WO2002022864A1

WO2002022864A1 - The method of detecting mutant dspp gene of hereditary opalescent

Info

Publication number: WO2002022864A1
Application number: PCT/CN2000/000280
Authority: WO
Inventors: Yan Shen; Jun Zhao; Xiaohai Zhang
Original assignee: Sinogenomax Co.,Ltd
Priority date: 2000-09-15
Filing date: 2000-09-15
Publication date: 2002-03-21
Also published as: JP2004508067A; JP3886901B2; CN1454264A; DE10085485T1; AU2000272670A1; CN1257986C; DE10085485B4

Abstract

The present invention involves a method of detecting mutant DSPP gene of hereditary opalescent dentin. The invention locates the mutation locus resulting in hereditary opalescent dentin in the third exon of dspp, and describes the application of said method in the diagnosis and therapy of hereditary opalescent dentin cases. Thereby the invention sets the foundation for further studies on the mineralizing process of teeth, nosogenetic mechanism of hereditary opalescent dentin, as well as their utilities in clinic and antenatal diagnosis. The invention also provides a kit and its use in the diagnosis and therapy of patients with hereditary opalescent dentin.

Description

Method for detecting mutated gene dspp of hereditary opalescent dentin FIELD OF THE INVENTION

The invention relates to a method for detecting a mutant gene dspp of hereditary opalescent dentin, and the method may be a direct sequencing method or a restriction enzyme method or an oligonucleotide probe hybridization method. More specifically, the present invention is a method for locating the mutation site of the hereditary opalescent tooth shield at the third exon of dspp. In addition, the present application also relates to a kit prepared according to the method of the present invention and the application of the kit to a method for detecting and treating hereditary opalescent dentin. Background technique

Hereditary opalescent dentin is an autosomal dominant hereditary disease with an incidence of 1/8000. In 1973, Shields classified it as Type 2 dentinogenesis imperfect type 11 (Dentinogenesis Imperfect Type 11). Both the primary and permanent teeth of the patient were affected, and the affected teeth were gray-blue or dark brown with a milky gloss. Under the X-ray film, you can see that the crown is spherical, the roots are smaller, the pulp chamber and root canal are narrowed or completely closed. Although the formation of enamel is not directly affected by hereditary opalescent dentin, because the contact surface between dentin and enamel is flattened from a shell shape, the enamel shield is easily detached from the dentin, making it originally stunted The dentin wears off too quickly and the teeth become significantly shorter. In severe cases, they can be worn down to the alveolar process. Due to excessive wear, older patients may develop alveolar bone hyperplasia and gum thickening and fibrosis. As a result, patients with hereditary opalescent dentin have to undergo extensive dental care and expensive treatment.

The pathogenic genes of hereditary opalescent dentin have been located in the 2 MB range on 4q21, and within this range 4 genes have been found to be involved in tissue mineralization. They are secreted phosphoprotein 1, SSPl, dentin matrix protein 1, DMPl, dentin sialophosphoprotein (DSPP) and bone saliva. Acid protein (bone sialoprotein, IBSP). The dspp genome sequence was recently determined (AF163151). dspp encodes DSP and DPP 2 proteins, of which DPP Highly phosphorylated, which is thought to regulate the shape and size of hydroxyapatite crystals, and plays an important role in the nucleation process of hydroxyapatite crystals.

Although the genome of dspp has been determined, no one in the art has used the direct sequencing method, restriction enzyme method or oligonucleotide probe hybridization method to locate the mutation site of hereditary opalescent dentin at the specific dspp At the exon; the inventor selected 8 short tandem repeat markers (STRP) near 4q21 and performed linkage analysis to locate the disease-causing gene of the hereditary opalescent tooth Shield family used in the present invention on chromosome 4q. By sequencing the first four exons of the dspp gene and the genomic sequences flanking it, a nonsense mutation was found, and the mutation caused premature termination of translation. Because the restriction enzyme Rsal recognizes mutations and normal DNA sequences, these mutations can be detected by Rsal digestion. The detection of nonsense mutation sites has laid a foundation for further research on the mineralization of teeth and the pathogenesis of hereditary opalescent dentin, as well as the clinical diagnosis or prenatal diagnosis for patients. In addition, the inventors prepared a kit capable of accurately and quickly diagnosing hereditary opalescent dentin diseases according to the method of the present invention. Summary of invention

It is an object of the present invention to provide a method for detecting a mutant gene dspp of hereditary opalescent dentin.

In one aspect of the present invention, the pathogenic gene of the family used in the present invention is mapped to chromosome 4q by linkage analysis. Then determine the genomic sequence of the first 4 exons of the candidate gene dspp in the patient and compare them with the normal control. It was found that there is a nonsense mutation in the third exon of dspp, so that the present invention finds heredity The pathogenic gene of opalescent dentin is dspp. Since this mutation leads to a change in the recognition site of the restriction enzyme Rsal, this method provides convenience for detecting hereditary opalescent dentinopathy. And the invention lays a foundation for further research on the mineralization process of teeth and the pathogenic mechanism and treatment of hereditary opalescent dentin. In addition, the present invention finds that the dspp gene is a disease-causing gene of hereditary opalescent dentin, which is the premise for further searching for other pathogenic mutations of the dspp gene in more hereditary opalescent dentin families, and is also the following More of the diagnostic kit The improvement has laid the foundation.

Another object of the present invention is to provide an application of a dspp mutant gene in the treatment of hereditary opalescent dentin.

Another object of the present invention is to provide a forward primer containing a reverse primer, a reverse primer on the inner side, a reverse primer on the inner side, a reverse primer on the inner side, a 10-fold PCR reaction buffer, dNTP, Taq DNA polymerase, MgCl according to the above method. _2. Restriction enzyme Rsal, Restriction enzyme 10-fold reaction buffer, BSA kit. By using the kit to design PCR primers near the nonsense mutations found in the present invention, to perform a PCR reaction, and then to cut the PCR product with the restriction enzyme Rsal, the disease can be diagnosed simply and quickly. The diagnostic kit can not only make the clinical diagnosis of hereditary opalescent dentin more accurate, but also can be used for prenatal diagnosis.

The invention also provides the application of the above kit in a method for detecting and treating hereditary opalescent dentin.

On the other hand, the present invention links the dspp gene with hereditary opalescent dentin, and provides a new idea for the treatment of this disease. On the basis of further understanding the pathogenesis of the mutated dspp gene, relevant drugs that can regulate the mineralization of the teeth were synthesized for treatment. Brief description of the drawings

Figure 1. Family map of hereditary opalescent dentin. The proband in the picture is indicated by the upper left tip, and the black icon represents the affected individual.

Figure 2. Partial sequencing map of dspp genes from normal opalescent dentin patients with normal controls. The left map is a partial map of the dspp of a normal individual, and the right is a sequencing picture of the patient's mutant dspp gene.

Figure 3. Rsal digestion map of the PCR product. The first + / + on the left is the digestion map of the control (Cont.); +/- is the digestion map of the affected individuals; the rest + / + is the digestion map of normal individuals, because of the nonsense mutation of dspp. The recognition site of Rsal resulted in a larger band after agarose electrophoresis. The present invention is further described below in conjunction with the embodiments. It should be understood that the following examples are only used to illustrate the present invention and not intended to limit the present invention. Examples

Example 1

1. Mapping of hereditary opalescent dentin-causing genes:

1.1 Subjects The hereditary opalescent dentin pedigree analyzed was discovered in clinical work at the Stomatological Hospital of Tianjin Medical University (Figure 1). There are 36 survivors in this family, and 15 are affected. Proband V2, male, 5 years old, has not completely lost the deciduous teeth, but the medullary root canal has a tendency to be locked, and the previous teeth were obvious. The deciduous teeth were excessively worn, but no periapical shadows were seen, and the development of permanent tooth germs was not abnormal. The clinical presentation of the patient is consistent with the main characteristics of hereditary opalescent dentin. Other patients in the family also have the main characteristics of the disease. The transmission of pathogenic genes is consistent with autosomal dominant genetic characteristics. We analyzed the DNA of 13 of these family members (of which 10 were patients).

1.2 linkage analysis

1.2.1 Extraction of DNA from peripheral blood cells After obtaining the consent of the subjects, 5 ml of blood was collected from 13 family members by intravenous injection, and anticoagulants were added and mixed immediately. Centrifuge at 4 ° C, 3000rpm for 15 minutes, and aspirate the upper plasma with a pipette. Add 5 to 10 times double distilled water to the remaining solution and let stand at room temperature for 10 minutes. Centrifuge at 4 ° C, 3500 rpm for 15 minutes. Discard the supernatant with a vacuum pump, add 15 mmol / L TES (15 mmol / L Tris-HCl pH8.0, 15 mmol / L EDTA pH8.0, 15 mmol / LN aCl 4 ml), and resuspend the pellet. Add 270 μ 1 of 10% SDS and mix, and then add 40 μ 1 of proteinase K (10 mg / ml) and mix. After 2 hours at 50 ° C, overnight at 37 ° C. Cool to 0 ° C in an ice bath, add 1 volume of phenol, mix and centrifuge at 4 ° C, 3500 rpm for 15 minutes. The supernatant was taken and extracted again with phenol. Take the supernatant, add 1 volume of chloroform: isoamyl alcohol (24: 1), mix, and centrifuge at room temperature for 5 minutes, 4 ° C, 3500 rpm for 5 minutes, and take the supernatant. Extract with chloroform: isoamyl alcohol (24: 1 again). Take the supernatant, add 2.5 times ice to pre-cool 95% ethanol, and shake gently until the DNA is precipitated and clumped. Wash once with 70% ethanol. Finally, the DNA was sucked into a 1.5ml centrifuge tube, dried and reconstituted. In 1.0 ml TE. After dissolution, quantify with UV spectrophotometer.

1.2.2 STRPs fluorescently labeled PCR and PCR product analysis scan

(1) Selection of STRPs primers

Eight markers on 4q21 were selected for linkage analysis. The eight STRPs are marked as: D4S2915, D4S2932, GATA62A11, D4S2409, DSP STRP, SPP1, D4S1563, D4S1544. The primer sequences of eight STRPs are shown in Table 1. PCR was performed on a Perkin Elmer 9600 thermal cycler with the above 8 pairs of primers. The reaction system was 12.5 μ 1 (10 x PCR buffer 1.25 μ 1, 2 mmol / L dNTPs 0.5 μ ld TP (product of Sigma)). 1% FdNTP 0.5 μΐ, 2W μ \ Taq polymerase (purchased from the original Pinghao Biotechnology Co., Ltd.) 0.25 μ 1, 5 pmol / μ 1 primer 0.25 μΐ, 40 ng / μΐ Genomic DNA 1.0 μ1). The PCR reaction conditions were denaturation at 94 ° C for 50 s, annealing for 1 min (annealing temperature see Table 1), extension at 72 ° C for 50 s, 35 cycles, and extension at 72 ° C for 5 min.

(2) Allele fragment analysis of STRPs

In the case that the PCR product can be separated from the polyacrylamide gel, the PCR products of different sites of the same individual are mixed, and the mixed product of the 2 μΙΡΟ reaction is taken with a molecular weight standard of 0.4 μΙΑΒΙΚΟχ-400, 2.1 μΐformamide and 0.4 μΐ Dye mix, 95 ° (denaturation 2 11 1,); water bath quickly cooled, electrophoresis on 4% polyacrylamide and 36% urea for 2 h on Perkin Elmer ABI377 sequencer, data collection using GENESCAN 2.1 software, lane line Calibration, intrinsic molecular weight calibration and migration fragment size measurement.

8 STRPs-labeled primer sequences and annealing temperature sites for PCR reactions Primer sequences Annealing temperature

D4S2915 5 'Primer TTTTAGAAATAGTTGTCAACCTTCC 50 ° C

4 ^^ 463668. 3 'primer TATAAGACCTTTACACTGATAACCA

D4S2932 ^^ 39368 51 'primer GAGCAAAACTCTGTCTCAAAAATAA 55 ° C

3 'Primer GGCTTACTTGGAAAGGTCTCTT

GATA62A11 5 'primer AACTTCACCATAGTGCCAGC 62 ° C

3 'Primer GACAAAATCCCTCTGTGCAT

D4S2409 5 'Primer ACTTTACCCCACAAGCATTG 50 ° C

3 'Primer CCATCCACCCTCAATACTTG

4 245751

DSP STRP 5 'Primer TCTG¾364563 8ATTAGATCATACTTTGGC 58 ° C

3 'Primer ATACTGGCTATTGAAAAGGTTC

SPP1 5 'Primer TCAGGTGATGCTTCTGCCTC 63 ° C

3 'Primer TGAGCCCAGGAGTTTAAGGC

D4S1563 5 'Primer GCTGCCTGACACACTGG 56 ° C

3 'primer ACTATTGCTGTTGCTGACCC

D4S1544 5 'Primer CCATATAACACAATGGATATAGC 55 ° C

3 'Primer CAGAAACTCCAGCAGAGACT

1.2.3 Linkage analysis Using the MLINK linkage analysis software of the LINKAGE software package, under the mode of autosomal dominant inheritance two allele system, set the frequency of disease-causing genes in heterozygotes o o

And the penetrance are 0.00001 and 0.99 respectively, and the alleles are set to have the same frequency. The 3581 calculates the Lod values when the recombination rates are 0, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4. Judging by the Lod value> 1, the pathogenic gene of hereditary opalescent dentin was located on chromosome 4q.

Table 2.Results of two-point Lod linkage analysis between 8 STRPs and hereditary opalescent dentin

Lod Score at a Recombination fraction of:

Locus 0.00 0.01 0.05 0.10 0.20 0.30 0.40 Zmax Θ

D4S2915 1.40 1.13 0.82 0.50 0.21 0.00

D4S2932 1.66 1.35 0.99 0.61 0.23 0.00

GATA62A11 1.60 1.27 0.90 0.51 0.16 0.00

D4S2409 1.32 0.97 0.64 0.35 0.11 0.00

DSP STRP 1.63 1.28 0.80 0.38 0.08

0.00

SPP1 0 0.79 0 0.65 0.49 0.33 0.17 0.00

D4S1563 0.00 0 0.65 0.54 0.32 0.12 0.12

D4S1544 -0.92 -0.08 0.05 0.08 0.06 0.31 Example 2

Screening for mutations in candidate genes

Select dspp as candidate gene for mutation screening. Primer 3 software was used to design PCR primers for the first 4 exons for nested PCR reaction, a total of 8 pairs of primers (Table 2). Elout, E2out, E34fout, and E341out are the primers for the first round of PCR reactions, and Elin, E2in, E34fin, and E341in are the primers for the second round of PCR reactions. The reaction system for the first 3 primers of the first PCR reaction is 50 μΐ:

10 X PCR buffer 5 μΐ

2 mmol / L dNTPs 5 μ ΐ

5 pmol / μ 1 primer 5 μ 1

2U / l Taq polymerase 1 μ ΐ

50 ng / μ 1 Genomic DNA 1 μ 1

Add water to 50 μ1. The reaction conditions were 94 ° C for 30 seconds, annealing for 30 seconds, and 72 ° C extension (see Table 3 for annealing temperature and extension time) for 30 cycles. Finally, extend at 72 ° C for 5 min. Table 3 Primer sequences and annealing and extension temperatures for PCR reactions Primer names Primer sequences Annealing temperature Extension time

Elout 5 'Primer ATTGTCATGCAAAAGTCCAG 59 ° C 60 seconds

3 'Primer CAATAAAAATGGCCCAGGTG

E2out 5 'primer TGTTTTCCTTCATTGGCACA 55. C 100 seconds

3 'Primer AAACATGATGGCTGGCTAGT

E34fout 5 'Primer GGGCTGATCTAACACGTCCA 55 ° C 100 seconds

3 'Primer CCTCGTTTCTACAGGAATTCTCA

E341out 5 'primer GCATCCAGGGACAAGTAAGC See text See text

3 'Primer TGTAATTGAAAGCATCCTGGTG

Elin 5 'Primer ATTGTCATGCAAAAGTCCAG 61 ° C 60 seconds

3 'primer CTTGTTTGAAAGCCCAAGGT

E2in 5 'Primer GATGTCCCCATAACCACACC 63 ° C 100 seconds

3 'Primer TCCAAATTTTCCACAGTGAGC

E34fin 5 'Primer CAAGCCCTGTAAGAAGCCACT 63 ° C 100 seconds

3 'Primer TGCTTCCAGCTACTTGAGGTC

E341in 5 'Primer AGCCACAAACAGAAGCAACA See text See text

3 'Primer TCATCCACATTCCTACCCAGT The reaction system of E341out is 50 μ 1:

Of which Mixl 2 mmol / L dNTPs 8.75 μ 1

5 pmol / μ 1 primer 2.4 μ 1

50 ng / μ 1 Genomic DNA 1 μ 1

Add water to 25 μ1.

Mix2 10 x PCR buffer 5 μΐ

Expand Long Template (Roche product) 0.75 μ 1

Add water to 25 μ1.

Mix Mixl and Mix2. The reaction conditions are:

94 ° C for 10 seconds, 55 ° C for 30 seconds, 68 ° C for 2 minutes, 10 cycles,

94 ° C for 10 seconds, 63 ° C for 30 seconds, 68 ° C for 2 minutes + 20 seconds per cycle, 20 cycles, and finally 68 ° C for 7 minutes. Take 5 μΐ of PCR products for electrophoresis separation, voltage 90V, electrophoresis time 15 minutes, electrophoresis is completed, and pictures are archived. Take the first round of PCR product diluted 250-1250 times and perform the second round of PCR reaction. The reaction conditions are: 94 ° C for 10 seconds, annealing for 30 seconds, 72 ° C extension, 25 cycles, (see Table 2 for annealing temperature and extension time). Take PCR products for electrophoresis and take pictures for archiving. The second round of PCR products was taken and directly sequenced using PCR primers as sequencing primers. The obtained sequence map is analyzed. Where there are impurities and double peaks, it indicates that the site is heterogeneous and needs further analysis. The sequences containing hetero and status sites were compared with those of Genebank and translated according to the normal reading frame. It was found that the patient had a nonsense mutation in exon III, in which the 3658th nucleotide of DSPP 3 exon was mutated from C to T, which caused the 45th position of dspp to be normally encoded by glutamine. The codon CAG of the amide was changed to the stop codon TAG, and as a result, the translation of dspp was terminated early, and DPP, one of the expression products of the dspp gene, could not be produced (Figure 2). Example 3 Identification by enzyme digestion:

3.1 PCR reaction The first round of PCR reaction was performed with E34fout primers. After the reaction was completed, electrophoresis and photos were archived. Then take one round of the PCR product and dilute it 250 times, and use E341out for the second round of PCR reaction. The reaction system is 100μ1. The reaction conditions are the same as those of the mutation screening section. Take the second round of PCR products for electrophoresis and take pictures for archiving.

3.2 PCR reaction recovery (PCR recovery kit is Life Technologies Concert Papid PCR Purfication System)

Take 4 ml of washing buffer, add 10 ml of 95% ethanol, and mix well.

Add 400 μl of binding buffer to 90 μl of PCR product and mix well.

Add the mixed solution to the center of the cartridge, 28 ° C, ll, 900g, centrifuge for 1 minute, and discard the flow-out liquid.

Add 700 μΐ of wash buffer (containing ethanol), 20 ° C, ll, 900g, and centrifuge for 1 minute. Discard the flow-out liquid, 20 ° C, ll, 900g, and centrifuge for 1 minute.

Transfer the column to a 1.5 ml recovery centrifuge tube, and add 50 μΐ TE buffer (pH 8.0, 10 mmol / L Tris.Cl, 1 mmol / L EDTA) pre-heated to 65 ° C, RT for 1 minute, ll , 900g, centrifuge for 2 minutes. Take 5 μΐ of the recovered agarose (product of BIOWEST company), electrophoresis, take pictures, and archive.

3.3. Rsal digestion

Digestion system 15 μΐ:

BSA (lOmg / ml) 0.15 μΐ

10x buffer 1.5 μΐ

Rsal (promega) (10 U / μ 1) 1 μΐ

PCR product 12.35 μΐ

37 ° C, 2 hours. After the digestion reaction was completed, 15 μΐ of the reaction mixture was subjected to agarose electrophoresis and photographed. It was found that the PCR products of normal individuals of this family can be completely digested by the restriction enzyme Rsal, and the affected individuals damaged the Rsal recognition site because of a nonsense mutation, resulting in a band after agarose electrophoresis. Larger bands (Figure 3). 51 unrelated normal individuals may also be Rsal PCR product was digested completely _c Example 4

Kit for diagnosis of hereditary opalescent dentin disease and application thereof

The kit contains:

Outer 5 'primer (5 pmol / μ 1)

Outer 3 'primer (5 pmol / μ 1)

Inner 5 'primer (5 pmol / μ 1)

Inner 3 'primer (5 pmol / μ 1)

10x PCR reaction buffer

dNTP (2mmol / μ 1)

Taq DNA polymerase

MgCl ₂

Restriction enzyme Rasl

Restriction enzyme 10-fold reaction buffer

When using BSA (10mg / ml), use the outer 5 'primer and the outer 3' primer to do the first round of PCR reaction. After the reaction is completed, electrophoresis and photographing are archived. Then take the first round of PCR product diluted 250 times as a template, use the inner 5 'primer and the inner 3' primer for the second round of PCR reaction, take the second round of PCR product electrophoresis, and take pictures for archiving. Adjust the ionic strength of the PCR product with MgCl ₂ and add the restriction enzyme Rsal, 37 ° C for 2 h (BSA 10 mg / ml 0.15 μ 1, 10-fold buffer 1.5 μ 1, (Rsal 10 U / μ Ι) 1 μ1, PCR product 12.35 μ 1). After the digestion reaction was completed, 15 μl of the reaction mixture was subjected to agarose electrophoresis and photographed. The PCR products of normal individuals can be completely digested by the restriction enzyme Rsal, and the affected individuals' Rsal recognition sites are destroyed by nonsense mutations, resulting in a larger band after agarose electrophoresis. In this way, it can be determined whether the dspp gene of the individual to be tested is hereditary opalescent tooth Patients with dysfunction.

It should be understood that after reading the above-mentioned teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, but the equivalent forms of the changes or modifications also fall within the scope defined by the claims of this application.

Claims

Claim

1. A method for detecting a mutant gene dspp of hereditary opalescent dentin, characterized in that the method includes a direct sequencing method, a restriction enzyme method or an oligonucleotide probe hybridization method.

2. The method for detecting a mutant gene dspp according to claim 1, wherein the mutation site of the mutant gene is located at the third exon of the DSPP.

3. The method for detecting a mutant gene dspp according to claim 2, wherein the 3658th nucleotide of the third exon of dspp is mutated from C to T, so that the 45th position of dspp is normally encoded The amino acid codon CAG becomes the stop codon TAG.

4. The method for detecting a mutant gene according to claim 2 or 3, comprising the steps of: A: selecting dspp as a candidate gene for mutation screening, designing PCR primers for the first four exons of the dspp gene, and Perform a PCR reaction;

B: The PCR reaction product is purified and directly sequenced or cloned and sequenced. The resulting sequence was compared with the sequence in Genebank and translated according to the normal reading frame to determine the mutation site of the dspp gene.

5. The method for detecting a mutant gene according to claim 2 or 3, comprising the steps of: A: extracting DNA, designing PCR primers near the mutation site, and performing a PCR reaction; B: purifying the PCR reaction product, or using ] ^^ (¾ After directly adjusting the MgCl ₂ concentration of the PCR reaction product, use the restriction endonuclease Rsal to cut it. After the digestion reaction is complete, take the reaction mixture agarose electrophoresis and take pictures to determine the mutant gene.

6. A kit prepared according to the method of claim 5, comprising:

5 'outside primer

Outer 3 'primer

Medial 5 'primer

Inverted 3 'primer

10x PCR reaction buffer dNTP

Taq DNA polymerase

MgCl ₂

Restriction enzyme Rsal

Restriction enzyme 10-fold reaction buffer

BSA

7. The use of the DSPP mutant gene of one of claims 1 to 6 in the treatment of hereditary opalescent dentin.

8. Use of the kit according to claim 6 in a method for detecting hereditary opalescent dentin.

9. Use of the kit according to claim 6 in a method for treating hereditary opalescent dentin.