JP2000316577A - Diagnosis of citrullinemia type ii onset in adult - Google Patents

Abstract

PROBLEM TO BE SOLVED: To simply and definitely diagnose citrullinemia type II which develops in adult by examining the presence of deletion in a specific region of cDNA which is synthesized from genomic DNA in a specimen or the like. SOLUTION: Citrullinemia type II onset in adult is diagnosed by examining (i) the presence or absence of variation deleting in a region of 851 nt to 854 nt of SLC25A13 cDNA encoding the region represented by the formula in cDNA or mRNA, or the presence or absence or variation corresponding to the variation in genomic DNA, (ii) the presence or absence of substitution from G to A in 5'-end of 11th intron of SLC25A13 gene in the position which corresponds to 1177 nt to 1178 nt of an encoding region of SLC25A13 cDNA represented by the formula, etc., in a genomic DNA or mRNA in a specimen or cDNA which is synthesized from the mRNA. It is preferable to diagnose by an immunoassay.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for diagnosing adult-onset type II citrullinemia, and primers and proteins used therefor.

[0002]

2. Description of the Related Art Citrullineemia (CTLN) increases citrulline and ammonia concentrations in blood and urine, causing vomiting,
Argininosuccinate synthase (AS) is a disease that causes consciousness disorder, convulsions, etc. and is one of the urea cycle enzymes.
It is a disease based on the abnormality of S). The present inventors have analyzed more than 170 cases of CTLN so far, and
They have been classified into two types according to their type and etiology. Among them
Types I and III are neonatal-onset classical citrullinemia (CTL) caused by an abnormality in the ASS gene located at chromosome 9q34.
N1).

[0003] On the other hand, adult-onset type II citrullinemia (CTLN2), which is observed in the majority of adult-onset cases, is characterized by a liver-specific deficiency of ASS, but has no abnormality in the ASS gene and ASS mRNA in hepatocytes. It is a disease caused by a specific etiology that there is no abnormality. CTLN2 causes impaired consciousness and coma, often death 2-3 years after onset. CTNL in Japan
The frequency of onset of 2 is about 1 in 100,000, which is higher than CTNL1. The fact that CTLN2 is a liver-specific disease is supported by the fact that liver transplantation performed in nine cases to date has shown a favorable therapeutic effect. The inventors of the present application have so far experienced CTNL2 in 118 families, and reported that CTNL2 is an autosomal recessive hereditary disease, since 23 of them are derived from kin marriage. However, the responsible gene was completely unknown.

At present, CTNL2 is diagnosed by examining biochemical markers such as amino acid analysis in blood and an increase in pancreatic secretory trypsin inhibitor (PSTI) concentration, and further in liver tissue.
It is performed by measuring the decrease in ASS activity and protein. However, biochemical tests and enzymatic analysis are complicated and time-consuming, so they are not always suitable for clinical tests that require a large number of samples to be tested in a short period of time. Is difficult. If the responsible gene of CTLN2 can be clarified, and the mutation in the responsible gene that causes CTLN2 can be clarified, it is simpler by genetic test, and
This is advantageous because CTNL2 can be reliably diagnosed. Moreover, not only the diagnosis of CTLN2 but also the diagnosis of the carrier of the gene becomes possible. Also, if the responsible gene is a structural gene encoding a protein, and CTLN2 is caused by an abnormality of the protein, the immunoassay for the protein is simple, and
Diagnosis of CTLN2 can be ensured.

[0005]

SUMMARY OF THE INVENTION Accordingly, an object of the present invention is to clarify the responsible gene for CTLN2 and the mutations in the responsible gene that cause CTLN2, and thereby to make CTLN2 simple and reliable by a genetic test or the like. The purpose of the present invention is to provide a diagnostic method capable of making a diagnosis.

[0006]

Means for Solving the Problems The present inventors have developed CTNL2
Are considered to be autosomal recessive genetic diseases,
Using the genomic DNA of a CTLN2 patient and a healthy subject, the locus of CTLN2 was found on chromosome 7 by the homozygosity mapping method.
By performing positional cloning of NA, CT
A novel gene located on chromosome 7q21.3, which is thought to be responsible for LN2, was identified. Further, by determining the nucleotide sequence of the gene in CTNL2 patients and healthy subjects, CTNL2
Five patients found homozygous or compound heterozygous but two homozygous but not homozygous ones, and concluded that the gene was responsible for CTLN2. Then, a method for detecting these five types of mutations by genetic testing was developed. Further, expressing the protein encoded by the responsible gene,
An antibody using the protein as an antigen was prepared.

That is, the present invention provides an adult-onset type II disease comprising examining at least one of the following (1) to (5) for genomic DNA or mRNA or cDNA synthesized from the mRNA in a test sample. A method for diagnosing citrullinemia is provided. (1) A mutation in which the 851-nt to 854-nt region of the SLC25A13 cDNA coding region represented by SEQ ID NO: 1 in the sequence listing is deleted
Or, whether it is present in mRNA, or whether there is a mutation corresponding to the mutation in genomic DNA. (2) G at the 5 ′ end of the eleventh intron of the SLC25A13 gene, which is located at a position corresponding to between 1177 nt and 1178 nt in the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing
Whether there is a mutation that substitutes for A. (3) A 23 bp region corresponding to 1638 nt to 1660 nt of the coding region of SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing,
Between 1637 nt and 1638 nt or 1660 nt and 1661 nt of the coding region
Whether there is a mutation in the cDNA or mRNA inserted at any site between
Whether a mutation corresponding to the mutation is present in A. (4) Whether or not a mutation in which the 674 nt C in the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing substitutes for A is present in the cDNA or mRNA;
Whether there is a mutation corresponding to the mutation in NA. (5) G at the 5 ′ end of the 13th intron of the SLC25A13 gene, which is located at a position corresponding to between 1311 nt and 1312 nt of the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing
Whether there is a mutation that substitutes for A.

Further, the present invention provides a primer used in the method of the present invention. Further, the present invention provides a c-protein having the nucleotide sequence shown in SEQ ID NO: 1
A protein encoded by DNA or a mutant thereof including any of the above (1) to (5), or one or more amino acid residues of the protein are deleted or substituted, or Alternatively, the present invention provides a modified protein to which a plurality of amino acid residues have been added or inserted, wherein the modified protein immunoreacts with an antibody against the protein, and a nucleic acid encoding the protein or the modified protein.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION As described in detail in the Examples below, the present inventors have determined that CTNL2 is an autosomal recessive hereditary disease and based on the fact that CTNL2 is Using the DNA, the CTLN2 gene locus was found on chromosome 7 by the homozygosity mapping method, and based on this, genomic DNA was subjected to positional cloning to position it on chromosome 7q21.3, which is considered to be the responsible gene for CTLN2. A new gene was identified and its cDNA sequence was determined. Further, the cDNA
Genomic DNA (including intron region) corresponding to
Was determined. Then, they found five types of mutations that were homozygous or compound heterozygous in CTLN2 patients but not homozygous in healthy individuals.
This revealed that the gene was the responsible gene for CTNL2, and that the five mutations were the pathogenesis of CTNL2. The responsible gene was named "SLC25A13" and the protein encoded by the gene was named "citrin".

The nucleotide sequence of the cDNA derived from SLC25A13 of a healthy subject is shown in SEQ ID NO: 1 in the sequence listing together with the deduced amino acid sequence of the protein (citrin) encoded by the cDNA. Less than,
In the present specification, the position of the base is the base number of the coding region shown in SEQ ID NO: 1 (starting from the 138th A in the sequence shown in SEQ ID NO: 1) unless otherwise specified. Represented by For example, the position of the first base A in the coding region is “1 nt”,
Is represented as "1000nt". The exon-exon boundary in the cDNA sequence was determined by analyzing the nucleotide sequence of SLC25A13, which is the gene in the genomic DNA from which the cDNA was derived, and comparing it with the cDNA sequence shown in SEQ ID NO: 1. As a result, it was revealed that SLC25A13 has 18 exon regions. cDNA
The position of each exon region in the following is shown in Table 1 below.

[0011]

[Table 1]

The intron was found in SLC25A13 in Table 1.
Are located between the exons shown in the figure. The number of the intron is the same as the number of the exon immediately upstream of the intron. That is, for example, the eleventh intron is located between exons 11 and 12 shown in Table 1, and the thirteenth intron is located between exons 13 and 14. The sequences (or partial sequences) of each intron related to the present invention are shown in SEQ ID NOs: 2 to 13. That is, in SEQ ID NO: 2, the base sequence at the 3 'end of the 7th intron (the 3' end G of the base sequence shown in SEQ ID NO: 2 is followed immediately by the 5 'end A of the 8th exon. The same). SEQ ID NO: 3 shows the nucleotide sequence of the eighth intron. SEQ ID NO: 4 has a base sequence at the 5 'end of the ninth intron (the G at the 5' end of the base sequence shown in SEQ ID NO: 4 immediately follows the G at the 3 'end of exon 9; the same applies hereinafter). Is shown. SEQ ID NO: 5 shows the 3 'end of the 10th intron, and SEQ ID NO: 6 shows the 5' end of the 11th intron.
SEQ ID NO: 7, 3 'end of intron 15; SEQ ID NO: 8, 16'intron; SEQ ID NO: 9, 5 'end of intron 17; SEQ ID NO: 10
The base at the 3 'end of the intron, SEQ ID NO: 11 at the 5' end of the 7th intron, SEQ ID NO: 12 at the 3 'end of the 12th intron, and SEQ ID NO: 13 at the 5' end of the 13th intron. The sequences are shown respectively.

The mutations in SLC25A13, which the present inventors have found to be the etiology of CTLN2, are the following five types. (1) Mutation in which the 851 nt to 854 nt region of the coding region of SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing is deleted (hereinafter referred to as
This mutation is sometimes referred to as "[I] 851del4"). (2) A mutation in which G at the 5 ′ end of the eleventh intron of SLC25A13 is substituted with A (hereinafter, this mutation may be referred to as “[II] IVS11 + 1G> A”). (3) A 23 bp region corresponding to 1638 nt to 1660 nt of the coding region of SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing,
Between 1637 nt and 1638 nt or 1660 nt and 1661 nt of the coding region
(Hereinafter, this mutation may be referred to as “[III] 1638ins23”). (4) A mutation in which 674 nt C of the coding region of SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing substitutes for A (hereinafter, this mutation may be referred to as “[IV] S225X”). (5) A mutation in which G at the 5 ′ end of the 13th intron of SLC25A13 is substituted with A (hereinafter, this mutation may be referred to as “[V] IVS13 + 1G> A”).

As described in the Examples below, citrine exhibits high homology with other mitochondrial carrier families, has a structure penetrating the mitochondrial lipid bilayer six times, and is present in the mitochondrial membrane. It is considered something. In addition, citrine is a characteristic EF-h
Since it has four and motifs, it is presumed to be a calcium-dependent mitochondrial carrier protein. FIG. 6 schematically shows the presence of citrine. the above
The approximate positions of the mutations (1) to (5) are also shown in FIG.

The mutation described in (1) introduces a stop codon at the position of the 286th codon in the sequence shown in SEQ ID NO: 1. Therefore, the protein encoded by the mutated gene cannot be cut in the middle. It becomes a complete protein. The mutation of the above (2) occurs in the intron region, but when this mutation is present, splicing during mRNA formation becomes abnormal, exon 11 of the mRNA is deleted, and the transmembrane region TM1 shown in FIG. In the hydrophilic loop between TM2, 53 amino acid residues encoded by codons 340-392 shown in SEQ ID NO: 1 are deleted. the above
When the mutation (3) is present, a frameshift occurs at the 554th codon, and the 570th codon becomes a stop codon, and 16 amino acid sequences different from normal exist between them. Thus, this mutation results in an incomplete protein with the C-terminal portion of citrine truncated. When the mutation of the above (4) is present, the 225th codon becomes a stop codon, and the protein encoded by the mutated gene becomes an incomplete protein cleaved in the middle. the above
The mutation of (5) occurs in the intron region,
When this mutation is present, splicing during mRNA formation becomes abnormal, and 27 amino acid residues (411 to 437 codons) are deleted between TM2 and TM3 shown in FIG. Thus, irrespective of the presence of any of the mutations (1) to (5), the citrine encoded by the mutant SLC25A13 has a structure significantly different from that of normal citrine.

In the method for diagnosing CTLN2 of the present invention, the above (1) to
Investigate at least one of the mutations in (5). Preferably, SLC25A13 in the test sample does not have any of the above mutations (1) to (5), and if so, which mutation of (1) to (5) Find out if you are. These mutations
The presence or absence of genomic DNA or cDNA or mRNA can be examined by examining any of them. The mutations (2) and (5) are mutations in the intron region.
Since the sequences of A and the cDNA derived therefrom are significantly different from the normal ones, the mutations (2) and (5)
By examining the RNA, the presence or absence thereof can be examined. Since CTNL2 is a liver-specific disease, hepatocytes are required as a test sample if a test is performed on cDNA or mRNA. On the other hand, if the test is performed on genomic DNA, genomic DNA extracted from peripheral blood cells or the like that can be easily collected can be used, so that it is not necessary to collect hepatocytes. It is preferable because the burden is small.

According to the present invention, the sequence of the SLC25A13 cDNA and the intron sequence near the mutation site in the genomic DNA and the position and structure of each of the mutations have been clarified. It can be easily determined by various conventional methods. For example, the above (1)
Alternatively, when examining the presence or absence of the mutation in (3), the region of the genomic DNA or cDNA containing the mutation is amplified by a nucleic acid amplification method such as PCR, and the amplified fragment is subjected to electrophoresis to measure the size of the band. be able to.
When a mutation is present, the size of the amplified nucleic acid fragment increases or decreases as compared to the case of a normal gene due to deletion or insertion. Therefore, the presence or absence of these mutations can be determined by checking the size of the amplified fragment. When the cDNA is examined, the presence or absence of the mutations (2) and (5) can be examined by this method. Genomic DNA
When examining the above (2), (4) or (5) mutation,
The size of the amplified fragment is the same in both the normal type and the mutant type due to the substitution of bases, but can be easily determined by using the so-called restriction fragment length polymorphism (RFLP) technique. For example,
When examining the presence or absence of the mutation of the above (4), since an AluI site (AGCT) is introduced by base substitution, a fragment containing the mutation of (4) is amplified by a nucleic acid amplification method and digested with a restriction enzyme AluI. Then, the presence or absence of the mutation can be examined by measuring the size of the digested fragment by electrophoresis. In the case of the normal type, the amplified fragment is not cleaved. In the case of the mutant type, the amplified fragment is cleaved by AluI at the site where the mutation exists, so that two fragments smaller than the normal type amplified fragment appear. . When an appropriate restriction enzyme site is not introduced due to mutation, the sequence of the amplification primer can be intentionally changed so that such a restriction enzyme site is introduced into the amplified fragment. For example, when detecting the mutation of the above (2), the 3 'end of the reverse-side primer is
By using G instead of A, which is complementary to NA, a GGTC sequence is introduced into the mutation site in the normal type, and a GATC sequence is introduced in the mutant type. GATC is cleaved by the restriction enzyme Sau3AI,
The presence or absence of mutation can be examined by RFLP in the same manner as in (4) above. The presence or absence of the mutation in the above (5) can be determined by setting the 3 ′ end of the reverse primer to C instead of A complementary to the template DNA.
Since the sequence of CTGCAG is introduced in the GG and mutant types, the presence or absence of the mutation (5) can be easily examined by RFLP using the restriction enzyme PstI. Furthermore, using a primer that does not hybridize with either the normal type or the mutant type, or using a primer that does not cause amplification even when hybridized, a nucleic acid amplification method is performed, and the presence or absence of a mutation is determined based on whether or not amplification occurs. It is also possible to check. For example, when examining genomic DNA, in the case of a mutation that causes deletion or insertion, such as the above-mentioned mutation (1) or (3), a primer that hybridizes with the mutation site can be used. It is also possible to examine the presence or absence of the mutation by Southern blot or Northern blot using a probe that hybridizes to the mutated portion. It is also possible to investigate the presence or absence of a mutation by directly determining the base sequence of the amplified fragment.

The primer used for the nucleic acid amplification may be the cDNA sequence shown in SEQ ID NO: 1 or the sequence shown in SEQ ID NO: 2
13 (complementary to a region spanning an intron and an exon), and hybridize to both ends of a region to be amplified. However, perfect complementarity is not always necessary, and non-complementary bases may be included as long as sequence-specific hybridization is possible. The size of the primer is generally about 15 to 50 bases, preferably about 20 to 40 bases, but is not limited thereto.

Further, as described above, citrine encoded by mutant SLC25A13 has a structure that is significantly different from that of normal citrine.
The presence or absence of the above mutation can also be examined. Whether a citrine is a mutant or a normal can be easily and accurately determined by, for example, immunoassay. By using a monoclonal antibody that specifically reacts only with mutant citrine but does not react with normal citrine, mutant citrine can be specifically detected. Such a monoclonal antibody is prepared by a conventional method using a mutant citrine as an immunogen, and selecting a monoclonal antibody that does not react with the normal citrine but reacts with the mutant citrine. Obtainable. Mutant or normal citrine used as an immunogen or for screening for monoclonal antibodies is produced in large amounts by a genetic engineering technique based on a conventional method, since the entire nucleotide sequence of the cDNA is known by the present invention. It is possible to A specific example is described in Example 3 below. The immunogen or citrine for screening is only a citrine encoded by a cDNA having the nucleotide sequence shown in SEQ ID NO: 1 of the sequence listing or a mutant thereof containing any of the above (1) to (5). Alternatively, one or more amino acid residues of the citrine are deleted or substituted, or one or more amino acid residues are added or inserted into the protein, and the modified citrine is an antibody against the citrine. It may be a modified citrine that reacts immunologically.

[0020]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below more specifically based on embodiments. However, the present invention is not limited to the following examples.

Embodiment 1 1. Methods (1) Patients Blood samples, surgical or necropsy liver specimens, and clinical data were collected from 18 adult-onset patients (19-48 years) of unrelated marriage families (FIG. 2a). .
The diagnosis of citrullineemia was made by an established method. 127 18-55 year old unrelated healthy subjects were used as controls.

(2) Homozygous mapping (Lander ES et
al., Science 236, 1567-1570 (1987)). CHLC Huma commercially available from Research Genetics, Inc.
Screening was performed using 391 microsatellite marker panels from Screening Set / Weber version 6. 0.2 for high resolution genotyping
PCR was performed in a mixture containing μM fluorescent label [R110]-or [R6G] -dUTP. The size of each PCR product was determined using GeneScan-500 [TAMRA] as a size standard and ABI310 Ge.
Resolution was performed using GeneScan 672 on a netic Analyzer. PO
The N1-192, PON2-148 and PDK4 promoter regions were constructed using established methods (Humbert, R., et al., Nature Genetics 3, 7
3-76 (1993); Hegele, RA et al., J. Clin.Endocrin
ol.Metab. 82, 3373-3377 (1997); Rowles, J. et al.,
J. Biol. Chem. 271, 22376-22382 (1996)).
Analysis was performed by a combination of CR and restriction enzyme digestion. To evaluate the statistical significance of the relationship, using a 2 × 2 contingency table chi ² test, and compared to irrelevant control the percentage of homozygous in a patient. P values were adjusted by Yates correction.

(3) Identification of SLC25A13 gene The 3 'part of SLC25A13 was firstly used as EST clone yg89b07 (GenBa
nk Acc. # R55737) (Hereinafter, all that described only Acc # alone mean Accession No. of BenBank) were identified by mapping to the YAC clone shown in FIG. Subsequently, cDNA library screening, RT-PCR, and 5'-RACE experiments were performed by a conventional method to isolate the full length of this gene. The gene structure is based on the BAC clones HGS025M02 (Acc. # AC002540) and HGS244B22 (Ac
c. # AC002450), the cDNA sequence was compared to the genomic sequence and determined by inverse PCR of genomic DNA.
So far, 18 exons of this gene have been identified.

(4) Northern blot analysis Primer 5'-F (5'-acgccagccagccagtcagt-3 ', -53 nt
~ -34 nt (the nucleotide of SLC25A13 mRNA indicates the start codon A as +1)) and primer 10B (5'-tctgggcctc
agccaagtta-3 ', 928 nt to 909 nt), and using a 981 bp fragment (5' side of cDNA) amplified by PCR as a probe, a human multi-tissue northern blot (Clontech # 7760-
The SLC25A13 mRNA was examined by hybridizing with 1). Furthermore, primer 3'-F (5'-taggaagatcagccc
tggga-3 ') and primer End-B (5'-gcgcctctgaccattatgc
Using a 934 bp fragment (3′-untranslated region of SLC25A13, 2026 nt to 2959 nt) amplified by PCR using a-3 ′) as a probe, hybridization was carried out on the same blot. aralar mRNA (del Arco, A. et al., J. Biol. Chem.
273, 23327-23334 (1998)) to detect primer 5'F (5'-gagcacagcatggcggtca-3 ') and primer 5'B
(5'-ctggagccagataggcctg-3 ') was used to amplify a 975 bp fragment (5' side of cDNA, 15 nt to 989 nt), which was used as a probe after cloning and sequencing.

(5) Mutation detection RT-PCR for amplifying the coding region of each mRNA
At the time, oligo (dT) _12-18And M-MuLV reverse transcriptase
Then, single-stranded cDNA was synthesized from liver RNA. Amplified
Separated cDNA fragments on agarose gel and extracted
And clone using TA-vector (Invitrogen)
Then, the nucleotide sequence was determined. For SLC25A13 mRNA,
Oligonucleotide primers 5'-F, 10B and MF (5'-ga
acggattgctcctctgga-3 ', 871nt-890nt) and 3'-B (5'-g
acagcactatcccagggct-3 ', 2055 nt to 2036 nt). T
FPI-2 (Acc. # L27624), PON1 (Acc. # M63012), PON2 (A
cc. # AF001601), PDK4 (Rowles, J. et al., J. biol.
Chem. 271, 22376-22382 (1996)) and DNCI1 mRNA.
Use the appropriate primer set for each
Amplified. The primer sets used were each 5'-g
gacgccttgcccagcgggc-3 'and 5'-ccaatgatttgtttcctcatgct
g-3 ', 5'-cccccgaccatggcgaagct-3' and 5'-tggcatgggtgca
aatcggt-3 ', 5'-cggagcgaggcagcgcgccc-3' and 5'-agggccg
ttccttactggaa-3 ', 5'-atgaaggcggcccgcttcgt-3' and 5'-a
gacccactttgatcccgtaaa-3 'and 5'-gagagaggaagtgatcg
ctc-3 'and 5'-acgctgagctctaggacaca-3'.

For the detection of SLC25A13 mutation, the following oligonucleotides were synthesized based on the sequence of the intron adjacent to each exon. IVS-6F (5'-ggagagtacaa
gttctggtc-3 '), IVS-7B (5'-actagttgccttcttcaccc-
3 '), IVS-7F (5'-tcactcattccagtgccttg-3'), IVS-9B
(5'-caatgccgcaaaggcaactg-3 '), IVS-10F (5'-ttgggctg
tagcaatgtgcc-3 '), IVS-11B (5'-ctagatgcctccagcctact
-3 '), IVS-12F (5'-ctcctgaaacatcagtgatgc-3'), IVS-1
3B (5'-cctagtagactctgcccttg-3 '), IVS-15F (5'-ggagc
agacatcttgcacac-3 ') and IVS-17B (5'-ggagttgatacattc
tcatca-3 '). The nucleotide sequence of each amplified genomic DNA fragment was directly determined, or after cloning into TA-vector, the nucleotide sequence was determined.

2. Results As described above, homozygous mapping approaches (Lander, ES, et.
al., supra) to search for the CTLN2 locus throughout the genome. First, a total of 332 genetic markers distributed along the autosome were analyzed for 15 CTLN2 patients and 15 controls (FIG. 1). Two markers on chromosome 7q21-q22 (D7S821 and D7S1799), respectively, were homozygous in 12 people out of 15 patients (80%) and nine (60%), these chi ² value (P Values) are 13.4
(0.0004) and 12.2 (0.0007).

FIG. 1 shows the results of homozygous mapping of 332 markers that traverse the autosomal chromosome. Chi ² analysis of the frequency of homozygous for each polymorphic DNA markers, of CTLN2 patients 18 people from consanguineous families (see FIG. 2), except for the AP-9, AP-69 and AP-80 15 people and 1
Performed between 5 unrelated controls. Homozygous percentage of high patients compared to controls, was plotted chi ² value on the right side of the line representing each chromosome. The relative positions of the markers used are
Each genetic distance is given in centiMorgans (cM). Two markers on chromosome 7q21-q22 (D7S821 and D7S1799)
, Among the 15 patients, 12 people each (80%) and nine (60%) and homozygous their chi ² values (P values) are respectively 13.4 (0.0004) and 12.2 (0.0007)
Met. Due to the observed differences between patients and controls,
It was suggested that the CTLN2 gene might be present in the tip region of D7S2212 (χ ² = 2.78, P = 0.039) and the flanking region of D7S22847 (χ ² = 1.29, P = 0.45). 18 CTNL
Examining 2 patients and 118 controls, D19S586 was also very significant on other autosomes (χ ² = 11.8, P =
0.0017). However, three additional markers adjacent to D19S586 within a distance of 1 cM, namely D19S413 (χ
² = 0.50, P = 0.57), D19S204 (χ ² = 1.65, P = 0.26) and D19S
At 583 (χ ² = 4.04, P = 0.062), no significant results were detected.

To confirm the significance of this observation and to more accurately identify the CTNL2 locus on chromosome 7q, 16 microsatellite markers and 3 genes (PON1,
PON2 and PDK4) (Humbert et al., Supra; Hegele, RA e)
et al., supra; Rowles J. et al., supra) were used to analyze all 18 patients and all 120 controls.
Both the proportion of homozygous chi ² and P values for the three markers (D7S527, D7S1812 and D7S821), was significantly higher (Figure 2). Furthermore, D7S1812 was homozygous in all 18 CTNL2 patients. These 18 CTNL2
290 bp of D7 in 13 (72%) of the patients
Homozygosity for the S1812 allele was observed,
Significantly higher (２４ ² = 20.7, P <0.0001) compared to 24 of the 21 controls (21%). Homozygous for the 281 bp D7S1812 allele was detected in 5 of 18 patients (28
%) And 11 of the 116 controls (9.5%), which were less significant (χ ² = 4.96, P = 0.04).
2). Based on comparing the haplotypes of all CTNL2 patients and allele frequencies compared to controls, the most likely site of the CTNL2 locus is between D7S527 and D7S821.
It was estimated to be 7q21.3, close to D7S1812 (see Figure 3 for the location of each marker). Furthermore, the analysis of the haplotype indicated the possibility that five different chromosomes carrying the disease gene were present (b in FIG. 2).

FIG. 2 shows 18 CTLs from blood marriage parents (a).
Figure 2 shows a list of N2 patients and corresponding haplotypes (b).
In FIG. 2a, "cousin" indicates the degree of relatives of the parents. “Cit” and “Arg” indicate the concentrations of citrulline and arginine in serum, respectively, and Thr / Ser indicates the ratio of threonine / serine in serum. sPSTI and hPSTI indicate the PSTI concentration in serum and liver, respectively. Liver ASS (hA
SS) is shown as% of control. Each number in parentheses indicates `` mean ± standard deviation '' (Kobayashi, K., et al.,
Hepatology 25, 1160-1165 (1997)). "Nt" means not measured. In FIG. 2 b, each marker from D7S2212 to D7S1799 is shown on the left side of chromosome 7
Physical mapping from the centromere end (top) to the telomere end (bottom) of the genomic interval containing the q21-q22 regions is shown. Numbers in parentheses indicate control homozygotes (homozygotes / number of people measured). The stretch of the marker for which each patient was homozygous is shown in light gray shading. In FIG. 2B, R and Q in the row of PON1 and A and G in the row of PON2 are respectively 192 of PON1.
, The 148th amino acid of PON2,
CC, CT and TT are -154, respectively, 5 'upstream of the PDK4 gene.
(C or T) and the -209th (C or T) base. In patients, the three markers, in both cases the chi ² and P values, the percentage of homozygous was significantly higher. That is, χ ² and P value are 42.1 and 8.7, respectively.
a x 10 ^-11 is D7S527,25.8 and 3.9x10 ^-7 D7S181
2, and D7S821 which is 25.7 and 3.9 × 10 ^-7 . Five different groups based on a common haplotype (I / I, II
/ II, III / III, I / IV and I / V), indicating the presence of five different disease gene-bearing chromosomes as shown in FIG.

In an effort to construct a complete genetic map of chromosome 7q, at least 17
Genes were identified (FIG. 3). PDK4, TFPI-2 and PO
The N gene was a positional (and functional) candidate for CTLN2, but when the nucleotide sequences of these coding regions were determined,
No mutation was found. Gene identification experiments in the immediate region, including D7S1812, indicated the presence of the mid-chain dynein gene (DNCI1) and a previously uncharacterized gene. By combining DNA sequencing and analysis, EST mapping, and cDNA library screening and characterization, the latter gene (designated SLC25A13) has 18 exons and has about 200 exons.
kb of DNA. This gene also included the D7S1812 marker (FIG. 3), and mutation screening ultimately identified it as the CTNL2 gene.

FIG. 3 shows a physical map of the CTNL2 locus at 7q21.3. The YAC contig covering 7q21.3 and the known genes within this chromosomal band are shown.
If known, the direction of transcription of the gene from 5 'to 3' is indicated by an arrow. The genetic markers used in this study were ordered according to their position in the YAC contig,
Shown with black circles. Three additional genetic markers (D7S15
13, D7S2430 and D7S1849) are also shown with white circles. The gene responsible for CTLN2 is shown as SLC25A13. D7S1812, which was homozygous in all patients analyzed, is located between exons 15 and 16 of SLC25A13. The YAC clone is from a known chromosome 7-specific YAC library.

From the nucleotide sequence analysis, it was found that the full length of SLC25A13 cDNA was 3135 bp, and the expected open reading frame (ORF) was 2025 bp. DNA (ggcgaatcat at the vicinity of the putative ATG translation initiation site)
g cg) is the Kozak consensus sequence (Kozak, M., Mamm. Gen.
ome 7, 563-574 (1996))
It has a guanine residue.

The putative protein named "Citrine", encoded by SLC25A13, consists of 675 amino acid residues and has a molecular weight of about 74 kDa (FIG. 4). C
The terminal region is the mitochondrial solute carrier family (K
uan, J. Crit. Rev. Biochem. Mol. Biol. 28, 209-233
(1993)) (20-30% amino acid identity). The N-terminal region is composed of four putative EF-hand regions (Kawasak
i, H. et al., Protein Profile 1, 343-517 (1994)). The overall structure of citrine is based on the mitochondrial carrier superfamily (del A
rco, A. et al., supra), and
C. elegans protein (Q21153) and 77.8% and 53.
Has 7% homology. Alignment of citrine with the Allar and Q21153 proteins revealed that the sequences were highly conserved except for the regions near the N- and C-termini (FIG. 4). These sequence features
Like Alala, citrine is also located in the mitochondrial membrane, suggesting that it may function as a calcium-dependent mitochondrial solute carrier (del Arco, A. et al., Supra).

FIG. 4 shows an alignment comparison between citrine and related proteins. Citrine (SLC25A13 protein) and Alara
2 shows a comparison between the deduced amino acid sequences of (SLC25A12 protein) and C. elegans Q21153 protein. Amino acid identity and conservation are highlighted by black or spots, respectively. Citrine has four putative EF-hand regions (28 to 3
9, 66-77, 100-111, 171-182 residues), which are conserved in calcium-binding proteins (Kawasaki, H. et al., Protein Profile
1, 343-517 (1994)). GX ₃ GX ₈ PX (D / E) X (I / L / V) (K / R) X (R / K), a typical mitochondrial carrier signature
XQX _20-30 GX ₄ (Y / W) (R / K) GX ₉ P is observed in the C-terminal half region of citrine (335-403, 435-49).
5 and 527-591 residues). Like other members of the mitochondrial solute carrier family, citrine contains a repeating sequence about 100 residues in length. Each repeat region consists of two transmembrane regions (T
M). The first region is more hydrophobic and has conserved glycine and proline residues, and the second region is more hydrophilic and has highly conserved hydrophilic residues in defined positions.
(Kuan, J. Crit. Rev. Biochem. Mol. Biol. 28, 209-2
33 (1993)). The functional areas are indicated by black and white boxes, indicating the EF-hand and TM helix, respectively. TM in each of the three repeating regions of the C-terminal three-region structure
Each pair of helices is indicated by a line connecting them.

Northern blot analysis of poly (A) ⁺ RNA from human tissues shows that probes from different regions of the SLC25A13 cDNA detect a major hybridization band of approximately 3.4 kb in most tissues examined. (A in FIG. 5). The observation that the level of expression in the liver is highest is consistent with the fact that this gene is associated with liver-specific CTNL2. In contrast to the relatively ubiquitous expression of SLC25A13, the malaN of Arara with two major bands at 3.3 kb and 2.8 kb and a weak band at 6.6 kb
A is well expressed in heart, brain and skeletal muscle,
It is not expressed in the liver (FIG. 5b).

FIG. 5 shows the expression profile of SLC25A13. Northern blots containing poly (A) ⁺ RNA (2 μg) from human tissues as shown in FIG. 5 were analyzed using SLC25A13-specific probe (5 ′ side of coding region) (a) and allah-specific probe (5% of coding region). 'Side) (b), and hybridized continuously with β-actin-specific probe (c). H
Is heart, B is brain, Pl is placenta, Lu is lung, Li is liver,
Sk means skeletal muscle, K means kidney, and Pa means pancreas. β-
Actin mRNA was detected as an internal control. SLC25A
In contrast to 13 mRNA (3.4 kb), the expression of allar (SLC25A12) was not observed in the liver, and two major bands of size 3.3 kb and 2.8 kb were observed in heart, brain and skeletal muscle. . A band of a size of about 6.6 kb, which is weaker but clearly specific, was also observed.

As shown in FIG. 6, in SLC25A13 of all 18 kin married CTLN2 patients, five different mutations ([I]-[V] defined initially by the haplotype shown in FIG. ] Were identified and confirmed to be the etiology of CTLN2. Thus, individual mutations were detected in genomic DNA from the CTLN2 patient. The mutation found was a 4 bp deletion resulting in [I] frameshifting and the introduction of a stop codon, [II] TM1
And [III] a 23 bp insertion resulting in a stop mutation, [IV] a substitution resulting in a nonsense mutation, and a [V] substitution causing a deletion of exon 13. 6).

FIG. 6 shows a putative topological model of human citrine and mutation in CTLN2 patients. This is a schematic diagram of human citrine, deduced based on the amino acid sequence (FIG. 4), showing the approximate location of the mutation caused by mutation [IV] of SLC25A13.

The identification of an independent mutation describing each observed haplotype at 7q21.3 (FIG. 2b) strongly suggests that CTNL2 is caused by a single gene. Of the 18 patients born to relatives of a kin marriage, up to 15 were homozygous for each mutation. Surprisingly, the three patients
He was heterozygous despite being born of a relative of marriage. This suggests a high incidence and / or low expression rate of the disease among Japanese. The same mutations described above were also observed in all 10 non-kind marriage patients. In addition, of the 127 unrelated controls, only one had the S225X sequence mutation, and this human is probably a carrier of the disease (this observation indicates that the frequency of CTLN2 carriers in Japanese was low). Is 1
(Consistent with expectations of between / 150 and 1/200).

Example 2 Detection of Mutation Using PCR or PCR-RFLP Genomic DNA was extracted from peripheral blood lymphocytes of a healthy person or a CTNL2 patient by an ordinary method. Using this as a template, a nucleic acid fragment was amplified by PCR using a primer set for detecting the following mutations according to a conventional method.

(1) Mutation detection primer set Forward side: IVS-8F2 (5'-ggtatatttgtttgcttgtgtttg-
3 ') (base sequence from 166th to 188th from the 5' end of SEQ ID NO: 3) Reverse side: Ex-9B (5'-tcttccagaggagcaatccg-3 ') (hybridizes with 874nt to 893nt of the coding region of SEQ ID NO: 1) )

(2) Primer set for mutation detection Forward side: Ex-11F2 (5'-gaaagtgctacgctatgaagg-
3 ') (1137 nt to 1157 nt of the coding region of SEQ ID NO: 1) Reverse side: IVS-11Bm2 (5'-aggtattgagcatgtggcact g-
3 ′) (hybridizes with the 3rd to 24th base sequence from the 5 ′ end of SEQ ID NO: 6 (however, the 3 ′ end of the primer is non-complementary))

Primer set for mutation detection of (3) Forward side: IVS-15F2 (5'-tgttgtgtctctctcctgcagg-
3 ') (1602 nt from the 5' end of SEQ ID NO: 7 to 1592 nt of the coding region of cDNA of SEQ ID NO: 1) Reverse side: Ex-16B (5'-gcagtctatcactccgctgt-3 ')
(1676 nt to 1695 nt of the coding region of the cDNA of SEQ ID NO: 1)
And hybridize)

(4) Primer set for mutation detection Forward side: ISV-6F (5'-ggagagtacaagttctggtc-3 ')
(The 72nd to 91st base sequence from the 5 'end of SEQ ID NO: 10) Reverse side: ISV-7B (5'-actagttgccttcttcaccc-3')
(Hybridizes with the 57th to 76th base sequence from the 5 'end of SEQ ID NO: 11)

(5) Mutation detection primer set Forward side: Ex-13F (5'-gtgaacgattttgtgagggata-3 ')
(Base sequence of 1231 nt to 1250 nt of the coding region of SEQ ID NO: 1) Reverse side: IVS-13Bm (5'-gaagagagcttcaaaaggtactt c-
3 ') (Hybridizes with the 2nd to 26th base sequence from the 5' end of SEQ ID NO: 13 (however, the 3 'end of the primer is non-complementary)

When the mutation in (1) was examined, the amplification product was directly subjected to agarose gel electrophoresis after amplification by PCR using the above primer set. As a result, in the case of a normal gene, an amplified fragment of 82 bp is detected,
In the case of the mutant gene having the mutation of (1), 78 bp
Amplified fragment was detected.

In the case of examining the mutation of (2), after amplification by PCR using the above primer set, digestion was carried out with Sau3AI, and the digestion product was subjected to agarose gel electrophoresis. As a result, in the case of the normal gene, an amplified fragment of 65 bp was detected, and in the case of the mutant gene having the mutation of (2), two amplified fragments of 42 bp and 23 bp were detected.

When the mutation of (3) was examined, the amplification product was directly subjected to agarose gel electrophoresis after amplification by PCR using the above primer set. As a result, in the case of a normal gene, an amplified fragment of 123 bp is detected,
In the case of the mutant gene having the mutation of (3), 146b
An amplified fragment of p was detected.

When examining the mutation of (4), amplification was performed by PCR using the above primer set, followed by digestion with AluI, and the digestion product was subjected to agarose gel electrophoresis. As a result, in the case of the normal gene, 57 bp and 369 bp
Are detected, and in the case of the mutant gene having the mutation of (4), 57 bp, 214 bp and 155 b
Three amplified fragments of p were detected.

When examining the mutation of (5), amplification was performed by PCR using the above primer set, followed by digestion with PstI, and the digestion product was subjected to agarose gel electrophoresis. As a result, in the case of the normal gene, an amplified fragment of 106 bp was detected, and in the case of the mutant gene having the mutation of (2), two amplified fragments of 80 bp and 26 bp were detected.

Example 3 Preparation of Recombinant Citrin Protein As a recombinant citrine protein, N-half (883 b
p), C-half (1188 bp), Full-length (2044 bp), C
Four types of outer terminal membrane (201 bp) were prepared. First Strand cDNA Synthe using mRNA extracted from human hepatocytes
cDNA was synthesized using the sis Kit (Pharmacia Biotech). Using that cDNA as a template, RT
-PCR was performed. Primer combinations are N-half:
ORF-1FN (5'-taggatccg atggcggccgccaaggtg -3 ') and ORF-1B
(5'-tcggatc caatgtctgctaaggtcgtc -3 '), C-half: ORF-
2F (5'-tgca tatgaccttagcagacattgaa -3 ') and ORF-2B (5'-
tcgga tcctatgggcctccaccaa -3 '), Full-length: ORF-1F
N and ORF-2B, C-terminal outside: Ex17F (5'-caagcttcat atggga
tcagagccagttcc -3 ') and ORF-2B, and the underlined part is Citrin
1 shows the nucleotide sequence of cDNA. PCR conditions are all 1 cycl
e (94 ° C, 5 minutes), 30 cycles (94 ° C, 1 minute; 58 ° C, 1
Min; 72 ° C, 4 minutes) and 1 cycle (72 ° C, 20 minutes). The PCR-product was subjected to electrophoresis using 1% agarose S gel (Nippon Gene), the target band was cut out, and the DNA was extracted from the gel by QIAEX II (QIAGEN). Target DNA is incorporated into TA vector (Invitrogen),
Cloned. After selection of Positive clones, each plasmid was cut with an appropriate restriction enzyme. PET obtained by cutting the obtained insert DNA with the corresponding restriction enzyme
-15b vector (Novagen) was cloned. BamHI was used for N-half and Full-length, and NdeI and BamHI were used for C-half and outside of C-terminal membrane. Target DNA
Transfection of BL21 (DE3) cells with plasmid inserted into pET-15b
When the OD600nm of the culture solution reached about 0.5-0.6, protein expression was carried out by adding IPTG having a final concentration of 0.4 mM and further culturing for 4 hours. 5.
The cells were collected by centrifugation at 000 g for 20 minutes at 4 ° C. The precipitate is washed with 20 mM Tri
The suspension was suspended in an s-HCl (pH 8.0), 1 mM DTT, 1% Triton X-100 solution, freeze-thawed three times, and centrifuged at 5,000 g for 20 minutes at 4 ° C. The precipitate is washed with 0.1 M Tris-HCl (pH
8.0) and applied to the Ni-column of His-Tag System, then 0.1 M Imidazole, 0.5 M NaCl, 20 M in the presence of 8 M Urea
The target protein is eluted using mM Tris-HCl (pH 8.0) solution,
Purification was performed. The fraction containing the target protein was concentrated with 10% final concentration of trichloroacetic acid, and the final precipitate was washed twice with 100% ethanol and stored at -20 ° C.

Example 4 Preparation of Anti-Citrine Antibody 400 μg of the recombinant protein purified by the above method was added to 250
After dissolving with 20 mM Tris-HCl (pH 8.0) in the presence of μl of 8 M Urea, the same amount of TiterMax Gold (CytRx) was added, mixed by sonication, and the mixture was injected into rabbits. Three weeks after the first immunization, a second immunization was performed in the same manner, and the antibody titer was measured by ELISA. Four weeks after the first immunization, a third immunization was performed, and one week later, whole blood was collected to obtain an antiserum.

[0054]

According to the present invention, for the first time, CTNL2 can be easily and reliably diagnosed by genetic test or immunoassay.

[0055]

[Sequence List] SEQUENCE LISTING <110> Keiko KOBAYASHI et al., <120> Method for diagnosing adult-onset type II citrullinemia <130> 99602 <160> 13

<210> 1 <211> 3159 <212> DNA <213> Homo sapiens <400> 1 ggccaggaac gcacgctgcc tggccgtatc gccgccccca ccgacgccgc cgccgggact 60 agaagtgagc cgcccgg gcgcc gcgcc gccc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc gcc aga 170 Met Ala Ala Ala Lys Val Ala Leu Thr Lys Arg 1 5 10 gca gat cca gct gag ctt aga aca ata ttt ttg aag tat gca agc att 218 Ala Asp Pro Ala Glu Leu Arg Thr Ile Phe Leu Lys Tyr Ala Ser Ile 15 20 25 gag aaa aac ggt gaa ttt ttc atg tcc ccc aat gac ttt gtc act cga 266 Glu Lys Asn Gly Glu Phe Phe Met Ser Pro Asn Asp Phe Val Thr Arg 30 35 40 tac ttg aac att ttt gga gaa agc cag cct aat cca aag act gtg gaa 314 Tyr Leu Asn Ile Phe Gly Glu Ser Gln Pro Asn Pro Lys Thr Val Glu 45 50 55 ctt tta agt gga gtg gtg gat cag acc aaa gat gga tta ata tct ttt 362 Leu Leu Ser Gly Val Val Asp Gln Thr Lys Asp Gly Leu Ile Ser Phe 60 65 70 75 caa gaa ttt gtt gcc ttt gaa tct gtc ctg tgt gcc cct gat gct ttg 410 Gln Glu Phe Val Ala Phe Glu Ser V al Leu Cys Ala Pro Asp Ala Leu 80 85 90 ttt atg gta gcc ttt cag ctg ttt gac aaa gct ggc aaa gga gaa gta 458 Phe Met Val Ala Phe Gln Leu Phe Asp Lys Ala Gly Lys Gly Glu Val 95 100 105 act ttt gag gat gtt aag caa gtt ttt gga cag acc aca att cat caa 506 Thr Phe Glu Asp Val Lys Gln Val Phe Gly Gln Thr Thr Ile His Gln 110 115 120 cat att cca ttt aac tgg gat tca gaa ttt gtg caa cta cat ttt gga 554 His Ile Pro Phe Asn Trp Asp Ser Glu Phe Val Gln Leu His Phe Gly 125 130 135 aaa gaa aga aaa aga cac ctg aca tat gcg gaa ttt act cag ttt tta 602 Lys Glu Arg Lys Arg His Leu Thr Tyr Ala Glu Phe Thr Gln Phe Leu 140 145 150 155 ttg gaa ata caa ctg gag cac gca aag caa gcc ttt gtg caa cgg gac 650 Leu Glu Ile Gln Leu Glu His Ala Lys Gln Ala Phe Val Gln Arg Asp 160 165 170 aat gct agg act ggg aga gtca gcc atc gac ttc cga gac atc atg 698 Asn Ala Arg Thr Gly Arg Val Thr Ala Ile Asp Phe Arg Asp Ile Met 175 180 185 gtc acc atc cgc ccc cat gtc ttg act cct ttt gta gaa gaa tgt cta 746 Val Thr Ile Arg Pro His V al Leu Thr Pro Phe Val Glu Glu Cys Leu 190 195 200 gta gct gct gct gga ggt acc aca tcc cat caa gtt agt ttc tcc tat 794 Val Ala Ala Ala Gly Gly Thr Thr Ser His Gln Val Ser Phe Ser Tyr 205 210 215 ttt aat gga ttt aat tcg ctc ctt aac aac atg gaa ctc att aga aag 842 Phe Asn Gly Phe Asn Ser Leu Leu Asn Asn Met Glu Leu Ile Arg Lys 220 225 230 235 atc tat agc act ctg gct ggc acc agg aaa gat gtt act aag 890 Ile Tyr Ser Thr Leu Ala Gly Thr Arg Lys Asp Val Glu Val Thr Lys 240 245 250 gag gag ttt gtt ctg gca gct cag aaa ttt ggt cag gtt aca ccc atg 938 Glu Glu Phe Val Leu Ala Ala Gln Lys Phe Gly Gln Val Thr Pro Met 255 260 265 gaa gtt gac atc ttg ttt cag tta gca gat tta tat gag cca agg gga 986 Glu Val Asp Ile Leu Phe Gln Leu Ala Asp Leu Tyr Glu Pro Arg Gly 270 275 275 280 cgt atg acc tta gca gac att gaa cgg att gct cct ctg gaa gag gga 1034 Arg Met Thr Leu Ala Asp Ile Glu Arg Ile Ala Pro Leu Glu Glu Gly 285 290 295 act ctg ccc ttt aac ttg gct gag gcc cag agg cag aag gcc Leca ggt 1082 Thr o Phe Asn Leu Ala Glu Ala Gln Arg Gln Lys Ala Ser Gly 300 305 310 315 gat tca gct cga cca gtt ctt cta caa gtt gca gag tcg gcc tac agg 1130 Asp Ser Ala Arg Pro Val Leu Leu Gln Val Ala Glu Ser Ala Tyr Arg 320 325 330 ttt ggt ctg ggt tct gtt gct gga gct gtt gga gcc act gct gtg tat 1178 Phe Gly Leu Gly Ser Val Ala Gly Ala Val Gly Ala Thr Ala Val Tyr 335 340 345 cct atc gat ctt gta aaa act cga atg cag aac caa cga tca act ggc 1226 Pro Ile Asp Leu Val Lys Thr Arg Met Gln Asn Gln Arg Ser Thr Gly 350 355 360 tct ttt gtg gga gaa ctc atg tat aaa aac agc ttt gac tgt ttt aag 1274 Ser Phe Val Gly Glu Leu Met Tyr Lys Asn Ser Phe Asp Cys Phe Lys 365 370 375 aaa gtg cta cgc tat gaa ggc ttc ttt gga ctg tat aga ggt ctg ttg 1322 Lys Val Leu Arg Tyr Glu Gly Phe Phe Gly Leu Tyr Arg Gly Leu Leu 380 c cag tta ttg gga gtt gcc cca gag aag gcc ata aaa ctt aca gtg 1370 Pro Gln Leu Leu Gly Val Ala Pro Glu Lys Ala Ile Lys Leu Thr Val 400 405 410 aac gat ttt gtg agg gat aaa ttt atg cac aaa gat ggt tcg gtc cca 1418 Asn Asp Phe Val Arg Asp Lys Phe Met His Lys Asp Gly Ser Val Pro 415 420 425 ctt gca gca gaa att ctt gct gga ggc tgc gct gga ggc tcc cag gtg 1466 Leu Ala Ala Glu Ile Leu Ala Gly Cys Gly Gly Ser Gln Val 430 435 440 att ttc aca aat cct tta gaa atc gtc aag atc cgt ttg caa gtg gca 1514 Ile Phe Thr Asn Pro Leu Glu Ile Val Lys Ile Arg Leu Gln Val Ala 445 450 455 gga gaa atc acc ggt cct cga gtc agt gct ctg tct gtc gtg cgg 1562 Gly Glu Ile Thr Thr Gly Pro Arg Val Ser Ala Leu Ser Val Val Arg 460 465 470 475 gac ctg ggg ttt ttt ggg atc tac aag ggt gcc aaa gca tgc ttt Lecg 1610 Asp Gly Phe Phe Gly Ile Tyr Lys Gly Ala Lys Ala Cys Phe Leu 480 485 490 cgg gac att cct ttc tcg gcc atc tac ttt ccg tgc tat gct cat gtg 1658 Arg Asp Ile Pro Phe Ser Ala Ile Tyr Phe Pro Cys Tyr Ala 495 500 505 aag gct tcc ttt gca aat gaa gat ggg cag gtt agc cca gga agc ctg 1706 Lys Ala Ser Phe Ala Asn Glu Asp Gly Gln Val Ser Pro Gly Ser Leu 510 515 520 ctc tta gct ggt gcc ata gct ggt atg cct gca gca tct tta gtg acc 1754 Leu Leu Ala Gly Ala Ile Ala Gly Met Pro Ala Ala Ser Leu Val Thr 525 530 535 cct gct gat gtt atc aag acg aga tta cag gtg gct gcc cgg gct ggc 1802 Pro Ala Asp Val Ile Lys Thr Arg Leu Gln Val Ala Ala Arg Ala Gly 540 545 550 555 caa acc act tac agc gga gtg ata gac tgc ttt aga aag ata ctg cgt 1850 Gln Thr Thr Tyr Ser Gly Val Ile Asp Cys Phe Arg Lys Ile Leu Arg 560 565 570 gaa gaa gga cca aaa gct ctg tgg aag gga gct ggt gct cgt gta ttt 1898 Glu Glu Gly Pro Lys Ala Leu Trp Lys Gly Ala Gly Ala Arg Val Phe 575 580 585 cga tcc tca ccc cag ttt ggt gta act ttg ctg act ttg cta 1946 Arg Ser Ser Pro Gln Phe Gly Val Thr Leu Leu Thr Tyr Glu Leu Leu 590 595 600 cag cga tgg ttc tac att gat ttt gga gga gta aaa ccc atg gga tca 1994 Gln Arg Trp Phe Tyr Ile Asp Phe Gly Gly Val Lys Pro Met Gly Ser 605 610 615 gag cca gtt cct aaa tcc agg atc aac ctg cct gcc ccg aat cct gat 2042 Glu Pro Val Pro Lys Ser Arg Ile Asn Leu Pro Ala Pro Asn Pro Asp 620 625 630 635 cac gtt ggg g gc tac aaa ctg gca gtt gct aca ttt gca ggg att gaa 2090 His Val Gly Gly Tyr Lys Leu Ala Val Ala Thr Phe Ala Gly Ile Glu 640 645 650 aac aaa ttt gga ctt tac cta cct ctc ttc aag cca tca gta tacc 2 Asn Lys Phe Gly Leu Tyr Leu Pro Leu Phe Lys Pro Ser Val Ser Thr 655 660 665 tca aag gct att ggt gga ggc cca taggaagatc agccctggga tagtgctgtc 2192 Ser Lys Ala Ile Gly Gly Gly Pro 670 675 tttttgc tctgcc tctgcc tctgcc tctgcc tctgcc tctgcc tctgca tg aaattcaagt ccaggctttt ttatcatgtg aaatcattca 2312 ttttctgggt gttttcttaa ccagatcatt gtgaaattat tcataattat tatttggccc 2372 tctgcccaga aacctttgtt tgcatctgaa aattgatggg atttggtcaa cactaacatg 2432 atttggggaa aggagcaagt cagaatagaa attagtactc ccctccttga actaggattg 2492 tagtcccaaa gaggctactg taaggcaatc atggtgctca gagcagtgtt tcgtgtgtgt 2552 tttaaactgg taggaaacta ggtgcatatt tataaaaata aaaaacactg ggagaaatga 2612 aaaaatatat atcaaatata ttcagcctgg cttcaaattg taagcatgca caaattctgt 2672 ctctggatta tattatgaag cttttatgtg aaacatgttt c tttgtaatg aaaaccacat 2732 tggagatgtt tagtaatcat attgttactg gtaccaagac tactagggaa atgcctttgt 2792 actttaggga agtacttttg gcattttact gtacagacag aaaaaactga gatgtagccc 2852 ctctcctgga agtgctaatt ttgaaaaact gctcatatga tgtacatgta ctgattactg 2912 cctattttaa taaacactct tgaaaaatgc atgttgccct gttgctgcct gccctattct 2972 cctcatctcc ccatcattgg tacccacttg cttttaaaat ccactttatc ttgaataatg 3032 taagacaaat atgttctgac ataagtattt aattcatgtt gccttgcata atggtcagag 3092 gcgcatgaat ttgtgaaggt ggaaataaac tatttgtaaa gtgaaaaaaa aaaaaaaaaa 3152 aaaaaaa 3159

<210> 2 <211> 101 <212> DNA <213> Homo sapiens <400> 2 aaagttttgt gatgttcact cattccagtg ccttgagtta atgctgaatt tagtggctat 60 ttcttcttga atctttccct tttaactttt cttccataca g 101

<210> 3 <211> 202 <212> DNA <213> Homo sapiens <400> 3 gtaagttggc tttttttttt ttttttttgg aattagctta ataaaaggag gttaggagga 60 gggcagcaat caggagaaaa agaag tagagaatattt 120g

<210> 4 <211> 118 <212> DNA <213> Homo sapiens <400> 4 gtgagcaaag aggagcaaac ttgcattctg gggtttcctt agcaggatac cccaaccctg 60 ttccacttgc agttgccttt gcggcattgg tatctgacttgttattttt

[0060] <210> 5 <211> 240 <212> DNA <213> Homo sapiens <400> 5 ttgggctgta gcaatgtgcc ttaatttaaa atatctatga catcctttta ttaggggata 60 cttgaatgaa aaccctcaat tgtttattaa agatataaga aaggtagtac tgttttaaaa 120 tctgtattta aaattcaaaa cacatttctt ttctcagtct tgtccttgac tttaactacc 180 ttcttctttc ttctgaccta tcttactttc ttctgagata atgatattgt ttaattttag 240

<210> 6 <211> 201 <212> DNA <213> Homo sapiens <400> 6 gttagtgcca catgctcaat acctgttagg tgaaataaca ctcaaaggtt tggtttctca 60 tcttagtgcc tgacatgaat tagcaagact gcgttaacat caggattgca tagcagact catcaccagattcatcac cagattcatcac cagattcatcac cagattcatcac cagattcatcag cagattcatcag cagattttcac cagattttg

<210> 7 <211> 179 <212> DNA <213> Homo sapiens <400> 7 ggagcagaca tcttgcacac aggagaggca tggttgcatt tcccatagag gacagcaaaa 60 taggcatttt attgaatcgg atttttaact ttctttccac ggccagcagt tcagtagtagcagt tcagag tgtcagtcagt tcagag

<210> 8 <211> 93 <212> DNA <213> Homo sapiens <400> 8 gtatggaaat aatgtgttct taactaactc tttggtatca ggtaaatttt taaaatatct 60 aattatatct gtgatttctc cattttttta aag 93

<210> 9 <211> 198 <212> DNA <213> Homo sapiens <400> 9 gtaagtatca tgctaaatct gctgctaaat tttggctgct gctaatgctc tgttgtcgta cat

[0065] <210> 10 <211> 282 <212> DNA <213> Homo sapiens <400> 10 aactctaaat tactactagt cctgttataa tcctacacat gtatttattt agttttctag 60 gagttgtgta tggagagtac aagttctggt catgattagt tgcagttgct tctaaaaatc 120 atttatagct tttttttaat gcaaaagaaa aatacttata gtcatttctt cttgtacatg 180 catttttgat tactttcaaa ctagttttag atgtatgtac ttctgaatca tctataaatc 240 ttttgtatat ttttcttctc tcttgttttc aatttatttg ag 282

<210> 11 <211> 129 <212> DNA <213> Homo sapiens <400> 11 gtgagtgaga atatatctga attctagcct gcaagtattg tggtgtatta ttattagggt 60 gaagaaggca actagtactt tattattttt ctatcccatt gacacatatt aactatag taga 120 ta

[0067] <210> 12 <211> 270 <212> DNA <213> Homo sapiens <400> 12 tctaattgca gaacatattt ttggctttca tttatctttt aacttttctc ctgaaacatc 60 agtgatgcat atatattttt cattttttaa aactattata ctattaagag tacttctcaa 120 actattttaa gatctgttaa attgtgcaat ttatgattac tccaatagac tgatagaaaa 180 aaatagcata tattgacaga tgcatattta taagtgttta atgactttct ttatattttt 240 catcagcttc tataaatatt tttcttcaag 270

<210> 13 <211> 129 <212> DNA <213> Homo sapiens <400> 13 gtaagtacct tttgaagctc tcttcattga aaagacttgt ttcacatata tatcactacc 60 atggtcaaca ggtgtggact aaggcttctg tttaaccaca gatcctgcag agagactag

[Brief description of the drawings]

FIG. 1 is a diagram showing the genetic mapping of CTLN2 on chromosome 7.

FIG. 2 shows a list of 18 CTNL2 patients (a) and corresponding haplotypes (b) from kin married parents.

FIG. 3 shows a physical map of the CTNL2 locus on chromosome 7q21.3.

FIG. 4 is a diagram showing an alignment comparison between citrine and related proteins.

FIG. 5 is a view showing an expression profile of SLC25A13 mRNA.

FIG. 6 shows a putative topological model of human citrine and mutations in CTNL2 patients.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/53 G01N 33/53 D 33/68 33/68 // C07K 16/40 C07K 16/40 (71 ) Applicant 599063251 Stephen W. Schaller M5G 1X8 Ontario Toronto University Venue 555 The Hospital for Thick Children (72) Inventor Keiko Kobayashi 1-chome Sakuragaoka, Kagoshima, Kagoshima 29-17 (72) Inventor Takeori Saeki 1-29-8 Sakuragaoka, Kagoshima City, Kagoshima Prefecture (72) Inventor Stephen W. Schaller M5G 1X8 Toronto, Ontario University Venue 555 The Hospital・ For shy・ F-term in children (reference) 2G045 AA25 AA34 AA35 DA13 DA14 DA36 FB01 FB03 4B024 AA11 BA80 CA03 HA11 4B063 QA08 QA17 QA19 QQ02 QQ40 QQ42 QR08 QR62 QS25 QS33 QS34 QX02 4B011 AG10 CA10 DA10 FA74

Claims (10)

[Claims] 1. Genomic DNA or mR in a test sample
A method for diagnosing adult-onset type II citrullinemia, comprising examining at least one of the following (1) to (5) for NA or cDNA synthesized from the mRNA: (1) A mutation in which the 851-nt to 854-nt region of the SLC25A13 cDNA coding region represented by SEQ ID NO: 1 in the sequence listing is deleted
Or, whether it is present in mRNA, or whether there is a mutation corresponding to the mutation in genomic DNA. (2) G at the 5 ′ end of the eleventh intron of the SLC25A13 gene, which is located at a position corresponding to between 1177 nt and 1178 nt in the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing
Whether there is a mutation that substitutes for A. (3) A 23 bp region corresponding to 1638 nt to 1660 nt of the coding region of SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing,
Between 1637 nt and 1638 nt or 1660 nt and 1661 nt of the coding region
Whether there is a mutation in the cDNA or mRNA inserted at any site between
Whether a mutation corresponding to the mutation is present in A. (4) Whether or not a mutation in which the 674 nt C in the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing substitutes for A is present in the cDNA or mRNA;
Whether there is a mutation corresponding to the mutation in NA. (5) G at the 5 ′ end of the 13th intron of the SLC25A13 gene, which is located at a position corresponding to between 1311 nt and 1312 nt of the coding region of the SLC25A13 cDNA represented by SEQ ID NO: 1 in the sequence listing
Whether there is a mutation that substitutes for A. 2. The presence or absence of the mutation according to (1) or (3),
The method according to claim 1, wherein the method is carried out by amplifying a nucleic acid region containing any of these mutations and examining the presence or absence of the mutation from the size of the amplified nucleic acid fragment. 3. The presence or absence of the mutation described in (2), (4) or (5) above, the nucleic acid region containing any of these mutations is amplified, and the amplified nucleic acid fragment is subjected to the presence or absence of the mutation. The method according to claim 1 or 2, wherein the digestion is carried out by digesting with a restriction enzyme that produces a digested nucleic acid fragment having a different size, and examining the presence or absence of the mutation from the size of the digested nucleic acid fragment produced by the digestion. 4. The method according to claim 1, wherein the mutation described in (1) to (5) is examined to determine whether the mutation is present in genomic DNA.
The method according to any one of claims 1 to 4. 5. The method according to claim 1, wherein the presence or absence of the mutation described in (1) to (5) is performed by examining a protein encoded by the cDNA. 6. The method according to claim 5, which is performed by an immunoassay. 7. The method according to any one of claims 1 to 6, wherein the presence or absence of all the mutations described in (1) to (5) is examined. 8. A primer for nucleic acid amplification used in the method according to claim 2 or 3. 9. A protein encoded by a cDNA having the nucleotide sequence shown in SEQ ID NO: 1 of the sequence listing or a mutant thereof containing any of the above-mentioned mutations (1) to (5); A modified protein in which a plurality of amino acid residues have been deleted or substituted, or one or more amino acid residues have been added or inserted into the protein, wherein the modified protein immunoreacts with an antibody against the protein. 10. A nucleic acid encoding the protein or the modified protein according to claim 9.