WO2002014373A1 - Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire - Google Patents

Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire Download PDF

Info

Publication number
WO2002014373A1
WO2002014373A1 PCT/JP2001/006967 JP0106967W WO0214373A1 WO 2002014373 A1 WO2002014373 A1 WO 2002014373A1 JP 0106967 W JP0106967 W JP 0106967W WO 0214373 A1 WO0214373 A1 WO 0214373A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
low
binding protein
weight gtp
gtp
Prior art date
Application number
PCT/JP2001/006967
Other languages
English (en)
Japanese (ja)
Inventor
Michiyuki Matsuda
Original Assignee
Michiyuki Matsuda
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/JP2001/000631 external-priority patent/WO2001034766A2/fr
Priority claimed from PCT/JP2001/004421 external-priority patent/WO2002014372A1/fr
Application filed by Michiyuki Matsuda filed Critical Michiyuki Matsuda
Priority to GB0305675A priority Critical patent/GB2383796B/en
Priority to JP2002519510A priority patent/JP3842729B2/ja
Priority to AU7777501A priority patent/AU7777501A/xx
Priority to CA002419503A priority patent/CA2419503A1/fr
Priority to US10/344,404 priority patent/US20040053328A1/en
Priority to AU2001277775A priority patent/AU2001277775B2/en
Publication of WO2002014373A1 publication Critical patent/WO2002014373A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes

Definitions

  • the present invention relates to a protein for monitoring the activity of a low molecular weight GTP-binding protein, a gene encoding the protein, an expression vector containing the gene, transformed cells and a transgenic animal carrying the expression vector,
  • the present invention relates to a method for measuring the activation of a low-molecular-weight GTP-binding protein using a protein, and a method for screening a substance for regulating the activity of a low-molecular-weight GTP-binding protein.
  • GTP-binding proteins are numerous and serve as important molecular switches. Therefore, it has been analyzed in great detail.
  • the low molecular weight GTP-binding proteins are composed of the Ras family, the Rh0 family, the Rab family, the Ran family, etc. (Reference 1). These low-molecular-weight GTP-binding proteins are important molecular switches that control diverse intracellular signal transduction such as cell proliferation, cytoskeleton, intracellular transport, and nuclear transport.
  • Low molecular weight GTP-binding proteins cycle between an inactivated form that binds to GDP and an activated form that binds to GTP ( Figure 1).
  • the GTP-binding form binds to a target protein specific to each GTP-binding protein and activates the target protein.
  • the protein that catalyzes the reaction of converting GDP-linked to GTP-linked is a guanine nucleotide exchange factor, and the protein that catalyzes the reaction of converting GTP-linked to GDP-linked is GTPase-activating enzyme (GTPase activator). ).
  • GTPase activator GTPase activator
  • GFP green fluorescent protein
  • GFPs include CFP (cyan-emitting mutant of GFP) and YFP (yellow-emitting mutant of GFP), and improved proteins such as EGFP (enhanced green fluorescent protein) and ECFP (enhanced green fluorescent protein) CFP), EYFP (enhanced YFP), EBFP (enhanced blue-emitting mutant of GFP) and the like (in the present specification, these are collectively referred to as GFP-related proteins). Each of these is excited by light of a different wavelength and emits fluorescence of a different wavelength.
  • FRET fluorescent resonance energy transfer
  • the present invention relates to a protein for monitoring the activity of a low-molecular-weight GTP-binding protein, which enables non-invasive measurement of the activation of a low-molecular-weight GTP-binding protein; a gene encoding the protein; an expression vector containing the gene; Transformed cells and transgenic animals carrying the expression vector that express the protein and are useful for measuring the activation of non-invasive low molecular weight GTP-binding proteins; and the use of the protein.
  • a method for measuring the activation of a low-molecular-weight GTP-binding protein more specifically, a method for measuring the amount ratio of GTP-binding to GDP-binding low-molecular-weight GTP-binding protein that can be used in living cells; and low-molecular-weight GTP-binding It is an object of the present invention to provide a method for screening a protein activity modulator.
  • the gist of the present invention is:
  • (6) a method for measuring activation of a low-molecular-weight GTP-binding protein, comprising a step of monitoring FRET in the activity monitor protein of the low-molecular-weight GTP-binding protein according to (1),
  • a method for measuring activation of a low-molecular-weight GTP-binding protein comprising a step of detecting FRET in the cell according to (4) or the transgenic animal according to (5), and
  • FIG. 1 shows a mechanism for controlling the activity of a low molecular weight GTP-binding protein.
  • Ras is taken as an example of a low molecular weight GTP-binding protein, and the activity control mechanism of the low molecular weight GTP-binding protein is schematically shown.
  • the low molecular weight GTP-binding protein is inactive when bound to GDP, and when guanine nucleotide exchange factor (GEF) acts on it, GDP is replaced by GTP and becomes activated.
  • GEF guanine nucleotide exchange factor
  • the activated GTP-binding protein undergoes a conformational change, binds to its specific target protein, and becomes able to activate it.
  • Activated low molecular weight GTP-bound protein is hydrolyzed to GDP in the presence of GTP hydrolyzing enzyme (GAP), releasing inorganic phosphate (Pi) and returning to its inactive form .
  • GAP GTP hydrolyzing enzyme
  • Fig. 2 shows a method for measuring the activation of GTP-bound protein with low molecular weight using FRET.
  • Ras is taken as an example of a low molecular weight GTP-binding protein
  • Raf is taken as an example of a target protein.
  • CFP cyan-emitting mutant of GFP
  • YFP yellow-emitting mutant of GFP
  • GFP receptor protein is excited by light at 505 nm and emits light having a maximum at 530 nm.
  • these can also be used as GFP receptor protein and / or GFP donor protein.
  • the monitor—in the protein the YFP at the amino terminal and the CFP at the carboxyl terminal are separated, so that There is little energy transfer to the country.
  • some kind of stimulus for example, the addition of epidermal growth factor (EGF)
  • EGF epidermal growth factor
  • Ras becomes activated and binds to the Ras-binding domain (RBD) of the target protein Raf. Comes to the vicinity, and as a result, the energy transfer from CFP to YFP and the accompanying 530 nm fluorescence from YFP are observed. Therefore, the activation of Ras can be measured by measuring the FRET efficiency before and after stimulation (ie, before and after the activation of Ras).
  • FIG. 3 shows the structure of plasmid pRafras1722.
  • the expression vector used was PCAGGS, which has already been reported.
  • EYFP Ras_RafRBD (Ras binding region) —a cDNA coding for the fusion protein in the order of ECFP was bound downstream of the CAG site ⁇ ⁇ .
  • FIG. 4 shows the nucleotide sequence and predicted amino acid sequence of the translation region of plasmid pRafras1722.
  • FIG. 5 shows the nucleotide sequence of the translation region of plasmid pRafras1722 and the predicted amino acid sequence (continued).
  • Figure 6 shows the nucleotide sequence and prediction of the translation region of plasmid p Rafras1722. Indicates the measured amino acid sequence (continued).
  • FIG. 7 shows the fluorescence profile of the expressed protein Rafras 1722.
  • HEK 293 cells were transfected with 1 ⁇ & fras 1 722 and guanine nucleotide exchange factor Sos expression vector (pCAGGS-mSos) or GTP hydrolytic enzyme Gap lm expression vector (pEF-Bos-Gap lm). After transfection by the calcium phosphate method, the cells were solubilized after culturing at 48 hours, and the supernatant was obtained after centrifugation. The fluorescence intensity of the supernatant at an excitation wavelength of 433 nm and a wavelength of 450 nm to 550 nm was measured with a fluorescence spectrophotometer.
  • Sos in the right box of the graph shown in Fig. 7 indicates the fluorescence profile of Rafras 1722 when both pRafras 1722 and pCAGGS-mSos were transfected, and Gap lm indicates that pRafras 1722 and pEF- This shows the fluorescence profile of Rafras 1722 when Bos-Gap 1 m was transfected together.
  • Figure 8 shows the ratio of GTP to GDP on the GTP-binding protein of the expressed protein Rafras 1722 [GTP / (GDP + GTP) (%)] versus the excitation wavelength of 433 nm at 433 nm and 530 nm. Shows the fluorescence intensity ratio (wavelength 530/475).
  • pRafras 1722 and various amounts of guanine nucleotide exchange factor Sos expression vector pCAGGS-mSos
  • GTP hydrolysis enzyme Gap lm expression vector pEF-Bos-Gap lm
  • the Ra fras 1 72 2 after immunoprecipitation with anti-GFP antibody, separating the G TP and GDP bound to Ra fras 1722 by thin layer chromatography and quantified.
  • the fluorescence profile of the cell lysate treated in the same manner was measured, and the fluorescence intensity ratio between the wavelength of 475 nm at the excitation wavelength of 433 nm and the wavelength of 530 nm was measured. It can be seen that the fluorescence intensity ratio is enhanced depending on the amount of GTP on Rafras1722.
  • Figure 9 shows that a cell line expressing the expressed protein Rafras 1722 was obtained. Indicates that 1 ⁇ & fras 172 2 was transfected into N 1 ⁇ 13 cho3 cells to establish the cell line 3T3-Rafras. The cells were solubilized and analyzed for Rafras722 expression by immunoblotting using an anti-GFP antibody. The molecular weight is shown on the left side of the imnotlotting shown in FIG.
  • FIG. 10 shows an analysis of Ras activation using 3T3-Rafras cells.
  • the fluorescence profile (wavelength 450 ⁇ ! ⁇ 550 nm) excited at a wavelength of 3 nm was measured.
  • FIG. 11 shows the structure of plasmid pR ai — c hu 311.
  • the structure of the backbone vector is the same as in Fig. 3.
  • FIG. 12 shows the nucleotide sequence and predicted amino acid sequence in the translation region of plasmid pRa i — chu311.
  • FIG. 13 shows the nucleotide sequence and predicted amino acid sequence (continued) in the translation region of plasmid pR ai—c hu31 1.
  • FIG. 14 shows the nucleotide sequence and the predicted amino acid sequence (continued) in the translation region of plasmid pRa i—chu311.
  • FIG. 15 shows the fluorescence profile of the expressed protein R ai -c hu 311.
  • HEK293 T cells have pRa i-chu31 1 and guanine nucleotide exchange factor C3G expression vector (pCAGGS-C3G; described in Reference 9) or GTP water-degrading enzyme rap 1 GAP II
  • the expression vector (p CAGGS-rapl GAP II; described in Reference 9) was transfected with the calcium phosphate method, and after culturing for 48 hours, the cells were solubilized and centrifuged to obtain a supernatant. Excitation wavelength for the supernatant
  • C 3 G in the right box of the graph shown in FIG. 15 is the fluorescence profile of R ai-c hu 31 1 when both pR ai — c hu 31 1 and pCAGGS — C 3 G were transfected Rap 1 GAP II is p This shows the fluorescence profile of Rai-chu311 when both Rai-chu311 and pCAGGS-raplGAPII were transfected.
  • FIG. 16 shows the structure of plasmid pRa i-chu 158.
  • the structure of the backbone vector is the same as in Fig. 3.
  • FIG. 17 shows the nucleotide sequence and predicted amino acid sequence in the translation region of plasmid pRa i-chu 158.
  • FIG. 18 shows the nucleotide sequence and predicted amino acid sequence (continued) of the translation region of plasmid pRa i-chu158.
  • FIG. 19 shows the nucleotide sequence and predicted amino acid sequence (continued) of the translation region of plasmid pRa i-chu158.
  • FIG. 20 shows the fluorescence profile of the expressed protein Rai-chu158.
  • HEK 293 T cells contain pRa i-chu 158 and a guanine nucleotide exchange factor Cal DAG-GEF III expression vector (pCAGGS-CalDAG-GEF III; described in Reference 10) or GTP lmmolysis promoting enzyme Gap lm expression vector (PEF-Bos-Gap lm) was transfected by the calcium phosphate method. After culturing for 48 hours, the cells were solubilized and centrifuged to obtain a supernatant.
  • pCAGGS-CalDAG-GEF III guanine nucleotide exchange factor Cal DAG-GEF III expression vector
  • Gap lm expression vector PEF-Bos-Gap lm
  • the fluorescence intensity of the supernatant at an excitation wavelength of 433 nm and a wavelength of 450 nm to 550 nm was measured with a fluorescence spectrophotometer.
  • Gap 1 m in the right box of the graph shown in FIG. 20 indicates the fluorescence profile of Ra i-chu 158 when both pRa i-chul 58 and pEF-Bos-Gap lm were transfected.
  • DAG-GEF III shows the fluorescence profile of Rai-chu 158 when both pRa i-chul 58 and pCAGGS-Cal DAG-GEF III were transfected.
  • FIG. 21 shows the nucleotide sequence and predicted amino acid sequence in the translation region of the plasmid pRa i—chu119.
  • FIG. 22 shows the nucleotide sequence and predicted amino acid sequence (continued) of the translation region of plasmid pRa i—chu119.
  • FIG. 23 shows the nucleotide sequence and predicted amino acid sequence (continued) of the translation region of plasmid pRa i-chu119.
  • FIG. 24 shows the fluorescence profile of the expressed protein Rai-chu119.
  • HEK 293 cells were transfected with 13 ⁇ 4 & i-cu hu 119 or pRafras 1722 and guanine nucleotide exchange factor S os expression vector (pCAGGS-mSo s) by the calcium phosphate method, and cultured for 24 hours. After transferring at 33 and 40 ° C and culturing for an additional 24 hours, the cells were solubilized and centrifuged to obtain a supernatant. The fluorescence intensity of the supernatant at an excitation wavelength of 433 nm and a wavelength of 450 nm to 550 nm was measured with a fluorescence spectrophotometer.
  • the control in the right box of the graph shown in Fig. 21 is the fluorescence profile of Rai-chu119 when both pRafras 1722 and pCAGGS-mSos were transfected. This shows that this is the fluorescence profile of Rai-chu119 when pRai-chu119 and pCAGGS-mSos are transfected together.
  • Ra i-chu 1 19 had increased reactivity to the guanine nucleotide exchange factor compared to the wild type (Rafras 17 22).
  • FIG. 25 shows the results of the change over time in the fluorescence intensity of ECFP and EYFP in cells by the addition of epidermal growth factor (EGF).
  • EGF epidermal growth factor
  • excitation light having a wavelength of 430 nm was irradiated to obtain images at fluorescence wavelengths of 475 nm and 530 nm over time, and ECFP and EY FP were obtained from the images.
  • the fluorescence intensity was determined.
  • FIG. 26 is a graph showing changes in the fluorescence intensity ratio between ECFP and EYFP in the expressed protein Rafrasl722 by various guanine nucleotide exchange factors and GTP hydrolysis promoter.
  • HEK293T cells were transfected with pRafrasl722 and a guanine nucleotide exchange factor expression vector or a GTP hydrolysis promoter expression vector by the calcium phosphate method. After transfection and culturing for 24 hours or more, the cells were solubilized and centrifuged to obtain a supernatant.
  • the fluorescence intensity of the supernatant was measured at an excitation wavelength of 433 nm, a wavelength of 475 nm, and a fluorescence intensity of 530 nm using a fluorescence spectrophotometer.
  • the ratio of the latter to the former is shown in the graph.
  • FIG. 27 is a graph showing changes in the fluorescence intensity ratio between ECFP and EYFP in the expressed protein Rai-chu404 by various guanine nucleotide exchange factors and GTP hydrolysis enzymes.
  • HEK293T cells were transfected with pRai-chu404 and a guanine nucleotide exchange factor expression vector or GTP hydrolysis promoter vector by the calcium phosphate method.After culturing for 24 hours or more, the cells were solubilized and centrifuged. To obtain a supernatant. The fluorescence intensity of the supernatant was measured at an excitation wavelength of 433 nm and at wavelengths of 475 nm and 530 nm using a fluorescence spectrophotometer. The ratio of the latter to the former (fluorescence intensity ratio) is shown in the graph.
  • FIG. 28 is a photograph showing the time-dependent change in the fluorescence intensity ratio of EYFP to ECFP and the intracellular distribution in C0S1 cells transfected with pRai-chulOIX or pRai-chu404X due to the addition of EGF.
  • the C0S1 cells were transfected with pRai-chulOIX or pRai-chu404X. After culturing for 24 hours or more, the medium was replaced with a medium free of phenol red and serum.
  • an inverted fluorescence microscope with a xenon light source (Carl Zeiss, Axiovert 100) is equipped with a rotating fluorescence excitation filter and a rotating fluorescence emission filter device (LUDL electronic), and a high-sensitivity cooled CCD camera (P hotometrix).
  • the image was acquired using a system that can be controlled and analyzed by Metamorph image analysis software manufactured by Nippon Koupa Co., Ltd.
  • the cells were irradiated with excitation light at 430 nm, and an image at the fluorescence wavelength of the ECFP donor at 475 nm was taken with a CCD camera, followed by an image at the fluorescence wavelength of the 530 thigh EYFP receptor. This was performed at 30 second intervals.
  • the EYFP / ECFP fluorescence intensity ratio was divided into eight levels for each pixel on the digital image, and colors from blue to red were assigned.
  • video images can be created by assigning ECFP fluorescence intensity as brightness. .
  • the images at the times shown in these figures are shown.
  • FIG. 29 is a photograph showing the time-dependent change in the fluorescence intensity ratio of EYFP to ECFP and the intracellular distribution in subconfluent C0S1 cells transfected with pRai-chulOIX by addition of EGF.
  • the experiment was performed by the same method as described in the explanation of FIG. 28, except that C0S1 cells in a subconfluent state were used.
  • EGF was added to Rai-chulOIX-expressing cells, the process of increasing the fluorescence intensity ratio, which reflects the FRET efficiency, from the margin that did not adhere to other cells was observed. On the other hand, it can be seen that this increase in FRET efficiency is suppressed at the site where it adheres to the adjacent cells.
  • FIG. 30 is a photograph showing a time-dependent change in the fluorescence intensity ratio of EYFP to ECFP and intracellular distribution in PC12 cells transfected with pRai-chulOIX or pRai-chu404X due to the addition of nerve growth factor.
  • Ras family G proteins are in different activation states at different sites in the cell, and the activity monitor proteins of the present invention have a temporal and spatial relationship with the Ras family — G protein activation. This indicates that it is the optimal molecular probe for obtaining relevant information.
  • FIG. 31 shows the structure of plasmid pRai-chulOllX.
  • the structure of the backbone vector is the same as in Fig. 3.
  • FIG. 32 shows the structure of plasmid pRai-chul054X.
  • the structure of the backbone vector is the same as in Fig. 3.
  • FIG. 33 shows the structure of plasmid pRai-chul214X.
  • the structure of the backbone vector is the same as in Fig. 3.
  • FIG. 34 shows the fluorescence profiles of the expressed proteins Rai-chulOllx (wild-type), Rai-chul012X (activated), and Rai-chul013X (non-activated).
  • the ⁇ 293> cells were transfected with pRai-chulOllx, pRai-chul012X, or pRai-chul013X by the calcium phosphate method, and after 48 hours, the cells were lysed and centrifuged to obtain a supernatant. At a wavelength of 433 nm, the fluorescence intensity at a wavelength of 450 nm to 550 nm was measured with a fluorescence spectrophotometer.
  • FIG. 35 shows the fluorescence profiles of the expressed proteins Rai-chul054x (wild type) and Rai-chul052X (activated type).
  • HEK293T cells were transfected with pRai-chul054x or pRai-chu 1052X by the calcium phosphate method. 48 hours later, the cells were solubilized and centrifuged to obtain a supernatant. The fluorescence intensity of the supernatant at an excitation wavelength of 433 nm and a wavelength of 450 mn to 550 nm was measured with a fluorescence spectrophotometer.
  • FIG. 36 shows the fluorescence profiles of the expressed proteins Rai-chul214X (wild type) and Rai-chul220X (activated).
  • PRai-chul214X or pRai in HEK293T cells -chul220X was transfected by the calcium phosphate method, and after 48 hours, the cells were solubilized and centrifuged to obtain a supernatant.
  • the fluorescence intensity of the supernatant at an excitation wavelength of 433 nm and a wavelength of 45 Onm to 550 nra was measured with a fluorescence spectrophotometer.
  • FIG. 37 is a photograph showing the time-dependent change in the fluorescence intensity ratio of EYFP to ECFP and the intracellular distribution in C0S1 cells transfected with pRai-chulOllX by addition of EGF.
  • EGF is added to Rai-chulOllX-expressing cells, the fluorescence intensity ratio that reflects the FRET efficiency transiently increases throughout the cell within one minute, and then the fluorescence intensity ratio at the site where cell membrane ruffling occurs. And a decrease in the fluorescence intensity ratio at the center.
  • the activity monitoring protein of the low molecular weight GTP-binding protein of the present invention utilizes the property that the GTP-binding low-molecular-weight GTP-binding protein specifically binds only to its target protein. It is a very useful protein for measuring non-invasive activation of small GTP-binding proteins.
  • the monitor protein of the present invention is a fusion protein comprising a low molecular weight GTP-binding protein, a target protein of the low molecular weight GTP-binding protein, a GFP receptor protein, and a GFP donor protein. That is, the respective proteins are directly or indirectly linked in such a state that the original conformations are individually formed and the functions of the respective proteins can be fully exhibited.
  • the rows have a structure in which the amino acid sequence portions of the proteins are directly or indirectly linked.
  • Each protein constituting the monitor protein of the present invention may be a part of the protein, as long as the function of the protein can be fully exhibited.
  • the target protein when referring to each protein contained in a monitor protein, for example, in the case of a target protein, for example, the target protein is distinguished from the target protein itself, and the target protein portion is simply referred to. Expressed as the target protein.
  • FIG. 2 schematically shows an example of the monitor protein of the present invention, and shows the principle of a method for measuring the activation of a low molecular weight GTP-binding protein using FRET using the monitor protein.
  • the FRET efficiency refers to the fluorescence intensity at the fluorescence wavelength of the GFP donor protein and the fluorescence of the GFP receptor protein when the monitor protein of the present invention is irradiated with excitation light for the GFP donor protein.
  • the ratio with the fluorescence intensity at the wavelength (fluorescence intensity ratio). Details will be described later.
  • the emission spectrum of the GFP donor overlaps the absorption spectrum of the GFP receptor, ii) the distance between the donor and the receptor, iii) the donor's luminescence moment and the receptor
  • the three factors of the orientation of the extinction moment must be taken into account.
  • the fusion of the GFP with another protein causes stress, resulting in GFP misfolding.
  • the efficiency of chromophore formation is reduced, and non-fluorescent GFP is used.
  • Possible Sex must also be considered. As described above, there are strict conditions for using the GFP donor and the GFP receptor to produce good expression of FRET between the two, and certain rules have been found for the arrangement between the two.
  • the monitor protein of the present invention is obtained by appropriately combining the above proteins so that the desired effect of the present invention can be obtained, and the GTP-bound low-molecular-weight GTP-binding protein specifically binds only to its target protein.
  • FRET is realized between the GFP donor protein and the GFP receptor protein, which can be changed according to the binding of GTP to low molecular weight GTP-binding protein. Its technical value is very large.
  • the order of binding of the constituent proteins in the monitor protein of the present invention is appropriately selected in consideration of the increase in the difference in FRET efficiency before and after activation of the low molecular weight GTP-binding protein (hereinafter simply referred to as the difference in FRET efficiency). Can be done.
  • the greater the difference in FRET efficiency before and after activation of the low molecular weight GTP-binding protein the more accurately the activation state of the protein can be grasped, thus improving the measurement accuracy of the activation of the low molecular weight GTP-binding protein. It is preferable because it can be performed.
  • the low-molecular-weight GTP-binding protein and the low-molecular-weight GTP-binding protein in the monitor protein are bound to the target protein of the low-molecular-weight GTP-binding protein at the target protein binding site of the low-molecular-weight GTP-binding protein present on the amino-terminal side.
  • the embodiment (1) is the one belonging to the family of Rho family.
  • embodiment (2) is preferred.
  • the GFP acceptor protein and GFP donor protein have their amino or carboxyl termini directly or indirectly to the amino or carboxyl terminus of a product in which a low molecular weight GTP-binding protein and a target protein are linked (linked product). And connected.
  • a monitor protein in which the carboxyl terminal of the GFP receptor protein is directly or indirectly connected to the carboxyl terminal of the GFP receptor protein at the amino terminal of the ligated product is preferable.
  • the monitor protein of the present invention in the monitor protein, a GFP receptor protein, a low molecular weight GTP binding protein, a target protein of the low molecular weight GTP binding protein, and a GFP dona protein from the amino terminal side. Or directly or indirectly from the amino terminus side to become the GFP receptor protein, the target protein of the low molecular weight GTP binding protein, the low molecular weight GTP binding protein, and the GFP donor protein, respectively. Those connected are particularly preferred.
  • the “indirect linking” refers to a mode in which the linking between proteins is performed, for example, via a peptide or the like as a spacer described later.
  • the low-molecular-weight GTP-binding protein that is a component of the monitor protein of the present invention is not particularly limited as long as it is known as the protein, but it belongs to the Ras superfamily from the viewpoint of usefulness. Are preferable, and among them, those belonging to the Ras family or the Rho family are more preferable. More specifically, the group consisting of H—Ras, K—Ras, N—Ras, R—Ras, Rap1A, RapB, Rap2A, and Rap2B, or RhoA, R One selected from the group consisting of hoB, RhoC, Rac1, Rac2, and Cdc42 is preferred.
  • the target protein of the low-molecular-weight GTP-binding protein is not particularly limited as long as each low-molecular-weight GTP-binding protein specifically binds to the GTP-binding protein as exemplified above. .
  • Preferred from the viewpoint of usefulness Is Ra f or Ra 1 GDS, or Pak or mDia.
  • a combination of the low-molecular-weight GTP-binding protein and the target protein from the viewpoint of utility and specificity, a combination in which the low-molecular-weight GTP-binding protein is H-Ras and the target protein is Raf, or A combination in which the low-molecular-weight GTP-binding protein is Rap1A and the target protein is Ra1GDS, a combination in which the low-molecular-weight GTP-binding protein is Rac1 and the target protein is Pak, and a low-molecular-weight GTP-binding Particularly preferred is a combination in which the protein is Cdc42 and the target protein is Pak, or a combination in which the low molecular weight GTP-binding protein is RhoA and the target protein is mDia.
  • any of the GFP-related proteins exemplified above can be used, but from a functional viewpoint, EGFP or EYFP is preferable.
  • any one of the GFP-related proteins exemplified above can be used as the GFP donor protein, but from the functional viewpoint, it is preferably ECFP or EBFP.
  • the low molecular weight GTP-binding protein is H-Ras
  • the target protein is R af
  • the GFP donor protein is ECFP
  • the GFP receptor protein is EYFP
  • the low molecular weight GTP-binding protein is Rap1A
  • the target protein is Ra1 GDS
  • GFP donor protein is ECFP
  • GFP receptor protein is EYFP
  • low molecular weight GTP binding protein is Rac 1
  • target protein is Pak
  • GFP donor protein is ECFP
  • GFP If the receptor protein is EYFP, or the low molecular weight GTP-binding protein is Cdc42, the target protein is Pak
  • the GFP donor protein is ECFP, GFP receptor-protein Is EYFP, or the low-molecular-weight GTP-binding protein is RhA
  • the target protein is mDia
  • the GFP donor protein is ECFP, GFP receptor-protein Is EYFP, or the low-molecular-weight GTP-binding
  • the order of binding of the low-molecular-weight GTP-binding protein, the target protein, the GFP donor protein, and the GFP receptor protein is preferably determined in the monitor protein of the present invention from the viewpoint of increasing the difference in FRET efficiency.
  • those obtained by exchanging EYFP and ECFP for each other can also be suitably used.
  • the low-molecular-weight GTP-binding protein may be a part of the protein as long as it can bind to the target protein, and need not necessarily be the entire (full-length) protein.
  • a part of the low-molecular-weight GTP-binding protein is, for example, a method in which the protein molecule is produced in Escherichia coli according to a known method, and bound to GTP in a test tube, whereby the binding to the target protein can be detected. Refers to the protein part.
  • the detection can be carried out, for example, by immunoprecipitation with an antibody against the target protein and examining by immunoblotting whether a part of GTP-bound protein is coprecipitated.
  • a protein portion consisting of an amino acid sequence portion preferably corresponding to positions 1-180, more preferably positions 1-172 is represented by R-Ras.
  • R-Ras a protein portion comprising an amino acid sequence portion corresponding to positions 1 to 204, more preferably 28 to 204; if Rac 1, a protein portion preferably comprising an amino acid sequence portion corresponding to positions 1 to 177
  • Cdc42 the amino acid sequence portion consisting of the amino acid sequence portion preferably corresponding to positions 1 to 176 if Cdc42, and the amino acid sequence preferably corresponding to positions 1 to 176 if Rh0A List the protein part consisting of Can be.
  • At least one, more preferably 1 to 28, and still more preferably 17 to 28 amino acid sequences are preferably present in the amino terminal region and / or the carboxyl terminal region of the amino acid sequence. And those having an amino acid deficiency.
  • the amino acid deletion site in such a region is not particularly limited. For example, in the case of H-Ras, the difference in FRET efficiency was greater when the C-terminus was truncated to position 172 than when it was truncated to position 180.
  • the amino acid sequence preferably has at least one, more preferably 9 to 20, and more preferably 17 amino acids in the carboxyl-terminal region of the amino acid sequence. Also, in the case of R-Ras, the difference in FRET efficiency was greater when the 28 amino acids were deleted from the amino terminal than when the amino acid was not deleted. That is, the amino acid sequence preferably has a deletion of at least 1, more preferably 1 to 28, and even more preferably 28 amino acids in the amino terminal region of the amino acid sequence.
  • the amino-terminal region or lipoxyl-terminal region refers to a region, preferably up to 30 amino acids in number, from the amino terminal or carboxyl terminal in the amino acid sequence of the low molecular weight GTP-binding protein.
  • the target protein may be a part of the corresponding low molecular weight GTP-binding protein as long as it can bind to the corresponding low molecular weight GTP-binding protein, and does not necessarily need to be the whole (full length).
  • the part of the target protein refers to a protein part in which the binding to the corresponding low molecular weight GTP-binding protein can be detected in the same manner as in the low molecular weight GTP-binding protein.
  • Ra f GenBank / EBL terminology number: X03484
  • it is preferably the Ras binding region (RBD), more preferably, the position 51 to 204, more preferably the position 51 to 204.
  • the protein portion comprising the amino acid sequence portion is Ra1 GDS (GenBank / EMBL accession number: U14417), an amino acid sequence corresponding to preferably positions 202 to 309, more preferably positions 211 to 297 Pak1
  • GFP donor protein and / or the GFP receptor protein may be a part of the protein as long as the function of pairing with FRET is maintained, and it is not necessarily required to be all (full length).
  • the carboxyl termini of their amino acid sequences results in increased differences in FRET efficiency.
  • those having preferably at least one, more preferably 1 to 11 deletions in the carboxyl terminal region of their amino acid sequences can be mentioned.
  • the amino acid deletion site in such a region is not particularly limited.
  • EYFP it is preferably at least one, more preferably 1-11, and still more preferably in the carboxyl terminal region of the amino acid sequence.
  • the amino acid sequence has a deletion of at least one, more preferably 1 to 11, and even more preferably 11 amino acids in the carboxyl terminal region of the amino acid sequence.
  • the carboxyl terminal region refers to the amino acid sequence of the GFP-related protein used in the present invention, from its lipoxyl end to the number of amino acids, preferably from 1 to 20, more preferably 11 The area up to.
  • Whether the FRET pair function is maintained or not is determined by, for example, a pair of protein molecules that are assumed to form a FRET pair according to a known method. Can be produced in Escherichia coli, and the cell extract containing the pair of proteins can be evaluated by observing the fluorescence intensity at the expected excitation wavelength of each of the proteins.
  • the GFP receptor protein and / or the GFP donor protein may have a mutation.
  • Such a mutation can be introduced into any site in the amino acid sequence of the GFP receptor protein and / or the GFP donor protein, as long as the function of pairing with FRET is maintained.
  • mutations include substitution of a plurality of amino acids. Specific examples of such amino acid substitutions include, for example, Phe64Leu, Va168Leu, Ser72Ala, Ile67Thr and the like. Is mentioned. It is preferable to introduce such a variation since effects such as an increase in chromophore formation efficiency and an increase in FRET efficiency can be obtained. Mutation can be introduced by a method using a known restriction enzyme or a method using PCR (polymerase chain reaction).
  • low-molecular-weight GTP-binding proteins and / or their target proteins into which mutations have been introduced can also be suitably used in the present invention.
  • a point mutation by introducing a point mutation, a mutant having improved sensitivity to guanine nucleotide exchange factor or GTPase activator can be obtained.
  • Such a mutation can be introduced into any site in the amino acid sequence of the low molecular weight GTP-binding protein and / or its target protein as long as the function of binding to each other is maintained.
  • examples of the mutation include amino acid substitution, insertion, and deletion. Specifically, for example, an embodiment in which I 1 e 36 is changed to Leu in the amino acid sequence of H—Ras (I 1 e 36 L eu).
  • H-Ras having such a mutation can be suitably used in the monitor protein of the present invention.
  • the mutation can be introduced by a method using a known restriction enzyme or a method using PCR.
  • the spatial arrangement of the constituent proteins is a factor related to the expression of their functions.
  • the difference in FRET efficiency can be greatly increased.
  • a spacer is preferably inserted between the low-molecular-weight GTP-binding protein and the target protein from the viewpoint of increasing the difference in FRET efficiency.
  • Preferable peptide sequences include peptides consisting of preferably 1 to 30, more preferably 1 to 10 consecutive arbitrary amino acids.
  • GTP-binding protein is localized in the cell. Activation can be directly measured, which is preferable.
  • GTPZGDP ratio amount ratio
  • GTP binds to the low molecular weight GTP-bound protein.
  • the binding of the low-molecular-weight GTP-binding protein to the target protein is induced in the monitor protein, resulting in a change in the overall conformation, and the GFP receptor protein and the GFP donor protein are changed. The distance and the direction change.
  • irradiation with light of a specific wavelength causes the increase in FRET efficiency to be detected between such a protein and the donor protein (Fig. 2).
  • Such changes in the FRET efficiency are affected by the arrangement of the GFP receptor protein and the GFP donor protein after the conformational change of the monitor protein.
  • the width of the change in the FRET efficiency that is, the increase or decrease in the difference in the FRET efficiency can be appropriately adjusted as desired by inserting a spacer peptide or the like, for example, depending on the properties of each constituent protein used.
  • the present invention also provides a gene encoding the monitor protein of the present invention.
  • a gene is obtained by obtaining the genetic information of each of the constituent proteins of the protein from GenBank or the like, and using a known PCR method or a method using a restriction enzyme and a ligase according to a conventional method. Can be made.
  • accession numbers in GenBankZEMB L of each protein suitably used as a constituent protein of the monitor protein of the present invention are shown below.
  • the accession number is shown in parentheses after each protein name.
  • Raf (X03484), Ra1 GDS (U14417), Pak1 (NM002576), mDia1 (E17361)
  • EGFP U76561
  • EYFP AVU73901 1
  • ECFP AB041904
  • EBFP GFP has the following three mutations: Ph e 64
  • the present invention further provides an expression vector containing the gene.
  • a vector may be a known prokaryotic cell expression vector such as pGEX-2T (Amersham-Pharmacia Biotech), a eukaryotic cell expression vector such as pCAGGS (for example, pGEX-2T). Reference 7) or by insertion into a viral vector, for example, p Shutt 1 e (manufactured by CLONTECH).
  • the expression vector is preferably an expression plasmid.
  • the present invention further provides transformed cells and transgenic animals that carry the expression vector.
  • Such cells can be obtained by introducing the expression vector into target cells.
  • a known transfection method or a virus infection method can be used as a method for introduction into cells, and there is no particular limitation.
  • a calcium phosphate method, a lipofection method, or an electoral poration method can be used.
  • Eukaryotic cells or prokaryotic cells can be used as the cells, and there is no particular limitation.
  • eukaryotic cells include human embryonic kidney-derived HEK293 T cells, monkey kidney-derived COS cells, human umbilical cord-derived HUVEC cells, yeast, etc.
  • Prokaryotic cells include cultured cells such as Escherichia coli, and other various cells. it can.
  • Transgenic animals can be obtained by directly introducing the expression vector into an individual such as a mouse by a known method, for example, by microinjecting plasmid DNA into the nucleus of a fertilized mouse egg. it can.
  • the present invention further provides a method for measuring the activation of a low molecular weight GTP binding protein using the monitor protein of the present invention.
  • activation of the low molecular weight GTP-binding protein can be measured by detecting FRET in the monitor protein of the present invention.
  • FRET can be detected in the above-described transformed cell or transgenic animal of the present invention, and the activation of a low-molecular-weight GTP-binding protein in the cell or animal can be directly measured.
  • the GTP-GDP ratio (or GTPZ (GDP + GTP-GTP) is measured separately by measuring the GTP-bound low-molecular-weight GTP-binding protein and the GDP-bound low-molecular-weight GTP-binding protein produced by the release of inorganic phosphate from GTP. ) Ratio) (all are molar ratios), and if the corresponding FRET efficiency is measured and a calibration curve is prepared in advance, the GTP ratio is calculated based on the FRET efficiency of the cell or animal. be able to.
  • the transformed cells of the present invention that can express the monitor protein are cultured under conditions that allow expression of the protein.
  • the cells are solubilized.
  • the method for solubilizing the cells is not particularly limited, but a solubilization method using a solution containing the detergent TritonXlOO is preferable.
  • the solubilized solution is irradiated with excitation light (eg, at a wavelength of 433 nm) for GFP donor protein, and the fluorescence profile is measured, for example, at a wavelength in the range of 45 Onm to 550 nm using a known fluorescence spectrophotometer.
  • the ratio of the fluorescence intensity of the GFP donor protein at a wavelength of 475 nm to the fluorescence intensity of the GFP receptor protein at a wavelength of 530 nm [(Fluorescence at a wavelength of 530 nm) Intensity) / (wavelength 47 Fluorescence intensity at 5 nm)] is calculated, and this is defined as the FRET efficiency from GFP donor protein to GFP receptor protein.
  • FRET efficiency increases after binding (that is, after activation of the low-molecular-weight GTP-binding protein) compared to before GTP-binding to the low-molecular-weight GTP-binding protein. The activation of is measured.
  • the activation and inactivation of the low-molecular-weight GTP-binding protein can be performed, for example, by using the guanine nucleotide exchange factor Sos expression vector (pCAGGS-mSos; described in Reference 9) as the monitor protein of the present invention.
  • pCAGGS-mSos guanine nucleotide exchange factor Sos expression vector
  • EGF epidermal growth factor
  • the GTP hydrolyzing enzyme Gap lm expression vector pEF-Bos-Gap lm; described in Reference 9
  • This can be done by transfecting the cells.
  • 13 ⁇ 4 £ 3 ⁇ 4Efficiency is 0? Since the change is caused by a change in the distance and direction between the donor protein and the GFP receptor protein, a change in the structure of the monitor protein can be detected by a change in the FRET efficiency.
  • the transformed cells or transgenic animals of the present invention that express the monitor protein are observed with a fluorescence microscope, and changes in FRET efficiency that occur before and after activation of the low-molecular-weight GTP-binding protein are directly detected.
  • the activation and inactivation of the low-molecular-weight GTP-binding protein can be performed in the same manner as in the above (1) measuring method using a spectrophotometer.
  • the fluorescence microscope there is no particular limitation on the fluorescence microscope to be used, but a high-sensitivity cooled CCD equipped with a rotating fluorescence excitation filter and a rotation fluorescence emission filter in a known inverted fluorescence microscope (Carl Zeiss, Axiovert 100) having a xenon light source Those with a camera are preferred. Further, it is desirable that the filter and the camera image be controlled and analyzed by using Metamorph image analysis software manufactured by Nippon Ichi-Par.
  • the guanine nucleotide exchange factor Sos expression vector can be introduced into cells or animals capable of expressing the protein in various amounts to introduce various activation states (ie, activation) of the low molecular weight GTP-binding protein. States of varying degrees). Next, the cells or animals in each state are observed with a fluorescence microscope, and the FRET efficiency is determined in the same manner as described above.
  • GTPZGDP ratio is calculated by measuring low molecular weight GTP-bound protein. Specifically, the GTPZGDP ratio is determined by measuring the amount of GTP bound to a low molecular weight GTP-binding protein and the amount of GDP bound by a known method (Reference 2). Then, the obtained GTP DP ratio is related to the FRET efficiency determined in advance. That is, the FRET efficiency and the GTPZGDP ratio at the measurement time point in each state are measured, and a calibration curve is created based on these.
  • a calibration curve is separately prepared in this way, the FRET efficiency in cells or animals expressing the monitor protein can be measured directly using a fluorescence microscope, and the GTP / GTP / It is possible to calculate the GDP ratio. Therefore, the activation state of the low-molecular-weight GTP-binding protein in a cell or an individual can be easily ascertained noninvasively, and the GTPZGDP ratio in such a state can be specifically obtained.
  • the method using such a calibration curve can be similarly used in the method (1).
  • a protein monitor for the activity of a low-molecular-weight GTP-binding protein that enables non-invasive measurement of the activation of the low-molecular-weight GTP-binding protein, a gene thereof, and the like.
  • it expresses such a monitor protein and retains the expression vector useful for measuring the activation of a non-invasive low molecular weight GTP-binding protein.
  • Transformed cells and transgenic animals are provided, as well as methods for measuring the activation of low molecular weight GTP binding proteins using the protein.
  • a substance that changes the activity of a low-molecular-weight GTP-binding protein is constructed by constructing a cell that expresses the activity monitor protein of the low-molecular-weight GTP-binding protein of the present invention and using a bioassay system.
  • a salt thereof ie, a modulator of the activity of a low molecular weight GTP-binding protein.
  • the test substance in the method is not particularly limited, but examples include peptides, proteins, non-peptidic substances, synthetic substances, fermentation products, and the like.
  • the screening method of the present invention can be carried out in the presence of (i) a low molecular weight GTP-binding protein activator, or (ii) in the absence of the activator.
  • the low-molecular-weight GTP-binding protein activator is a substance that activates a low-molecular-weight GTP-binding protein, and includes, for example, cell growth factors such as epidermal growth factor, and cytodynamics such as interleukin. Can also this It is not limited to them.
  • the activity regulating substance of the low-molecular-weight GTP-binding protein is a substance that enhances or reduces the activity of the low-molecular-weight GTP-binding protein, and in the case of (ii), the activity of the low-molecular-weight GTP-binding protein is It can be screened as a substance to enhance.
  • the screening method of the present invention is characterized in that, in the step (a), in the presence or absence of the activating substance, the cell expressing the activity monitor protein of the low-molecular-weight GTP-binding protein of the present invention is treated with the cell.
  • the sample is brought into contact with the test substance (aspect 1).
  • the method of contacting is not particularly limited, and can be performed, for example, by culturing the cells in the presence of a test substance.
  • the activity monitor of the low-molecular-weight GTP-binding protein of the present invention is performed (case 2), where the cells expressing the protein are not brought into contact with the test substance.
  • step (b) the activity of the low-molecular-weight GTP-binding protein in each case is measured, and the change in the activity of the low-molecular-weight GTP-binding protein in embodiment 1 compared to embodiment 2 is detected, whereby the low-molecular-weight GTP-binding protein is detected.
  • the substance that further enhances the activity of the low-molecular-weight GTP-binding protein is an activity-regulating substance that can enhance the activity of the low-molecular-weight GTP-binding protein.
  • a reducing agent is an activity modulator that can decrease the activity of a low molecular weight GTP binding protein.
  • the substance that enhances the activity of the low-molecular-weight GTP-binding protein is an activity modulator that can enhance the activity of the low-molecular-weight GTP-binding protein.
  • human H-Ras is Ras
  • human c-Raf1 is Raf
  • human Rap1A is Rap1A
  • human RalgDs is RalGDS
  • Human R-Ras is called R-Ras.
  • human Cdc42 is Cdc42
  • human RhoA is RhoA
  • human Pakl is Pakl
  • human mDia1 is mDia1.
  • the sense primer 1 h R as X h (5′-CTCGAGATGACGGAATATAAGCTGGTGGTG-3 ′) (SEQ ID NO: 1) and the antisense primer 1 Ra s PCR (Polymerase chain reaction) using 1 72Ra f (5'-AGTGTTGCTTGTC TTAGAAGGGGTACCACCTCCGGAGCCGTTCAGCTTCCGCAGCTTGTG-3 ') (SEQ ID NO: 2) and a thermostable DNA replication enzyme PfX (Gibco-BRL Bethesda, USA)
  • PfX thermostable DNA replication enzyme
  • the sense primer hRas Xh has the nucleotide sequence of the cleavage site of the restriction enzyme XhoI shown underlined at the 5 'end and the nucleotide sequence of the cDNA portion corresponding to the amino acid sequence at positions 1 to 8 of Ras.
  • the antisense primer Ras172Raf is complementary to the cDNA complementary to the amino-terminal region (from position 61 to position 67) of the amino acid sequence of the Ras binding region of Raf from the 5 'end. It consists of the base sequence, spacer sequence (underlined), and the base sequence of the complementary strand of c • DNA corresponding to the amino acid sequence from position 166 to position 172 of Ras.
  • the sense primer Ra f RBD—F 1 (5′-GGTACCCCTTCTAAGACAAGCAACACT-3 ′) (SEQ ID NO: 3) and antisense Using the sense primer Ra f RBDn 2 (5′-GCGGCCGCCCA GGAAATCTACTTGAAGTTC-3 ′) (SEQ ID NO: 4) and the Pfx, it corresponds to the amino acid sequence of positions 51 to 1.3 of Ra f by PCR method. Amplify the cDNA portion did.
  • the sense primer Ra f RBD—Fl is the nucleotide sequence of the cleavage site of the restriction enzyme K ⁇ I underlined at the 5 'end and the nucleotide sequence of the cDNA portion corresponding to the amino acid sequence from position 51 to position 57 of Raf. Consists of On the other hand, the antisense primer Ra f RBD n2 has the base sequence of the cleavage site of the restriction enzyme Not I and the carboxyl terminal region of the amino acid sequence of the Ras binding region of Ra f (position 125 From position 131 to position 131).
  • Ras was determined by PCR using the sense primer hR as Xh, the antisense primer Raf RBDn2 and the Pfx, and PCR.
  • a cDNA consisting of a chimeric gene encoding Raf was amplified.
  • the obtained DNA fragment was ligated to pCR-b1unitII-TOPO (Invitrogen), and Escherichia coli was transformed with the obtained plasmid construct. After culturing such Escherichia coli, a plasmid was purified by a known alkaline SDS method.
  • p7 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3 ') (SEQ ID NO: 5) and primer P8 (5'-AGCGGATAACAATTTCACACAGGAAAC) were added to pB l ue scrip t-SKI I (+) (Stratagene)' s Martinburg roning site. -3 ′) (SEQ ID NO: 6) and amplified by PCR in the same manner as described above to obtain a DNA fragment.
  • pCAGGS (Reference 7), a mammalian cell expression vector, was cut with EcoRI and blunt-ended with K1enow enzyme. Next, the DNA fragment and the pCAGGS after the treatment were ligated with T4 DNA ligase. The resulting vector is called pC AGGS-P7.
  • EYFP cDNA As type III, the sense primers GFP—N 2 (5′-GGATCCGGCATGGTGAGCAAGGGCGAGGAG-3 ′) (SEQ ID NO: 7) and antisense primer GFP—N3 (5′-GGATCCGGTACCTCGAGCTTGTACAGCTCGTCCATG-3 ′) — (SEQ ID NO: : 8) and the above-mentioned Pfx, cDNA corresponding to the full-length amino acid sequence of EYFP was amplified by PCR.
  • Sense Primer GFP—N2 is the base sequence of the cleavage site of the restriction enzyme BamHI, underlined at the 5 'end, a 3-base spacer, and the amino acid sequence at positions 1 to 7 of EYFP.
  • the base sequence of the cDNA portion corresponding to On the other hand, the antisense primer GFP-N3 has the nucleotide sequence of each of the cleavage sites of the restriction enzymes BamHI, KnI and XhoI shown underlined at the 5 'end and the amino acid sequence of ECFP described below.
  • EGFP Genebank / EMBL R / C / No .: U76561
  • four amino acid substitutions (Tyr67Trp; Asnl47Ile; Metl54Thr; Vall64Ala) were introduced by a known method using a PCR method was used.
  • the cDNA of ECF P was used as type II, and the sense primer XFPNott2 (5'-GCGGCCGCATG GTGAGCAAGGGCGAGGAGC-3 ') (SEQ ID NO: 9) and antisense primer XFP-Bg1 (5'- Using AGATCTACAGCTCGTCCATGCCGAGAG-3 ′) (SEQ ID NO: 10) and the aforementioned PfX, cDNA corresponding to the full-length amino acid sequence of ECFP was amplified by PCR.
  • the sense primer XF PNot 2 corresponds to the base sequence of the cleavage site of the restriction enzyme Not I shown underlined at the 5 'end and the amino acid sequence from position 1 to position 8 of ECFP. It consists of the base sequence of the DNA part.
  • the antisense primer XFP—Bg1 binds to the base sequence of the cleavage site of the restriction enzyme Bg1II and the carboxyl terminal region (from 231 to 237) of the amino acid sequence of ECFP, which are underlined at the 5 'end. And the base sequence of the complementary strand of the corresponding cDNA portion.
  • the pCAGGS-P7 obtained in the above (i) was cleaved with the restriction enzyme XhoI, and treated with the Klenow enzyme in the presence of dTTP and dCTP.
  • the EYFP DNA fragment obtained in (ii) above was digested with BamHI and then treated with the K1enow enzyme in the presence of dGTP and dATP. The resulting two gene fragments were ligated with T4 DNA ligase to obtain a plasmid.
  • the plasmid was cleaved with NotI and Bg1II, and then the DNA fragment of ECFP obtained in the above (iii) which had been cleaved with NotI and Bg1II, and a T4 DNA ligase. Ligation was carried out.
  • the obtained plasmid was named pFret2.
  • the pFret 2 obtained in the above (2) — (iv) was cut with XhoI and NotI, and then in (1)-(iii), which was cut in advance with XhoI and NotI.
  • the obtained chimeric gene was ligated using T4 DNA ligase.
  • the resulting plasmid is called pRafrasl722.
  • the structure of pRafrasl 722, the nucleotide sequence of its translation region (SEQ ID NO: 11) and the predicted amino acid sequence (SEQ ID NO: 12) are shown in FIGS. 3 and 4 to 6, respectively.
  • nt 1240-125 linker nt 1258-1500 Raf
  • nt 1510-2220 Owan jellyfish ECFP
  • Ras activity monitor protein Ras activity monitor protein (Rafrasl722) in mammalian cells and analysis by spectrophotometry
  • HEK 293 T cells derived from human fetal kidney were cultured in DMEM medium (manufactured by Nippon Pharmaceutical Co., Ltd.) containing 10% fetal serum.
  • DMEM medium manufactured by Nippon Pharmaceutical Co., Ltd.
  • the pRafrasl 722 obtained in the above (3) and the guanine nucleotide exchange factor Sos expression vector (pCAGGS-mSos) or the GTP water degradation promoting enzyme Gap lm expression vector (pEF — Bo s — Gap lm) was transfected by the calcium phosphate method.
  • the HEK293 T cells after the transfection were cultured in a DMEM medium (manufactured by Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum to express the Ras activity monitor protein. After culturing for 48 hours, the cells were washed with phosphate buffered saline and lysed with a lysis solution (20 mM Tris-HCl, pH 7.5, 150 mM NaCL 5 mM MgCh, 0.1% Triton X-100). The obtained cell lysate was centrifuged at 10,000 xg, and the supernatant was recovered.
  • the supernatant was placed in a 1 ml cuvette of a fluorescence spectrophotometer (FP-750, manufactured by JASCO Corporation), and the fluorescence intensity from 450 nm to 550 nm was measured at an excitation wavelength of 433 nm.
  • FP-750 fluorescence spectrophotometer
  • the expressed Ras-active monitor protein was immunized with an anti-GFP antibody. Separation of sedimented and bound GTP and GDP by thin-layer chromatography, FRET efficiency obtained from the fluorescence profile data obtained for the Ras activity monitor protein (excitation at 433 nm wavelength). Then, the value obtained by dividing (the fluorescence intensity at a wavelength of 530 nm) by (the fluorescence intensity at a wavelength of 475 nm) can be associated with the actual degree of GTP binding (Fig. 8). In FIG. 8, the FRET efficiency is expressed as “fluorescence intensity ratio (wavelength 5 30/475) ”and the degree of GTP binding was expressed as rGTP / 7 (GDP + GTP) (%) J.
  • Monkey kidney-derived COS 7 cells were cultured in a FUNOLED Red-free MEM medium (manufactured by Nippon Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum.
  • PRafras1722 obtained in the above (3) was transfected into the COS 7 cells by the calcium phosphate method.
  • the transfected COS 7 cells were cultured in a phenol-free MEM medium (manufactured by Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum to express the Ras activity monitor protein. Forty-eight hours after transfection, the cultured cells were subjected to observation with a Timelabs fluorescence microscope.
  • Such a microscope is equipped with a rotary fluorescence excitation filter device and a rotary fluorescence emission filter device (manufactured by LUDL electronic) and an inverted xenon light source equipped with a high-sensitivity cooled CCD camera (Photometrix, Micromax450).
  • Type fluorescence microscope (Carl Zeiss, Axiovert 100).
  • Metamorph image analysis software manufactured by Nippon Roper Co., Ltd. Using.
  • the fluorescence excitation filter, fluorescence emission filter, and dichroic mirror were purchased from Omega.
  • the cultured cells were irradiated with excitation light of 433 nm, an image of the fluorescence wavelength of the ECFP donor of 475 nm was taken with a CCD camera, and then an image of the fluorescence wavelength of the EYFP receptor of 530 nm was taken.
  • the FRET efficiency at each measurement point was calculated by calculating the ratio of the fluorescence intensities of the two based on the image data.
  • Mouse fibroblast NI H3T3 cells were cultured in DMEM medium (manufactured by Nissui Pharmaceutical) containing 10% fetal calf serum.
  • the NIH 3 T3 cells obtained in Example 1 pRfrasl722 and vector pSV2neo (Genbank / EMBL: U02434) containing the G4 18 resistance gene were co-transfected using FuGene 6 (Nippon Roche).
  • the cells were cultured in the above-mentioned medium, and after culturing for 48 hours, re-wound at a dilution ratio of 1:10, and G4 18 (Gibco — manufactured by BRL) was added to the medium to a concentration of 0.5 mgZml. .
  • the medium was changed once every three days. After 2 weeks of culture, well separated colonies were cloned and named 3T3_Rafras cells.
  • the 3T3-Rafras cells are cultured in a DMEM medium (manufactured by Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum and 0.5 mg / m1 of G418, and the Ras activity monitor protein is analyzed. Was expressed.
  • the expression of such a protein was analyzed by the usual immunoblotting method using an anti-Ras antibody (Transduction Lab). As a result, expression of a protein of about 8.0 kDa was observed (Fig. 9).
  • Example 3 Measurement of Rap A activation by Ra i _c hu 3 11
  • sense primer hRapl Xh (5′-GGCTCGAGATGCGTGAGTACAAGCTAGTGG-3 ′) (SEQ ID NO: 13) and antisense primer Ra p 1 72Ra 1 GDS (5′-GCGGATGATACAGCAGTCGCCACCTCCGGATCCGCCGGTACCTCCACCACCGGTTCCACCTCCGGAGCCAT TGATCTTTGACTTTGCAGAAG-3 ′) (SEQ ID NO: 14)
  • the corresponding cDNA portion was amplified.
  • the sense primer hRap 1 Xh is the restriction enzyme Xh 0 It consists of the nucleotide sequence of the cleavage site of I and the nucleotide sequence of the cDNA portion corresponding to the amino acid sequence at positions 1 to 8 of Rap1A.
  • the antisense primer Rap172Ra1GDS is composed of the amino terminal region (21) of the amino acid sequence of the Rap1A binding region of Ra1GDS (Genbank / EMBL accession number: U14417) from the 5 'end.
  • Ra 1 GDS cDNA Genbank / EMBL endion number: U14417
  • the sense primer Ra l GDS—F 5′-GGCGACTGCTGTATCATCCGC-3 ′) (SEQ ID NO: 15)
  • the antisense primer Ra 1 Ra1 GDS cDNA was amplified by PCR using GDSR (5'-CGCGGCCGCCCCG CTTCTTGAGGACAAAGTC-3 ') (SEQ ID NO: 16) and the Pfx.
  • the sense primer Ra1GDS-F has the nucleotide sequence of the cDNA portion corresponding to the amino terminal region (from position 211 to position 217) of the amino acid sequence of the Rap1A binding region of the cDNA of Ra1GDS.
  • the antisense primer Ra 1 GDSR is composed of the base sequence of the cleavage site of the restriction enzyme N 0 ⁇ I underlined at the 5 ′ end and the carboxyl terminal region of the amino acid sequence of the Rap 1 A binding region of Ra 1 GDS ( 291 from position 1 to position 297), and the complementary nucleotide sequence of the nucleotide sequence of the cDNA portion.
  • Rap 1A was synthesized by PCR using sense primer hRap1Xh and antisense primer Ra1GDSR and PfX.
  • a cDNA consisting of a chimeric gene encoding Ra1GDS was amplified.
  • the obtained DNA fragment was ligated to pCR-b1untII-TOPO, and the resulting plasmid construct was used to colonize the large intestine.
  • the bacteria were transformed. After culturing such Escherichia coli, a plasmid was purified by a known alkaline SDS method.
  • antisense primer GFP-d11R (5'-GGATCCGGTACCTCGAGGGCGGCGGTCACGAACTCCAGCAG-3 ') (SEQ ID NO: 17) was used instead of antisense primer GFP-N3.
  • a similar operation was performed to prepare a vector containing cDNA encoding ECFP and EYFP which lacks 11 amino acids at the carboxyl terminus of the amino acid sequence. This vector was cut with XhoI and NotI. Next, the vector and the chimeric gene obtained in the above (1), which had been cut with XhoI and NotI, were ligated with T4 DNA ligase.
  • the resulting plasmid was named pR ai -c hu 311.
  • the structure of the obtained plasmid, the nucleotide sequence of its translated region (SEQ ID NO: 18) and the predicted amino acid sequence (SEQ ID NO: 19) are shown in FIGS. 11 and 12 to 14. Are shown below.
  • nt 1-684 EYFP of the Jellyfish
  • nt 1258-1515 Ra 1 GDS
  • nt 1522-2235 Owan jellyfish ECFP
  • Rap 1 A activity monitor protein (Ra i-chu 3 11) in mammalian cells and analysis by spectrophotometry
  • Example 4 Measurement of R—Ras activation by Ra i-chu 158
  • R—Ras cDNA (Genbank / EMBL accession number: M14948, 14949) was used as type III, and the sense primer RRas 28F (5′-CCCCTCGAGACACACAAGCTGGTGGTC-3 ′) (SEQ ID NO: 20) and antisense primer RRa Using s204R (5'-G CCGGTACCGCCACTGGGAGGGCTCGGTGGGAG-3 ') (SEQ ID NO: 21) and Pfx, a cDNA portion corresponding to the amino acid sequence from position 28 to position 204 of R-Ras by PCR method was amplified.
  • the sense primer RRas28F is derived from the nucleotide sequence of the cleavage site of the restriction enzyme XhoI shown underlined at the 5 'end and the nucleotide sequence of the cDNA corresponding to the amino acid sequence from position 28 to position 33 of R-Ras. Become.
  • the antisense primer RRas 204 R. corresponds to the spacer sequence containing the KpnI cleavage site (underlined) from the 5 'end, and the amino acid sequence from position 198 to position 204 of R-Ras. It consists of the base sequence of the complementary strand of the cDNA portion.
  • the PCR product obtained in the above (i) was cut with XhoI and KpnI.
  • PR afras 1 722 obtained in Example 1 was completely digested with XhoI and then partially digested with Kpn. I to obtain a DNA fragment from which the Ras portion had been removed.
  • the DNA fragment and the DNA fragment obtained in (ii) were ligated with T4 DNA ligase.
  • the resulting plasmid was named pRa i-chu 158.
  • the structure of the plasmid, the nucleotide sequence in its translation region (SEQ ID NO: 22) and the predicted amino acid The acid sequence (SEQ ID NO: 23) is shown in FIG. 16 and FIGS. 17 to 19, respectively. Illustrating such a base sequence and the predicted amino acid sequence:
  • nt 1-717 EYFP of the Jellyfish
  • nt 1510-2220 Owan jellyfish ECFP
  • the antisense primer RaSI36LR has the sequence of the cDNA portion corresponding to the amino acid sequence from position 35 to position 42 of Ras, and the underlined portion indicates that the I 1 e It has a mutation. This mutation makes Ras activity temperature sensitive. Is known (Ref. 8).
  • the sense primer RasI36LF (5'-CGACCCCACTCTAGAGGATTCC-3 ') (SEQ ID NO: 25) and the antisense primer -Ras172Raf (see Example 1)
  • the antisense primer -Ras172Raf see Example 1
  • the obtained two DNA fragments were mixed, and PCR was carried out using the sense primer hRasXh and the antisense primer Ras172Raf in the same manner as described above, corresponding to positions 1 to 172 of the amino acid sequence of Ras. And a DNA containing a point mutation of I1e36 to Leu was amplified.
  • the PCR product was cut with XhoI and KpnI.
  • pRafrasl722 obtained in Example 1 was completely digested with XhoI and then partially digested with KpnI to obtain a DNA fragment from which Ras was removed.
  • the DNA fragment and the DNA fragment obtained in (ii) were ligated with T4 DNA ligase.
  • the resulting plasmid was named pRai-chu119.
  • the nucleotide sequence (SEQ ID NO: 26) and the predicted amino acid sequence (SEQ ID NO: 27) in the translation region of the plasmid are shown in FIGS. 21 to 23, respectively.
  • monitor protein Ra i- c hu 119
  • HEK293 T cells derived from human fetal kidney were cultured in a DMEM medium (manufactured by Mizu Seiyaku) containing 10% fetal serum.
  • the HEK 293 T cells were transfected with the pRafras 1722 or pRa i-chu 119 prepared in Example 1 and a guanine nucleotide exchange factor Sos expression vector (pCAGGS_mSos) by a phosphoric acid lupus method. did. After culturing for 24 hours in the same medium, the cells were transferred to an incubator at 33 ° C and 40 ° C, and further cultured for 24 hours.
  • the supernatant was collected by centrifugation at 100,000 xg.
  • pRafras 1722 obtained in Example 1 was digested with restriction enzymes SpE I and BamHI, subjected to agarose gel electrophoresis, and a promoter, an intron, a coding sequence, a polysequence of about 4.5 kb was obtained. A DNA fragment of the region containing the A addition signal was obtained. After removing the DNA from the gel by electroelution, use a Qiagen20 chip
  • This DNA was injected into the pronucleus of a mouse fertilized egg (DB Fl, Japan SLC) according to a standard method, and transplanted into the oviduct of a pseudopregnant ICR mouse (Japan SLC). After weaning of the obtained mouse, the tail was cut 1 cm, and kept overnight at 37 ° C. in a DNA extract containing P-tinase K (ABI). From here, phenol and phenol After removing the protein with form, an equal volume of isopropanol was added to recover the precipitated DNA. The recovered DNA was put in water and dissolved at 37 ° C.
  • the F1 mouse was bred to a C57 / Black mouse (Japan SLC).
  • the ventricle was taken from a newborn F2 mouse (0 day old) and minced with ophthalmic scissors.
  • PBS containing 0.05% trypsin and 0.5 mM EDTA was added, the cells were treated at 37 ° C for 10 minutes, and the isolated cardiomyocytes were collected. This operation was repeated six times, and cardiomyocytes were collected.
  • a DMEM medium containing 10% fetal calf serum, and cardiomyocytes were precipitated by low-speed centrifugation, and the supernatant was discarded.
  • the recovered cardiomyocytes were cultured in DMEM containing 10% fetal calf serum.
  • FIG. 25 shows the results of the change over time in the fluorescence intensity of ECFP and EYFP in the cells upon addition of EGF. It was confirmed that the activation of Ras can be measured in an EGF-dependent manner even in primary cultured cells derived from transgenic mice.
  • Example 7 Specificity of Raf rasl722 for guanine nucleotide exchange factor and GTP hydrolysis enzyme
  • GAPlm a GTP water-degrading enzyme for Ras
  • FRET efficiency for some RTPases, R-RasGAP and raplGAPII, for R-Ras and Rapl can be reduced Drop Absent.
  • guanine nucleotide exchange factors for Ras such as mSosl, RasGRF, and CalDAG-GEFI I increase FRET efficiency, but guanine nucleotide exchange using other Ras family G proteins such as CalDAG-GEFI, C3G, PDZ-GEF1, and KIAA0351 as substrates. FRET efficiency did not increase for some factors.
  • Rafrasl722 is specifically regulated in its FRBT efficiency by the same guanine nucleotide exchange factor and GTP hydrolysis enzyme as Ras.
  • Example 8 Preparation of Rai-chu404, a Rap1 monitor, and its specificity for guanine nucleotide exchange factor and GTP hydrolysis enzyme
  • a known amino acid substitution (Thr66Gly; Val69Leu; Ser73Ala; Metl54Thr; Vall64Ala; Serl76Gly; Thr204Tyr) in which known EGFP (Genbank / EBL accession number: U76561) has been replaced with seven amino acids by a known method using PCR.
  • known EGFP Genebank / EBL accession number: U76561
  • the Kpnl / NotI fragment containing the Raf region of Rafrasl722 was replaced with a Kpnl / Notl fragment containing the RalGDS region of the plasmid derived from pRai-chu311.
  • This vector was named pRaichu404.
  • the base sequence of the translation region is shown as SEQ ID NO: 30 and the amino acid sequence predicted from the base sequence is shown as S
  • Example 1 ECFP was amplified using a primer (SEQ ID NO: 32) containing a recognition site of a restriction enzyme Xbal instead of the antisense primer XFP-Bg1, and the method described in (Reference 11) was used. Then, the CAAX box of Ki-Ras protein was fused to the carboxyl terminus of ECFP. This was replaced by the method using Rafrasl722 and Rai-chu404 ECFP, restriction enzymes and T4 ligase. The resulting vectors were named pRai-chulOIX and pRai-chu404X, respectively.
  • FIG. 28 shows the results of the change over time in the fluorescence intensity ratio of ECFP and EYFP (EYFP / ECFP) in the cells due to the addition of EGF.
  • a high fluorescence ratio is shown in red and a low fluorescence ratio is shown in blue, and the diagram is presented using the IMD mode in which the fluorescence intensity of ECFP is expressed as lightness.
  • the red area indicates the site where Ras or Rapl activation is high.
  • Ras was activated from the periphery of cells by stimulation with cell growth factor, and Rapl was activated from the perinuclear area.
  • Rapl was activated from the perinuclear area.
  • the use of the active protein protein of the present invention allows intracellular Ras-amily G-tannos. Temporal and spatial information on the activity of the protein can be obtained.
  • Example 11 1 Visualization of Ras activation in PC12 cells expressing Rai-chulOIX and Rai-chu404X
  • FIG. 30 shows the results of the time-dependent changes in the fluorescence intensity ratio of ECFP and EYFP (EYFP / ECFP) in the cells due to the addition of nerve growth factor.
  • the part with high fluorescence ratio is shown in red and the part with low fluorescence ratio is shown in blue, and the figure is presented using IMD mode, which shows the fluorescence intensity of ECFP as brightness.
  • the red area indicates the site where Ras or Rapl activation is high.
  • Ras is activated from the periphery in the cell body during the induction phase of differentiation, whereas Ras activity required for cell survival is obtained at the completion of differentiation. was found to be maintained only in neurites.
  • Ra s occurred at different sites in the cell depending on the stage of cell differentiation.
  • Rapl was activated by the addition of nerve growth factor from the perinuclear region, and its activity in differentiated neurites was found to be low. This indicates that the activity of Ras family G proteins is regulated differently in different parts of the cell.
  • Example 1 2 Preparation of Rai-chulOlIX, which is an activity monitor of Ra c 1 activity protein (1) Preparation of chimeric gene encoding Ra c 1 and Pak 1
  • nt 1-684 Owan jellyfish EYFP
  • Ra c 1 activity monitor protein Rai-chulOllX
  • nt 1-684 Owan jellyfish EYFP
  • the plasmid was prepared by the PCR method according to the method of Example 1.
  • De pRai-chul214X was obtained.
  • the structure of pRai-chul214X (FIG. 33), the nucleotide sequence of its translated region (SEQ ID NO: 41) and the predicted amino acid sequence (SEQ ID NO: 42) are shown.
  • nt 1-684 Owan jellyfish EYFP
  • nt 697-1092 mD i a 1
  • Rh 0 A activity monitor protein (Rai-chul214X) in mammalian cells and analysis by spectrophotometer
  • Example 15 Rai-chulOllX and! Visualization of Rac1 activation in C0S1 cells expressing ai-chul054X
  • FIG. 37 shows the results of the change over time in the fluorescence intensity ratio of ECFP and EYFP (EYFP / ECFP) in the cells due to the addition of EGF.
  • Rac 1 is rapidly activated in the whole cell within 1 minute by EGF stimulation, and the activation converges to a part where the cell membrane is moving, called ruffling at the cell margin. I was able to observe how it was being done.
  • SEQ ID NO: 1 is the nucleotide sequence of the restriction enzyme Xh0I cleavage site and that of human H-Ras. This is the base sequence of the primer designed based on the base sequence.
  • SEQ ID NO: 2 is a nucleotide sequence of a primer designed based on the nucleotide sequence of human c-Raf 1 and the nucleotide sequence of human H-Ras.
  • SEQ ID NO: 3 is a nucleotide sequence of a primer designed based on a nucleotide sequence of a cleavage site of restriction enzyme KpnI and a nucleotide sequence of human c-Raf1.
  • SEQ ID NO: 4 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme N0tI and the nucleotide sequence of human c-Raf1.
  • SEQ ID NO: 5 is a nucleotide sequence of a primer designed based on the nucleotide sequence on the 5 ′ side of the Martinburg roning site of pB1uescript—SKIII (+).
  • SEQ ID NO: 6 is a nucleotide sequence of a primer designed based on the nucleotide sequence on the 3 ′ side of the Martinburg roning site of pB1uescript—SKIII (+).
  • SEQ ID NO: 7 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme BamHI and the nucleotide sequence of EYFP.
  • SEQ ID NO: 8 is a nucleotide sequence of a primer designed based on the nucleotide sequence of each cleavage site of restriction enzymes BamHI, KpnI, and XhoI and the nucleotide sequence of ECFP.
  • SEQ ID NO: 9 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme Not I and the nucleotide sequence of ECFP.
  • SEQ ID NO: 10 is a nucleotide sequence of a primer designed based on a nucleotide sequence of a cleavage site of restriction enzyme BglII and a nucleotide sequence of ECFP.
  • SEQ ID NO: 11 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human H-Ras, human c-Rayl, EYFP and ECFP.
  • SEQ ID NO: 12 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 11.
  • SEQ ID NO: 13 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme Xh0I and the nucleotide sequence of human Rap1A.
  • SEQ ID NO: 14 is a nucleotide sequence of a primer designed based on the nucleotide sequence of human Ra 1 GDS and the nucleotide sequence of human Rap 1A.
  • SEQ ID NO: 15 is a nucleotide sequence of one primer designed based on the nucleotide sequence of human Ra1 GDS.
  • SEQ ID NO: 16 is the nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme N0tI and the nucleotide sequence of human Ra1GDS.
  • SEQ ID NO: 17 is a nucleotide sequence of a primer designed based on the nucleotide sequence of each cleavage site of restriction enzymes BamHI, KpnI and XhoI and the nucleotide sequence of ECFP.
  • SEQ ID NO: 18 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human Rap1A, human Ra1GDS, EYFP and ECFP.
  • SEQ ID NO: 19 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 18.
  • SEQ ID NO: 20 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme Xh0I and the nucleotide sequence of human R-Ras.
  • SEQ ID NO: 21 is a nucleotide sequence of a primer designed based on the nucleotide sequence of the cleavage site of restriction enzyme KpnI and the nucleotide sequence of human R_Ras.
  • SEQ ID NO: 22 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human R-Ras, human c-Rafl, EYFP and ECFP.
  • SEQ ID NO: 23 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 22.
  • SEQ ID NO: 24 is a nucleotide sequence of a primer designed based on the nucleotide sequence of human H-Ras.
  • SEQ ID NO: 25 is a primer designed based on the nucleotide sequence of human H-Ras Is the base sequence.
  • SEQ ID NO: 26 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human H-Ras, human c-Rafl, EYFP and ECFP.
  • SEQ ID NO: 27 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 26.
  • SEQ ID NO: 28 is a nucleotide sequence of a primer designed based on a nucleotide sequence of a human H—Ras binding region of human c-Rafl.
  • SEQ ID NO: 29 is a nucleotide sequence of a primer designed based on the nucleotide sequence of ECFP.
  • SEQ ID NO: 30 is a plasmid base sequence designed based on each base sequence of human Rap1A, human c-Raf1, EYFP and ECFP.
  • SEQ ID NO: 31 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 30.
  • SEQ ID NO: 32 is a nucleotide sequence of a primer designed based on the nucleotide sequence of ECFP.
  • SEQ ID NO: 33 is given as a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human H_Ras, human c_Rafl, EYFP.ECFP and human K-Ras.
  • SEQ ID NO: 34 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 33.
  • SEQ ID NO: 35 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human RaplA, human c-Rafl, EYFP.ECFP and human K-Ras.
  • SEQ ID NO: 36 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 35.
  • SEQ ID NO: 37 is a fragment of human Ra cl, human Pak l, EYFP. This is a plasmid base sequence designed based on each base sequence of human K-Ras.
  • SEQ ID NO: 38 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 37.
  • SEQ ID NO: 39 is a nucleotide sequence of a plasmid designed based on each nucleotide sequence of human Cdc42, human Pak1, EYFP, ECFP, and human K-Ras.
  • SEQ ID NO: 40 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 39.
  • SEQ ID NO: 41 is a base sequence of a plasmid designed based on each base sequence of human RhoA, human mDia1, EYFP, ECFP, and human K-Ras
  • SEQ ID NO: 42 is an amino acid sequence predicted from the base sequence of the plasmid of SEQ ID NO: 41.
  • an activity monitor protein of a low-molecular-weight GTP-binding protein capable of measuring the activation of a non-invasive low-molecular-weight GTP-binding protein, a non-invasive low-molecular-weight GTP-binding protein expressing the protein Cells and transgenic animals useful for measuring protein activation, methods for measuring the activation of low-molecular-weight GTP-binding proteins using the proteins, and more specifically, low-molecular-weight GTP-binding proteins that can be used in living cells
  • the present invention provides a method for measuring the amount ratio of GTP-bound to GDP-bound, and a method for screening a low-molecular-weight GTP-binding protein activity modulator.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention concerne la surveillance protéique de l'activité d'une protéine de liaison de GTP (guanosine triphosphate) de bas poids moléculaire, permettant de mesurer l'activation d'une protéine de liaison de GTP de bas poids moléculaire et non effractive. L'invention concerne également un gène codant la protéine ci-dessus, un vecteur d'expression contenant ce gène, des cellules transformées ainsi qu'un animal transgénique exprimant la protéine ci-dessus décrite et portant le vecteur d'expression ci-dessus décrit, lequel est utile pour mesurer l'activation d'une protéine de liaison de GTP de bas poids moléculaire et non effractive. L'invention concerne encore un procédé de mesure de l'activation de cette protéine de liaison, à l'aide de la protéine ci-dessus décrite, ainsi qu'un procédé de criblage d'une substance régulant l'activité d'une protéine de liaison de GTP, de bas poids moléculaire.
PCT/JP2001/006967 2000-08-14 2001-08-13 Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire WO2002014373A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
GB0305675A GB2383796B (en) 2000-08-14 2001-08-13 Fusion proteins for monitoring the activities of low-molecular weight GTP-binding proteins
JP2002519510A JP3842729B2 (ja) 2000-08-14 2001-08-13 低分子量ｇｔｐ結合タンパク質の活性モニタータンパク質
AU7777501A AU7777501A (en) 2000-08-14 2001-08-13 Protein monitoring the activity of low-molecular weight gtp-binding protein
CA002419503A CA2419503A1 (fr) 2000-08-14 2001-08-13 Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire
US10/344,404 US20040053328A1 (en) 2000-08-14 2001-08-13 Monitoring proteins for the activities of low-molecular- weight gtp-binding proteins
AU2001277775A AU2001277775B2 (en) 2000-08-14 2001-08-13 Protein monitoring the activity of low-molecular weight GTP-binding protein

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
JP2000245910 2000-08-14
JP2000-245910 2000-08-14
PCT/JP2001/000631 WO2001034766A2 (fr) 2000-08-14 2001-01-31 Proteine surveillant l'activite d'une petite proteine de fusion gtp
JPPCT/JP01/00631 2001-01-31
PCT/JP2001/004421 WO2002014372A1 (fr) 2000-08-14 2001-05-25 Proteine de surveillance d'activite pour proteine de faible poids moleculaire se liant a la guanosine triphosphate (gtp)
JPPCT/JP01/04421 2001-05-25

Publications (1)

Publication Number Publication Date
WO2002014373A1 true WO2002014373A1 (fr) 2002-02-21

Family

ID=27278766

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2001/006967 WO2002014373A1 (fr) 2000-08-14 2001-08-13 Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire

Country Status (4)

Country Link
AU (2) AU2001277775B2 (fr)
CA (1) CA2419503A1 (fr)
GB (1) GB2383796B (fr)
WO (1) WO2002014373A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012043477A1 (fr) * 2010-09-27 2012-04-05 国立大学法人京都大学 Pont pour biocapteur fret unimoléculaire basé sur le principe du transfert d'énergie par résonance de fluorescence
US8889425B2 (en) 2003-11-26 2014-11-18 Bayerische Julius-Maximilians-Universität Würzburg Means and methods for the determination of camp in vitro and in vivo

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008444A1 (fr) * 1998-08-08 2000-02-17 Imperial Cancer Research Technology Limited Mesures de fluorescence pour systemes biologiques
WO2001034766A2 (fr) * 2000-08-14 2001-05-17 Michiyuki Matsuda Proteine surveillant l'activite d'une petite proteine de fusion gtp

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6803188B1 (en) * 1996-01-31 2004-10-12 The Regents Of The University Of California Tandem fluorescent protein constructs

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008444A1 (fr) * 1998-08-08 2000-02-17 Imperial Cancer Research Technology Limited Mesures de fluorescence pour systemes biologiques
WO2001034766A2 (fr) * 2000-08-14 2001-05-17 Michiyuki Matsuda Proteine surveillant l'activite d'une petite proteine de fusion gtp

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BOS J.L. ET AL.: "Ras-like GTPases", BIOCHIM. BIOPHYS. ACTA, vol. 1333, no. 2, 1997, pages M19 - M31 *
FRANKE B. ET AL.: "Rapid Ca2+-mediated activation of Rap1 in human platelets", EMBO J., vol. 16, no. 2, 1997, pages 252 - 259 *
MIYAWAKI A. ET AL.: "Fluorescent indicator for Ca2+ based on green fluorescent proteins and calmodulin", NATURE, vol. 388, no. 6645, 1997, pages 882 - 887 *
MOCHIZUKI N. ET AL.: "Spatio-temporal images of growth-factor-induced activation of Ras and Rap1", NATURE, vol. 411, no. 6841, 28 June 2001 (2001-06-28), pages 1065 - 1068 *
OHBA F. ET AL.: "Regulatory proteins of R-Ras, TC21/R-Ras2 and M-Ras/R-Ras3", J. BIOL. CHEM., vol. 275, no. 26, June 2000 (2000-06-01), pages 20020 - 20026 *
TSIEN R.Y. ET AL.: "Seeing the machinery of live cells", SCIENCE, vol. 280, no. 5371, 1998, pages 1954 - 1955 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8889425B2 (en) 2003-11-26 2014-11-18 Bayerische Julius-Maximilians-Universität Würzburg Means and methods for the determination of camp in vitro and in vivo
WO2012043477A1 (fr) * 2010-09-27 2012-04-05 国立大学法人京都大学 Pont pour biocapteur fret unimoléculaire basé sur le principe du transfert d'énergie par résonance de fluorescence
US9103790B2 (en) 2010-09-27 2015-08-11 Kyoto University Linker for unimolecular FRET biosensor based on principle of fluorescence resonance energy transfer
JP5802674B2 (ja) * 2010-09-27 2015-10-28 国立大学法人京都大学 蛍光共鳴エネルギー移動の原理に基づく一分子型ｆｒｅｔバイオセンサーのリンカー

Also Published As

Publication number Publication date
CA2419503A1 (fr) 2003-02-14
GB0305675D0 (en) 2003-04-16
GB2383796A (en) 2003-07-09
AU7777501A (en) 2002-02-25
AU2001277775B2 (en) 2007-09-06
GB2383796B (en) 2005-02-23

Similar Documents

Publication Publication Date Title
Nielsen et al. Gap junctions
US5962316A (en) Cell-cycle regulatory proteins, and uses related thereto
US9908918B2 (en) Cyan-excitable orange-red fluorescent proteins and bioluminescent resonance energy transfer systems
JP5802674B2 (ja) 蛍光共鳴エネルギー移動の原理に基づく一分子型ｆｒｅｔバイオセンサーのリンカー
DK2790018T3 (en) PROCEDURE FOR DETECTING PROTEIN-PROTEIN INTERACTION
US11267874B2 (en) Sensor systems for target ligands and uses thereof
US20070212707A1 (en) Cell cycle markers
Kumari et al. Functional expression and biophysical properties of polymorphic variants of the human gap junction protein connexin37
WO2001034766A2 (fr) Proteine surveillant l'activite d'une petite proteine de fusion gtp
WO2006099486A2 (fr) Methode et composes pour detecter des interactions proteine/proteine et proteine/acide nucleique
KR100626475B1 (ko) 프리세닐린과 베타-아밀로이드 펩타이드 또는 이의 전구체간의 상호작용을 억제할 수 있는 펩타이드
WO2002014373A1 (fr) Surveillance proteique de l'activite de la proteine de liaison gtp de bas poids moleculaire
US7691632B2 (en) Kit for detecting the level of cyclin-dependent kinase inhibitor P16 gene expression
JP3842729B2 (ja) 低分子量ｇｔｐ結合タンパク質の活性モニタータンパク質
US20020132340A1 (en) Isogenic beta-catenin cell lines, and methods of making and using same
US7713713B2 (en) Polypeptide having intracellular calcium ion indicator function
JP6473080B2 (ja) フェルスター共鳴エネルギー移動用ポリペプチド
EP1637540A1 (fr) Des molécules hyperactives de stat et procédés d'essai de l'activation génique
WO2005116219A1 (fr) Proteine fluorescente
ES2427854B1 (es) Sensores de calcio y métodos para la detección de calcio libre intracelular
SREEPATHY A SYNTHETIC BIOLOGY APPROACH TO INVESTIGATE THE INTERACTIONS OF MOUSE CRIPTO
Logan Functional aspects of Adenomatous Polyposis Coli protein dimerization and posttranslational regulation
Witosch Structural characterization of the Timeless-Tipin-RPA Complex and its interaction with ssDNA
Laughery Cellular localization and assembly of the Na, K-ATPase
Cheng Identification of the molecular interaction between the dihydropyridine receptor beta subunit and the ryanodine receptor in skeletal muscle

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

ENP Entry into the national phase

Ref document number: 0305675

Country of ref document: GB

Kind code of ref document: A

Free format text: PCT FILING DATE = 20010813

Format of ref document f/p: F

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002519510

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2419503

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2001277775

Country of ref document: AU

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10344404

Country of ref document: US

122 Ep: pct application non-entry in european phase