which interact with the linear sequence or a three-dimensional configuration.

A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted onto it can conveniently be selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. Alternatively, where the mimetic is peptide-based, further stability can be achieved by cyclizing the peptide, increasing its rigidity. The mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.

The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g. agonists, antagonists, inhibitors or enhancers) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g. enhance or interfere with the function of a polypeptide in vivo. See, e.g. Hodgson (Bio/Technology 9: 19-21, 1991). In one approach, one first determines the three-dimensional structure of a target by x-ray crystallography, by computer modeling or most typically, by a combination of approaches. Useful information regarding the structure of a target may also be gained by modeling based on the structure of homologous proteins. An example of rational drug design is the development of HIV protease inhibitors (Erickson et ah, Science 249: 527-533, 1990). In addition, target molecules may be analyzed by an alanine scan (Wells, Methods Enzymol 202: 2699-2705, 1991). In this technique, an amino acid residue is replaced by Ala and its effect on the peptide's activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the important regions of the peptide.

Proteomics may be also be used to screen for components which interact with a target.

The present invention extends to a genetic approach to up-regulating or down-regulating expression of a gene encoding a target. Generally, it is more convenient to use genetic means to induce gene silencing such as pre- or post-transcriptional gene silencing. However, the general techniques can be used to up-regulate expression such as by increasing gene copy numbers or antagonizing inhibitors of gene expression.

The terms "nucleic acids", "nucleotide" and "polynucleotide" include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g. phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g. polypeptides), intercalators (e.g. acridine, psoralen, etc.), chelators, alkylators and modified linkages (e.g. α-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

Antisense polynucleotide sequences, for example, are useful in silencing transcripts of target genes. Expression of such an antisense construct within a cell interferes with target gene transcription and/or translation. Furthermore, co-suppression and mechanisms to induce RNAi or siRNA may also be employed. Alternatively, antisense or sense molecules may be directly administered. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells.

A variation on antisense and sense molecules involves the use of morpholinos, which are oligonucleotides composed of morpholine nucleotide derivatives and phosphorodiamidate linkages (for example, Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997). Such compounds are injected into embryos and the effect of interference with mRNA is observed.

In one embodiment, the present invention employs compounds such as oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules such as those encoding a target, i.e. the oligonucleotides induce pre-transcriptional or post- transcriptional gene silencing. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding the target gene transcription. The oligonucleotides may be provided directly to a cell or generated within the cell. As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding a target gene transcript" have been used for convenience to encompass DNA encoding the target, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of the subject invention with its target nucleic acid is generally referred to as "antisense". Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition." Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.

The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. In one example, the result of such interference with target transcript function is reduced levels of the target. In the context of the present invention, "modulation" and "modulation of expression" mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.

In the context of this invention, "hybridization" means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.

An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

"Complementary" as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a

DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus,

"specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.

According to the present invention, compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.

While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals.

In the context of the subject invention, the term "oligomeric compound" refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and honiologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such iriodified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.

While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those herein described.

The open reading frame (ORF) or "coding region" which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is a region which may be effectively targeted. Within the context of the present invention, one region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.

Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.

Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns", which are excised from a transcript before it is translated. The remaining (and, therefore, translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e. intron- exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA, As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may, therefore, fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

The antisense oligonucleotides may be administered by any convenient means including by inhalation, local or systemic means.

In an alternative embodiment, genetic constructs including DNA vaccines are used to generate antisense molecules in vivo. Furthermore, many of the preferred features described above are appropriate for sense nucleic acid molecules or for gene therapy applications to promote levels of targets.

Following identification of an agent which potentiates or antagonizes a target, it may be manufactured and/or used in a preparation, i.e. in the manufacture or formulation or a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals in a method of treatment or prophylaxis of inection. Alternatively, they may be incorporated into a patch or slow release capsule or implant.

Thus, the present invention extends, therefore, to a pharmaceutical composition, medicament, drug or other composition including a patch or slow release formulation comprising an agonist or antagonist of target activity or target gene expression or the activity or gene expression of a component of the target.

Another aspect of the present invention contemplates a method comprising administration of such a composition to a subject such as for treatment or prophylaxis of an infection or other disease condition. Furthermore, the present invention contemplates a method of making a pharmaceutical composition comprising admixing a compound of the instant invention with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients. Where multiple compositions are provided, then such compositions may be given simultaneously or sequentially. Sequential administration includes administration within nanoseconds, seconds, minutes, hours or days. Preferably, sequential administration is within seconds or minutes.

Another method includes providing a wild-type or mutant target gene function to a cell This is particularly useful when generating an animal model. Alternatively, it may be part of a gene therapy approach. A target gene or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. If a gene portion is introduced and expressed in a cell carrying a mutant target allele, the gene portion should encode a part of the target protein. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation calcium phosphate co-precipitation and viral transduction are known in the art.

Gene transfer systems known in the art may be useful in the practice of genetic manipulation. These include viral and non-viral transfer methods. A number of viruses have been used as gene transfer vectors or as the basis for preparing gene transfer vectors, including papovaviruses (e.g. SV40, Madzak et al, J. Gen. Virol. 73: 1533-1536, 1992), adenovirus (Berkner, Curr. Top. Microbiol. Immunol. 158: 39-66, 1992; Berkner et al, BioTechniqves 6; 616-629, 1988; Gorziglia and Kapikian, J. Virol 66: 4407-4412, 1992; Quantin et al, Proc. Natl Acad. ScL USA 89: 2581-2584, 1992; Rosenfeld et al, Cell 68: 143-155, 1992; Wilkinson et al, Nucleic Acids Res. 20: 2233-2239, 1992; Stratford- Perricaudet et al, Hum. Gene Ther. 1: 241-256, 1990; Schneider et al, Nature Genetics 18: 180-183, 1998), vaccinia virus (Moss, Curr. Top. Microbiol Immunol 158: 25-38, 1992; Moss, Proc. Natl. Acad. Sd. USA 93: 11341-11348, 1996), adeno-associated virus (Muzyczka, Curr. Top. Microbiol. Immunol 158: 97-129, 1992; Ohi et al, Gene 89: 279- 282, 1990; Russell and Hirata, Nature Genetics 18: 323-328, 1998), herpesviruses including HSV and EBV (Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992; Johnson et al, J. Virol 66: 2952-2965, 1992; Fink et al, Hum. Gene Ther. 3: 11-19, 1992; Breakefield and Geller, MoI Neurobiol 1: 339-371, 1987; Freese et al, Biochem. Pharmacol 40: 2189-2199, 1990; Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996), Antiviruses (Naldini et al, Science 272: 263-267, 1996), Sindbis and Semliki Forest virus (Berglund et al, Biotechnology 11: 916-920, 1993) and retroviruses of avian (Bandyopadhyay and Temin, MoI Cell Biol. 4: 749-754, 1984; Petropoulos et al, J. Viol 66: 3391-3397, 1992], murine [Miller, Curr. Top. Microbiol. Immunol 158: 1-24, 1992; Miller et al, MoI Cell Biol. 5: 431-437, 1985; Sorge et al, MoI Cell Biol. 4: 1730-1737, 1984; and Baltimore, J Virol. 54: 401-407, 1985; Miller et al, J. Virol. 62: 4337-4345, 1988] and human [Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991; Helseth et al, J. Virol 64: 2416-2420, 1990; Page et al, J. Virol. 64: 5270-5276, 1990; Buchschacher and Panganiban, J Virol 66: 2731-2739, 1982] origin.

Non-viral gene transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer. Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery, allowing one to direct the viral vectors to particular cells. Alternatively, the retroviral vector producer cell line can be injected into particular tissue. Injection of producer cells would then provide a continuous source of vector particles.

In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein and the resulting complex is bound to an adenovirus vector. The trimolecular complex is then used to infect cells. The adenovirus vector permits efficient binding, internalization and degradation of the endosome before the coupled DNA is damaged. For other techniques for the delivery of adenovirus based vectors, see U.S. Patent No. 5,691,198.

Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is non-specific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration.

If the polynucleotide encodes a sense or antisense polynucleotide or a ribozyme or DNAzyme, expression will produce the sense or antisense polynucleotide or ribozyme or DNAzyme. Thus, in this context, expression does not require that a protein product be synthesized. In addition to the polynucleotide cloned into the expression vector, the vector also contains a promoter functional in eukaryotic cells. The cloned polynucleotide sequence is under control of this promoter. Suitable eukaryotic promoters include those described above. The expression vector may also include sequences, such as selectable markers and other sequences described herein.

The present invention is further described by the following non-limiting Examples.

EXAMPLE 1 Sequence of Psammomys obesus AGT-307

AGT-307 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.

The nucleotide sequence identified is as follows :-

GCTTATGGGCCCCTGGCCTCGCCCGGCCTCGGCACCTGGGGCCAGTGAAC AΆGAGCCCTGGCTGGATTTCAAACATGTGGGGCCTTGTGAGGCTCCTGTT GGCCTGGCTGGGTGGCTGGGGCTGCATGGGGCGCCTGGCAGCTCCAGTCC CAGCCTGGGCGGGGTCCCGGGGACACTCAGGCCCTACACTGCTGCGGACC CGAAGGAGCTGGGTCTGGAACCAGTTCTTTGTCATTGAGGAGTACTCTGG CCCAGAGCCTGTCCTTATCGGCAAGCTCCACTCAGACGTTGACCGGGGTG AGGGCCGCACCAAGTACCTGCTGACAGGGGAGGGGGCAGGTACTGTGTTT GTGATCGATGAGGCCACGGGCAATATCCATGTGACCAAGAGCCTGGACAG GGAGGAGAAGGCCCAGTATGTGCTCCTGGCGCAAGCTGTGGACCGTGCCT CTAACCGGCCACTGGAGCCTCCATCAGAGTTCATCATCAAAGTGCAAGAC ATCAΆTGACAΆTCCGCCAGTGTTTCCCCTTGGGCCCTACCACGCCACAGT GCCTGAGATGTCTAACGTCGGGACATCTGTAATCCAAGTAACTGCCCACG ATGCTGATGATCCCAGCTATGGGAACAGTGNCCAAGCTGGTGTACACAGT GCTGGATGGACTCCCTTTCTTCTCTGTGGACCCCAGACTGGAGTGGTTCG TACAGCCATCCCCAACATGNACCGGGAΆACCCAAAANNANTTCTNGGTGG TGATTCAAGCCAAGGATATGGGTGGCCACATGGGGGGGCTGTCAGGCAGC ACTACAGTAACAGTCACCCTCAGCGATGTCAATGACAACCCCCCCAAGTT CCCTCAGAGTCTATACCAGTTNTCTGTGGTGGAGACAGCTGGCCCTGGAA CCCTGGTGGGCCGGCTGAAGGCCCAGGACCCAGACCTAGGGGACAACGCC CTAATGGCATACAGCATCCTGGATGGGGAAGGATCAGAGGCCTTCAGCAT TAGCACAGACTCCCAGGGTCAGGATGGGCTGCTTACTGTCCGCAAGGCCC TGGACTTCGAGACCCGCCGTTCTTATACCTTCCGTGTAGAAGCCACCAAC ACCCTCATCGACCCAGCCTATCTGCGCCGAGGTCCCTTCAAGGATGTGGC GTCGGTGCGAGTGGCTGTGCAGGACGCCCCGGAGCCACCTGCCTTCACCC AGGCCGCCTACCACCTGACAGTACCTGAAAACAAGGCTCCAGGGACCCTG GTGGGCCAGATCTCAGCCAGTGACCTGGACTCGCCGGCCAGTCCCATCCG ATACTCCATCCTTCCCCACTCGGACCCTGAGCGCTGCTTTTCCATCGAGC CCGAAGATGGCACTATCCGAACAGCGGTGCTCCTGGACCGCGAGGCTCGT GTCTGGCACAACCTCACCGTGCTCGCCACAGAGCTGGACAGCTCTGCACA GTCTTCCCGTGTGCAAGTGGCCATCCAGACCCTGGATGAAAATGACAATG CTCCACAGCTG EXAMPLE 2 AGT-S '07 sequence homology

Compression of SEQ ID NO:1 revelaed it shared some level of sequence identity with the nucleotide sequences encoding the following proteins:

Mus musculus Cadherin-like 24 (Cdh24) Homo sapiens Cadherin-like 24 (Cdh24 Drosophila melanogaster Cadherin-N (CadN)

EXAMPLE 3 AGT-307 gene expression

Cadherin-24 was recently discovered in a screen of a breast cancer cell line using redundant primers to amplify novel cadherin gene family members. The cadherin-24 gene is found on chromosome 14pll.2. Sequence homology analysis indicates that cadherin-24 is a member of the type II cadherin gene family and exhibits significant amino acid homology to the type II cadherin genes cadherin- 11 (57%) and cadherin-8 (55%). Two alternatively spliced mRNA transcripts have been identified for cadherin-24 (Katafiasz et al. J. Biol. Chem. 278 (30):27513-27519, 2003). The short form is the predominant isoform expressed and is found in a wide range of tissues including brain, heart and skeletal muscle. The short isoform of cadherin-24 mRNA contains a 2346 nucleotide open reading frame that encodes a 781 amino acid peptide. Domain analysis indicates that the predicted protein contains 5 C-terminal extracellular calcium binding domains, a transmembrane domain and a highly conserved N-terminal cytoplasmic domain. The long isoform of the cadherin-24 mRNA contains a 2460 nucleotide open reading frame that encodes an 819 amino acid peptide. The long isoform contains an extra 114 nucleotide exon that inserts 38 amino acids into the predicted fourth extracellular calcium binding domain. Overexpression studies in A431D cells demonstrated that both isoforms of cadherin-24 are expressed on the cell surface and can bind intracellular proteins α-catenin, β-catenin and p 120 catenin. Interestingly, overexperssion of both isoforms promoted aggregation of A431D cells. In addition, overexpression of both isoforms stabilised the α-catenin and β- catenin proteins. These observations are typical of type II cadherins and suggest that cadherin-24 plays a significant role in mediating cell-cell interactions (Wheelock & Johnson Annu Rev Cell Dev Biol. 19:207-35, 2003). Moreover, these findings suggest that the extra 38 amino acids found in the long isoform does not impair the activity of cadherin- 24.

EXAMPLE 4

AGT-307 gene expression in hypothalamus as measured by SYBR Green Real Time

PCR

AGT-307 gene expression was significantly higher in Day 2 (p=0.022) separated animals when compared to Day 0 control animals (Table 5). In addition, gene expression was significantly higher in Day 2 separated animals compared to Day 6 (p=0.011) and Day 8 (p=0.005) separated animals. The expression of AGT-307 was significantly elevated in this animal model of depression, which suggests that AGT-307 may be a target for the treatment of depression.

TABLE 5

EXAMPLE 5 AGT-307 gene expression in amygdala as measured by SYBR Green Real Time PCR

AGT-307 gene expression was significantly higher in Day 4 (p=0.044) separated animals when compared to Day 0 control animals (Table 6). In addition, gene expression was significantly higher in Day 6 separated animals compared to Day 0 (p=0.022) and separated animals.

TABLE 6

EXAMPLE 6

AGT-307 gene expression in different tissues as measured by SYBR Green Real Time

PCR

AGT-307 gene expression levels were higher in brain and stomach tissue (Table 7).

TABLE 7

Given the observed elevated expression of AGT-307 following social isolation in both hypothalamus and amygdala and the predominant expression in brain tissue, it is proposed that AGT-307 is a candidate gene involved in the pathogenesis of depression and anxiety. Furthermore, the role of AGT-307 in cell-cell interactions and the known relationship between cell-cell interactions, neuronal plasticity and remodelling in the pathogenesis of depression provides further support for a possible role for AGT-307 in the onset or resolution of depression and anxiety.

EXAMPLE 7 Sequence of Psammomys obesus AGT-308

AGT-308 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.

The nucleotide sequence identified is as follows :-

TTAAGTGTGAGATTGCCGTTGCTGCCTGCTCCTGTCTTAGGGCCTCAACATGTTGGTACACTTAT TTCGAGTCGGAATCCGGGGTGGTCCAGTCCTAGGATGGTCGCTAAAATCCTTGCGCTTCCAGACG TTCTCGGCCACCAGGTCCTCAGATGACTGTTTCAGCTCATGCCTCCTCCGGGCTGTGGCCCGGCT GCGGTCACAGCTCCGGACTCAΆCTCCCTCGAGCCCCACCAGCTTCCCGCCGGAGCCCCTCTACCT GGTATTGGGTTGGGGGGACCTTGGTGGTCCCTGCAGTGCTGTGGCAGCATCCCCGTTTCTGCCTT CGAGCACTATGTGAGGCCGAAGGGTCTCCTGGCCACCCCACACCCGGTGCCCTGGAGCTGCGCTT TAACTGGAGGCTGTTCTGGCATTTCCTTCACCCCCACCTGCTGGCCCTGGGGGTAGCCATTGTGT TGGCCTTGGGCGCCGCACTAGTGAATGTGCAGATCCCCTTGCTCCTCGGCCAGCTGGTGGAGATC GTGGCCAAGTACATGAGGGACCGCGTGGGGAGCTTCACTTCTGAGTCCAGTAGGCTCAGCACCCA GCTGCTCCTACTCTATGGTGTTCAGGGGCTGCTGACCTTCGGGTACCTAGTGCTGCTGTCCCACA TCGGTGAGCGCATGGCCATGGACATGCGGAAAGCCCTCTTCAGCTCCCTGCTCAGGCAAGACATT GCTTTCTTTGATGCCAAAAAGACAGGGCAGCTAGTGAGCCGCTTGACTACAGACGTGCAAGAGTT CAAGTCATCCTTCAAGCTTGTCATCTCACANGGACTGCGCAGCTGCACCCAAGGTGATCGGTAAC CCTGGTGTCCCTGTCTTTGCTGTNCCCCGCGCCTTACACTGCTGCTGGGAGTCA

EXAMPLE 8 AGT-308 sequence homology

Compression of SEQ ID NO:2 revelaed it shared some level of sequence identity with the nucleotide sequences encoding the following proteins:

Mus musculus RIKEN cDNA 4833412N02 gene

Homo sapiens ATP -binding cassette, sub-family B (MDR/TAP), member 8 (ABCB8)

Rattus norvegicus similar to RIKEN cDNA 4833412N02

Danio rerio cDNA clone IMAGE:3816521 3¹ similar to TR:O95787 095787 ATP-binding cassette protein M-ABCl Caenorhabditis elegans HAlF transporter, PGP related

Hordeum vulgare tonoplast ABC transporter IDI7

Triticum aestivum cDNA clone WHE2058_C08_F16

Arabidopsis thaliana P-glycoprotein, putative (AtI gl 0680)

Vitis vinifera cDNA clone CAB40007_Ib_Rb_C12 EXAMPLE 9 AGT-308 gene expression

ATP-binding cassette, subfamily B, member 8 (ABCB 8) belongs to the ATP-binding cassette (ABC) superfamily of transporter proteins. The ABC superfamily is comprised of a large group of evolutionary conserved proteins and consists of eight subfamilies: ABCl, MDR/TAP, CFTR/MRP, ALD, OABP, GCN20, WHITE and ANSA (Kerb et al, Pharmacogenomics 2:51-64, 2001). The ABC proteins are characterised by the presence of transmembrane domains (TMDs) and highly conserved nucleotide-binding domains (NBDs), and are involved in the energy-dependent transport of a wide range of substrates across membranes. In eukaryotes, ABC genes typically encode 'full length' or 'half length' molecules. Full length molecules consist of four domains, which include two ATP- binding segments and two transmembrane (TM) regions. The half-molecule contains one ATP-binding and one TM domain (Hyde et al, Nature 346:362-365, 1990). Full length transporter molecules are usually found in the plasma membrane whereas half length molecules are typically found in subcellular organelles. Extensive studies have been carried out in many members of this superfamily as mutations of some human ABC proteins are known to be causative in inherited diseases. For example, mutation to the chloride channel CFTR gives rise to cystic fibrosis (Allikmets et al Nat. Genet., 15:236- 246, 1997). Another extensively studied ABC protein is the mammalian full length P- glycoprotein, whose expression contributes to multidrug resistance (Gros et al., Nature 323:728-731, 1986). P-glycoprotein is encoded by the ABCBl gene, which belongs to the MDR/TAP subfamily.

Members of the MDR/TAP subfamily include the ATP-binding cassette, subfamily B (ABCB) and the transporter associated with antigen processing (TAP) (Saito et al., J. Hum. Genet. 47:38-50, 2002). The TAP molecule is comprised of two subunits (TAPl and TAP2) and provides peptides to major histocompatibility complex (MHC) I molecules in the endoplasmic reticulum (Neefjes et ah, Science 261 :769-771, 1993). Comprising the ABC subfamily are seven proteins: ABCBl, ABCB4, ABCB7, ABCB8, ABCB9, ABCBlO and ABCBI l. In an attempt to identify EST cDNAs that encoded previously unknown human ABC proteins, Hogue et al, (J. MoI. Biol. 285:379-389, 1999) compared conserved motif regions of human ABCBl against the EST nucleotide database. The conserved protein sequences, known as Walker A (GX₄GKTT), Walker B (LILDE) and SGGQ signature motifs, are characterised to members of the ABC superfamily, distinguishing them from other ATP-binding domains. ABCB8 was identified in a screen of an acute lymphoblastic leukaemia cDNA library using the cDNA insert of one such identified EST clone as a probe (Hogue et al, J. MoI. Biol. 285:379-389, 1999).

Human ABCB8 cDNA has an open reading frame of 2154 base pairs that encodes a 718 amino acid peptide. The expected mass of 77.9 kDa is predicted to contain six hydrophobic membrane spanning regions (Hogue et ah, J. MoI. Biol. 285:379-389, 1999), followed by the Walker A, Walker B and SGGQ signature motifs. Within ABCB8 reside four potential N-linked consensus glycosylation motifs (NXS/T), in addition to a region consisting of the VVQEALD P-glycoprotein core epitope. The ABCB8 protein has been classed as an ABC half-molecule, as it consists of one TM domain and one ATP-binding domain (Klein et al, Biochem. BiophysActa, 1461: 237-262, 1999).

Sequence homology analysis of known ABC proteins indicates that ABCB8 exhibits significant amino acid similarity to TAP2 (59%), ABCBl (58%) and TAPl (57%).

However, the function of AB CB 8 cannot be accurately predicted since ABC proteins can show sequence similarities and yet be functionally divergent. An EST corresponding to

ABCB8 has been mapped to chromosome 7q35-q36 (Allikmets et al, Hum. Molec. Genet.

5:1649-1655, 1996). Somatic cell hybrid analysis using oligonucleotide primers specific to ABCB8 cDNA confirmed the localisation of this gene to chromosome 7 (Hogue et al, J.

MoI. Biol. 285:379-389, 1999). Currently, there are no obvious disease candidates associated with the ABC gene at 7q35-q36. Multiple tissue Northern Blot analysis has been performed to determine mRNA expression levels of ABCB 8 in human tissues (Hogue et al, J. MoI Biol. 285:379-389, 1999). Of the 23 different tissues examined, all show a hybridisation signal positive for ABCB8. These results indicate that ABCB8 is most likely expressed to some extent in most or all human tissues. EXAMPLE 10

AGT-308 gene expression in hypothalamus as measured by SYBR Green Real Time

PCR

AGT-308 gene expression was significantly higher in Day 4 (p=0.002) separated animals when compared to Day 0 control animals (Table 8). In addition, gene expression was significantly higher in Day 4 separated animals compared to Day 6 (p=0.021) and Day 8 (p=0.013) separated animals. The expression of AGT-308 was significantly elevated in this animal model of depression, which suggests that AGT-308 may be a target for the treatment of depression.

TABLE 8

EXAMPLE 11 AGT-308 gene expression in amygdala as measured by SYBR Green Real Time PCR

AGT-308 gene expression was significantly higher in Day 6 (p=0.023) separated animals when compared to Day 0 control animals (Table 9).

TABLE 9

EXAMPLE 12

AGT-308 gene expression in different tissues as measured by SYBR Green Real Time

PCR

AGT-308 gene expression levels were higher in brain stem and adrenal tissue (Table 10).

TABLE 10

AGT-308 exhibits elevated expression in the hypothalamus and amygdala of socially isolated P. obesus. These findings, coupled with significant expression in brain tissue suggest that AGT-308 is involved in the pathophysiology of depression and anxiety. In addition, human AGT-308 protein is localised predominantly to the mitochondria and may be important to mitochondria homeostasis, a process critical to neuronal tissue meeting its high energy requirements. Elevated AGT-308 expression may therefore regulate neuronal survival which supports a putative role for AGT-308 in depression and anxiety.

EXAMPLE 13

Sequence ofPsammotnys obesus AGT-S 09

AGT-309 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.

The nucleotide sequence identified is as follows :-

AAAAGGTTCTGGGCATGTTTCCAGATACCACCTACATGGTGGTGAGGTGGGGGGAGGAAACTTCATTAACATT ATATGCATAATCTCTCCTTGTACTAATAAAGCTTATCAGCAGCATAAAGCTTAGCAAAATCTTTCCTATCTAA

CCACATTAAAGCAGGCAGTGTCAACTCAAGCCATGGCATAGCGGATAGTGTCTATAAGGTGGCCCAGCACTAT GCAGATGCATGTAGCAAGGTTATGCATGCTAACCTTGTTCTCTCTGCTACCCTGAACTACAAGCTGCAGAAAC

AATACTGCTGCCAGAAAAAAGTTCTGGTTGCCACAGTTCCTAGTGAAACCAGATCTAATAGCAGCTTTGGGTT AAACTCAGCATATTTAΆGTGGAAAAAATGTG

EXAMPLE 14

AGT-309 sequence homology Compression of SEQ ID NOs: 1 to 3 revelaed it shared some level of sequence identity with the nucleotide sequences encoding the following proteins:

Mouse BAC clone RP23-455E11 and BAC clone RP23-4006 both from chromosome 3.

EXAMPLE 15

AGT-309 gene expression as measured by SYBR Green Real Time PCR in the hypothalamus

AGT-309 gene expression significantly higher in Day 4 (p=0.004) separated animals when compared to Day 0 control animals (Table 11). In addition, gene expression significantly higher in Day 4 separated animals compared to Day 6 (p=0.001) and Day 8 (p=0.005) separated animals. The expression of AGT-309 was significantly elevated in this animal model of depression, which suggests that AGT-309 may be a target for the treatment of depression.

TABLE 11

EXAMPLE 16 Sequence of Psammomys obesus AGT-310

AGT-310 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.

The nucleotide sequence identified is as folio ws:-

TTCCCGGGATATCGTCGACCCACGCGTCCGGCGGCGCAGGCGCCAAGTCGAGCAGAGCGTGGAGCGGAGGGCG GGCAGCCGCGCTCCGGGCCGGGGTCCCGAGGGAGCAGATCCTCCCCAGCATGGCCCTTGGTGCTACAGTCGTG

GCAGGCTCTGGGCCGGGGCACCAAGGGGGCACTGGATGACTCCCCAGTTCCGGGACCCTGCCATCTATGACTC

GGCGCCCATGGGCCCCCCGGGCTCCCCGTACATGGGCAGCCCCGCCGTGCGACCCGGCCTGGCCCCCGCGGGC CCACCGCTCCCGCGCGGAGCCGCAGTGCCAAGAGGAGGAAGATGGCTGACAAAATCCTCCCTCAAAGGATTCG

CGGAAGCGAGTGGACATCCAGGAGGCCCTGAAGAGGCCCATGAAGCAAAAGCGAAAGCTGCGCCTTTACATCT

GAGCTGGACAAAGACCTTTATGGCCCGGACAACCACCTCGTCGAGTGGCACCGGACACCTACAACCCAGGAGA CGGATGGGTTCCAAGTGAAGAGGCCAGGGGACCTGAGTGTGCGTTGCACCCTGCTCCTTATGCTGGACTATCA GCCTCCCCAGTTCAAACTGGACCCCCGCTTAGCCCGGCTGCTGGGGTTGCATACCCAGAGCCGCTCAGCCATT GTCCAGGCGCTGTGGCAGTATGTGΆAGACCAACAGGCTTCAΆGACTCCCATGACAAGGAATACATCAATGGAG ACAAGTACTTCCAGCAGATTTTTGACTGTCCCCGCCTGAAGTTCTCCGAGATTCCCCAGCGCCTCACAGCCCT

TGCTATGACATTGATGTGGAGGTAGAGGAGCC

EXAMPLE 17 AGT-310 sequence homology

Compression of SEQ ID NOs: 1 to 4 revelaed it shared some level of sequence identity with the nucleotide sequences encoding the following proteins:

Human SWI/SNF complex 60 KDa subunit (BAF60c) niRNA, Homo Sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3),

Mus Musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3)

Rattus Norvegicus LOC296732 similar to SWI/SNF-related matrix-associated actin- dependent regulator of chromatin d3; Rsc6p; mammalian chromatin remodelling complex BRGl -associated factor 6OC; Swp73-like protein; chromatin remodeling complex BAF60C subunit; SWI/SNF complex 60 kD

EXAMPLE 18 A GT-310 gene expression

BRGl/Brm-associated factor of 60 kDa, subunit c (BAF60c), also known as SWI/SNF- related, matrix associated, actin dependent regulators of chromatin 3 (SMARCD3), is a component of the SWI/SNF chromatin remodeling complex. The large multiprotein SWI/SNF (mating type switching/sucrose non-fermenting) complexes are a subfamily of ATP-dependent chromatin remodeling complexes that are involved in transcriptional control as well as in DNA replication, DNA repair and recombination (Wang et at., 1996, Peterson and Workman, 2000). The SWI/SNF complexes are evolutionarily conserved from yeast to human. Mammalian SWI/SNF-like complexes exist in multiple forms made up of 9-12 protein subunits referred to as BAFs (BRGl/Brm-associated factors), and central to the activity is either the ATPase BRGl or BRM that serves as the catalytic component.

The SWI/SNF complex can cooperate with nuclear receptors to modulate transcription. Consistent with its role in chromatin remodeling, BAF60c is localized primarily in the cell nucleus where it binds to several nuclear receptors and transcription factors of various families. BAF60c constitutes an important anchoring point by which the SWI/SNF complex is recruited to nuclear receptors and other transcription factors (Debril et ah, 2004). BAF60c binds to several nuclear receptors, such as RXRα, RORα, ERa, FXR, PP ARγ, steroidogenic factor 1 and liver receptor honiolog 1. In addition, B AF60c interacts with transcription factors such as certain homeobox, bZIP and helix-loop-helix. Therefore BAF60c is an important coregulator that is not only involved in chromatin modification but also serves as a bridging factor between transcription factors and the basal transcription machinery. The human BAF60c gene is located on chromosome 7 (7q35-36) (Ring et ah, 1998) and comprises 13 exons and 12 introns. There are two isoforms of the human BAF60c protein, recently renamed BAFόOcl and BAF60c2 (Debril et ah, 2004). They are identical except that the N-terminal 13 amino acids of BAFβOcl are replaced by a different 26 residue sequence in BAF60c2. Hence hBAF60cl is a 471 amino acid protein and hBAF60c2 is a 484 residue protein. In mice, only BAF60c2 is produced as there is a 4 nucleotide insertion disrupting the reading frame which would have encoded BAFόOcl.

Both isoforms of human BAFoOc are broadly expressed, with the highest levels in the central nervous system (Debril et ah, 2004). BAFβOcl is the predominant isoform in brain, spleen and trachea. BAF60c2 showed a higher expression than BAF60c2 in adipose tissue, skeletal muscle, lung, heart and thyroid. Debril and colleagues found that in mice, BAF60c mRNA is also highly enriched in the brain and cerebellum. In the cerebellum, BAF60c is expressed in nuclei that are involved in motor functions as well as in sensory motor learning and memory. BAF60c is highly expressed in Purkinje cells and in deep cerebellar nuclei. BAF60c is also expressed in cerebellar pedoncule, particularly in the vestibular nuclei which are involved in equilibrium and motricity. BAFoOc is broadly expressed in the primary and secondary motor cortex and in the hippocampus. A high expression was also observed in piriform cortex as well as olfactory tubercle and the adjacent anterior olfactory nuclei. This suggests that BAF60c could also be involved in olfactory activities

(Debril et ah, 2004).

EXAMPLE 19

AGT-310 gene expression as measured by SYBR Green Real Time PCR in the hypothalamus

AGT-310 gene expression was significantly higher in Day 4 (p=0.010) separated animals when compared to Day 0 control animals (Table 12), In addition, gene expression was significantly higher in Day 4 (p=0.033) separated animals compared to Day 8 separated animals. The expression of AGT-310 was significantly elevated in this animal model of depression, which suggests that AGT-310 may be a target for the treatment of depression.

TABLE 12

EXAMPLE 20 AGT-310 gene expression as measured by SYBR Green Real Time PCR in the amygdala

Although there was no change in gene expression between Day 0 and Day 2, Day 4, Day 6 and Day 8 separated animals (Table 13), there was a positive correlation between amygdala gene expression and total time moved (p=0.012, r²=0.136) and jumps (p=0.040, r²=0.094) in the open-field test (Figure 1).

TABLE 13

EXAMPLE 21

AGT-310 gene expression in different tissues as measured by SYBR Green Real Time

PCR

AGT 310 expression was present in the brain, fat and muscle tissues.

TABLE 14

AGT-310 expression was found to be elevated in the hypothalamus and amygdala of socially isolated P. obesus. These observations indicate that AGT-310 may play an important role in depression and anxiety. In addition, given that changes in gene expression are integral to the onset or resolution of depression and AGT-310 belongs to a family of transcription factors that may regulate the expression of genes critical to the response of P. obesus to the stress of social isolation these findings provide further support for a possible role for AGT-311 in the of depression and anxiety. EXAMPLE 22 Sequence of Psammomys obesus AGT-311

AGT-311 was identified using microarray analysis of prefrontal cortex in a depression time-course study of P. obesus.

The nucleotide sequence identified is as follows:-

CCCGGCCGCCGCAGCCCGCGCTGCCAGGGGACCGCGTCCCGCCCGAAGCCCCGTGCCTGGCCCGGGCTTGGTC CCCTCGCCCACGGGCCGTCTAGCCCCGGTTTCTCCTCTCTTCTCCCCTTCTCTCTCTCTCTCTCTCTCTCTCT CTCTCTCTCTCTCTCTCTCGTCCACCTAGACCCTGGCCAGTCACCAGCTCCCCCTGCCTCGGCGTCCCCACCC TCTGCACCCTAAGCTGCACCCCGGCGGCCGGCGCGGGGCCGCGGACCCGGCTGGAGATGCGAATCCTGCAGCG CTTCGTCGCGTGCGTCCAGCTCCTGTGCGTGTGTCGCCTGGACTGGGCTTATGGATACTACAGACAACAGAGA AAACTTGTTGAAGAGATTGGCTGGTCCTATACAGGTGCACTAAATCAAAAAAACTGGGGAAAGAAATATCCAA TATGTAATAGCCCAAAGCAGTCTCCTATTAATATTGATGAAGATCTTACACAAGTCAATGTGGAATCTTAAGA AACTGAAATTTCAGGGCTGGGAAAAGCATCTTTGGAAGACACGTTCATTCACAACACTGGGAAAACAGTGGAA ATAAATCTCACTAATGACTACTATCTCAGTGGAGGACTTTCNGAAAΆGATATTCAAGGCAAGCAAAATAACTT TTCACTGGGGAAAATGCAATGTGTCTTCTGAAGGATCAGAGCACAGTTTAGAAGGACAGAΆGTTCCCGCTTGA GATGCAAGTGTACTGCTTTGATGTGGACCGATTTTCAAGTTTTGAGGAAGCAGTTAAAGGAAAAGGGAGGTTA AGGGCTTTATCCATCTTATTCGAGGTTGGAATTGAAGAAAATTTGGATTACAAAGCCATTATTGATGGAATCG AGAGTGTTAGTCGTTTCGGGAAGCAGGCTGCCTTGGATCCGTTCATCCCGCAGAACCTTCTGCCAAACTCCAC TGACAAATΆTTACATTTACAACGGCTCATTGACATCTCCTCCCTGCACAGACACCGTTGAATGGATCATTTTT AAGGATACAGTTAGCATCTCTGAAAGCCAGCTGGCTGTATTTTGTGAAGTTCTCACAATGCAACAGTCTGGCT

CTCATATACTGGAAAGGGAAGAGATTCATGAAGCAGTGTGTAGTTCAGAGCTATGTCATGTTGATGGATTACC TACAAAACAATTTCCGAGANCACCAGTACAAGTTTNCCAGGCAGGTGTTTTCCTCATATACTGGAAAGGAAGA GATTCATGAAGCAGTGTGTAGTTCAGAACCAGAAAATGTGCAGGCTGACCCTGAAAATTACACCAGCCTTCTG GTCACATGGGAGAGACCTCGAGTTGTTTATGACACCATGATTGAGAAGTTTGCGGTGCTGTACCAACCACTGG AGGGAAATGACCAAACCAAGCATGAGTTTTTAACAGATGGCTATCAGGACTTGGTAACTATAAGATGAATTAC

TCACTCTAGATTTTGAGTGAAGTTGTTTCCAGGGAACATGGGTGTGATAAATGATGTCTGTAGTTAGAACTAA ATGCAAGAAGATCATGACTCGACATTATGAGGGGTGGACACATGCAGAAAACTTAGACACTGGACATTATTAG TGCACTCCCCTTTTATGATAAAGTGATGTAAAGAATAATTAAGCACTCTAAGTAAAATCTCACAGTTAGCCTG AGAATCTTACCTTGTTCACATTGTGCACCCTATACCACCACAAGAAAAAAAAAAAAAAAGGGCGGCCGCTCTA GAGTATCCCTCGAGGGGCCCANGCTTACGCGACCCAGCTTCTGACAAT

EXAMPLE 23 AGT-311 sequence homology

Compression of SEQ ID NOs: 1 to 5 revelaed it shared some level of sequence identity with the nucleotide sequences encoding the following proteins:

Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (PTPRZl), mRNA

Rattus norvegicus Protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (Ptprzl) Mus musculus Protein tyrosine phosphatase, receptor type Z, polypeptide 1 (Ptprzl)

EXAMPLE 24 AGT-311 gene expression

Tyrosine phosphatase receptor-type z (PTPRζ or RPTPβ), is expressed exclusively in the CNS in both neurons and glia (Shintani et al, Neurosci Lett 1998;247: 135-8). PTPRζ has significant homology with neuronal cell adhesion molecules (N-CAMs), which are involved in intercellular contact signalling in the brain (Levy et al, J Biol Chem. 268: 10573-81, 1993). PTPRζ expressed on the surface of glial cells binds the cell recognition molecule contactin on neurons, which leads to subsequent neurite outgrowth (Peles et al, Trends Biochem Sci 1998;23:121-4). In a study of PTPRζ deficient mice, widespread death of oligodendrocytes was observed (Harroch et al, Nat Genet 2002;32:411-4). While the exact functional role of PTPRζ is unknown, it has been implicated in neurite extension, neuronal migration, and synaptic plasticity (Peles et al, Trends Biochem Sci 1998;23:121-4, Holland et al, Curr Opin Neurobiol 1998;8:117-27)

The PTPRζ gene has been localised in humans to the chromosomal region 7q31.3, with the full length transcript encoding a 2307 amino acid chondroitin sulphate proteoglycan. The PTPRζ gene has three alternate splice variants including: a full length plasma membrane bound receptor form; a shortened form, with a large extracellular serine/glycine rich region deleted; and an extracellular secreted form, known as a phosphacan ((Peles et al, Trends Biochem Sci 1998;23:121-4). The full length receptor consists of two tandem intracellular phosphatase domains towards the C-terminal, linked via a single transmembrane domain to a long, heavily glycosylated, extracellular cysteine-free spacer. Towards the N-terminal is a fibronectin type III repeat followed by a domain homologous with the enzyme carbonic anhydrase (Peles et al, Trends Biochem Sci 1998;23:121-4).

A variety of molecules that interact with the extracellular region of PTPRζ have been identified. Among the ligands which bind to the extracellular region of PTPRζ are: the extracellular matrix protein tenascin, the heparin-binding neurite-promoting factor pleiotropin, contactin, and several N-CAMs from the Ig superfamily ( Shintani et al, Neurosci Lett 1998;247: 135-8, 3). PTPRζ can also bind in homophilic interactions with other PTPRζ proteins on neighbouring cells (Peles et al, Trends Biochem Sci 1998;23:121-4). It has recently been hypothesised that PTPRζ may exist in a dimeric state in cells, with the activity of the phosphatase domains dependent on the conformation of the dimer (Peles et al, Trends Biochem Sci 1998;23: 121-4). Binding to ligands which affect this conformation may therefore be a mechanism of regulation for PTPRζ enzymatic activity.

Our tissue distribution studies indicate that PTPRζ is expressed exclusively in the brain. These findings are consistent with other previous studies (Shintani et al, Neurosci Lett 1998;247: 135-8). So far, we have not found any evidence to link anxiety or depression to the PTPRζ chromosomal region. To date, no studies have been published indicating that PTPRζ is involved in mental illness, including anxiety and depression.

EXAMPLE 25

AGT-311 gene expression as measured by SYBR Green Real Time PCR in the prefrontal cortex AGT-311 gene expression was significantly lower in Day 4 (p=0.041) separated animals when compared to Day 0 control animals (Table 15).There was also a positive correlation between prefrontal cortex gene expression and total time spent in the inner region of the open field test (p=0.023, r²=0.157) (Figure 2). The expression of AGT-311 was significantly lowered in this animal model of depression, which suggests that AGT-311 may be a target for the treatment of depression.

TABLE 15

EXAMPLE 26

AGTS 11 gene expression as measured by SYBR Green Real Time PCR in the hypothalamus

AGT-311 gene expression was significantly lower in Day 6 (p=0.004) and Day 8 (p=0.015) separated animals when compared to Day 0 control animals (Table 16). The expression of AGT-311 was significantly lowered in this animal model of depression, which suggests that AGT-311 may be a target for the treatment of depression. TABLE 16

EXAMPLE 27 AGT-311 gene expression in different tissues as measured by SYBR Green Real Time

PCR

AGT 311 expression was found at high levels in the brain relative to other tissues examined.

TABLE 17

AGT-311 expression was found to be reduced in the prefrontal cortex following social isolation of P. obesus. In addition, AGT-311 expression is largely restricted to brain tissue. Furthermore, AGT-311 is known to participate in cell-cell interactions that are important to neuronal survival and remodelling. Given the importance of these processes to the depression these observations provides further support for a possible role for AGT-311 in the onset or resolution of depression and anxiety. BIBLIOGRAPHY

Adams et al, Cancer Res. 53: 4026-4034, 1993

Allikmets et al, Hum. Molec. Genet. 5:1649-1655, 1996

Allikmets et al, Nature Genet. 25:236-246, 1997

Altschul et al. (Nucl, Acids Res. 25: 3389, 1997

American Psychiatric Association, Diagnostic and statistical manual of mental disorders. Washington, D.C. Assoc. Am. Psychiatr. 4^th edition, 1994

Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc, Chapter 15, 1994-1998

Baltimore, J Virol. 54: 401-407, 1985

Bandyopadhyay and Temin, MoI. Cell. Biol. 4: 749-754, 1984

Berglund et al, Biotechnology 11: 916-920, 1993

Berkner et al, BioTechniques 6; 616-629, 1988

Berkner, Curr. Top. Microbiol. Immunol. 158: 39-66, 1992

Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974

Breakefield and Geller, MoI Neurobiol 1: 339-371, 1987

Buchschacher and Panganiban, J. Virol 66: 2131-2139, 1982 Chothia et al, J MoI, Biol, 196: 901, 1987

Chothia et al, J. MoI. Biol 227: 799, 1992

Cumber et al, J. Immunol. 149: 120-126, 1992

Davies & Riechmann, FEBS Lett. 339: 285-290, 1994

Debril et al, J. Biol. Chem. 279:16677-16686, 2004

Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981

Drevets, .4rø7. Rev. Med 49: 341-361, 1998

Erickson et al, Science 249: 527-533, 1990

European Patent No. 0 239 400

Fink et al, Hum. Gene Ther. 3: 11-19, 1992 .

Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996

Freese et al, Biochem. Pharmacol 40: 2189-2199, 1990

Glockshuber et al, Biochem. 29:1363-1367, 1990

Gorziglia and Kapikian, J. Virol 66: 4407-4412, 1992

Gros et al, Nature 323:728-731, 1986 Hamers-Casterman et al, Nature 363: 446-448, 1993

Harroch et al, Nat Genet 32(3):4\ 1 -4, 2002

Helseth et al, J. Virol. 64: 2416-2420, 1990

Hodgson, Bio/Technology 9: 19-21, 1991

Hogue et al, J. Molec. Biol 285:379-389, 1999

Holland et al, Curr Opin Neurobiol 8(l):l7-27, 1998

Hyde et al, Nature 346362-365, 1990

Jesberger and Richardson, Biol. Psychiatry 20: 764-784, 1985

Jones et al, Nature 321: 522-525, 1986

Johnson et al, J. Virol 66: 2952-2965, 1992

Johnson et al, "Peptide Turn Mimetics" in Biotechnology and Pharmacy, Pezzuto et al, Eds., Chapman and Hall, New York, 1993

Kabat et al, "Sequences of Proteins of Immunological Interest", U.S. Department of Health and Human Sciences, 1983

Katafiasz et al. J. Biol Chem. 278 (30):27513-27519, 2003

Klein et al, Biochim Biophys Acta. 1461:237-62, 1999 Kerb et al, Pharmacogenomics 2:51-64, 2001

Kohler and Milstein, Nature 256: 495-499, 1975

Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976

Kostelny et al, J. Immunol. 148: 1547-1553, 1992

Krebber et al, J. Immunol. Methods 201 (1):35-55,1997

Ku & Schutz, Proc. Natl. Acad. Sci. USA 92: 6552-6556, 1995

Levy et al, J Biol Chem 268(14):10573-8l, 1993

Liu et al, Proc. Natl. Acad. Sci. USA 84: 3439-3443, 1987

Madzak et α/., J. Gen. Virol 73: 1533-1536, 1992

Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992

Marmur and Doty, J. MoI Biol 5: 109, 1962

Miller et al, MoI Cell. Biol 5: 431-437, 1985

Miller et al, J. Virol 62: 4337-4345, 1988

Miller, Curr. Top. Microbiol Immunol 158: 1-24, 1992

Moss, Curr. Top. Microbiol Immunol. 158: 25-38, 1992

Moss, Proc. Natl Acad. Sci. USA 93: 11341 - 11348, 1996 Murray and Lopez, Lancet 349: 1498-1504, 1997

Muzyczka, Curr. Top. Microbiol Immunol. 158: 97-129, 1992

Naldini et al, Science 272: 263-267, 1996

Neefjes et al, Science 261:769-771, 1993

Ohi et al, Gene 89: 279-282, 1990

Quantin et al, Proc. Natl Acad. Sci. USA 89: 2581-2584, 1992

Page et al, J. Virol 64: 5270-5276, 1990

Peles etal, Trends Biochem Sci 23(4):121-4, 1998

Peterson, CL. and Workman, J.L, Curr Opin Genet Dev. 70:187-92, 2000

Petropoulos et al, J. Viol. 66: 3391-3397, 1992

Plϋnckthun, Biochem 31: 1579-1584, 1992

Plϋckthun et al, Antibody engineering: A practical approach, 203-252, 1996

Reiter et al, J. Biol Chem. 269: 18327-18331, 1994

Reiter et al, Biochem. 33: 5451-5459, 1994

Reiter et al, Cancer Res. 54: 2714-2718, 1994 Richmann et al, Nature 332: 323-327, 1988

Ring et al, Genomics. 57:140-143, 1998

Rosenfeld et al, Cell 68: 143-155, 1992

Russell and Hirata, Nature Genetics 18: 323-328, 1998

Saito et al, J Hum Genet. ¥7:38-50, 2002

Schneider et al, Nature Genetics 18: 180-183, 1998

Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991

Shintani et al, Neurosci Lett 247(2-3):135-8, 1998

Sorge et al, MoI. Cell. Biol 4: 1730-1737, 1984

Stratford-Perricaudet et al, Hum. Gene Ther. 1: 241-256, 1990

Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997

U.S. Patent No 5,091,513

Verhoeyen et al, Science 239: 1534-1536, 1988

Wang et al, Genes Dev. 7(9:2117-30, 1996

Ward et al, Nature 347;544-546, 1989

Webber etal, MoI Immunol. 32: 249-258, 1995 Wells, Methods Enzymol. 202: 2699-2705, 1991

Wheelock, MJ. and Johnson, K.R. Annu Rev Cell Dev Biol 19:207-35, 2003

Wilkinson et al, Nucleic Acids Res, 20: 2233-2239, 1992

Willner, Handbook of Depression and Anxiety, (J.A. den Boer and J. M. Ad. Sisten, eds.), Marcek Dekker, New York:291 -316, 1994

Winter and Milstein, Nature 349: 293, 1991

Claims

CLAIMS:

1. A differentially expressed isolated nucleic acid molecule encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NO-.l (AGT-307) or SEQ ID NO.2 (AGT-308) or SEQ ID NO.3 (AGT-309) or SEQ ID NO:4 (AGT-310) or SEQ ID NO:5 (AGT-311) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 and/or is capable of hybridizing to one or more of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or a complementary form thereof under low stringency conditions at 42⁰C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.

2. The nucleic acid molecule of Claim 1 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:1 (AGT-307) or a derivative, homolog or mimetic thereof or having at least about 90% similarity to all or part of SEQ ID NO:1 or a nucleotide sequence capable of hybridizing to SEQ ID NO:1 or its complementary form under high stringency conditions.

3. The nucleic acid molecule of Claim 1 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:2 (AGT-308) or a derivative, homolog or mimetic thereof or having at least about 90% similarity to all or part of SEQ ID NO:2 or a nucleotide sequence capable of hybridizing to SEQ ID NO:2 or its complementary form under high stringency conditions.

4. The nucleic acid molecule of Claim 1 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 3 (AGT-309) or a derivative, homolog or mimetic thereof or having at least about 90% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO:3 or their complementary forms under high stringency conditions.

5. The nucleic acid molecule of Claim 1 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:4 (AGT-310) or a derivative, homolog or mimetic thereof or having at least about 90% similarity to all or part of SEQ ID NO:4 or a nucleotide sequence capable of hybridizing to SEQ ID NO:4 or its complementary form under high stringency conditions.

6. The nucleic acid molecule of Claim 1 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:5 (AGT-311) or a derivative, homolog or mimetic thereof or having at least about 90% similarity to all or part of SEQ ID NO: 5 or a nucleotide sequence capable of hybridizing to SEQ ID NO:5 or its complementary form under high stringency conditions.

7. The nucleic acid molecule of any one of Claims 1 to 6, wherein the homolog is a human homolog.

8. An isolated expression product or a derivative, homolog, analog or mimetic thereof which is produced in larger or lesser amounts in hypothalamus tissue of a communally- reared P. obesus animal separated from other P. obesus animals from the same community.

9. The isolated expression product of Claim 8 selected from the list consisting of:-

(iii) AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 or a derivative, homolog, analog, chemical equivalent or mimetic thereof;

(iv) a protein encoded by a nucleotide sequence comprising SEQ ID NO.l or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 90% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(v) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO:2 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 90% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(vi) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO:3 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 90% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(vii) a protein comprising an amino acid sequence substantially as set forth in SEQ ID NO:4 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 90% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(viii) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO:5 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;

(ix) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO.l or its complementary form or a derivative, homolog or analog thereof under high stringency conditions;

(x) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:2 or its complementary form or a derivative, homolog or analog thereof under high stringency conditions;

(xi) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO: 3 or its complementary forms or a derivative, homolog or analog thereof under high stringency conditions; (xii) protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:4 or its complementary forms or a derivative, homolog or analog thereof under high stringency conditions; and

(xiii) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO:5 or its complementary form or a derivative, homolog or analog thereof under high stringency conditions.

10. The expression product of Claim 8 or 9, wherein the homolog is a human homolog.

11. A method for modulating expression of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 in a mammal, said method comprising contacting the AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 gene with an effective amount of a modulator of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 expression for a time and under conditions sufficient to up-regulate or down-regulate or otherwise modulate expression of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311.

12. A method of modulating activity of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 in a mammal, said method comprising administering to said mammal a modulating effective amount of a molecule for a time and under conditions sufficient to increase or decrease AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 activity. The molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or its ligand.

13. A method of modulating expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 in.a mammal, said method comprising contacting the AGT-307, AGT-308, AGT-309, AGT-310 and/ or AGT-311 genes with an effective amount of an agent for a time and under conditions sufficient to up-regulate, down-regulate or otherwise modulate expression of AGT-307, AGT-308, AGT-309, AGT-310 and/ 'or AGT-311.

14. A method of modulating activity of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 in a subject, said method comprising administering to said subject a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 activity or function.

15. A method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or sufficient to modulate the activity of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311.

16. A method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT- 311 or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311.

17. Use of an agent capable of modulating the expression of AGT-307, AGT-308, AGT- 309, AGT-310 and/or AGT-311 or a derivative, homolog or analog thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.

18. Use of an agent capable of modulating the activity of AGT-307, AGT-308, AGT- 309, AGT-310 and/or AGT-311 or a derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.

19. Use of AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or derivative, homolog or analog thereof or AGT-307, AGT-308, AGT-309, AGT-310 and/or AGT-311 or derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for treating a behavioral condition or disorder.

20. A composition comprising a modulator of AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 expression or AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 activity and one or more pharmaceutically acceptable carriers and/or diluents. In another embodiment, the composition comprises AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or a derivative, homolog, analog or mimetic thereof and one or more pharmaceutically acceptable carriers and/or diluents.

21. An isolated antibody to AGT-307, AGT-308, AGT-309, AGT-310 or AGT-311 and their derivatives or homologs.

22. A method for detecting AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or a derivative or homolog thereof in a biological sample from a subject, said method comprising contacting said biological sample with an antibody specific for AGT-307, AGT-308, AGT-309, AGT-310 and AGT-311 or their antigenic derivatives or homologs for a time and under conditions sufficient for a complex to form, and then detecting said complex.

23. A deimmunized antibody molecule having specificity for an epitope recognized by a monoclonal antibody to a target wherein at least one of the CDRs of the variable domain of said deimmunized antibody is derived from the said monoclonal antibody to said target and the remaining immunoglobulin-derived parts of the deimmunized antibody molecule are derived from an immunoglobulin or an analog thereof from the host for which the antibody is to be deimmunized.