WO2002000828A2 - Nouveau polypeptide, proteine a doigt de zinc 34, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine a doigt de zinc 34, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002000828A2 WO2002000828A2 PCT/CN2001/000944 CN0100944W WO0200828A2 WO 2002000828 A2 WO2002000828 A2 WO 2002000828A2 CN 0100944 W CN0100944 W CN 0100944W WO 0200828 A2 WO0200828 A2 WO 0200828A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- zinc finger
- finger protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a zinc finger protein 34, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- Transcriptional regulation of eukaryotic genes is very important for the normal expression of genes and exerts biological functions. Usually, transcriptional regulatory factors complete this process. Transcriptional regulatory factors are involved in the body to determine which tissues and developmental stages of genes begin to transcribe. If the genes encoding such proteins are mutated, not only the gene itself cannot be expressed normally, but many genes regulated by it cannot be normal. Perform transcription and expression. The regulation of gene expression by transcription factors is mainly accomplished through the binding of transcription factors to specific DNA sequences, the interaction between transcription factors, and the interaction of transcription factors with conventional transcription mechanisms.
- DNA binding proteins there are many types of known DNA binding proteins: (1) proteins containing a helix-turn-helix motif; (2) Cys-His zinc finger protein; (3) Cys-Cys zinc finger protein (4) Leu zipper structural protein and so on.
- Zinc finger protein is a DNA-binding protein, which was first discovered in the amino acid sequence of the protein 5S rRNA gene transcription factor TF III A mediated by Xenopus MA polymerase III. Since then, zinc finger proteins have been expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, epidermal tissues, various tissues related to secretion and absorption, and tissues related to tumors and immortal cell lines. Wait. It is estimated that more than 1% of the zinc finger protein genes are in the human genome (Bellefroid et al., 1989; Pellegrino and Berg, 1991).
- the GATA family is a family of transcription regulators. It can be considered to belong to a zinc finger protein. It is a Cys-Cys zinc finger protein. Zn 2+ forms coordination bonds with four cysteine residues. This domain is required for the GATA transcription factor protein to bind DNA.
- the binding of GATA transcription factor protein to DM depends on the same sequence on DM: (A / T) GATA (A / G). GATA transcription factor protein can regulate the expression of many genes.
- GATA-1 GATA-1, GATA-2, GATA-3, GATA- 4 and so on.
- GATA-1 which can bind to the globin genes expressed in red blood cells and the GATA region of other genes, which plays an important role in the development of red blood cells and the transcriptional regulation of genes in them;
- GATA-2 regulates the eiidothelin-1 gene in endothelial cells
- GATA-3 which can bind to the enhancers of alpha and delta genes of T cell receptors, to its regulatory functions;
- GATA-4 which is expressed in tissues of endothelial origin and cardiac tissue.
- the human GATA transcription factor protein has important significance for the regulation of the expression of many genes and plays an extremely important role in human life activities.
- the zinc finger protein 34 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more zinc involved in these processes.
- the protein 34 protein especially the amino acid sequence that identifies this protein. Isolation of the new zinc finger protein 34 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Disclosure of invention
- Another object of the present invention is to provide a method for producing zinc finger protein 34.
- Another object of the present invention is to provide an antibody against the polypeptide-zinc finger protein 34 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide-zinc finger protein 34 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of zinc finger protein 34.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 7-924 in SEQ ID NO: 1; and (b) having a position 1430 in SEQ ID NO: 1 the sequence of.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the zinc finger protein 34 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of zinc finger protein 34 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of zinc finger protein 34.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to genomes or DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with zinc finger protein 34, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind zinc finger protein 34.
- Antagonist or an “inhibitor” refers to a molecule that, when combined with zinc finger protein 34, can block or regulate the biological or immunological activity of zinc finger protein 34.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind zinc finger protein 34.
- Regular refers to a change in the function of zinc finger protein 34, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of zinc finger protein 34.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify zinc finger protein 34 using standard protein purification techniques.
- the substantially pure zinc finger protein 34 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the zinc finger protein 34 polypeptide can be analyzed by amino acid sequence.
- “Complementary” or “complementary” refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "CT-G-A" can be combined with the complementary sequence "G-A-C-T".
- the complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou thern blot or
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percent identity can be determined electronically, such as by the MEGAL IGN program (La sergene sof tware package, DNASTAR, Inc., Madi son Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Hi gg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244).
- the Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in emzumo ogy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 Fv, which can specifically bind to the epitope of zinc finger protein 34.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity. .
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated zinc finger protein 34 means that zinc finger protein 34 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify zinc finger protein 34 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 34 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, zinc finger protein 34, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of zinc finger protein 34.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the zinc finger protein 34 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as leader or secretory sequences or used to purify this poly The sequence of a peptide or protease sequence)
- such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SBQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1430 bases, and its open reading frame 7-924 encodes 305 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with zinc finger protein, and it can be concluded that the zinc finger protein 34 has a similar function to zinc finger protein.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DM can be single-stranded or double-stranded.
- DNA can be a coding or non-coding strand.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- the "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring .variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid tablets are at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments are also Amplification techniques such as PCR can be used to identify and / or isolate a polynucleotide encoding a zinc finger protein 34.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the zinc finger protein 34 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate inRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature methods for mRNA extraction, and kits are also commercially available (Qiagene), and constructing cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) the level of zinc finger protein 34 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a MA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the zinc finger protein 34 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the substance can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by a conventional method.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a zinc finger protein 34 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the zinc finger protein 34 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a zinc finger protein 34 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and processed by the CaClr method, the steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant zinc finger protein 34 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- Fig. 1 is a comparison diagram of gene chip expression profiles of zinc finger protein 34 and zinc finger protein of the present invention.
- the upper figure is a graph of the zinc finger protein 34 expression profile, and the lower sequence is the zinc finger protein expression profile.
- 1-bladder mucosa 2-PMA + Ecv304 cell line
- 3-LPS + Ecv304 cell line thymus 4-normal fibroblasts 1024NC
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated zinc finger protein 34.
- 34kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Quik mRNA Isolat ion Kit (( ⁇ 6 8 6116 company product) was used to isolate 0 ⁇ (human) mRNA 0 2ug poly (A) mRNA from reverse transcription to form cDNA.
- Smart cDNA cloning kit (purchased from Clontech) ) The cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech) and transformed into DH5 a to form a cDNA library.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
- Pr imer 1 5'- GACAAAATGTCCCTGGAACAGGAG -3 '(SEQ ID NO: 3)
- Pr imer2 5'- ATCCTCAACTTGAGACAGGTTTAT -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions containing 5 0mmol / L KC 1, 10 ol / L in a reaction volume of 50 ⁇ 1
- Tr is-CI, (P H8 . 5), 1. 5ramol / L MgCl 2, 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech Co.).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 D C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1430bp shown in SEQ ID NO: 1.
- Example 3 Nor thern blot analysis of zinc finger protein 34 gene expression:
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA Using 20 ⁇ ⁇ RNA, perform electrophoresis on a 1.2% agarose gel containing 20raM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-ImM EDTA-2. 2M formaldehyde . It was then transferred to a nitrocellulose membrane.
- ⁇ - 32 P dATP was prepared by a random primer method : ' 2 P-labeled DNA probe.
- the DNA probe used was the PCR amplified zinc finger protein 34 coding region sequence (7bp to 924bp) shown in FIG.
- the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 (pH7. 4) -5 SSC- 5 ⁇ Denhardt's solution and 200 ⁇ g / 1 ⁇ 2l salmon sperm DNA. After hybridization, the filters were washed in 1 X SSC-0. 1% SDS at 55 C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant zinc finger protein 34
- Primer 3 5'-CCCCATATGATGTCCCTGGAACAGGAGGAGGAA-3 '(Seq ID No: 5)
- Pr imer4 5'-CATGGATCCTCATGTCACCTGTCCAATCTGTGG-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- Mel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen Product, Cat. No. 69865. 3).
- PCR was performed using the pBS-0749c01 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were as follows: a total volume of 50 ⁇ 1, containing 10 pg of pBS-0749c01 plasmid, 51 3 ⁇ 4 Primer-3 ⁇ PPrimer-4 ⁇ - ⁇ ! 1 Opmol> Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid PET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 (Ui g / ral)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (pET-0749C01) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following zinc finger protein 34-specific peptides:
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 301 ⁇ 2-70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 ( 4 lNt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Two NC membranes are required for each probe, so that it can be used in subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRi s i; J. L., Lyer, Y. & Brown, P. 0.
- Various cDM total of four full-length nucleotide sequence of more than 000 as a target DNA which comprises a polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500ng / ul, and spotted on a glass medium with a Cartesian 7 500 spotting instrument (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips.
- the specific method steps are in the literature There have been many reports in this article.
- the post-sampling processing steps of this embodiment are:
- mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescence was analyzed by reverse transcription.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue
- J Cy5dUTP (5 -Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the specific tissue (or stimulated cell line) tnRNA of the body, and the probe was prepared after purification.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1G24NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation , 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Draw a graph based on these Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the expression profiles of zinc finger protein 34 and zinc finger protein according to the present invention are very similar. Industrial applicability
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- GATA transcription factor protein can regulate the expression of many genes.
- GATA-1 which can bind to the globin genes expressed in red blood cells and GATA regions of other genes, has an important role in the development of red blood cells and the transcriptional regulation of genes in them; GATA-2, which regulates endothelin in endothelial cells -1 gene expression; GATA-3, which can bind to the enhancer of alpha and delta genes of T cell receptors, to its regulatory function; GATA-4, expressed in tissues of endothelial origin and cardiac tissue. (Trainor CD. Et al., 1990); (Lee ME. Et al., 1991); (Ho IC. Et al., 1991); (Spieth J. et al., 1991).
- abnormal expression of the specific GATA transcription factor protein raotif will cause abnormal function of the polypeptide containing the raotif of the present invention, resulting in abnormal regulation of the expression of many genes, and related diseases such as red blood cell disease and endothelial tissue disease. , Immune system diseases, tumors, etc.
- abnormal expression of the zinc finger protein 34 of the present invention will produce various diseases, especially red blood cell disease, endothelial tissue disease, immune system disease, and tumor. These diseases include, but are not limited to:
- Erythrocyte diseases various anemias such as thalassemia, angiocytic anemia, megaloblastic anemia, malignant anemia, aplastic anemia, hemolytic anemia, myelopathic anemia, anemia secondary to chronic diseases, erythrocytosis, inheritance Oval Red Blood Cells
- Endothelial Diseases Angiosarcoma, Kaposi's Sarcoma, Hemangioendothelioma, Lymphangioma, Lymphangiomyoma, Heart Valve Disease
- Immune system diseases Primary T lymphocyte immunodeficiency diseases such as congenital thymic dysplasia, nucleoside phosphorylase deficiency, chronic cutaneous mucosal candidiasis, high IgE syndrome, primary B lymphocyte immunodeficiency disease, Primary cell-humor combined immunodeficiency disease
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, Uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Abnormal expression of the zinc finger protein 30 of the present invention will also produce certain inflammations, certain genetic diseases, and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially red blood cell diseases, endothelial tissue diseases, immune system diseases, tumors, certain inflammations, certain Some hereditary diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) zinc finger protein 34.
- Agonists enhance biological functions such as zinc finger protein 34 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing zinc finger protein 34 can be cultured together with labeled zinc finger protein 34 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of zinc finger protein 34 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of zinc finger protein 34 can bind to zinc finger protein 34 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
- zinc finger protein 34 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between zinc finger protein 34 and its receptor.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to zinc finger protein 34 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the zinc finger protein 34 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a zinc finger protein 34 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of zinc finger protein 34 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to zinc finger protein 34 include, but are not limited to, hybridoma technology (Kohl er and
- Anti-zinc finger protein 34 antibodies can be used in immunohistochemical techniques to detect zinc finger protein 34 in biopsy specimens. Monoclonal antibodies that bind to zinc finger protein 34 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins against a specific bead site in the body.
- Such as zinc finger protein 34 high affinity monoclonal antibodies can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill zinc finger protein 34-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to zinc finger protein 34. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of zinc finger protein 34.
- the present invention also relates to a diagnostic test method for quantitative and localized detection of zinc finger protein 34 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of zinc finger protein 34 detected in the test can be used to explain the importance of zinc finger protein 34 in various diseases and to diagnose diseases where zinc finger protein 34 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- Polynucleotides encoding zinc finger protein 34 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormalities in cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of zinc finger protein 34.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant zinc finger protein 34 to inhibit endogenous zinc finger protein 34 activity.
- a variant zinc finger protein 34 may be a shortened zinc finger protein 34 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of zinc finger protein 34.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding a zinc finger protein 34 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a zinc finger protein 34 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding zinc finger protein 34 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit zinc finger protein 34 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
- Antisense RM, DNA and ribozymes can be obtained by any of the existing RNA or DM synthesis techniques, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis, which is widely used.
- Antisense RNA molecules can be expressed in vitro by a DM sequence encoding the RNA Or in vivo transcription. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside is linked using a phosphorothioate or peptide bond instead of a phosphodiester bond.
- a polynucleotide encoding a zinc finger protein 34 can be used in the diagnosis of disease associated with the zinc finger protein 34.
- the polynucleotide encoding zinc finger protein 34 can be used to detect the expression of zinc finger protein 34 or the abnormal expression of zinc finger protein 34 in a disease state.
- the DNA sequence encoding zinc finger protein 34 can be used to hybridize biopsy specimens to determine the expression of zinc finger protein 34.
- Hybridization techniques include Sout hern blotting, No rt hern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be immobilized on a microarray as probes
- Zinc finger protein 34 specific primers can also be used to detect the transcription products of zinc finger protein 34 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Zinc finger protein 34 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type zinc finger protein 34 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
- 'Somatic cell hybridization is a quick and easy way to map DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be Associated with genetic map data. These data can be found, for example, in V. Mckus i ck, Mendel i an Inher i tance in Man (available online with Johns Hopkins Un ivers i ty We l ch Medi ca l L i brary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
- the polypeptide of the present invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Zinc finger protein 34 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and range of zinc finger protein 34 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89533/01A AU8953301A (en) | 2000-06-12 | 2001-06-11 | A novel polypeptide, a zinc-finger protein 34 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116448.1 | 2000-06-12 | ||
CN 00116448 CN1327996A (zh) | 2000-06-12 | 2000-06-12 | 一种新的多肽——锌指蛋白34和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002000828A2 true WO2002000828A2 (fr) | 2002-01-03 |
WO2002000828A3 WO2002000828A3 (fr) | 2002-04-04 |
Family
ID=4585852
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000944 WO2002000828A2 (fr) | 2000-06-12 | 2001-06-11 | Nouveau polypeptide, proteine a doigt de zinc 34, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1327996A (zh) |
AU (1) | AU8953301A (zh) |
WO (1) | WO2002000828A2 (zh) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1381621A2 (en) * | 2001-03-05 | 2004-01-21 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999062952A1 (en) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | A human zinc finger protein gene (bmzf2) |
-
2000
- 2000-06-12 CN CN 00116448 patent/CN1327996A/zh active Pending
-
2001
- 2001-06-11 AU AU89533/01A patent/AU8953301A/en not_active Abandoned
- 2001-06-11 WO PCT/CN2001/000944 patent/WO2002000828A2/zh active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999062952A1 (en) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | A human zinc finger protein gene (bmzf2) |
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [Online] 21 December 1999 SULSTON J.E. ET AL. Retrieved from NCBI, accession no. GI:4508146 Database accession no. (AC004890.2) * |
DATABASE PROTEIN [Online] 21 October 1996 CHERET G. ET AL. Retrieved from NCBI, accession no. GI:1279698 Database accession no. (CAA61777.1) * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1381621A2 (en) * | 2001-03-05 | 2004-01-21 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
EP1381621A4 (en) * | 2001-03-05 | 2004-09-22 | Nuvelo Inc | NEW NUCLEIC ACIDS AND POLYPEPTIDES |
Also Published As
Publication number | Publication date |
---|---|
AU8953301A (en) | 2002-01-08 |
CN1327996A (zh) | 2001-12-26 |
WO2002000828A3 (fr) | 2002-04-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002000828A2 (fr) | Nouveau polypeptide, proteine a doigt de zinc 34, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001096560A1 (fr) | Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide | |
WO2002000823A2 (fr) | Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2001090377A1 (fr) | Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide | |
WO2002020585A1 (fr) | Nouveau polypeptide, suppresseur de la transmission de signaux par la cytokine socs-5-29, et polynucleotide codant ce polypeptide | |
WO2001068875A1 (fr) | Nouveau polypeptide, proteine humaine 67 de sarcome, et polynucleotide codant pour ce polypeptide | |
WO2001092324A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001094536A2 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 10.89, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001079433A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 13 and the polynucleotide encoding the polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001075059A2 (en) | A novel polypeptide, human gtp-regulatory protein 11 and a polynucleotide encoding the same | |
WO2002014365A1 (fr) | Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine | |
WO2002020589A1 (fr) | Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |