WO2002020602A1 - A novel peptide---human short chain dehydrogenase 9.9 and the polynucleotide coding this novel peptide - Google Patents

Abstract

The invention disclosed a novel peptide--- Human short chain dehydrogenase 9.9, polynucleotide coding this peptide and the method producing this peptide by DNA recombination techniques. This invention also disclosed the therapeutical methods will this peptide for several diseases, such as Cancer, heart haemal illness, nerve system illness, immunological illness and inflammations, et al. This invention also disclosed an antagonist against this peptide and it's therapical effect. The invention also disclosed the use of this polynucleotide coding the novel human short chain dehydrogenase 9.9.

Description

 A new polypeptide-human short chain dehydrogenase 9.9 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human short chain dehydrogenase 9.9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 Short chain dehydrogenases have a large protein family with many members such as pyruvate dehydrogenase, 15-hydroxyprostaglandin dehydrogenase (NAD +), alcohol dehydrogenase, carbonyl dehydrogenase, retinol dehydrogenase (MDP +), 3α / 20 β-hydroxysteroid dehydrogenase, 11 β-hydroxysteroid dehydrogenase, etc., and are widely distributed in animals, plants, yeast, bacteria and other organisms, participating in the metabolic cycle.

Most short-chain dehydrogenase members are dimers and tetramers, with four highly conserved characteristic motifs: The catalytic active site of the enzyme is near the C-terminus and is a strictly conserved TyrXXXLys fragment, which can The target is attacked by nucleophiles; there is a Pro-Gly fragment near the active site; the N-terminal GlyXXXGlyXGly fragment is related to the co-enzyme interaction; the Asn-Asn-Ala-Asn fragment is related to the formation of the active center of the enzyme. [Persson B, et al Adv Exp Biol 1995; 372: 383-95] ₀ and Gly accounts for about one-third of highly conserved amino acids, which ensures that all members have similar tertiary structures and similar catalytic mechanisms. The HSCD2 protein described in the present invention is related to the formation of an enzyme active center as an Asn-Asn-Ala-Try fragment, which has an amino acid residue difference from a conserved fragment of familial characteristics, and the remaining conserved fragments are consistent with the familial characteristics.

When these enzymes function poorly or are lost, they can cause diseases such as immune disorders and cancer. For example, pyruvate dehydrogenase is a complex enzyme that is involved in glycolysis and fatty acid metabolism in the body. Deficiency of this enzyme leads to disturbances in energy metabolism. Retinol dehydrogenase (NADP +) in microparticles is involved in catalyzing the reduction of retinal to retinol to increase the content of retinoic acid. This enzyme deficiency affects the metabolism of retinoic acid [Duester G, et al. Biochemistry 1996; 35: 12221-12227] „The short-chain acyl CoA dehydrogenase (NAD ⁺ ) is a homotetrameric mitochondrial flavinase, which catalyzes Initiation of β-oxidation of short-chain fatty acids. Defects in this enzyme cause neuromuscular dysfunction and growth retardation. [Corydon, MJ et al. Mamra Genome 1997; 8: 922-926]. 11 β-hydroxysteroid dehydrogenase Catalyzes the mutual conversion of cortisone and cortisone (cortisol). This enzyme deficiency causes a significant excess of mineral corticosteroids in the body, leading to adolescent hypertension syndrome [White PC, et al. Steroids 1995 Jan; 60: 65-68 ].

Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-fc growth factor stimulation, 1013HT, scar-fc Not stimulated with growth factors, 1013HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, forefront In adenocarcinoma and jejunum adenocarcinoma, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human short-chain dehydrogenase, so their functions may also be similar. 9。 The present invention is named human short chain dehydrogenase 9.9.

 As mentioned above, the human short chain dehydrogenase 9.9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art Human short-chain dehydrogenase 9.9 proteins involved in these processes, in particular the amino acid sequence of this protein is identified. Newcomer short-chain dehydrogenase 9.9 The isolation of the protein-coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human short chain dehydrogenase 9.9 and fragments thereof. Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human short-chain dehydrogenase 9.9.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human short-chain dehydrogenase 9.9.

 Another object of the present invention is to provide a method for producing human short-chain dehydrogenase 9.9.

 Another object of the present invention is to provide an antibody against the human short chain dehydrogenase 9.9 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human short chain dehydrogenase 9.9.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human short chain dehydrogenase 9.9.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 1368-1640; and (b) a sequence of positions 1-2316 in SEQ ID NO: 1. The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human short chain dehydrogenase 9.9 protein, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human short-chain dehydrogenase 9.9 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human short chain dehydrogenase 9.9.

 Other aspects of the invention will be apparent to those skilled in the art due to the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RM, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" means the replacement of a different amino acid or A nucleotide replaces one or more amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when bound to a human short-chain dehydrogenase 9.9; causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to human short chain dehydrogenase 9.9.

 "Antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human short-chain dehydrogenase 9.9 when combined with human short-chain dehydrogenase 9.9 . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human short chain dehydrogenase 9.9.

 "Regulation" refers to a change in the function of human short-chain dehydrogenase 9.9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human short-chain dehydrogenase 9.9 Or changes in immune properties.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human short chain dehydrogenase 9.9 using standard protein purification techniques. 9 Basically pure human short chain dehydrogenase 9.9 can produce a single main band on a non-reducing polyacrylamide gel. Human short chain dehydrogenase 9.9 The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern print, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence B

 X 100

The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in. He in J "(1990) Methods in emz logy 183: 625-645) ₀

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RM sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

 "Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human short chain dehydrogenase 9.9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human short-chain dehydrogenase 9.9" means that human short-chain dehydrogenase 9.9 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can 9。 Purified human short chain dehydrogenase 9.9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human short chain dehydrogenase 9.9 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide-human short-chain dehydrogenase 9.9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or not include the initial cysteine residues.

 The invention also includes fragments, derivatives and analogs of human short chain dehydrogenase 9.9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human short chain dehydrogenase 9.9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or

(IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence) formed by fusing additional amino acid sequences into a mature polypeptide. As explained herein, such fragments, Derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2316 bases in length and its open reading frame 1 368-1640 encodes 90 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human short chain dehydrogenase, and it can be deduced that the human short chain dehydrogenase 9.9 has similar functions to human short chain dehydrogenase.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. The DM can be a coding chain or a non-coding chain. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F ico ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human short-chain dehydrogenase 9.9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human short-chain dehydrogenase 9.9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; ² ) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. Isolate cDNA of interest The standard method is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for raRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available CDM libraries are also available, such as different CDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of a human short-chain dehydrogenase 9.9 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human short-chain dehydrogenase 9.9 gene.

 A method using DNA technology to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human short chain dehydrogenase 9.9 coding sequence, and a recombinant technology to produce a polypeptide of the present invention method.

In the present invention, a polynucleotide sequence encoding a human short-chain dehydrogenase 9.9 can be inserted into a vector to construct Into a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to:

T7 promoter expression vector (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vector (Lee and Na thans, J Bi o Chem. 263: 3521, 1988) expressed in mammalian cells; and Baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human short-chain dehydrogenase 9.9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mo l ecu l ar C l on ing, a Labora tory Manua l, co ld Spr ing Harbor Labora tory. New York, 1989 ). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for transcription initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human short-chain dehydrogenase 9.9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells Cells if fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (Treatment 1 ₂ ^, with steps well known in the art. Alternatively, it is a MgCl _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human short-chain dehydrogenase 9.9 (Science, 1984; 224: 1431). Generally there are the following steps: (1). Use the polynucleotide (or variant) encoding human short chain dehydrogenase 9.9 of the present invention, or transform or transduce with a recombinant expression vector incorporating the polynucleotide A suitable host cell;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of the human short-chain dehydrogenase 9.9 and human short-chain dehydrogenase. The upper graph is a graph of the expression profile of human short chain dehydrogenase 9.9, and the lower graph is the graph of the expression profile of human short chain dehydrogenase 9.9. Among them, 1-fetal brain, 2-bladder mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC, 6- Fibroblast, growth factor stimulation, 1024NT, 7-scar Stimulated by fc growth factor, 1013HT, 8-scar into fc without stimulation by growth factor, 1013HC, 9-bladder cancer established cells EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cell line, 14-fetal skin, 15-spleen, 16-prostate cancer, 17-jejunal adenocarcinoma.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human short-chain dehydrogenase 9.9.

 9.9 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human short-chain dehydrogenase 9.9

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik niRNA Isolation Kit '(Qiegene Co.) RM from the total _{poly (A) mRNA 0 2ug poly} (A) mRNA is formed by reverse transcription cDNA. Use a Smartt cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech) and transformed into DH5α to form a cDNA library. Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that one of the clones (M67c01's cDNA sequence was new DNA. A series of primers were synthesized to synthesize the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0467c01 clone was 2316bp (as shown in SeqIDN0: 1), and there was a 273bp open reading frame (0RF) from 1308bp to 1640bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0467c01 and the encoded protein was named human short-chain dehydrogenase 9.9. Example 2: Cloning the gene encoding human short-chain dehydrogenase 9.9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5, one CATTTAGGAAACTTTATTGCACTT —3, (SEQ ID NO: 3)

 Primer2: 5'- GGACTCATGAACCGTCGTGATGCC-3 '(SEQ ID NO: 4)

 Priraerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence of SEQ ID Book 1: 1.

Amplification conditions: 50 mmol / L C1, 10 mmol / L Tris in a reaction volume of 50 μ 1- CI, (pH8.5), 1.5mmol / L MgCl ₂ , 200 μmol / L dNTP, lOpraol primer, Taq DNA polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min ₀ β-acUn was set as a positive control at the same time during RT-PCR And template blank is negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (IrwUrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2323bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human short-chain dehydrogenase 9.9 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human short-chain dehydrogenase 9.9 coding region sequence (1368bp to 1640bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human short chain dehydrogenase 9.9

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

 Primer3: 5'-CATGCTAGCATGCACAGGGGTGGCCCTATGGTC-3 '(Seq ID No: 5)

Primer4: 5'-CATGGATCCCTAAGGTACCCTTGCCCCCTTCTG-3 '(Seq ID No: 6) The two ends of the two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5, 5, and ³ ' ends of the target gene. The Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The pBS- (H67c01 plasmid containing the full-length target gene was used as a template to perform the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1, a plasmid containing 10 pg of pBS-0467c01, primers Primer-3 and Primer-4 points and another! 1 LOpmol, Advantage polymerase Mix (Clontech) 1 μ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 Loop. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 oc by the calcium chloride method, containing kanamycin

After the LB plate (final concentration 30 g / ral) was cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0467c01) with a correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0467c01) was 37 in LB liquid medium containing kanamycin (final concentration 30 μ _§ / ηι1). C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue incubating for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartr idge was used to bind 6 histidines (6His-Tag).

(Product of Novagen, Inc.) Chromatography was performed to obtain purified human short chain dehydrogenase 9.9. After SDS-PAGE electrophoresis, a single band was obtained at lOkDa (Figure 2). The band was transferred to a PVDF membrane, and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human short chain dehydrogenase 9.9 antibodies

 The following peptides specific to human short chain dehydrogenase 9.9 were synthesized using a peptide synthesizer (product of PE company):

NH2-Met-His-Arg-Gly-Gly-Pro-Met-Val-Thr-Ala-Gly-Met-Pro-Leu-Pro-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A 15 μ _§ / ηι1 bovine serum albumin peptide complex-coated titer plate was used as the ELISi to determine the titer of antibody in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to human short chain dehydrogenase 9.9. Example 6. Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting Trace method, Northern blotting method and copying method, etc., are all used to fix the polynucleotide sample to be tested on the filter membrane and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5, —TGCACAGGGGTGGCCCTATGGTCACTGCTGGAATGCCTCTT-3, (SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'-TGCACAGGGGTGGCCCTATGCTCACTGCTGGAATGCCTCTT-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES G. Η · Kel ler; , 1989 (USA) and more commonly used molecular cloning laboratory manuals, such as the Guide to Molecular Cloning Experiments (Second Edition, 1998). Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Procedure: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25m.l / L sucrose; 25 let ol / L Tris-HCl, pH 7.5; 25 let oi / LnaCl; 25mmol / L MgC12) suspension precipitation (about 10ml / g) „ 4) Homogenize the tissue suspension at 4oC at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5ml per 0.1 g of the original tissue sample) Centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1ml per G. lg of the initial tissue sample), then Following the phenol extraction method.

 2, DNA phenol extraction method

 Steps: 1) Wash cells with 1-1 Oml cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 108 cells / ml) with a minimum of 100 μl lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break and reduce the overall yield. This is particularly serious when extracting> 107 cells. 4) Add proteinase K to a final concentration of 200ug / ral. 5) Incubate at 50oC for 1 hour or shake gently at 37oC overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

 Steps: 1) Add 180 vol. 2mol / L sodium acetate and 1 vol. Cold 100% ethanol to the DNA solution and mix. Store at -20oC for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 7W cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500U1 cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the precipitate to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a pipette while gradually increasing TE, mix until the DNA is fully dissolved, and add approximately 1 ul per 1-5 x 106 cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37oC for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100u _g / ml. Incubate at 37oC for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well-20oC for 1 hour. 13) Use 70% ethanol and 100%. /. Wash the pellet with ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-5. 14) A260 and A280 were measured to detect the purity and yield of DNA. 15) Store at -20oC after packaging. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 Iraol / LNaOH, 1.5mol / LNaCl for 5 minutes (twice), dry and put in filter paper infiltrated with 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-SOoC for 2 hours.

 Labeling of probes

 1) 3 μl Probe (0.1OD / 10 μ 1), add 2 μ I inase buffer, 8-10 uCi γ-32Ρ-άΑΤΡ + 2ϋ Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37V for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (BPB). 4) Pass through a Sephadex G-50 column.

 5) Before the 32P-Probe washes out, start collecting the first peak (moni tor can be used for monitoring).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

 8) After combining the collection solutions of the first peak, the 32P-Probe (the second peak is free γ-32P-dATP) is prepared.

 Pre-hybridization

 Put the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (OxDenhardt, s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)). After sealing the bag, shake it at 68oC in a water bath for 2 hour.

 ^ Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42oC in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40oC for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1 ° / oSDS at 40oC for 15 minutes (twice).

 4) IxSSC, 0.1% SDS, wash at 55oC for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 37oC for 15 minutes (twice).

 3) 0. IxSSC, 0.1% SDS, wash at 7oC for 15 minutes (twice).

 4) IxSSC, 0.1% SDS, wash at 40oC for 15 minutes (twice), and dry at room temperature. X-ray auto-development:

 -70oC, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results.

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Mi croarray

Gene chip or gene micromatrix (DNA Microairay) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . Its specific method Steps have been reported in the literature in various ways, see, for example, DeRis i, JL, Lyer, V. Brown, P. 0. (1997) Sc ience 278, 680-686. And Hel le, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on the glass slide to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

 3. ddH20 was washed twice for 1 minute each time;

 4. NaBH4 is blocked for 5 minutes;

 5. 95oC water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

 7. Rinse twice with ddH20;

 8. Dry and store at 25oC in the dark for future use.

 (2) Probe labeling

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino ~ propargyl-2, -deoxyur idine 5, -tr iphate coupled to Cy3 f luorescent dye, purchased from Atnershara Pamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2, -deoxyur idine 5, -tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) raRM, and the probe was prepared after purification. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Sha lon, Dari., Davi s, RW (1995) Science. 270. (20): 467-480.

(Three) cross

Combine the probes from the two tissues with the chips in the UniHybTM Hybridizat ion Hybridization in a Solut ion (purchased from Tel eChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased by Genera l Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, and PMA +

Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fi brobl as t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer Established cells EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunal adenocarcinoma. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the expression profile of human short-chain dehydrogenase 9.9 and human short-chain dehydrogenase according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 The invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist J human short chain dehydrogenase 9.9. Agonists increase human short chain dehydrogenase 9.9 to stimulate cell proliferation and the like Biological functions, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, in the presence of drugs, mammalian cells or membrane preparations expressing human short-chain dehydrogenase 9.9 can be labeled The human short-chain dehydrogenase 9.9 was cultured together. The ability of the drug to increase or suppress this interaction was then determined.

 Antagonists of human short-chain dehydrogenase 9.9 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human short-chain degassing enzyme 9.9 can bind to human short-chain dehydrogenase 9.9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.

 When screening compounds as antagonists, human short-chain dehydrogenase 9.9 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between human short-chain dehydrogenase 9.9 and its receptors Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human short chain dehydrogenase 9.9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human short chain dehydrogenase 9.9 molecules should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides Antibodies against the human short-chain dehydrogenase 9.9 epitope These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human short chain dehydrogenase 9.9 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies against human short chain dehydrogenase 9.9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using conventional techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Other techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human short chain dehydrogenase 9.9.

 Antibodies against human short-chain dehydrogenase 9.9 can be used in immunohistochemistry to detect human short-chain dehydrogenase 9.9 in biopsy specimens.

 Monoclonal antibodies that bind to human short chain dehydrogenase 9.9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human short chain dehydrogenase 9.9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human short chain dehydrogenase 9.9 positive cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to human short chain dehydrogenase 9.9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human short chain dehydrogenase 9.9.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human short-chain dehydrogenase 9.9 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human short chain dehydrogenase 9.9 detected in the test can be used to explain the importance of human short chain dehydrogenase 9.9 in various diseases and to diagnose diseases in which human short chain dehydrogenase 9.9 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human short-chain dehydrogenase 9.9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat cell proliferation caused by non-expression or abnormal / inactive expression of human short-chain dehydrogenase 9.9 Colonization, development or metabolic abnormalities. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human short-chain dehydrogenase 9.9 to inhibit endogenous human short-chain dehydrogenase 9.9 activity. For example, a mutant human short-chain dehydrogenase 9.9 can be shortened and lack human signaling short-chain dehydrogenase 9.9. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human short chain dehydrogenase 9.9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human short-chain dehydrogenase 9.9 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human short-chain dehydrogenase 9.9 can be found in the existing literature (Sambrook, et al.). Alternatively, a recombinant polynucleotide encoding human short-chain dehydrogenase 9.9 can be packaged in Liposomes are transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on. .

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human short-chain dehydrogenase 9.9 inRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or D1 synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human short-chain dehydrogenase 9.9 can be used for the diagnosis of diseases related to human short-chain dehydrogenase 9.9. A polynucleotide encoding human short-chain dehydrogenase 9.9 can be used to detect the expression of human short-chain dehydrogenase 9.9 or the abnormal expression of human short-chain dehydrogenase 9.9 in a disease state. For example, the DNA sequence encoding human short-chain dehydrogenase 9.9 can be used to hybridize biopsy specimens to determine the expression of human short-chain dehydrogenase 9.9. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human short-chain dehydrogenase 9.9-specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human short-chain dehydrogenase 9.9 transcription products. Detection of mutations in the human short-chain dehydrogenase 9.9 gene can also be used to diagnose human short-chain dehydrogenase 9.9-related diseases. Human short-chain dehydrogenase 9.9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human short-chain dehydrogenase 9.9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 5'00 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human short chain dehydrogenase 9.9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human short chain dehydrogenase 9.9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

1. An isolated polypeptide-human short-chain dehydrogenase 9.9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof .

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 1 368-1640 in SEQ ID NO: 1 or positions 1-2316 in SEQ ID NO: 1 the sequence of.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human short chain dehydrogenase 9.9 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human short-chain dehydrogenase 9.9;

 (b) Isolating a polypeptide having human short chain dehydrogenase 9.9 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human short chain dehydrogenase 9. 9

 twenty three

Replacement page (Article 26) Specific binding antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human short chain dehydrogenase 9.9.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for regulating the activity of human short chain dehydrogenase 9.9 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used to screen mimetics, agonists, antagonists or inhibitors of human short chain dehydrogenase 9.9; Or used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1 to 6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human short chain dehydrogenase 9.9 abnormalities.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.