WO2001083557A1 - A novel polypeptide, a cellular factor receptor 10 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a cellular factor receptor 10, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumor, hemopathy, development disorders, HIV infection, immunological disease, and various inflammations, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel cellular factor receptor 10.

Description

 A new polypeptide-cell shuttlecock receptor 10 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, cytokine receptor 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. technical background

 The evolution of multicellular organisms depends on communication between cells. Due to the delicate division of labor between cells, some cell populations depend on other cell populations and require other cell populations to respond to them. This sophisticated intercellular communication network can control cell growth, division, death, differentiation, formation of tissues, and various other life processes. Judging from the importance and complexity of communication between higher animals, it is likely that a significant portion of genes in the organism are involved in this process.

 Chemical signal factors of cells can be divided into two types, lipophilic and hydrophilic. Among them, hydrophilic signal molecules include neurotransmitters, growth factors, and cytokines. They cannot penetrate the double lipid layer of the plasma membrane of the target cell, and can only bind to specific receptors on the cell surface, and through signal transduction mechanisms, they can generate a second messenger or activate protein kinase or protein phosphatase activity in the cell. The second messenger quickly changed the activity of enzymes or non-enzyme proteins in the target cells, causing the cells to respond to external signals.

 The cytokine receptor is a superfamily of transmembrane proteins. The structures outside their membranes have two barrel-shaped structures formed by seven bundle-like structures. Cytokine receptors mediate many non-tyrosine protein kinase receptor signaling, including growth hormone, prolactin, many growth factors of the hematopoietic system and their interferons, etc. Therefore, cytokine receptors are involved in a variety of cell physiology. Activities play important regulatory roles, such as regulating cell proliferation, regulating cell differentiation, immunity, and development during hematopoietic effects. For example: Cytokine receptor c-Mpl plays an important role in stimulating megakaryocyte development and platelet formation [Current Opinion in Hematology 1995, 2: 22-28.].

Many receptors for lymphokines, angiogenesis factors, and growth hormone-related molecules have the same binding region. These receptors include: Common β-chains of cytokine receptors, common to IL-3, IL-5, and GM-CSF receptors. Cytokine receptors commonly have Υ chains, which are common for IL-2, IL-4, IL-7, and IL-13 receptors. Ciliary neurotrophic factor receptor (CNTFR); Erythropoietin receptor; Interleukin 2 receptor β chain; Interleukin 3 receptor ct chain; Interleukin 4 receptor α chain; Interleukin 5 receptor α Chain; interleukin 6 receptor interleukin 7 receptor alpha chain; interleukin receptor 9; growth hormone receptor; lactation stimulating hormone; thrombopoietin receptor; characteristic conserved regions including extracellular ligand binding Region, about 200 amino acids in length. A pair of cysteines at the N-terminus of this region are involved in disulfide bond formation:

 + xxxxxxx

 +

 I C C C C, Extrace l lular XXXXXXX Cytoplasmi c

I I I I Transmembrane

 +-+ + ― +

 Its characteristic sequence: 1. C- [LVFYR] -x (7, 8)-[STIVDN] -C-x-W where two C form a disulfide bond 1. [STGL] -X-W- [SG] -x-W-S

 The polypeptide of the present invention contains the above-mentioned characteristic conserved sequences of cytokine receptors, so it is considered to be a new cytokine receptor with similar biological functions, and is named as cytokine receptor 10.

 As the cytokine receptor 10 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more cytokine receptor 10 proteins involved in these processes In particular, the amino acid sequence of this protein is identified. The isolation of the novel cytokine receptor 10 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention

 It is an object of the present invention to provide an isolated new polypeptide, cytokine receptor 10, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a cytokine receptor 10.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a cytokine receptor 10.

 Another object of the present invention is to provide a method for producing a cytokine receptor 10.

Another object of the present invention is to provide antibodies against the cytokine receptor 10 of the polypeptide of the present invention. Another object of the present invention is to provide a simulation of the cytokine receptor 10 of the polypeptide of the present invention. Compounds, antagonists, agonists, inhibitors.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in cytokine receptor 10. · '' Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 12-296 in SEQ ID NO: 1; and (b) a sequence having 1-1999 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a cytokine receptor 10 protein, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a cytokine receptor 10 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample. The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of cytokine receptor 10.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. MM

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Figure 1 is a comparison diagram of the amino acid sequence homology of a total of 68 amino acids in the 13-80 cytokine receptor 10 and characteristic domains of the cytokine receptor family of the present invention. The upper sequence is the cytokine receptor 10, and the lower sequence is the characteristic domain of the cytokine receptor family proteins. Ί "and": "" and "." Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated cytokine receptor 10. lOKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

"Agonist" refers to a protein that, when bound to cytokine receptor 10, causes the protein to change, thereby Molecules that regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the cytokine receptor 10.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with a cytokine receptor 10, can block or regulate the biological or immunological activity of the cytokine receptor 10. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the cytokine receptor 10.

 "Regulation" refers to a change in the function of the cytokine receptor 10, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of the cytokine receptor 10.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify cytokine receptor 10 using standard protein purification techniques. Essentially pure cytokine receptor 10 produces a single main band on a non-reducing polyacrylamide gel. The purity of the cytokine receptor 10 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This blot etc.) to detect. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:

 The number of residues between the sequence ^ and the sequence

 lOO

Number of residues in sequence ^-number of interval residues in sequence ^-number of interval residues in sequence S The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or R sequence. The "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds to the cytokine receptor antigenic determinant 10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated cytokine receptor 10" means that the cytokine receptor 10 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify cytokine receptor 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the cytokine receptor 10 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, cytokine receptor 10, which is basically composed of SEQ ID NO: 2 The amino acid sequence shown is composed. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the cytokine receptor 10. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the cytokine receptor 10 of the present invention. The fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length nucleotide sequence of 1999 bases, and its open reading frame (12-296) encodes 94 amino acids. This polypeptide has a characteristic sequence of a cytokine receptor family protein, and it can be deduced that the cytokine receptor 10 has the structure and function represented by the cytokine receptor family protein.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides encoding the polypeptide and include additional editing Coded and / or non-coding polynucleotides.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between

50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Crosses occur only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding cytokine receptor 10.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the cytokine receptor 10 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qi agene). And the construction of cDNA libraries is also a common method (Sambrook, eta l., Moleclar Cloning, A Labora tory Manua l, Col. Harbor Labora tory. New York, 1989). Commercially available cDNA libraries, such as different cDNAs from Clontech library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of cytokine receptor 10 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the cytokine receptor 10 gene.

 A method for amplifying DNA / RNA using PCR technology (Sa ik i, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used, and the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a cytokine receptor 10 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

In the present invention, the polynucleotide sequence encoding the cytokine receptor 10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, etal. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vector (Lee) expressed in mammalian cells and Na thans, J Bi o Chem. 263: 3521, 1988) And baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding cytokine receptor 10 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, D synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu lar Cl on ing, a Labora tory Manua l, Co ld Spr ing Harbor Labora tory. New York, 1989) . The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a cytokine receptor 10 or a recombinant vector containing the polynucleotide can be transformed or transferred into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 _2, steps well known in the art with alternative is MgC l ₂ If necessary, transformation can also be electroporated Method. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant cytokine receptor 10 (Scence, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding the human cytokine receptor of the present invention or a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.

 Signaling and communication networks between cells can control cell growth, division, death, differentiation to form tissues, and various other life processes. Cellular hydrophilic chemical signal factors, such as neurotransmitters, growth factors, and cytokines, cannot pass through the double lipid layer of the target cell's plasma membrane, and can only bind to special receptors on the cell surface. Through signal transduction mechanisms, A second messenger is produced in the cell or activates protein kinase or protein phosphatase activity. The second messenger quickly changed the activity of enzymes or non-enzymatic proteins in the target cells, causing the cells to respond to external signals.

Cytokine receptors are a superfamily of transmembrane proteins that mediate many non-tyrosine protein kinase receptor signaling, including growth hormone, prolactin, many growth factors of the hematopoietic system and their interferons, and so on. Cytokine receptors play important regulatory roles in a variety of cellular physiological activities, such as regulating cell proliferation, regulating cell differentiation, immunity, and development during hematopoietic effects. Receptors for many lymphokines, angiogenesis factors and growth hormone-related molecules such as interleukin receptors, erythropoietin receptors, growth hormone receptors, Both the thrombopoietin receptor and the neurofibrillary factor receptor have the same conserved binding region, and this same conserved binding region is necessary for its active function.

 This specific conserved sequence is also required to form its active mot i f.

 The polypeptide of the invention also has this specific conserved sequence.

 It can be seen that the abnormal expression of the specific cytokine receptor mo tif will cause the function of the polypeptide containing the mo tif of the present invention to be abnormal, resulting in a variety of cell physiological activities such as cell proliferation, cell differentiation during hematopoietic action, and immunity. Regulation and neurodevelopment are abnormal, and related diseases occur.

 It can be seen that the abnormal expression of the cytokine receptor 10 of the present invention will produce various diseases, especially embryonic fetal developmental disorders, immune diseases, various tumors, developmental disorders, and inflammation. These diseases include, but are not limited to:

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Abnormal expression of the cytokine receptor 10 of the present invention may also cause certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, immune diseases, various tumors, developmental disorders, Inflammation, some hereditary, hematological diseases, etc.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) cytokine receptor 10. Agonists enhance biological functions such as cytokine receptor 10 to stimulate cell proliferation, Antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing cytokine receptor 10 can be cultured together with labeled cytokine receptor 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of cytokine receptor 10 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of cytokine receptor 10 can bind to cytokine receptor 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, cytokine receptor 10 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between cytokine receptor 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to cytokine receptor 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 10 cytokine receptor molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a cytokine receptor 10 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting cytokine receptor 10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Wait. Techniques for preparing monoclonal antibodies to cytokine receptor 10 include, but are not limited to, hybridoma technology (Kohl er and Milestein, Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against cytokine receptor 10.

 Antibodies against cytokine receptor 10 can be used in immunohistochemical techniques to detect cytokine receptor 10 in biopsy specimens.

 Monoclonal antibodies that bind to cytokine receptor 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. Cytokine receptor 10 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill cytokine receptor 10 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to cytokine receptor 10. Administration of an appropriate dose of antibody can stimulate or block the production or activity of cytokine receptor 10.

 The invention also relates to a diagnostic test method for quantitative and localized detection of cytokine receptor 10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of cytokine receptor 10 detected in the test can be used to explain the importance of cytokine receptor 10 in various diseases and to diagnose diseases in which cytokine receptor 10 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding cytokine receptor 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of cytokine receptor 10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated cytokine receptor 10 to inhibit endogenous cytokine receptor 10 activity. For example, a mutated cytokine receptor 10 may be a shortened cytokine receptor 10 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of cytokine receptor 10. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a cytokine receptor 10 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a cytokine receptor 10 can be found in the existing literature (Sambrook, et al.). In addition, the polynucleotide encoding the cytokine receptor 10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit cytokine receptor 10 mRNA are also within the scope of the invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA and DNA and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide The technology of synthesizing oligonucleotides by chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This D sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 Polynucleotides encoding cytokine receptor 10 can be used for the diagnosis of diseases related to cytokine receptor 10. The polynucleotide encoding the cytokine receptor 10 can be used to detect the expression of the cytokine receptor 10 or the abnormal expression of the cytokine receptor 10 in a disease state. For example, the DNA sequence encoding cytokine receptor 10 can be used to hybridize biopsy specimens to determine the expression of cytokine receptor 10. Hybridization techniques include Souter hern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue. Cytokine receptor 10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect cytokine receptor 10 transcription products.

 Detection of mutations in the cytokine receptor 10 gene can also be used to diagnose cytokine receptor 10-related diseases. Cytokine receptor 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type cytokine receptor 10 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, D-sequence analysis, PCR, and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian ian Inherance in Man (available online with Johns Hopkins University Welch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Cytokine receptor 10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of cytokine receptor 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these embodiments are only for illustration The invention is not intended to limit the scope of the invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.

 Example 1 Cloning of cytokine receptor 10

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was reverse transcribed to form cDNA. Using Sma r t cDM cloning kit (purchased from C1 on tech), the 00 fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech) to transform DH5 cc, and the bacteria formed a cDM library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDM sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0255d04 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0255d04 clone is 1999bp (as shown in Seq ID NO: 1), and there is a 285bp open reading frame (0RF) from 12bp to 296bp, which encodes a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0255d04 and the encoded protein was named cytokine receptor 10. Example 2 Domain analysis of cDNA clones

 The sequence of the cytokine receptor 10 of the present invention and the protein sequence encoded by the cytokine receptor 10 were profiled by the GCF prof le scan program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol 1990; 215: 403-10], domain analysis was performed in databases such as Prote. The cytokine receptor 10 of the present invention is homologous with the domain cytokine receptor family protein at 13-80, and the homology result is shown in FIG. 1 with a homology of 0.08 and a score of 4.99; the threshold is 4 . 93. Example 3 Cloning of a gene encoding cytokine receptor 10 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5-CACTGTGAGGCATGCATGAAGTGC -3 '(SEQ ID NO: 3)

 Primer2: 5-CTCTGTGCATGGTCTGTTTCTTCT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1. Amplification reaction conditions: 50 μl / LKCl, 10 mmol / L Tris-HCl pH8.5, 1.5 mmol / L MgCl ₂ , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerization in a 50 μ1 reaction volume Enzyme (Clontech). The reaction was performed on a PE9600 D thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1999bp shown in SEQ ID NO: 1. Example 4 Analysis of cytokine receptor 10 gene expression by Northern blot

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] This method includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 (Volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ RNA in 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0) ) - electrophoresed on ImM EDTA-2.2M formaldehyde-1.2% agarose gel and transferred to nitrocellulose membrane ³² P- DNA probe labeled with ct- ³² P dATP by random priming Preparation Method - 5 mM sodium acetate. The DNA probe used was the PCR amplified cytokine receptor 10 coding region sequence (12bp to 296bp) shown in Figure 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was transferred with RNA-nitrocellulose membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) -5 χ SSC-5 χ Denha rdt, s solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, it was analyzed and quantified with Phosphor Imager. Example 5 Recombinant cytokines Receptor 10 in vitro expression, isolation and purification

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Priraer3: 5'- CCCCATATGATGCATGAAGTGCTCACTAAATGT -3 '(Seq ID No: 5) Primer4: 5'- CATGGATCCTTAGTCCATGCTCCAATTCTCCCA -3' (Seq ID No: 6) These two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the target gene are followed, respectively. The Ndel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET28b (+) (Novagen, Cat. No. 69865.3). Site. The PCR reaction was performed using the pBS-0255d04 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0255d04 plasmid in a total volume of 50 μl, primers 卩 1 ^ 1116]: -3 and 1 1116]: -4 points in addition! | Is 10 11101, Advantage polymerase Mix (Clontech) 1μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed by the calcium chloride method of coliform bacteria DH50.

After the LB plates (final concentration 30 g / ml) were cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0255d04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 3 (^ g / ml)), the host bacteria BL21 (pET-0255d04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol. / L, continue to culture for 5 hours. Collect the cells by centrifugation, decompose the cells by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His s. Bind Qui ck that can bind to 6 histidines (6His-Tag). Car tr idge

(Product of Novagen) was chromatographed to obtain purified cytokine receptor 10 of the target protein. After SDS-PAGE electrophoresis, a single band was obtained at lOKDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-cytokine receptor 10 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following cytokine receptor 10-specific peptides:

NH2-Met-His-Glu-Val-Leu-Thr-Lys-Cys-Cys-Ser-Trp-Leu-Leu-Leu-Thr-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15A titer plate coated with 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to cytokine receptor 10. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this example is to select a suitable oligonucleoside from the polynucleotide SEQ ID NO: 1 of the present invention The acid fragment is used as a hybridization probe, and the membrane hybridization method is used to identify whether some tissues contain the polynucleotide sequence of the present invention or a homologous polynucleotide sequence. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: Probes of the type I are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the invention; probes of the second type are partially the same or complementary to the polynucleotide SEQ ID NO: 1 of the invention Oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (411U):

 5'- TGCATGAAGTGCTCACTAAATGTTGCTCTTGGCTGTTACTA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

5 '-TGCATGAAGTGCTCACTAAACGTTGCTCTTGGCTGTTACTA -3' (SEQ ID NO: 9) Please refer to the literature for other commonly listed reagents and their preparation methods related to the following specific experimental procedures: DNA PROBES GH Kel ler; M. Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning experiment manual books Such as the "Molecular Cloning Experiment Guide" (1998 Second Edition) [US] Sambrook and others, Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mraol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 ranol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5ml per 0.1 g of the original tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), then connect the following

2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.

6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, every 1-5 x 10 ^δ cells Approximately added luL

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ral respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A ₂₆ . And A _2sfl to check the purity and yield of D. 15) Store at -20 ° (:) after packing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P- (1ATP + 2U Kinase, to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The combined solution after the first peak was collected as ³² P-Probe (second peak to prepare the desired free γ- ³² Ρ- dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

Cross Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 0 ° C for 15 minutes (twice).

 4) 0.1 x SSC, 0.1 medium, wash at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 at 1, 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 8 DNA Microarray

 Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially diseases-related new genes such as tumors; diagnosis of diseases, such as heredity disease. The specific method steps have been reported in the literature. For example, see the references DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DM, including the present invention Polynucleotide. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and a Cartesian 7500 spotter (purchased from Cartesian, USA) was used to spot the glass medium. The distance is 280 μηι. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95. C water for 2 minutes;

 6. 0.2 ° /. Wash with SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino- propargyl-2--deoxyuridine 5 '-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech company) labeled mRNA of normal liver tissue, using the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2' -deoxyuri dine 5--triphate coupled to Cy5 fluorescent dye, (Purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science.270 (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered as Differentially expressed genes.

 Experimental results show that Cy3 signal = 9642.88 (take the average of four experiments), Cy5 signal = 6998.71 (take the average of four experiments), Cy3 / Cy5 = 1.3778, the polynucleotide of the present invention is in the above two There were no significant differences in expression in the tissues.

Claims

Rights request

1. An isolated polypeptide-cytokine receptor 10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) a polynucleotide that is at least 70% identical to) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 12 to 296 in SEQ ID NO: 1 or the sequence of positions 1 to 1999 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6, and a plasmid, virus or carrier expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having cytokine receptor 10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing cytokine receptor 10;

(b) Isolating a polypeptide having cytokine receptor 10 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to a cytokine receptor 10.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of cytokine receptor 10.

12. The compound according to claim 11, characterized in that it is a multi-core as shown in SEQ ID NO: 1. Antisense sequence of a nucleotide sequence or a fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of cytokine receptor 10 in vivo and in vitro.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Polypeptide activity, or a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of cytokine receptor 10; or for peptide fingerprinting Atlas identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with a cytokine receptor 10 abnormality.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.