WO2001094402A1 - Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001094402A1 WO2001094402A1 PCT/CN2001/000674 CN0100674W WO0194402A1 WO 2001094402 A1 WO2001094402 A1 WO 2001094402A1 CN 0100674 W CN0100674 W CN 0100674W WO 0194402 A1 WO0194402 A1 WO 0194402A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- human
- human npat
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human NPAT protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. ' technical background
- Cdk cyclin-dependent kinases
- Cdk2 is a member of the cyclin-dependent family of protein kinases. This protein binds to the corresponding cyclin in vivo and regulates cell mitosis into the S phase. In the regulation process, it also involves the synergy of many different proteins, such as NPAT protein. CDK protein catalyzes the phosphorylation and dephosphorylation of NPAT protein in this process, in order to activate the protein's intracellular activity and promote cell mitosis from G1 to S phase. Mutations or abnormal expression of these proteins will directly lead to abnormal mitotic pathways in various tissue cells of the organism, and then affect the growth and development of the organism, triggering a series of related metabolic disorders.
- NPAT proteins Many different NPAT proteins have been cloned from mice and humans, and it has been found that the protein has high homology and similar physiological functions in different organisms.
- Platzer et al. Cloned another NPAT protein from humans.
- the protein was localized on the eleventh human chromosome.
- This gene and its downstream gene ATM are members of the human housekeeping gene family.
- Various tissues and cells have different levels of expression.
- the protein and the ATM gene are expressed in the opposite direction and share a 5'-terminal nucleic acid sequence. Studies have found that the expression of these two proteins in organisms has a certain correlation. Their mutations or abnormal expressions are closely related to the occurrence of some autosomal genetic disorders in the organism, and provide a diagnosis and treatment for these diseases. Scientific basis [Platzer M., Rotman G. et al, 1997, Genome Res, 7: 592-605].
- NPAT protein is involved in regulating a variety of important biological processes in vivo.
- a housekeeping gene has a certain amount of expression in various tissues and cells of the organism.
- the protein works synergistically with some cyclin kinases in the body and plays an important regulatory role in the process of cell mitosis, regulating the process of cell mitosis from G1 to S phase.
- the mutation or abnormal expression of this protein will affect a series of related metabolic processes, and then cause various related diseases.
- This protein is usually closely related to the occurrence of autosomal genetic disorders such as developmental and metabolic disorders, ataxia capillary dilatation, and malignant tumors such as breast cancer and colon cancer, and cancer in vivo.
- the protein can also be used for the diagnosis and treatment of various diseases mentioned above.
- NPAT protein 12 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more people involved in these processes NPAT protein 12 protein, especially the amino acid sequence of this protein is identified. Isolation of the new gene encoding the NPAT protein 12 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human NPAT protein 12 '.
- Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human NPAT protein 12.
- Another object of the present invention is to provide a method for producing human NPAT protein 12.
- Another object of the present invention is to provide a simulation of human NPAT protein 12 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human NPAT protein 12. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 54 to 386 in SEQ ID NO: 1; and (b) a sequence having 1-622 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human NPAT protein 12 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human NPAT protein 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- a method for detecting a disease or susceptibility to disease associated with abnormal expression of human NPAT protein 12 protein in vitro which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection, immune diseases and various types of inflammation or other abnormalities due to the abnormal expression of human NPAT protein 12. Use of drugs that cause disease.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human NPAT protein 12 and human NPAT protein according to the present invention.
- the upper graph is a graph of the expression profile of human NPAT protein 12, and the lower graph is the graph of the expression profile of human NPAT protein.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human NPAT protein 12 isolated. 12KDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- Class Similarly, the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human NPAT protein 12, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human NPAT protein 12.
- Antagonist refers to a molecule that, when combined with human NPAT protein 12, can block or regulate the biological or immunological activity of human NPAT protein 12.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human NPAT protein 12.
- Regular refers to a change in the function of human NPAT protein 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human NPAT protein 12.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human NPAT protein 12 using standard protein purification techniques. Essentially pure human NPAT protein 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of human NPAT protein 12 can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by:
- Percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun Hein (He in L, (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human NP AT protein 12.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human NPAT protein 12 means that human NPAT protein 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human NPAT protein 12 using standard protein purification techniques. Non-reducing polyacryl A single main band can be produced on the amine gel. The purity of the human NPAT protein 12 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human NPAT protein 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human NPAT protein 12.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human NPAT protein 12 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 622 bases and its open reading frame 54-386 encodes 110 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human NPAT protein, and it can be deduced that the human NPAT protein 12 has similar functions to human NPAT protein.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DM forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optionally the additional Plus coding sequences) and non-coding sequences.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes . '
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i col l, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human NPAT protein 12.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human NPAT protein 12 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of human NP AT protein 12 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human NPAT protein 12 gene.
- ELISA enzyme-linked immunosorbent assay
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDNA terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human NPAT protein 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the human NPAT protein 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, which are well known in the art. Or other carriers.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human NPAT protein 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spin Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human NPAT protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- the host cell can be transformed with the DM sequence of the present invention or a recombinant vector containing the DNA sequence. This is done using conventional techniques well known to those skilled in the art.
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human NPAT protein 12 by conventional recombinant DM technology (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Cdk cyclin-dependent kinases
- Cdk and cycl in combine to form cyclin-dependent kinase activity, where cycl in is the regulatory subunit of the kinase and Cdk is the catalytic subunit; Cdk only binds to the corresponding cycl in and is phosphorylated by some protein kinases or Dephosphorylation only has protein kinase activity.
- a cyclin-dependent protein kinase Cdk2 which binds to the corresponding cyclin in vivo, regulates cell mitosis into the S phase. In the regulation process, it also involves the synergy of many different proteins, such as NPAT protein.
- CDK protein catalyzes the phosphorylation and dephosphorization of NPAT protein in this process
- the acidification process activates the protein's intracellular activity and promotes cell mitosis from G1 to S phase.
- the NPAT protein is required for this process.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human NPAT protein, and both have similar biological functions. It regulates the mitotic process of cells in the body, and its abnormal expression is usually closely related to the development of embryonic disorders, growth and development disorders, inflammation, and immune diseases, and produces related diseases.
- the abnormal expression of the human NPAT protein 12 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
- Tumors of various tissues breast cancer, colon cancer, stomach cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, nerve fibers Tumor, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human NPAT protein 12 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides screening compounds to identify increasing (agonist) or suppressing (antagonist) human NPAT Method of medicament for protein 12.
- Agonists enhance human NPAT protein 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human NPAT protein 12 can be cultured together with labeled human NPAT protein 12 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human NPAT protein 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human NPAT protein 12 can bind to human NPAT protein 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions. !
- human NPAT protein 12 When screening compounds as antagonists, human NPAT protein 12 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human NPAT protein 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human NPAT protein 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally, 12 molecules of human NPAT protein should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human NPAT protein 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human NPAT protein 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human NPAT protein 12 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human NPAT protein 12.
- Antibodies against human NPAT protein 12 can be used in immunohistochemical techniques to detect human NPAT protein 12 in biopsy specimens.
- Monoclonal antibodies that bind to human NPAT protein 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Human NPAT protein 12 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human NPAT protein 12 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human NPAT protein 12. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human NPAT protein 12.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human NPAT protein 12 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human NPAT protein 12 detected in the test can be used to explain the importance of human NPAT protein 12 in various diseases and to diagnose diseases in which human NPAT protein 12 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human NPAT protein 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human NPAT protein 12.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human NPAT protein 12 to inhibit endogenous human NPAT protein 12 activity.
- a mutant human NPAT protein 12 may be a shortened human NPAT protein 12 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human NPAT protein 12.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human NPAT protein 12 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a human NPAT protein 12 can be found in the literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human NPAT protein 12 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human NPAT protein 12 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RM, DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
- Antisense RM molecules can pass the DM encoding the RM
- the 00674 sequence was obtained by in vitro or in vivo transcription. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- a polynucleotide encoding human NPAT protein 12 can be used for the diagnosis of diseases related to human NPAT protein 12.
- a polynucleotide encoding human NPAT protein 12. can be used to detect the expression of human NPAT protein 12 or the abnormal expression of human NPAT protein 12 in a disease state.
- the DM sequence encoding human NPAT protein 12 can be used to hybridize biopsy specimens to determine the expression of human NPAT protein 12.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- RNA-polymerase chain reaction in vitro amplification of human NPAT protein 12-specific primers can also detect the transcribed products of human NPAT protein 12.
- Detection of mutations in the human NPAT protein 12 gene can also be used to diagnose human NPAT protein 12-related diseases.
- Human NPAT protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human NMT protein 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cMA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition contains a safe and effective amount of the polypeptide or antagonist and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human NPAT protein 12 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human NPAT protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDM cloning kit purchased from Clontech
- Clontech was used to insert the cDM fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the public D-sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0524dl2 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDM was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification by Qiagene's kit, PCR was performed using the following primers:
- Pr imerl 5'- GTACATAATATTTTTAAAAATAAT -3 '(SEQ ID NO: 3)
- Primer2 5'- ATTAGATTTTATTTTAAGGCAAAG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- a reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, 10 mmol / L Tri s- HC1 pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 at RT- During PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
- Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the pCR vector (Invitrogen's product).
- the results of DM sequence analysis showed that The DM sequence of the PCR product is exactly the same as the 1-622bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human AT protein 12 gene expression
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate ( PH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH 7.4) '-5 x SSC-5 x Denhardt, s solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter The membrane was washed in 1 x SSC-0. 1% SDS at 55 ° C for 30 min. Then, analysis and quantification were performed using a Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human NPAT protein 12
- Primer 3 5'- CCCCATATGATGCAATACATGACATTAATCTTT -3 '(Seq ID No: 5)
- Pr imer4 5'- CATGGATCCCTAAGCTTCTGACTCTATCTTGCT -3, (Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- the pBS-0524dl2 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: 10 pg of pBS-0524dl2 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primaer-4 primers were 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 rain, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the colibacillus DH5 CX by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0524dl2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- NH2-Met-Gln-Tyr-Met-Thr-Leu-I le-Phe-Ser-Gln-Asn-Pro-Leu-Arg-Cys-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Iramunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization
- the background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (understand):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively. .
- the 32 P- Probe (the second peak is free ⁇ - 32 P_dATP) to be prepared after the collection solution of the first peak is combined.
- the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt's; 6xSSC, 0.1mg / ral CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- 3-lOmg prehybridization solution (10xDenhardt's; 6xSSC, 0.1mg / ral CT DM (calf thymus DNA)
- Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently researching and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription!]
- the fluorescent reagent Cy3dUTP (5-Amino-pr opar gy 2'-deoxyuridine 5'-tri pha te coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino-propargyl- 2'- deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech Company, labeled mRM, a specific tissue (or stimulated cell line) of the body, and prepared probes after purification.
- Cy3dUTP 5-Amino-pr opar gy 2'-deoxyuridine 5'-tri pha te coupled
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L0 2 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU85655/01A AU8565501A (en) | 2000-04-29 | 2001-04-28 | A new polypeptide---human npat protein 12 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115548.2 | 2000-04-29 | ||
CN00115548A CN1321676A (zh) | 2000-04-29 | 2000-04-29 | 一种新的多肽——人npat蛋白12和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001094402A1 true WO2001094402A1 (fr) | 2001-12-13 |
Family
ID=4584994
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000674 WO2001094402A1 (fr) | 2000-04-29 | 2001-04-28 | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1321676A (zh) |
AU (1) | AU8565501A (zh) |
WO (1) | WO2001094402A1 (zh) |
-
2000
- 2000-04-29 CN CN00115548A patent/CN1321676A/zh active Pending
-
2001
- 2001-04-28 WO PCT/CN2001/000674 patent/WO2001094402A1/zh active Application Filing
- 2001-04-28 AU AU85655/01A patent/AU8565501A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
BYRD P.J. ET AL.: "A gene transcribed from the bidirectional ATM promoter coding for a serine rich protein: amino acid sequence, structure and expression studies", HUM. MOL. GENET., vol. 5, no. 11, 1996, pages 1785 - 1791 * |
DATABASE GENBANK [online] 14 December 1999 (1999-12-14), "Homo sapiens chromosome X sequence from 5 cosmids, map Xp21.1 ewgion DXS709-SRPX, complete sequence", XP002905341, Database accession no. AL121577 * |
IMAI T. ET AL.: "The structure and organization of the human NPAT gene", GENOMICS, vol. 42, no. 3, 1997, pages 388 - 392 * |
THOMAS G.H. ET AL.: "Intragenic duplication and divergence in the spectrin superfamily of proteins", MOL. BIOL. EVOL., vol. 14, no. 12, 1997, pages 1285 - 1295 * |
Also Published As
Publication number | Publication date |
---|---|
AU8565501A (en) | 2001-12-17 |
CN1321676A (zh) | 2001-11-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001096560A1 (fr) | Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001066578A1 (fr) | Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2001046244A1 (fr) | Nouveau polypeptide, adn polymerase 17, et polynucleotide codant pour ce polypeptide | |
WO2002026810A1 (fr) | Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide | |
WO2002012492A1 (fr) | Nouveau polypeptide, proteine npat humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001088147A1 (fr) | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant | |
WO2001075027A2 (fr) | Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001083758A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001070960A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001087968A1 (fr) | Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001092540A1 (fr) | Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide | |
WO2001083542A1 (en) | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide | |
WO2001070795A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2002012512A1 (fr) | Nouveau polypeptide, 6-pyruvoyl-tetrahydropterine synthase 11 humaine (ptps), et polynucleotide codant ce polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001078755A2 (en) | A novel polypeptide - human ataxia-telangiectasia mutant protein 9 and a polynucleotide encoding the same | |
WO2001075059A2 (en) | A novel polypeptide, human gtp-regulatory protein 11 and a polynucleotide encoding the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |