WO2002012316A1

WO2002012316A1 - A novel polypeptide - human branched-chain alpha-ketoacid dehydrogenase (bckdh) e1-beta subunit 9.9 and a polynucleotide encoding the same

Info

Publication number: WO2002012316A1
Application number: PCT/CN2001/001049
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Biowindow Gene Development Inc.
Priority date: 2000-06-28
Filing date: 2001-06-25
Publication date: 2002-02-14
Also published as: AU1490602A; CN1331092A

Abstract

The present invention discloses a novel polypeptide - human branched-chain α-ketoacid dehydroegnase (BCKDH) E1-α subunit 9.9 and a polynucleotide encoding the same, as well as a method of producing the polypeptide by DNA recombinant technique. The present invention also discloses methods of using the polypeptide in treatment of various disease, such as maple sugar urine disease, organacidia, developmental disturbance and so on. The present invention also discloses an antagonist against the polypeptide and the therapeutic use of the same. The present invention also discloses the use of such polynucleotide encoding human branched-chain α-ketoacid dehydrogenase (BCKDH) E1-β subunit 9.9.

Description

A New Polypeptide——Human Chain Alpha-Ketoacid Dehydrogenase (BCKDH) El-beta Subunit 9. 9 and Polynucleotide of This Polypeptide Technical Field

The present invention belongs to the field of biotechnology, and specifically, the present invention describes a new polypeptide ~~ Λ branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, and a multi-core encoding the polypeptide Nucleotide sequence. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. technical background

Branched-chain alpha-keto acid dehydrogenase participates in the oxidative decarboxylation of a-pha-keto acid, releasing CO 2 and producing the corresponding acetyl-CoA and MDH. BCKDH is a multi-enzyme complex consisting of three functional complexes. These three components are: decarboxylase E transacylase E2, and lipoic acid dehydrogenase E3. The purified BCKDH contains four polypeptide chains, namely Ela lpha, Elbeta, E2, and E3 (Per am, R. N., 1991, Biochemi stry, 30: 8501-8512).

A defect in the Elbeta subunit of the branched-chain alpha-keto acid dehydrogenase (BCKDH) complex is a cause of maple diabetes (MSUD). The DM isolated from the precursor of the BCKDH complex Elbeta subunit isolated from placental cells was found to contain a 5'-untranslated sequence of several nucleotides in its nucleotide sequence and more than one thousand translated nucleotides Sequence and more than a hundred untranslated 3, _untranslated sequences. This subunit was synthesized as a precursor with a 50 amino acid leader sequence and was processed at the NH2 end. The main structure of BCKDH-E1 beta shares homology with all regions of the Elbeta subunit of the human pyruvate dehydrogenase complex.

Maple diabetic (MSUD) patients have not found the normal branched alpha-keto acid dehydrogenase (BCKDH) complex Elbeta subunit, so the branched alpha a-keto acid dehydrogenase (BCKM) complex Elbeta subunit Deletion or mutation of the gene will cause a variety of diseases such as maple diabetes (MSUD) (obukuni, Y., Mi tsubuchi, H., Endo, F., Akaboshi, I., Asaka, J. and Matsuda, I. , J. Cl in. Invest. 86 (1), 242-247 (1990)).

Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC :, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation, 1013HT, scar Fc was not stimulated with growth factors, 1013HC, bladder cancer construct cells EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunal adenocarcinoma, and cardia cancer. The expression profile of the peptide is very similar to the expression profile of the human branched chain a lpha-ketoacid dehydrogenase (BCKDH) El-beta subunit, so the functions of the two are also possible. Similar. 9。 The present invention is named human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. As mentioned above, the human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that these regulatory processes are involved in There are a large number of proteins, so there is always a need in the art to identify more human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 proteins involved in these processes, especially to identify the amino acid sequence of this protein. Newcomer branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 The isolation of the protein-coding gene also provides a basis for the study to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, a human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human branched chain a pha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9.

Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9.

Another object of the present invention is to provide a method for producing a human chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9.

Another object of the present invention is to provide an antibody against a human branched chain apha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 of the polypeptide of the present invention.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the human branched chain apha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 of the polypeptide of the present invention.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Summary of invention

The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 787 to 1059 in SEQ ID NO: 1; and (b) a sequence having 1-1238 in SEQ ID NO: 1 Sequence of bits.

The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human branched chain alpha-keto acid dehydrogenase (BCKDH) E beta subunit 9.9 protein activity, which comprises using the polypeptide of the invention . The invention also relates to compounds obtained by this method.

The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 protein in vitro, which comprises detecting said biological sample Mutations in the polypeptide or its coding polynucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the polypeptides and / or polynucleotides of the present invention in the preparation for the treatment of cancer, developmental or immune diseases or other due to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9 Use of a medicament for a disease caused by abnormal expression.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.跗 Illustration

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a gene chip expression profile of the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 and the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit according to the present invention Comparison chart. The upper picture is a graph of the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, and the lower picture is the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta. Subunit expression profile histogram. Among them:!-Fetal brain, 2-arm Cystic mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC, 6- Fibroblas t, growth factor stimulation, 1024NT, 7-scars into fc growth factor stimulation, 1013HT, 8-scar into fc without stimulation with growth factor, 1013HC, 9-bladder cancer cell EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cell line, 14-fetal skin, 15- Spleen, 16-prostate cancer, Π-jejunal adenocarcinoma, 18 cardiac cancer.

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. OkDa is the molecular weight of the protein. The arrows indicate the separated protein bands. Invention soluble

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, protein sequences, and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

An "agonist" refers to a molecule that, when combined with human branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, causes a change in the protein to regulate the activity of the protein. Agonist can Including proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human branched chain alphaphatoketone dehydrogenase (BCKDH) El-be ta subunit 9.9.

"Antagonist" or "inhibitor" refers to a kind of human branched chain a lpha-one that can block or regulate human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 when combined with it. Acid dehydrogenase (BCKDH) El-be ta subunit 9.9 biologically or immunologically active molecule. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human branched chain alpha-ketoacid degassing enzyme (BCKM) El-beta subunit 9.9.

"Regulation" refers to changes in the function of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, including increased or decreased protein activity, changes in binding characteristics, and human branched chain a lpha -Changes in any other biological, functional or immune properties of the ketoacid dehydrogenase (BCKDH) El-beta subunit 9.9.

"Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 using standard protein purification techniques. Substantially pure human branched chain alpha-keto acid dehydrogenase (BCKDH) E1-beta subunit 9. 9 produces a single main band on a non-reducing polyacrylamide gel. Human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 The purity of the polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

Number of residues matching between sequence ^ and sequence S

Number of residues in sequence ^-number of interval residues in sequence ^-number of interval residues in sequence ^X

The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). ₀

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b,)} 2 and F _V, which specifically binds to human branched-chain alpha- ketoacid dehydrogenase (BCKDH) El- beta subunit 9. 9 epitopes.

A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9" refers to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9 . 9 Basically free of natural and Its related to other proteins, lipids, sugars or other substances. Those skilled in the art can purify human branched chain alpha-keto acid dehydrogenase (BCKDH) El-be ta subunit 9.9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, a human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, miracidia, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of the human branched chain a lpha- «acid dehydrogenase (BCKDH) El-beta subunit 9.9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to the human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 that is substantially retained in the present invention Biological function or activity of the polypeptide. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution is The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence is formed (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1238 bases in length and its open reading frame 787-1059 encodes 90 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit, and it can be inferred that the human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 has a similar function to the human branched chain al pha-keto acid dehydrogenase (BCKDH) El-beta subunit.

The polynucleotide of the present invention may be in the form of DNA or RNA. D form includes _C DNA, base Due to genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be coded or non-coded. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID MO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the thermogenic polypeptide shown in SEQ ID NO: 2 .

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. Encoding the branched-chain alpha- ketoacid dehydrogenase (BCKDH) of the present invention, polynucleotide sequences specific for El-beta subunit of ^9.9 can be obtained a variety of methods. For example, separation of Nucleotides. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human branched chain alpha-keto acid dehydrogenase (BCKDH) El -The transcript level of the beta subunit 9.9; (4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the protein product of the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 gene expression can be detected by immunological techniques such as Western blotting and radioimmunoprecipitation. , Enzyme-linked immunosorbent assay (ELISA) and so on.

A method for amplifying DNA / RM using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-cDM terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis. The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and using the vector of the present invention or directly using a human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 coding sequence produced by genetic engineering Host cells, and methods for producing the polypeptides of the present invention by recombinant techniques.

In the present invention, a polynucleotide sequence encoding a human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. . The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding human branched chain al pha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 and suitable transcription / translation regulatory elements . These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Ligation to an appropriate promoter in an expression vector to direct the synthesis of raRNA. Representative examples of these promoters are: the c or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters including CMV immediate early start child,

HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers. In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a The polynucleotide or recombinant vector is a genetically engineered host cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; eukaryotic cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with 0; 1 ₂ Treatment, procedure used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following D transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

By conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 (Science, 1984; 224 : 1431). Generally there are the following steps:

(1) The polynucleotide (or variant) encoding the human-human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 of the present invention, or recombinant expression containing the polynucleotide The vector transforms or transduces a suitable host cell;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. Physical, chemical, and other properties can be used for various separation methods if required Isolation and purification of recombinant proteins. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

Branched-chain cc-ketoacid dehydrogenase (BCKDH) catalyzes the oxidative decarboxylation of branched-chain cc-ketoacid, releases CO2 and produces corresponding acetyl-CoA and MM _e BCKDH is a multi-enzyme complex consisting of three functional The complex consists of three components: decarboxylase El, transacylase E2, and lipoic acid dehydrogenase E3. The purified BCKDH contains four polypeptide chains, namely ΐα, ΐβ, Ε2, and Ε3.

A defect in the branched-chain cc-keto acid dehydrogenase (BCKDH) complex Εββ subunit is a cause of mapleuria disease (MSUD). Maple diabetes (MSUD) patients have not found the normal branched chain cc-keto acid dehydrogenase (BCKDH) complex E 复合 β subunit, so branched chain cc-keto acid dehydrogenase (BCKDH) complex Eΐβ subunit Gene deletion or mutation will cause a variety of diseases such as maple diabetes (MSUD).

The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human branched chain α-keto acid dehydrogenase (BCKDH) El-β subunit, both of which have similar biological functions. The polypeptide of the present invention can catalyze the oxidative decarboxylation reaction of branched-chain cx-keto acids in the body. It has significance for the progress of the tricarboxylic acid cycle, especially for the glycogen metabolism. Its abnormal expression will cause material metabolism, especially glycogen. Disorders of metabolism and related diseases such as maple diabetes.

It can be seen that the abnormal expression of the human branched chain alpha-keto acid dehydrofluorene (BCKDH) El-beta subunit 9.9 of the present invention will produce various diseases, especially maple diabetes, organic acidemia, and developmental disorders. These diseases include, but are not limited to:

Organic acidemia: propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutarate type I

Developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, mental retardation, brain development disorder, skin, fat and muscular dysplasia Bone and joint dysplasia, various metabolic defects, and sexual retardation The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, can treat various diseases, especially It is maple diabetes, organic acidemia, developmental disorders, certain inflammations, and immune diseases.

The invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) human branch chains. Method for preparation of alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Agonists increase the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, a mammalian cell or a human branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit can be expressed in the presence of a drug. A membrane preparation of 9 and a labeled human branched-chain alpha-keto acid dehydrogenate The enzyme (BCKDH) El-beta subunit 9.9 was cultured together. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonist of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can bind to and eliminate human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 Its function is either to inhibit the production of the polypeptide or to bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.

When screening compounds as antagonists, human branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be added to the bioanalytical assay, and the human branched-chain alpha-keto acid can be removed by measuring the compounds. The effect of the interaction between the catalase (BCKDH) El-beta subunit 9.9 and its receptor to determine whether the compound is an antagonist. Using the same method for screening compounds described above, receptor deletions and analogs that act as antagonists can be screened. Polypeptides that bind to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 Molecules can be obtained by screening random peptide libraries composed of various possible combinations of amino acids bound to a solid phase. When screening, generally, the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 molecule should be labeled.

The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The present invention also provides antibodies directed against the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

The production of polyclonal antibodies can be obtained by direct injection of human branched chain alpha-keto acid dehydrogenase (BCKDH) E1-beta subunit 9.9 into immunized animals (such as rabbits, mice, rats, etc.). Agents can be used to enhance the immune response, including but not limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495- 497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce anti-human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta Single chain antibody of subunit 9.9.

Anti-human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 antibody can be used in immunohistochemistry to detect human branched chain alpha-keto acid dehydrogenase (BCKDH) El- beta subunit 9.9.

Monoclonal antibodies that bind to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.) . A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human branched chain alpha-keto acid dehydrogenation. Enzyme (BCKDH) El-beta Subunit 9.9 Positive Cells.

The antibodies of the present invention can be used to treat or prevent diseases related to human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9.

The invention also relates to a diagnostic test method for quantitative and localized detection of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 level. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 detected in the experiment can be used to explain the human branched chain alpha-keto acid dehydrogenase (BC H) El-beta subunit 9.9 Importance in a variety of diseases and for diagnosing diseases where the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 functions.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 to inhibit endogenous human branched chain alpha-keto acid Dehydrogenase (BCKDH) Bl-beta subunit 9.9 activity. For example, a variant human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be shortened and lack a signaling domain Human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, although it can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of the human chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9 The ⁹ polynucleotides are transferred into the cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9. 9 mRNA and ribozymes are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense R and DNA and ribozymes can be obtained by any existing RM or DNA synthesis technology, such as the technique of solid phase phosphate amide synthesis of oligonucleotides, which is widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This D sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

, A polynucleotide encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9. 9 can be used in conjunction with human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9. Diagnosis of 9 related diseases. A polynucleotide encoding human branched alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be used to detect human branched chain alpha-keto acid dehydrogenase (BC H) El-beta subunit 9. The expression of 9 or the abnormal expression of human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 in a disease state. For example, the DNA sequence encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 can be used to hybridize biopsy specimens to determine human branched chain alpha-keto acid dehydrogenase (BCKDH) El- beta subunit 9.9 expression. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a D chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis. Human branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human branched-chain alpha-keto acid dehydrogenase (RT-PCR) Transcription product of catalase (BCKDH) El-beta subunit 9.9.

Detection of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 gene mutations can also be used to diagnose human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 Related diseases. Human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9. 9 mutant forms include a normal wild-type human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 DM sequences are compared to point mutations, translocations, deletions, recombinations and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human branched chain a lpha-rimate dehydrogenase (BCKDH) El-beta subunit 9.9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of the human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the diagnostician Judgment. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are usually performed according to the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.

Example 1 Cloning of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-be subunit 9.9 The total RNA of human fetal brain was extracted by a one-step method of guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontecti) was used to insert the cDNA fragments into the multicloning site of the pBSK (+) vector (Clontecli) to transform DH5α to form a CDM library. With Dye The terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0068h07 was new DNA. A series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone. The results show that the 0068h07 clone contains a full-length cDNA of 1238bp (as shown in Seq ID N0: 1), and a 272bp open reading frame (0RF) from 787bp to 1059bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0068h07, and the encoded protein was named human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Example 2 Cloning of a gene encoding human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 using RT-PCR

CDM was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed with the following primers:

Pr imerl: 5,-GCTTTAGGTAAGAATTTATATTAT -3, (SEQ ID NO: 3)

Pr imer 2: 5'- TGCGGGAATAGTCATCTTTAATGT -3 '(SEQ ID NO: 4)

Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;

Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification conditions: 50 μl reaction volume containing 50 μl / L KCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl ₂ , 200 mol / L dNTP, 1 Opmol primer, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QUGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as l-1238bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 gene expression

Total RNA extraction in one step [Ana l. Biochera 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a MA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Use 20 μ§ RNA in 20 mM 3- (N- Morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-lmM EDTA-2. 2M formaldehyde on an L ² ½ agarose gel was used for electrophoresis. It was then transferred to a nitrocellulose membrane. ³² -P-labeled DNA probes were prepared by random primer method using c- ³² P dATP. The DNA probe used was the PCR amplified human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 coding region sequence (787bp to 1059bp) shown in FIG. 1. The 32P- labeled probes (about 2 xl 0 ⁶ cpra / ffll) and transferred to a nitrocellulose membrane R is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide - 25mM H ₂ P0 ₄ (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then Analysis and quantification using Phosphor Imager. Example 4 Recombinant human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 in vitro expression, isolation and purification

Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5'-CCCCATATGATGCAGAGTGGCACAATCTTGGCT-3 '(Seq ID No: 5) Primer4: 5' -CATGGATCCTTACAGAACTGCAGAACTGTTGGC-3 '(Seq ID No: 6) The 5' ends of these two primers contain Mel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to those on the expression vector plasmid pET- ² 8b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site. A PCR reaction was performed using the PBS-0068h07 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0068h07 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 4 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 () μ _£ / ιη1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0068h07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novageri) by the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 μ _§ / ιη1), the host strain BL21 (pET-0068h07) was at 37. C. Cultivate to the logarithmic growth phase, add IPTG to a final concentration of Iramol / L, and continue the cultivation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (Novagen) was used to obtain 6 histidine (6His-Tag). 9。 Purified human protein branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. After SDS-PAGE electrophoresis, a single band was obtained at 10 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human branched-chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 antibody The following human-chain alpha-keto acid dehydrogenase was synthesized using a peptide synthesizer (product of PE company) ( BCKDH) El-beta subunit 9.9 specific polypeptide:

NH2- et-Gln-Ser-Gly-Thr-I le-Leu-Ala-His-Cys-Asn-Ser-Cys-Leu-Pro-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Imraunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.釆 A titer plate coated with 15 pg / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human branched chain alpha-keto acid dehydrogenation (BCKDH) E beta subunit 9.9. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, orthern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2. GC content is 30% -70%, if it exceeds, non-specific hybridization increases;

3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85¾ or there are more than 15 consecutive bases, the primary probe should not be used in general;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'-TGCAGAGTGGCACAATCTTGGCTCACTGCAACTCTTGCCTC-3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

5'-TGCAGAGTGGCACAATCTTGCCTCACTGCAACTCTTGCCTC-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Press.

Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0. 25mol / L sucrose;. 25mmol / L Tris-HCl , pH7 5; 25 Ship ol / L NaCl; 25 so ol / L MgCl ₂₎ was suspended precipitate (about 10 _m l / g). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) 1000g centrifugation 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1ml per 0.1 g of the original tissue sample), then connect the following

2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (Ix10 ⁸ cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. ⁴ ) Add proteinase K to a final concentration of 200ug / ml. 5) 50 ° C or incubated gently shaking for 1 hour at 3 ⁷ ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/1 Q volume of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5X 10 ⁶ cells extracted about plus lul.

The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. I ² ) Carefully remove the aqueous phase, add 1/10 volume of 2 mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well and set to -20. C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100¾ ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) A _26β and A _28D were measured to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

1) Take 4x2 sheets of nitrocellulose (NC film) of appropriate size, and mark it lightly with a pencil For spotting position and sample number, two NC membranes are required for each probe, in order to wash the membranes with high-strength conditions and intensity conditions in the subsequent experimental steps.

2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5raol / L NaCl for 5 minutes (twice), dry and put in 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20μ1.

2) 37 Ό Incubate for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (ΒΡΒΧ

4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out.

6) 5 drops / tube, collect 10-15 tubes.

7) Monitor the amount of isotope with a liquid scintillator.

8) combining the first peak was collected after ³² P-Prob _e is prepared as required (the second peak to the free γ- ³² P- dATP).

Pre-hybridization

Place the sample membrane in a plastic bag and add 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 lrng / ml CT DNA (calf thymus DNA)). After sealing the bag, shake at 68 ° C for 2 hours.

Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

High-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) In 0.1xSSC, 0.1 SDS, wash at 40 ° C for 15 minutes (twice).

4) In 0.1xSSC, 0.1 DS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

1) Take out the sample membrane of hybridization. 2) 2xSSC, 0.1 SDS, wash at 37 ° C for 15 minutes (twice).

3) 0.1xSSC, 0.1% SDS, 37. C wash for 15 minutes (2 times).

4) 0. lxSSC, 0. 1 ⁰ /. Wash in SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

-70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

Experimental results:

的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; finding and screening new tissue-specific new genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., C ai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μηι. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

1. Hydration in a humid environment for 4 hours;

2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time; 4. NaBH _{4 is} blocked for 5 minutes;

5. 95. C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8. Store in a cool place at 25 ° C.

(Two) probe marking

Total RNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Araino-propar gy 1-2. Propargyl- 2'- deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

Sc ena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad, Sci. USA. Vol. 93: 10614-10619. Schena,., Shalon, Dar i., Dav is, RW (1995) Sc ience. 270 (20): 467-480.

(Three) cross

The probes from the two types of tissues and the chip were hybridized in niHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). The figure shows the expression of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 and human branched chain alpha-keto acid dehydrogenase (BCKDH) El-bet a subunit according to the present invention. The spectra are very similar.

Claims

Rights request

1. An isolated polypeptide-human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 , Or an active fragment, analog, or derivative of a polypeptide thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to the polynucleotide U); or

(c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 787-1059 in SEQ ID NO: 1 or the sequence of positions 1-1238 in SEQ ID NO: 1. .

'Ί, a recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Recombinant vector.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) A host cell transformed or transduced with the polynucleotide according to any of claims 4-6.

9. A method for preparing a polypeptide having human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 activity, characterized in that the method comprises:

(a) culturing the engineered host cell of claim 8 under the condition of expressing human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9;

(b) Isolate human branched alpha-keto acid dehydrogenase (BCKDH) El-beta from culture Subunit 9.9 active polypeptide.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to the human chain alpha-ketoacid dehydrogenase (BCKDH) El-beta subunit 9.9.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they mimic, promote, antagonize or inhibit the activity of human branched chain alpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9. Compound.

12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

13. An application of the compound according to claim 11, characterized in that the compound is used for regulating human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 in vivo and in vitro activity Methods.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 Mimetics, agonist I antagonists or inhibitors; or for peptide fingerprinting.

16. The use of a nucleic acid molecule as claimed in any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

17. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist Agent or inhibitor in a safe and effective dose with a pharmaceutically acceptable carrier composition as a drug combination for the diagnosis or treatment of diseases associated with human branched chain a lpha-keto acid dehydrogenase (BCKDH) El-beta subunit 9.9 Thing.

18. The use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.