Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
  • C12N5/0682—Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2500/00—Specific components of cell culture medium
  • C12N2500/05—Inorganic components
  • C12N2500/10—Metals; Metal chelators
  • C12N2500/20—Transition metals
  • C12N2500/24—Iron; Fe chelators; Transferrin
  • C12N2500/25—Insulin-transferrin; Insulin-transferrin-selenium
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2500/00—Specific components of cell culture medium
  • C12N2500/30—Organic components
  • C12N2500/38—Vitamins
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2500/00—Specific components of cell culture medium
  • C12N2500/90—Serum-free medium, which may still contain naturally-sourced components
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
  • C12N2501/70—Enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2503/00—Use of cells in diagnostics

Definitions

• This invention is in the field of developmental biology and cell biology. Specifically, this invention relates to a population of Mullerian duct-derived epithelial cells that are capable of differentiating into uterine, oviductal, vaginal, and cervical cells, methods of isolating the Mullerian duct-derived epithelial cells, characterization of Mullerian duct-derived epithelial cells, and uses of the Mullerian duct-derived epithelial cells.
• Cervical cancer for example, is a particularly important topic for women's health considering that cervical cancer is the second most common cancer among women worldwide with approximately 450,000 new cases being diagnosed annually and that almost 200,000 deaths are due to cervical cancer. Pisani et al. Int. J.
• the cervix, uterus, oviduct, and part of the vagina of the female reproductive system are formed early in embryogenesis from Mullerian ducts, also known as paramesonephric ducts.
• Mullerian ducts also known as paramesonephric ducts.
• a primordial gonadal ridge develops into a primitive gonad.
• both sexes have primordial genital ducts and a primitive gonad which develops into a cortex and a medulla.
• the cortex develops into ovaries and the medulla regresses.
• the medulla develops into testes and the cortex regresses in genetic males.
• Mullerian ducts in males begin to regress with the secretion of
• Mullerian inhibiting substance or MIS. Ganong, William F. Review of Medical Physiology, Chapter 23 "The Gonads: Development and Function of the Reproductive System", Fifteenth Edition, Appleton and Lange (1991).
• the Mullerian duct is either of the two paired embryonic tubes extending along the mesonephros roughly parallel to the mesonephric duct and emptying into the cloaca. In females, the upper parts of the
• Mullerian duct form the oviducts, while the lower parts fuse to form the uterus, cervix, and part of the vagina.
• Mullerian ducts Previous work on Mullerian ducts have focused on anatomical and structural characteristics of Mullerian ducts. For example, one study revealed that the movements of Mullerian ridges and the immunohistochemical staining of Mullerian ducts in avians closely resemble that seen in human. Jacob M, et. al. Cells Tissues Organs 164(2), 63-81, (1999). In another study, human fetuses were examined by ultrasound to study the developing urogenital tracts. Lawrence W.D., et. al. American Journal of Obstetrics and Gynecology 167(1), 185-193, (1992). Other studies have focused on gene expression patterns in the developing fetus. Pellegrini M. et. al. Anat. Embryol. 196(6). 427-433,
• the invention relates to a population of substantially pure human Mullerian duct-derived epithelial cells that have a pluripotent capability to differentiate into oviductal, uterine, vaginal, or cervical cells.
• the invention relates to methods of isolating a population of substantially pure human Mullerian duct-derived epithelial cells that have the pluripotent capability to differentiate into oviductal, uterine, vaginal, and cervical cells.
• the invention relates to methods of maintaining a population of substantially pure human Mullerian duct-derived epithelial cells that have the pluripotent capability to differentiate into oviductal, uterine, vaginal, and cervical cells and maintaining or culturing these Mullerian duct-derived epithelial cells under culture conditions sufficient to allow the Mullerian duct-derived epithelial cells to retain their pluripotent capacity.
• the invention relates to methods of providing a source of immunogen to a heterologous recipient and the uses of a substantially pure population of Mullerian duct-derived epithelial cells as an immunogen.
• the invention relates to methods of generating a human tissue model of Mullerian duct-derived cells or cells differentiated from Mullerian duct-derived cells (i.e. oviductal, uterine, vaginal, and cervical cells) using a substantially pure population of Mullerian duct-derived epithelial cells or cell differentiated therefrom as a source of Mullerian duct-derived cells and administering the
• Mullerian duct-derived epithelial cells into a non-human, mammalian recipient.
• the invention relates to methods of providing cell therapy whereby a substantially pure population of human Mullerian duct-derived epithelial cells or cell differentiated therefrom are introduced into a recipient.
• the invention relates to methods of providing a means for developing pharmaceutical drugs wherein a substantially pure population of human Mullerian duct-derived epithelial cells is used as a source of Mullerian duct-derived biological components in which one or more of these Mullerian duct-derived biological components are the targets of the drugs that are being developed.
• the invention in another aspect of this invention, relates to methods of providing bioassay development wherein a substantially pure population of human Mullerian duct- derived epithelial cells are used as a source of nucleic acids or proteins and wherein these nucleic acids or proteins are used as one or more principal components in a bioassay or the development of a bioassay.
• FIG 1 A shows Mullerian Tract Epithelial (MTE) cells, as seen under phase contrast microscope, as a tight epithelial cell colony.
• Figure IB shows MTE cells, as seen under phase contrast microscope, at high density in culture when MTE cells form dome-like structures (indicated by arrows).
• Figure IC shows MTE cells, as seen under phase contrast microscope, with smooth cell outlines and slender processes. This cell morphology resembles that seen with endometrial epithelial cell cultures.
• Figure 2 shows microphotographs of immunoperoxidase staining for several markers on MTE cells.
• Figure 2 A shows staining of MTE cells for cytokeratin 19.
• FIG. 2B shows staining of MTE cells for cytokeratins 10, 11, and 18.
• Figure 2C shows cytokeratin staining of MTE cells for cytokeratins 13 and 16.
• Figure 2D shows staining of
• Figure 3 shows the results of RT-PCR assay wherein PCR primers specific for
• Hoxa9, HoxalO, and Hoxal 1 genes were used to detect HOX gene transcripts in total RNA extracted from MTE cells.
• the arrows indicate expected sizes of HOX gene transcript bands.
• FIG. 4 show the results of a histological analysis of a Mullerian tract epithelial cell graft recombinant that was transplanted in nude mice.
• MTE cells formed structures that resembled the endometrium and oviduct.
• M refers to a portion of the mesenchyme
• L indicates the lumen
• the long arrow indicates the location of an apical epithelium
• the short arrow indicates the location of glandular epithelium.
• PROTOCOLS IN MOLECULAR BIOLOGY F. M. Ausubel, et al. eds., (1987); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R.I. Freshney, ed. (1987).
• a cell includes a plurality of cells, including mixtures thereof.
• Mullerian duct-derived epithelial cells As used in the specification and claims, the terms “Mullerian duct-derived epithelial cells”, “Mullerian duct-derived cells”, “Mullerian ductal cells”, and “Mullerian duct cells” are used interchangeably and refer to cells derived from human Mullerian ducts. These cells are capable of dividing and have not yet committed to an essentially non-dividing stage of end differentiation. "Mullerian duct-derived epithelial cells”, “Mullerian ductal cells”, and “Mullerian duct cells” are derived ultimately from a paramesonephric ridge in human embryos.
• Mullerian tract epithelial cells and “MTE cells” are used interchangeably herein and refer to Mullerian duct-derived epithelial cells that are in culture under standard in vitro cell conditions.
• paramesonephric duct and “Mullerian duct” are used interchangeably.
• Paramesonephric duct and “Mullerian duct” are derived from a primordial genital duct in the early stages of embryonic development.
• Mullerian duct-derived refers to a stage of development of a multipotent cell that is beyond the stage of being part of the primordial gonadal ridge and before the stage of terminally differentiated Mullerian duct-derived cells (such as mature oviductal, uterine, cervical, and vaginal cells).
• Mullerian duct-derived cells which are "predetermined Mullerian duct-derived” are committed to becoming Mullerian duct-derived cells but have not begun to develop into terminally differentiated Mullerian duct-derived cells yet. Different factors cause pre-determined Mullerian duct-derived cells to begin differentiating. Non-limiting examples include exposure to hormones (i.e. estrogen, progesterone, leutinizing hormone, etc.), cell-to-cell contact with surrounding tissue (i.e. mesenchymal tissue), and microenvironment of the cells.
• hormones i.e. estrogen, progesterone, leutinizing hormone, etc.
• cell-to-cell contact with surrounding tissue i.e. mesenchymal tissue
• microenvironment of the cells i.e. mesenchymal tissue
• An “antibody” is an immunoglobulin molecule capable of binding an antigen.
• the term encompasses not only intact immunoglobulin molecules, but also anti-idiotypic antibodies, mutants, fragments, fusion proteins, humanized proteins and modifications of the immunoglobulin molecule that comprise an antigen recognition site of the required specificity.
• the term "antigen” is a molecule which can include one or a plurality of epitopes to which an antibody can bind.
• An antigen is a substance which can have immunogenic properties, i.e., induce an immune response.
• Antigens are considered to be a type of immunogen.
• the term "antigen" is intended to mean full length proteins as well as peptide fragments thereof containing or comprising one or a plurality of epitopes.
• surface antigens and “cell surface antigen” are used interchangeably herein and refer to the plasma membrane components of a cell. These component include, but are not limited to, integral and peripheral membrane proteins, glycoproteins, polysaccharides, lipids, and glycosylphosphatidylinositol (GPI)-linked proteins.
• An "integral membrane protein” is a transmembrane protein that extends across the lipid bilayer of the plasma membrane of a cell.
• a typical integral membrane protein consists of at least one membrane spanning segment that generally comprises hydrophobic amino acid residues.
• Peripheral membrane proteins do not extend into the hydrophobic interior of the lipid bilayer and they are bound to the membrane surface by noncovalent interaction with other membrane proteins.
• GPI-linked proteins are proteins which are held on the cell surface by a lipid tail which is inserted into the lipid bilayer.
• monoclonal antibody refers to an antibody composition having a substantially homogeneous antibody population. It is not intended to be limited as regards to the source of the antibody or the manner in which it is made (e.g. by hybridoma or recombinant synthesis). Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
• a population of monoclonal antibodies refers to a plurality of heterogeneous monoclonal antibodies, i.e., individual monoclonal antibodies comprising the population may recognize antigenic determinants distinct from each other.
• Immunogen refers to any substance that induces an immune response. A substance that is an immunogen is described as being “immunogenic”. Induction of immune response includes but is not limited to activation of humoral responses (e.g. producing antibodies) or cellular responses (e.g. priming cytotoxic T cells), inflammatory responses (e.g. recruitment of leukocytes), and secretion of cytokines and lymphokines.
• heterologous as applied to a cell used for immunization or transplantation means that the cell is derived from a genotypically distinct entity from the recipient.
• a heterologous cell may be derived from a different species or a different individual from the same species as the recipient.
• An embryonic cell derived from an individual of one species is heterologous to an adult of the same species.
• Heterologous as applied to a recipient means that the recipient is a genotypically distinct entity from the source of the cells that are being introduced into the recipient.
• Explant refers to Mullerian duct tissues taken out of a human fetus. Generally, explants are used as a source of Mullerian duct-derived cells.
• Isolating the cells from the explant can be accomplished by several methods.
• One method is to place the Mullerian duct tissue explant, either whole tissue or cut in smaller pieces, in a basal defining media and allow the cells of the Mullerian duct to naturally migrate out of the solid tissue mass into the media.
• Another method is to subject the Mullerian duct tissue to enzymatic digestion or to mechanical forces that forces cells away from the solid tissue.
• a cell is of "ectodermal", “endodermal” or “mesodermal” origin, if the cell is derived, respectively, from one of the three germ layers - ectoderm, the endoderm, or the mesoderm of an embryo.
• the ectoderm is the outer layer that produces the cells of the epidermis, and the nervous system.
• the endoderm is the inner layer that produces the lining of the digestive tube and its associated organs.
• the middle layer, mesoderm gives rise to several organs, including but not limited to heart, kidney, mesothelium, and gonads), connective tissues (e.g., bone, muscles, tendons), and the blood cells.
• medium refers to the aqueous microenvironment in which the mammalian cells are grown in culture.
• the medium comprises the physicochemical, nutritional, and hormonal microenvironment.
• a cell culture medium is "essentially serum-free” when the percentage by volume of serum in the medium does not mask antigenic sites or antibody binding sites on cell surfaces.
• the term “essentially serum-free” generally applies when the cell culture medium comprises less than about 50% serum (by volume), preferably less than about 25% serum, even more preferably less than about 5% serum, and most preferably less than about 0.1% serum.
• a cell surface is "substantially free of serum biomolecules" when at least about
• the Mullerian tract epithelial cell surfaces 50% of the Mullerian tract epithelial cell surfaces, more preferably at least about 75% of the Mullerian tract epithelial cell surfaces, even more preferably at least about 90% of the Mullerian tract epithelial cell surfaces, and most preferably at least about 95% of the Mullerian tract epithelial cell surfaces do not have serum biomolecules derived from serum binding to the cell surface such that antigenic sites or antibody binding sites are bound or are unavailable for antigenic recognition by an antibody or a portion of an antibody.
• Cell surface can determined by measuring the cell size, either by microscopy or flow cytometry. For example, synthetic beads of various known sizes are commonly used for calibration in flow cytometry.
• a small quantity of calibrated bead may be mixed with MTE cells and the resultant population is analyzed by flow cytometry. MTE cells can then be compared with the size of the calibrated beads. Calculations of cell surface amount can be accomplished since the sizes of the beads are known.
• a "substantially pure" population of Mullerian tract epithelial cells is a population of cells that is comprised at least about 85% Mullerian tract epithelial cells, preferably at least about 90%, and even more preferably about 95% or more.
• a “defined medium,” “basal cell-sustaining medium,” “nutrient medium”, and “basal nutrient medium” are used interchangeably herein and refer to a medium comprising nutritional and hormonal requirements necessary for the survival and/or growth of the cells in culture such that the components of the medium are known.
• the defined medium has been formulated by the addition of nutritional and growth factors necessary for growth and/or survival.
• the defined medium provides at least one component from one or more of the following categories: a) all essential amino acids, and usually the basic set of twenty amino acids plus cystine; b) an energy source, usually in the form of a carbohydrate such as glucose; c) vitamins and/or other organic compounds required at low concentrations; d) free fatty acids; and e) trace elements, where trace elements are defined as inorganic compounds or naturally occurring elements that are typically required at very low concentrations, usually in the micromolar range.
• the defined medium may also optionally be supplemented with one or more components from any of the following categories: a) one or more mitogenic agents; b) salts and buffers as, for example, calcium, magnesium, and phosphate; c) nucleosides and bases such as, for example, adenosine and thymidine, hypoxanthine; and d) protein and tissue hydrolysates.
• conditioned media refers to culture media, free of intact cells, in which MTE cells have been grown. Mullerian duct-derived cells grown in nutrient media may release factors which promote the continued survival, growth, and maintenance of preexisting state of pre-differentiation of the Mullerian tract epithelial cells.
• Conditioned media may be used to reconstitute a cell pellet or added to cells already existing in culture plates. Conditioned media may also be used alone or to supplement nutrient media being used to feed Mullerian duct-derived cells. Since conditioned media is derived from nutrient media and nutrient media, as disclosed herein, is essential serum-free, conditioned media is also essentially serum-free.
• Standard incubation conditions refers to the physicochemical conditions in an incubator designed for tissue culture in which cells are placed. Generally, the standard incubation conditions are about 37 degrees Celsius and about 5% CO 2 content with humidification. All tissue culture techniques and equipment should be performed under sterile conditions.
• MTE aggregates MTE aggregates
• MTE cell spheres are used interchangeably throughout and refer to a monolayer mass of Mullerian tract epithelial cells that are patches of cells in close physical proximity and have cell-to- cell contact.
• a "grafting recombinant”, as used herein, refers to the combined unit of Mullerian tract epithelial cell aggregates placed with mesenchymal tissue.
• Mesenchymal tissue can be of Mullerian duct-derived or non-M ⁇ llerian duct-derived origin.
• Mesenchymal tissue can be from a species heterologous to the graft recipient.
• Mesenchymal tissue can also be from a species heterologous to the source of Mullerian tract epithelial cells.
• Grafting recombinants can be incubated on substrate, preferably a soft, biological substrate (e.g. agar) for a period ranging from 1 hour to 96 hours, more preferably between about 6 hours to 48 hours, and even more preferably, overnight with an incubation period of about 24 hours.
• “Serum”, as used herein, refers to the fluid phase of mammalian blood that remains after blood is allowed to clot.
• Serum biomolecules refers to biological compositions found in serum. Examples include, but are not limited to, albumin, ⁇ l-globulin, ⁇ 2-globulin, ⁇ - globulin, and ⁇ -globulin. Serum biomolecules can include biological compositions, whole or partial, that are either naturally found in serum or derived from processing and handling of serum.
• mammals or “mammalian” refer to warm blooded vertebrates which include but are not limited to humans, mice, rats, rabbits, simians, sport animals, and pets. Isolation and maintenance of Mullerian tract epithelial cells
• Mullerian tract epithelial cells of this invention are isolated from human fetal Mullerian duct-derived tissue.
• the age of the fetus is between about week 1 and about week 40, preferably between about week 8 and about week 30, and even more preferably between about week 17 and about week 25.
• the Mullerian duct-derived tissue can be identified by gross anatomy, outward appearance, and location within the fetus. The appearance distinguishing a Mullerian duct is either of two paired embryonic tubes extending along the mesonephros roughly parallel to the mesonephric duct and emptying into the cloaca in the female, the upper parts of the ducts form the uterine tubes while the lower fuse to from the uterus and part of the vagina.
• microdissection is to divide the solid tissue mass into smaller parts of the whole tissue mass so that the basal nutrient media has greater access to Mullerian duct-derived cells within the tissue pieces and/or to separate Mullerian duct- derived cells from Mullerian duct tissue mass.
• microdissection include devices that render mechanical shearing forces (i.e. homogenizer, mortar and pestle, blender, etc.), devices that render cuts or tears (i.e. scalpel, syringes, forceps, etc.), or ultrasonic devices.
• microdissecting fetal Mullerian duct-derived tissue is the use of enzyme treatment.
• enzyme treatment Various enzyme treatments used to microdissect tissue are well known in the art.
• One method includes the use of collagenase- dispase to digest partially sheared Mullerian duct-derived tissue in a buffered medium that will sustain viability of cells isolated from the Mullerian duct-derived tissue.
• the amount of enzyme will depend on the age of the fetus and the mass of the Mullerian duct tissue.
• enzyme treatment with collagenase-dispase may lower the overall cell yield. Accordingly, the amount of enzyme used would be reduced or not used at all. In other embodiments, enzyme treatment may increase overall cell yield.
• enzyme treatment may be used alone or in combination with microdissection methods.
• basal cell-sustaining media that can be used to keep the pH of the liquid in a range that promotes survival of Mullerian tract epithelial cells and to provide additional volume of liquid within which the enzymatic digestion can occur.
• Non-limiting examples include F12/DMEM, Ham's F10 (Sigma), CMRL-1066, Minimal essential medium (MEM, Sigma), RPMI-1640 (Sigma), Dulbecco's Modified Eagle's Medium (DMEM, Sigma), and Iscove's Modified Eagle's Medium (IMEM).
• F12/DMEM Ham's F10
• CMRL-1066 Minimal essential medium
• MEM RPMI-1640
• DMEM Dulbecco's Modified Eagle's Medium
• IMEM Iscove's Modified Eagle's Medium
• Examples include, but are not limited to, insulin, transferrin, ⁇ -tocopheral, and aprotinin.
• the following amounts of nutrients are used to promote Mullerian duct epithelial cell survival and growth: at least about 10 ng/ml insulin and not more than about 1 mg/ml insulin, more preferably about 10 ⁇ g/ml insulin; at least about 1 ⁇ g/ml transferrin and not more than about 100 ⁇ g/ml transferrin, more preferably about 10 ⁇ g/ml transferrin; at least about 0.1 ⁇ g/ml ⁇ -tocopherol and not more than about 1 mg/ml ⁇ -tocopherol, more preferably about
• Mullerian duct epithelial cells migrate out the Mullerian duct tissue into the media in which the Mullerian duct tissue is placed. In one embodiment, the Mullerian duct epithelial cells migrate out of the Mullerian duct tissue into the media in aggregate form.
• the Mullerian duct epithelial cells migrate out of the Mullerian duct tissue into the media in the form of single cells.
• the Mullerian duct epithelial cells that migrate out of the Mullerian duct tissue are no longer imbedded in the Mullerian duct tissue but are loosely associated with the tissue. Mullerian duct-derived cells are then resuspended in a basal cell-sustaining media.
• the Mullerian duct epithelial cells can be grown in tissue culture containers (i.e. flasks, plates, etc.) that are either uncoated or coated with different substrates.
• Non-limiting examples of substrates that may be used include fibronectin, laminin, collagen, polylysine, nitrocellulose, nylon, and polytetrafluoroethylene.
• Mullerian duct epithelial cells are grown on laminin-coated tissue culture containers in the preferred nutrient media described above.
• Mullerian duct epithelial cells are grown in uncoated tissue culture containers in the preferred nutrient media described above.
• the size of the tissue culture containers is proportional to the amount of Mullerian duct tissue being placed within the containers. A skilled artisan may determine the correct size of the tissue culture containers by a stepwise increment of Mullerian duct tissue placed within the tissue culture containers.
• the media When the Mullerian duct tissue is first placed within the tissue culture containers, the media is generally clear in overall turbidity. As Mullerian duct-derived cells migrate out and away from the Mullerian duct tissue pieces, the media will become more opaque and more turbid. At the point where the media is highly turbid because of the increasing amount of Mullerian duct-derived cells migrating from the Mullerian duct tissue or because of Mullerian duct-derived cell growth, more nutrient media is placed in the tissue culture containers to replenish the nutrients consumed by the Mullerian duct cells.
• the media becomes turbid with increasing amounts of Mullerian duct epithelial cells
• a small amount of cells may be removed from the tissue culture containers and checked for cell viability, for example, with trypan blue staining. Tissue culture containers that have been overrun with too many cells will begin to show decreased cell viability.
• the skilled artisan may then transfer the contents of the tissue culture containers to other containers of a larger size (e.g. greater cubic volume) to accommodate the increasing amount of cells.
• the entire content of the tissue culture container is transferred to another container of a larger cubic volume.
• the Mullerian duct cell suspension is split into several separate tissue culture containers with fresh nutrient media (also known as "subculturing"). In this manner, a substantially pure population of Mullerian duct cells can be obtained.
• the Mullerian duct cells in culture or Mullerian tract epithelial (MTE) cells may be grown in tissue culture containers (e.g. flasks, plates, etc.) that are either uncoated or coated with different substrates.
• tissue culture containers e.g. flasks, plates, etc.
• substrates include fibronectin, laminin, collagen, polylysine, nitrocellulose, nylon, and polytetrafluoroethylene.
• MTE cells form monolayers when grown with or without substrate in the preferred nutrient media.
• MTE cells grown in uncoated tissue culture flasks form a monolayer.
• MTE cells at high density in the preferred nutrient media form enclosed dilated cysts which float freely in the preferred nutrient medium.
• MTE cells form monolayer patches or monolayer aggregates in the tissue culture container.
• MTE aggregates adhere to the surface of tissue culture containers and proliferate as a colony of monolayer cells. These colonies may be subcultured to propagate MTE cells.
• Various methods can be used to subculture MTE cell colonies. One method is enzymatic treatment to detach the colonies from the sides of the plastic tissue culture flasks.
• an enzyme such as collagenase-dispase is used in an effective amount to dissociate MTE aggregates from the sides of the tissue culture flask while leaving the cells in aggregate formation.
• An effective amount is at least about 10%, more preferably at least about 1%, and most preferably at least about 0.1% collagenase- dispase by volume.
• a confluent cell culture may be obtained in at least about two months, more preferably at least about one month, and most preferably at least about two to three weeks.
• growth factors such as basic fibroblast growth factor (FGF) and forskolin may be added in stepwise increments to stimulate proliferation.
• FGF basic fibroblast growth factor
• the addition of FGF and/or forskolin promotes a greater rate of proliferation and does not decrease the life span of the MTE cells. Accordingly, the addition of FGF and/or forskolin may be used when a greater proliferation rate is desired by a skilled artisan. In other embodiments, the addition of FGF and/or forskolin promotes a greater rate of proliferation and decreases the life span of the MTE cells.
• Mullerian tract epithelial cells The frequency of feeding Mullerian tract epithelial cells is dependent on the rate of nutrient metabolism of MTE cells. The higher rate of nutrient metabolism, the more frequent MTE cells need to be fed. Generally, media acidity will increase as cells metabolize nutrients in the media. Some nutrient media (e.g. RPMI-1640, DMEM, EMEM, etc.) have media colors that indicate the acidity such that media that is highly acidic will turn bright shades of pink. Nutrient media can then be added to bring acidity of the existing media to an acidity that will sustain life and promote growth of the MTE cells.
• RPMI-1640, DMEM, EMEM, etc. have media colors that indicate the acidity such that media that is highly acidic will turn bright shades of pink. Nutrient media can then be added to bring acidity of the existing media to an acidity that will sustain life and promote growth of the MTE cells.
• Mullerian tract epithelial cells may be fed by replacing the entirety of the old nutrient media with new nutrient media.
• Mullerian tract epithelial cells may be fed with conditioned media in which these cells were grown. Because the claimed Mullerian tract epithelial cells are unique to this invention and will secrete factors specific to these cells, the conditioned media derived from the Mullerian tract epithelial cells are also unique.
• a frequency of feeding that is preferable for promoting the survival and growth of Mullerian tract epithelial cells is about once a week.
• the Mullerian tract epithelial cells of this invention can be passaged multiple (about 4-5) times without senescence and without inducing differentiation of these Mullerian tract epithelial cells into terminally differentiated uterine, cervical, vaginal, or oviductal cells.
• the population of Mullerian tract epithelial cells of this invention isolated in the manner disclosed herein have several defining characteristics.
• the Mullerian tract epithelial cells are at a stage that can be described as "pre-determined Mullerian duct- derived".
• the Mullerian tract epithelial cells of this invention have the capacity to become either uterine, cervical, vaginal, or oviductal cells.
• Identification of Mullerian tract epithelial cells may be accomplished by morphology or specific markers or a combination of both techniques. Morphology of MTE cells is characterized by monolayer formation of polygonal or ovoid shaped cells in close proximity to each other, with cell-to-cell contact, and growth in tight colonies.
• dome-like structures When MTE cells are at high density in tissue culture containers, they can form dome-like structures.
• the formation of dome-like structures is an unique property for glandular epithelial cells.
• the formation of dome-like structures indicate that MTE cells form occlusive junctions or tight junctions between the adjacent cells. Occlusive junctions can be visualized by conventional or freeze fracture electron microscopy or alternatively, by staining by markers to occlusive junctions (i.e. zona occludens proteins ZO1, ZO2, etc.).
• markers to occlusive junctions i.e. zona occludens proteins ZO1, ZO2, etc.
• MTE cells can also secrete protein into the lumen of the domes.
• the protein may be visualized by staining with dyes (i.e. hematoxylin, eosin, etc.)
• dyes i.e. hematoxylin, eosin, etc.
• Other morphology that MTE cells can present is an epithelial cell type with smooth outline and slender processes, similar to that seen with endometrial epithelial cell cultures from human adult endometrium.
• Markers that can be used to detect MTE cells include but are not limited to cytokeratins (CK) 1, 5, 6, 7, 8, 10, 11, 13, 15, 16, 18, and 19 and vimentin on MTE cell surfaces. These cell surface markers are assessed by employing antibodies specific for CK and vimentin. Examples of antibodies that may be used include but are not limited to: anti- cytokeratin (CK) antibodies clone 4.62, clone 8.12, clone 8.13 from Sigma Chemical Co. and anti-vimentin antibodies clone 13.2 from Sigma Chemical Co. Anti-CK antibodies and anti-vimentin antibodies can be used in either direct or indirect staining of MTE cells in immunohistochemistry or by flow cytometry.
• CK cytokeratins
• Anti-CK antibodies and anti-vimentin antibodies can be used in either direct or indirect staining of MTE cells in immunohistochemistry or by flow cytometry.
• MTE cells of this invention is also characterized by expression of HOX genes.
• HOX genes are vertebrate homologues of homeotic selector genes that define positional values along the anterior-posterior axis in Drosophila.
• Hoxa9 gene expression is restricted to fallopian tube (oviduct)
• Hoxal 0 gene expression is restricted to endometrial expression
• Hoxal 1 gene expression is restricted to endocervical epithelial cells.
• MTE cells are isolated and cultured using the methods disclosed herein and total RNA is extracted from MTE cells and subjected to reverse transcriptase polymerase chain reaction (RT-PCR) using primers specific to Hoxa9, HoxalO, Hoxal 1 gene sequences.
• RT-PCR reverse transcriptase polymerase chain reaction
• MTE cells of this invention may also be characterized by their sensitivity to different hormones or compounds.
• Mullerian Inhibition Substance MIS is known to cause regression of Mullerian ducts in male embryos.
• Application of MIS to MTE cells can cause several cellular morphological effects that may be observed by phase contract microscopy.
• expression of MIS receptors may be modulated by exposure to
• MIS Receptor expression may be assessed by flow cytometry with MIS receptor-specific antibodies.
• Hormones such as progesterone, estrogen, or luteinizing hormone (LH) can affect MTE cells.
• LH luteinizing hormone
• MTE cells may be monitored for cell morphological effects by phase contract microscopy.
• proliferation assay may be used to monitor cell growth in response to LH.
• MTE cells can be stained for markers specific for uterine, cervical, oviductal, or vaginal tissues and analyzed by immunohistochemistry or flow cytometry.
• Mullerian tract epithelial cells of this invention are maintained in serum-free media at a stage that can be described as pre-determined Mullerian duct-derived state.
• Basal cell- sustaining media or the preferred nutrient media disclosed herein or conditioned media may be used to culture the Mullerian tract epithelial cells in vitro.
• Mullerian tract epithelial cells of this invention have the capacity to be passaged multiple times in the preferred serum- free nutrient media disclosed herein. Multipotency is retained during each passage and at any point after each passage, Mullerian tract epithelial cells of this invention can differentiate into functional Mullerian duct-derived cells.
• Mullerian tract epithelial cells may be used as an immunogen, for cell therapy, for bioassays, to establish a human Mullerian duct-derived model, or for drug discovery and/or development as disclosed herein.
• Mullerian tract epithelial cells of this invention Another characteristic of the Mullerian tract epithelial cells of this invention is the capacity to differentiate into uterine, cervical, oviductal, or vaginal cells upon transplantation under kidney capsule of a recipient mammal.
• Mullerian tract epithelial cells are grown in monolayers and then combined with mesenchymal tissue and placed under a kidney capsule of a recipient mammal.
• human Mullerian tract epithelial cell aggregates are combined with rat urogenital mesenchymal tissue and placed under the kidney capsule of a recipient mammal.
• a portion of the transplant may be removed for analysis using the markers, morphology, or a combination thereof to identify the Mullerian duct-derived cells and cell differentiated therefrom.
• Mullerian tract epithelial cells A use for Mullerian tract epithelial cells is as an immunogen.
• the unique serum-free culturing conditions allow the cell surfaces of the Mullerian tract epithelial cells to remain free of serum proteins or serum biomolecules that may bind to the surface.
• a potential problem of antigenic sites that may be "masked” with binding by serum biomolecules is avoided by using the disclosed serum-free isolation and culturing techniques. Accordingly, a panel of antibodies may be generated to newly available antigens that were "masked" when using culture conditions containing serum.
• Mullerian tract epithelial cells isolated and cultured with the methods disclosed herein can be used as an immunogen that is administered to a heterologous recipient. Administration of MTE cells as an immunogen can be accomplished by several methods.
• Methods of administrating MTE cells as immunogens to a heterologous recipient include but are not limited to: immunization, administration to a membrane by direct contact such as swabbing or scratch apparatus, administration to mucous membrane by aerosol, and oral administration.
• immunization can be either passive or active immunization.
• Methods of immunization can occur via different routes which include but are not limited to intraperitoneal injection, intradermal injection, local injection.
• the subjects of immunization may include mammals such as mice.
• the route and schedule of immunization are generally in keeping with established and conventional techniques for antibody stimulation and production.
• mice are employed in this embodiment, any mammalian subject including humans or antibody producing cells therefrom can be manipulated according to the processes of this invention to serve as the basis for production of mammalian hybridoma cell lines.
• mice are inoculated intraperitoneally with an immunogenic amount of the MTE cells and then boosted with similar amounts of the immunogen.
• cells grown on non-biological membrane matrix are surgically implanted intraperitoneally into the host mammal. Lymphoid cells, preferably spleen lymphoid cells from the mice, are collected a few days after the final boost and a cell suspension is prepared therefrom for use in the fusion.
• Hybridomas are prepared from the lymphocytes and immortalized myeloma cells using the general somatic cell hybridization technique of Kohler, B. and Milstein, C. (1975) N ⁇ twre 256:495-497 as modified by Buck, D. W., et al., (1982) In Vitro, 18:377-381.
• Available myeloma lines including but not limited to X63-Ag8.653 and those from the Salk Institute, Cell Distribution Center, San Diego, Calif, USA, may be used in the hybridization.
• the technique involves fusing the myeloma cells and lymphoid cells using a fusogen such as polyethylene glycol, or by electrical means well known to those skilled in the art.
• the cells are separated from the fusion medium and grown in a selective growth medium, such as HAT medium, to eliminate unhybridized parent cells.
• a selective growth medium such as HAT medium
• Any of the media described herein can be used for culturing hybridomas that secrete monoclonal antibodies.
• EBV immortalized B cells are used to produce the monoclonal antibodies of the subject invention.
• the hybridomas are expanded and subcloned, if desired, and supernatants are assayed for anti-immunogen activity by conventional immunoassay procedures (e.g., radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay).
• Hybridomas that produce such antibodies may be grown in vitro or in vivo using known procedures.
• the monoclonal antibodies may be isolated from the culture media or body fluids, by conventional immunoglobulin purification procedures such as ammonium sulfate precipitation, gel electrophoresis, dialysis, chromatography, and ultrafiltration, if desired.
• Undesired activity if present, can be removed, for example, by running the preparation over adsorbents made of the immunogen attached to a solid phase and eluting or releasing the desired antibodies off the immunogen.
• a panel of novel antibodies to cell surface antigen specific to Mullerian tract epithelial cells can be generated using the Mullerian tract epithelial cells of this invention.
• monoclonal antibodies to cell surface antigens on Mullerian tract epithelial cells are made by the method disclosed herein, the antibodies have several uses.
• the antibodies may be sequenced and cloned for purposes of generating recombinant antibodies or humanized antibodies.
• Other uses of Mullerian tract epithelial cell-specific antibodies include, but are not limited to, biological testing and purification (i.e. isolating Mullerian duct-derived epithelial cells, for example by flow cytometry or panning), therapeutic uses (i.e.
• Another use as an immunogen is to modulate overall immune response in a heterologous recipient.
• foreign substances such as cells or organs introduced into a heterologous recipient may induce a variety of immune responses.
• the immune responses can be in the form of rejection (e.g. in organ transplantation), T cell activation (e.g. cross-priming), anergy, or tolerance.
• the overall immune response can be systemic or localized. In the case where a localized immune response is desired, for example in the gonadal region, an immunogen such as Mullerian tract epithelial cells is introduced into the gonadal region in an effective amount.
• Effective amount can be determined in a stepwise fashion in which increasing amounts of Mullerian tract epithelial cells are introduced into a heterologous recipient and the subsequent immune response is monitored.
• Overall immune response e.g. antibody production, cytokine production, T cell proliferation, anergy, tolerance, etc.
• ELISA Enzyme-Linked Immunosorbent Assay
• Mullerian tract epithelial cells Another use of Mullerian tract epithelial cells is related to drug discovery. Since the pre-determined multipotent Mullerian tract epithelial cell population has not been isolated and cultured in the disclosed manner, the Mullerian tract epithelial cell population may secrete proteins that have not been heretofore discovered or characterized. Previous culturing techniques using serum may inhibit the secretion of proteins. Alternatively, proteins may change in function, conformation, or activity as they are being secreted and interacting with serum biomolecules. Proteins secreted by Mullerian tract epithelial cells have minimal interference from serum biomolecules and thus, may be more physiologically and topologically accurate. Therefore, proteins secreted by Mullerian tract epithelial cells may be used as targets for drug development.
• drugs can be made to target specific proteins on Mullerian tract epithelial cells and/or cells differentiated therefrom in vivo. Binding of the drug may promote differentiation of the Mullerian tract epithelial cells into uterine, cervical, oviductal, and vaginal cells. This approach may be useful when neogenesis of uterine, cervical, oviductal, or vaginal cells are desired, for example in cases of partial and complete hysterectomies or tissue damage.
• Mullerian tract epithelial cells are used for cell therapy.
• Mullerian tract epithelial cells and cells derived therefrom are one such example of cell therapy.
• Mullerian duct-derived cells of this invention are useful because of their capability to differentiate into uterine, cervical, oviductal, endometrial, and vaginal cells.
• Mullerian tract epithelial cells are isolated and cultured in serum-free, nutrient-defined media using the methods disclosed.
• Mullerian tract epithelial cells are grown on tissue culture containers, either uncoated or coated with substrate, to obtain Mullerian tract epithelial cell monolayer aggregates.
• Mullerian tract epithelial cell aggregates are grown under standard incubation conditions at least about 1 cell cycle passage, more preferably for at least about 2 cell cycle passage, most preferably at least about 3 cell cycle passages. Mullerian cell aggregates can then be administered to a recipient and allowed to differentiate. In an alternative, Mullerian cell aggregates can be used as cellular carriers of gene therapy wherein Mullerian cells are transfected with one or more genes and enclosed in a delivery device and then administered to a recipient. In another embodiment, Mullerian cell aggregates are placed under a kidney capsule and allowed to differentiate into uterine, cervical, oviductal, and vaginal cells. In another embodiment, Mullerian cell aggregates are used in a device which contains cells and limits access from other cells (i.e. Theracyte®) to limit immune system responses.
• Theracyte® Theracyte®
• Mullerian tract epithelial cells are used to make human tissue models in non-human mammals.
• Mullerian tract epithelial cell aggregates are placed on top of mesenchymal tissue to form grafting recombinants.
• the mesenchymal tissue may be either Mullerian duct-derived or non-M ⁇ llerian duct-derived tissue and may be derived from a different species from which Mullerian tract epithelial cells are isolated.
• human Mullerian tract epithelial cells are placed on top of rat mesenchymal urogenital tissue to form a graft recombinant.
• a skilled artisan may determine the optimal combination in a stepwise fashion, by first isolating human Mullerian tract epithelial cells using the methods disclosed herein and then combining with mesenchymal tissue from different organs.
• a different species e.g. rat
• rat is used as a source for mesenchymal tissue in combination with human Mullerian tract epithelial cells.
• heterologous species allows human-specific markers to be used to determine the identity of differentiated Mullerian duct-derived cells. The likelihood of false positives is reduced if rat mesenchymal tissue is used.
• the use of urogenital mesenchymal tissue over Mullerian duct-derived mesenchymal tissue reduces the likelihood of false positives in identifying differentiated Mullerian duct-derived cells.
• a graft recombinant comprising
• Mullerian tract epithelial cell spheres placed on mesenchymal tissue is cultured on a soft substrate, such as agar, preferably about half a day to about 3 days, more preferably about one day, and then placed under the kidney capsule of a recipient mammal.
• a soft substrate such as agar
• Possible recipient mammals include but are not limited to mice and rats.
• donor tissue is vulnerable to attack by the recipient's immune system.
• To alleviate graft rejection several techniques may be used. One method is to irradiate the recipient with a sub-lethal dose of radiation to destroy immune cells that may attack the graft. Another method is to give the recipient cyclosporin or other T cell immunosuppressive drugs.
• mice With the use of mice as recipient mammals, a wider variety of methods are possible for alleviating graft rejection.
• One such method is the use of an immunodeficient mouse (nude or severe combined immunodeficiency or SCID).
• SCID severe combined immunodeficiency
• human Mullerian tract epithelial cell spheres are placed on rat urogenital mesenchymal tissue and placed under the kidney capsule of an immunodeficient mouse.
• the graft recombinant remains in the recipient for about 1 week to about 52 weeks, preferably about 5 weeks to about 40 weeks, and even more preferably about 6 weeks to about 8 weeks before the grafts are harvested and analyzed for Mullerian tract epithelial cell differentiation. In some cases, a small portion of the graft is needed for analysis.
• Markers specific for the MTE cells and cells derived therefrom as disclosed herein may be utilized in an immunohistochemical analysis.
• a combination of one or more of these markers may be used in combination with cell morphology to determine the efficacy of the transplantation.
• human Mullerian duct-derived model can be generated in a
• SCID severe combined immunodeficiency mouse.
• This human Mullerian duct-derived model can be made by utilizing the human Mullerian tract epithelial cells isolated and cultured with methods disclosed herein and using the human Mullerian tract epithelial cells to make graft recombinants. Graft recombinants are then placed under the kidney capsule of mice. After about 1 to 10 weeks, preferably about 6 to 8 weeks after implantation under the kidney capsule, the graft or portion thereof is harvested and analyzed by immunohistochemistry. Cell surface markers on Mullerian duct-derived cells that may be used include, but are not limited to, CK 1, 5, 6, 7, 8, 10, 11, 13, 15, 16, 18, and 19 and vimentin.
• the anti-CK antibodies or anti-vimentin antibodies disclosed herein are used to analyze the efficacy of the tissue model system.
• markers specific for receptors in differentiated cells of Mullerian duct-derived tissue such as estrogen receptor and progesterone receptor are used.
• Yet another way to assess the results of Mullerian tract epithelial cell differentiation is by morphology. Mullerian tract epithelial cells have the appearance of polygonal or ovoid shape while the differentiated cell types have the mo ⁇ hology consistent with that of epithelial cells, which is well-known to those of ordinary skill in the art. Mo ⁇ hology can be combined with cell surface markers for a more complete assessment.
• the Mullerian tract epithelial cells disclosed herein can be used in various bioassays.
• the Mullerian tract epithelial cells are used to determine which biological factors are required for differentiation.
• one or more specific biological compounds can be found to induce differentiation to uterine cells.
• one or more specific biological compound can be found to induce differentiation to oviduct cells and likewise for cervical and vaginal cells.
• Other uses in a bioassay for Mullerian tract epithelial cells are differential display (i.e.
• Protein-protein interactions can be determined with techniques such as yeast two-hybrid system. Proteins from Mullerian tract epithelial cells can be used to identify other unknown proteins or other cell types that interact with Mullerian tract epithelial cells. These unknown proteins may be one or more of the following: growth factors, hormones, enzymes, transcription factors, translational factors, and tumor suppressors. Bioassays involving Mullerian tract epithelial cells and the protein-protein interaction these cells form and the effects of protein-protein or even cell-cell contact may be used to determine how surrounding tissue, such as mesenchymal tissue, contributes to
• the segments of the Mullerian ducts from each sample were plated in a T75 tissue culture flask.
• the culture medium was serum free F12/DMEM supplemented with insulin
• the colonies of MTE cells were treated with 0.1% (by volume) collagenase- dispase. This enzyme mixture detached the cells from the plastic surface while keeping the cells in small monolayer aggregates. After the enzyme was washed away with nutrient medium, the MTE cells were plated in nutrient medium at 1 : 10 splits. The plating efficiency was low, but a fraction of cells became attached in the first week after subculture and give a confluent cell culture within 2-3 weeks. The culture medium was replenished each week. Basic fibroblast growth factor (FGF) and forskolin could stimulate the cell proliferation, but the growth factors appeared to shorten the life span of the cells. The cells were passaged in this way for 4 to 5 passages.
• FGF Basic fibroblast growth factor
• forskolin could stimulate the cell proliferation, but the growth factors appeared to shorten the life span of the cells. The cells were passaged in this way for 4 to 5 passages.
• Example 2 Characterization of Mullerian Tract Epithelial Cells Under phase contrast microscope, the colonies of cells grown in the primary culture were identified as all epithelial cells based on mo ⁇ hology. The cells kept in close contact to each other. The cell mo ⁇ hology exhibited by MTE cells were of two types. One type was a tight epithelial cell colony (shown in figure 1 A). These MTE cells underwent active cell division. The MTE cells appeared to be small. At high density, the MTE cells tend to form dome-like structures (shown in figure IB, indicated by arrows). The dome-like structures indicated that the MTE cells formed occlusive junctions between the adjacent cells. In addition, MTE cells secreted protein into the hollow lumen of the domes. In addition, the cells could form a second layer of round cells on the top of the bottom layer that attached to the plastic surface at high density.
• MTE cells with a smooth outline with slender processes (shown in figure IC).
• This cell mo ⁇ hology was also observed in endometrial epithelial cell cultures derived from adult human endometrium. This was probably due to the fact that Mullerian duct give rise to many types of epithelial cells (i.e. oviduct, uterus, vagina, and cervix).
• Example 3 Immunohistochemistry Staining of MTE Cells for Cytokeratins and Vimentin Monolayer cultures of MTE cells were fixed in situ with 3% paraformaldehyde for about 1 hour. Alternatively, monolayer cultures of MTE cells may be fixed with ethanol at -20 degrees Celsius for about 5 seconds and allowed to air dry. After the fixative was washed away with phosphate buffered saline (PBS), the cells were incubated sequentially in blocking buffer (5% goat serum and 0.1% Tween 20 in PBS) for about 30 minutes then in primary antibodies for about 1 hour, and then with anti-mouse Ig-horse radish peroxidase for about 1 hour with PBS rinses in between the steps.
• PBS phosphate buffered saline
• the primary antibodies used were anti-cytokeratin clone 4.62, 8.12, 8.13 and anti-vimentin clone VIM 13.2 from Sigma at the dilution recommended by the supplier.
• total RNA was extracted from MTE cells after 5 passages and the RNA was amplified by RT-PCR using Hox-specific primers. The primers used were:
• Hoxa9 accagaactggtcggtgat and agaggtacctggagacgat (SEQ ID NOS: 1-2)
• HoxalO cgcagaacatcaaagaagag and tgagaaaggcggaagtagc (SEQ ID NOS: 3-4)
• Hoxal 1 tacgtctcgggtccagat and atggcgtactctctgaaggt (SEQ ID NOS: 5-6)
• PCR products were separated on a 2% agarose gel and the PCR bands were detected by staining the agarose gel with ethidium bromide. All the three HOX genes
• Example 5 Use of MTE cells for generating a human tissue model or cell therapy MTE cells harvested from monolayer cultures after 3 passages were combined with rat urogenital sinus mesenchymal tissue to make tissue graft recombinants.
• the graft recombinant was cultured on agar plates for approximately 24 hours. Thereafter, the graft recombinants were implanted under the kidney capsule in nude (severe combined immunodeficiency or SCID) mice. The implant was allowed to grow for about 2 months before the graft recombinant tissues were excised and analyzed by histology. The result showed the MTE cells formed structure that resembled the endometrium or oviduct ( Figure 4).

Landscapes

• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Life Sciences & Earth Sciences (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Biotechnology (AREA)
• General Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Cell Biology (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Reproductive Health (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Veterinary Medicine (AREA)
• Endocrinology (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Materials For Medical Uses (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Priority Applications (8)

Applications Claiming Priority (2)

Publications (2)

Family

ID=24176236

Family Applications (1)

Country Status (11)

Cited By (2)

Families Citing this family (10)

Family Cites Families (3)

• 2000
  • 2000-04-07 US US09/545,435 patent/US6416999B1/en not_active Expired - Fee Related
• 2001
  • 2001-04-04 DE DE60134469T patent/DE60134469D1/de not_active Expired - Lifetime
  • 2001-04-04 JP JP2001575152A patent/JP4748700B2/ja not_active Expired - Fee Related
  • 2001-04-04 CN CN01808098A patent/CN1423692A/zh active Pending
  • 2001-04-04 KR KR1020027013431A patent/KR100748039B1/ko not_active Expired - Fee Related
  • 2001-04-04 AU AU2001251311A patent/AU2001251311B2/en not_active Ceased
  • 2001-04-04 CA CA002404634A patent/CA2404634A1/en not_active Abandoned
  • 2001-04-04 DK DK01924679T patent/DK1276850T3/da active
  • 2001-04-04 AT AT01924679T patent/ATE398671T1/de not_active IP Right Cessation
  • 2001-04-04 WO PCT/US2001/010998 patent/WO2001077298A2/en not_active Ceased
  • 2001-04-04 EP EP01924679A patent/EP1276850B1/en not_active Expired - Lifetime
  • 2001-04-04 AU AU5131101A patent/AU5131101A/xx active Pending
• 2002
  • 2002-04-05 US US10/117,895 patent/US7125713B2/en not_active Expired - Fee Related

Also Published As

Similar Documents

Legal Events