WO2002000824A2 - Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002000824A2 WO2002000824A2 PCT/CN2001/000936 CN0100936W WO0200824A2 WO 2002000824 A2 WO2002000824 A2 WO 2002000824A2 CN 0100936 W CN0100936 W CN 0100936W WO 0200824 A2 WO0200824 A2 WO 0200824A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- oncogene protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human tre oncogene protein 10.56, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- Tre is a recombinant gene isolated from NIH3T3 cells transfected with human Ewing's sarcoma DNA. It consists of three major genetic components derived from human chromosomes 5, 18 and 17. Tre-2 is a new transcription unit of the tre oncogene, located near the centromere of human chromosome 17q. The same or polymorphic or tumor-specific model of the transcription unit exists in various cancer cells in the human body However, it was not expressed in normal tissue-derived cells.
- the protein encoded by the tre oncogene is a highly hydrophilic protein with two charged clusters and therefore has the characteristics of binding to nucleotides (Ta tsuya Nakamura, Jana Hi lova, Oncogene (1992), 7, 733 -741).
- the human tre oncogene protein 10.56 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need to identify more participants in this field.
- These processes of human tre oncogene protein 10.56 protein In particular, the amino acid sequence of this protein is identified. Isolation of the new human tre oncogene protein 10.56 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for disease 1 and it is therefore important to isolate its coding DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human tre oncogene protein 10.56.
- Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human tre oncogene protein 10.56.
- Another object of the present invention is to provide a method for producing human t re oncogene protein 10.56.
- Another object of the present invention is to provide a human tre oncogene protein directed to the polypeptide of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human tre oncogene protein 10.56 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human tre oncogene protein 10.56.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 904 to 1194 in SEQ ID NO: 1; and (b) a sequence having 1 to 1421 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
- the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human TRE oncogene protein 10.56 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of the human oncogene protein 10.56 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human oncogene protein 10.56. .
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” is a molecule that, when combined with the human tre oncogene protein 10.56, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to the human oncogene protein 10.56.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human tre oncogene protein 10.56 when combined with human tre oncogene protein 10.56.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human tre oncogene protein 10.56.
- Regular refers to a change in the function of human tre oncogene protein 10.56, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of human tre oncogene protein 10.56. Change of nature.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human tre oncogene protein 10.56 using standard protein purification techniques. Basically pure human tre oncogene protein 10.56 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human tre oncogene protein 10.56 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of perfectly homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences interact with each other specifically or selectively.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences (Higg ins, DG and PM Sharp according to different methods such as Clus ter method). (1988) Gene 73: 237-244) 0 C lus ter method by examining the distances between all pairs of each set of sequence arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the number of residues matching between sequence A and sequence B X 100
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by a method well known in the art Methods such as Jotun He in determine the percent identity between nucleic acid sequences (He in J., (1990) Me thods in emzumo logy 183: 625-645) 0 "similarity" refers to the corresponding position in the alignment of amino acid sequences Degree of identical or conservative substitutions of amino acid residues.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand means
- Sense strand A complementary nucleic acid strand.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of the human oncogene protein 10.56.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides exist in the same state as in a natural state. Separated from other substances, it is isolated and purified.
- isolated human tre oncogene protein 10.56 refers to human tre oncogene protein 10.56 which is substantially free of other proteins, lipids, sugars or other substances naturally associated with it. Those skilled in the art can purify human tre oncogene protein 10.56 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human tre oncogene protein 10.56 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a human tre oncogene protein 10.56, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the human tre oncogene protein 10.56.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human oncogene protein 10.56 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1421 bases and its open reading frame 904-1194 encodes 96 amino acids.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be a coding strand or Non-coding chain.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human tre oncogene protein 10.56.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human oncogene protein 10.56 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of the transcript of human tre oncogene protein 10.56; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of 10.56 gene expression of human tre oncogene protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Selected and synthesized by conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human tre oncogene protein 10.56 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology .
- a polynucleotide sequence encoding a human tre oncogene protein 10.56 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human tre oncogene protein 10.56 or a polynucleotide containing the same The recombinant vector can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human t oncogene protein 10.56 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's tre oncogene protein 10.56 and human tre oncogene protein.
- the upper graph is a graph of the expression profile of the human tre oncogene protein 10.56, and the lower graph is the graph of the expression profile of the human tre oncogene protein.
- 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6-scarf to fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human tre oncogene protein 10.56.
- llkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Example 1 Cloning of human tre oncogene protein 10.56
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Quik mRNA I solat ion Kit product of Qiegene was used to isolate poly (A) m 2 2 poly (A) mRNA from total RNA by reverse transcription to form CDM.
- the Smart cDM cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a.
- the bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with a public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones G644E09 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer. After purification of Qiagene's kit, PCR amplification was performed with the following primers:
- Primerl 5'- TACACCGTTAATTTCCTATGGTTG -3 '(SEQ ID NO: 3)
- Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- P mer2 is the 3′-end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 leg ol / L KC1, 10mmol / L Tris-Cl, (pH8.5), 1.5ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a 50 ⁇ 1 reaction volume Primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -actin was also set as a positive control during RT-PCR And template blank is negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1421 bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human tre oncogene protein 10.56 gene expression:
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transferred to nitrocellulose.
- cc- 32 P dATP with 32 P- DNA probes prepared by Method labeled by random priming. The DNA probe used is shown in Figure 1 PCR amplification of the coding region of the human tre 10.56 oncogene protein Sequence (904bp to 1194b P ).
- 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C. overnight, the solution containing 50% formamide -25mM KH 2 P0 ⁇ (pH7.4) -5 ⁇ SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° / »SDS at 55 ° C 30min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human tre oncogene protein 10.56
- Primer 3 5, — CCCCATATGATGAGATTTGGGTGGAGTCACAGC- 3, (Seq ID No: 5)
- Primer 4 5'-CATGGATCCTCACCGTGTTGGCCAGGCTGGCCT-3 '(Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively, followed by the coding sequences of the 5 ' and 3 'ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28M +) (Novagen product, Cat. No. 69865. 3).
- the pBS-0644E09 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ , containing 10 pg of pBS-0644E09 plasmid, Primer-3 and Primer-4 l Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into colibacillus DH5 c by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 () ⁇ ⁇ / ⁇ 1), and then positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0644E09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0644E09) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration lmraol / L. Continue incubation for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with an affinity column His s. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). 56 ⁇ Purification of the target protein human tre oncogene protein 10.56.
- a peptide synthesizer (product of PE company) was used to synthesize 10.56 specific polypeptide of the following human tre oncogene protein: NH2- Met— Arg-Phe-Gly-Trp- Ser- Hi s- Ser- Gin- Thr- l ie -Leu-Leu- Gin- Trp-C00 H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose (R) column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
- the sample-immobilized filter is first prehybridized with a probe-free hybridization buffer to saturate the non-specific binding sites of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is identical to the gene fragment of SEQ ID NO: 1 Source or complementary (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene chip or gene micro-matrix is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze data to To achieve the purpose of fast, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen).
- the fluorescent test J Cy3dUTP (5-Araino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino- propargy 1-2'- deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and prepared it after purification Probe.
- Cy5dUTP 5- Amino- propargy 1-2'- deoxyur idine 5'-tr
- the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + E CV 304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a chart based on these 17 Cy3 / Cy5 ratios. (figure 1 ) . The figure shows that the human tre oncogene protein 10.56 and the human tre oncogene protein expression profile according to the present invention are very similar.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- tre oncogene This important tumorigenic gene is called tre oncogene, found in human Ewing's sarcoma cells and can be produced in NIH3T3 cells, but has not been found in other human cells It was found that the tre oncogene is a recombinant gene that can be isolated from NIH3T3 cells transfected with human Ewing's sarcoma DNA. Tre-2 is a new transcription unit of the tre oncogene, the same or more of the transcription units State-of-the-art or tumor-specific models exist in various human cancer cells, but are not expressed in normal tissue-derived cells.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human tre oncogene protein, and both have similar biological functions.
- the polypeptide of the present invention is involved in regulating or activating a variety of human tumor genes in vivo, and its translocation has a very significant activating effect on Ewing's sarcoma as a transcription unit. Its abnormal expression is usually closely related to the occurrence of a variety of tumors, abnormal inflammation or immune disorder. And produce related diseases, especially Ewing's sarcoma.
- the abnormal expression of the human tre oncogene protein 10.56 of the present invention will produce various diseases, especially bone tumors, other tumors, inflammations, and immune diseases. These diseases include, but are not limited to:
- Bone tumors Ewing's sarcoma, osteoid osteoma, osteochondroma, chondroma, osteoblastoma, chondroblastoma, etc.), malignant bone tumors such as giant cell tumor of bone, osteosarcoma, chondrosarcoma, myeloma
- tumors gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, astrocytoma, ependymoma, glioblastoma, neurofibromas, colon cancer, bladder Cancer, endometrial cancer, colon cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human tre oncogene protein 10.56 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially bone tumors, other tumors, inflammation, immune diseases, certain hereditary, blood Sexually transmitted diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human tre oncogene protein 10.56.
- Agonists enhance the human oncogene protein 10.56 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human tre oncogene protein 10. 56 can be cultured with labeled human tre oncogene protein 10.56 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human oncogene protein 10.56 include screened antibodies, compounds, receptor deletions, and the like. Antagonist of human oncogene protein 10.56 can bind to human oncogene protein 10.56 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions. .
- human tre oncogene protein 10.56 When screening compounds as antagonists, human tre oncogene protein 10.56 can be added to the bioanalytical assay, and the compound can be determined by determining the effect of the compound on the interaction between human tre oncogene protein 10.56 and its receptor. Whether it is an antagonist. In the same way as above for screening compounds, Receptor deletions and analogs that act as antagonists. Polypeptide molecules capable of binding to human tre oncogene protein 10.56 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10.56 molecules of human tre oncogene protein should be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human tre oncogene protein 10.56 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human tre oncogene protein 10.56 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human tre oncogene protein 10.56 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human tre oncogene protein 10.56.
- Anti-human tre oncogene protein 10.56 antibody can be used in immunohistochemistry to detect human tre oncogene protein 10.56 in biopsy specimens.
- Monoclonal antibodies that bind to human tre oncogene protein 10.56 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human tre oncogene protein 10.56 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human tre oncogene protein 10, 56 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human tre oncogene protein 10.56. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human tre oncogene protein 10.56.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human tre oncogene protein 10.56.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human tre oncogene protein 10.56 detected in the test can be used to explain the human tre oncogene protein 10.56 Importance in various diseases and diseases for which human tre oncogene protein 10.56 plays a role.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human tre oncogene protein 10.56 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human tre oncogene protein 10.56.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human tre oncogene protein 10.56 to inhibit endogenous human tre oncogene protein 10.56 activity.
- a mutated human tre oncogene protein 10.56 may be a shortened human tre oncogene protein 10.56 lacking a signaling functional domain. Although it can bind to a downstream substrate, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human tre oncogene protein 10.56.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human tre oncogene protein 10.56 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human tre oncogene protein 10.56 can be found in the existing literature (Sambrook, et al.). 0
- Another recombinant polynucleotide encoding human tre oncogene protein 10.56 can be packaged into lipids. In vivo transfer into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit 10.56 mRNA of human tre oncogene protein are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human tre oncogene protein 10.56 can be used for the diagnosis of diseases related to human tre oncogene protein 10.56.
- the polynucleotide encoding human tre oncogene protein 10.56 can be used to detect the expression of human tre oncogene protein 10.56 or the abnormal expression of human tre oncogene protein 10.56 in a disease state.
- the DNA sequence encoding human tre oncogene protein 10.56 can be used to hybridize biopsy specimens to determine the expression of human tre oncogene protein 10.56.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These technical methods are publicly available Commercially available techniques and related kits are available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- 56-transcripts of human tre oncogene protein 10.56 can also be detected using in vitro amplification of human tre oncogene protein 10.56 specific primers for MA-polymerase chain reaction (RT-PCR).
- Human tre oncogene protein 10.56 mutations can also be used to diagnose human tre oncogene protein 10.56-related diseases.
- Human tre oncogene protein 10.56 mutations include point mutations, translocations, deletions, recombination, and any other abnormalities compared to the normal wild-type human tre oncogene protein 10.56 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease.
- Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR.
- the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
- the polypeptide of the present invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human t oncogene protein 10. 56 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of the human oncogene 10.56 to be administered to the patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89529/01A AU8952901A (en) | 2000-06-12 | 2001-06-11 | A novel polypeptide, a human tre oncogene 10.56 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00116436 CN1328029A (zh) | 2000-06-12 | 2000-06-12 | 一种新的多肽——人tre致癌基因蛋白10.56和编码这种多肽的多核苷酸 |
CN00116436.8 | 2000-06-12 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002000824A2 true WO2002000824A2 (fr) | 2002-01-03 |
WO2002000824A3 WO2002000824A3 (fr) | 2002-05-10 |
Family
ID=4585840
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000936 WO2002000824A2 (fr) | 2000-06-12 | 2001-06-11 | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1328029A (zh) |
AU (1) | AU8952901A (zh) |
WO (1) | WO2002000824A2 (zh) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3936620A1 (en) | 2012-04-06 | 2022-01-12 | Geneohm Sciences Canada, Inc. | Sequences for detection and identification of methicillin-resistant staphylococcus aureus (mrsa) of mrej type xxi |
-
2000
- 2000-06-12 CN CN 00116436 patent/CN1328029A/zh active Pending
-
2001
- 2001-06-11 WO PCT/CN2001/000936 patent/WO2002000824A2/zh active Application Filing
- 2001-06-11 AU AU89529/01A patent/AU8952901A/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [Online] 21 December 1999 ABU-THREIDEH, J. ET AL. Retrieved from NCBI, accession no. GI: 3980546 Database accession no. (AC004875.1) * |
DATABASE GENBANK [Online] 22 February 2000 ISOGAI, T. ET AL. Retrieved from NCBI, accession no. GI: 7023820 Database accession no. (BAA92096.1) * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3936620A1 (en) | 2012-04-06 | 2022-01-12 | Geneohm Sciences Canada, Inc. | Sequences for detection and identification of methicillin-resistant staphylococcus aureus (mrsa) of mrej type xxi |
Also Published As
Publication number | Publication date |
---|---|
WO2002000824A3 (fr) | 2002-05-10 |
AU8952901A (en) | 2002-01-08 |
CN1328029A (zh) | 2001-12-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002000824A2 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002006475A1 (fr) | NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2001074869A1 (fr) | Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001074870A1 (fr) | Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001092517A1 (fr) | Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001092328A1 (fr) | Nouveau polypeptide, proteine humaine 10.78 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001094533A2 (fr) | Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide | |
WO2001090381A1 (en) | Novel polypeptide - a human alpha interferon receptor 115.62 and polynucleotide encoding it | |
WO2001070983A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide | |
WO2002020575A1 (fr) | Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide | |
WO2001047993A1 (fr) | Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
ENP | Entry into the national phase in: |
Ref document number: 10757201 Country of ref document: BG Kind code of ref document: A Format of ref document f/p: F |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |