WO2001075027A2 - Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075027A2 WO2001075027A2 PCT/CN2001/000382 CN0100382W WO0175027A2 WO 2001075027 A2 WO2001075027 A2 WO 2001075027A2 CN 0100382 W CN0100382 W CN 0100382W WO 0175027 A2 WO0175027 A2 WO 0175027A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- polypeptide
- sequence
- helicase
- human helicase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, "A helicase 13," and a polynucleotide sequence encoding the polypeptide. The present invention also relates to the preparation of the polynucleotide and the polypeptide Method and application.Technical background
- RNA structure such as splicing of precursor RNA, assembly of spliceosome, protein translation, etc.
- RNA structure such as splicing of precursor RNA, assembly of spliceosome, protein translation, etc.
- helicases are detected in many biological systems where RNA plays an important role. They are widely distributed in various tissues and organs from prokaryotes (including viruses) to lower and higher organisms, and are involved in cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mR transport, and mRM. Degradation and other processes.
- Helicases are considered to be important factors in cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded RM [Arr i E i sen, John C. Lucches i, Bi oes says, 1998, 20: 634-641] 0 It provides an effective means for the diagnosis, prevention and treatment of cancer, nervous system diseases and immune system diseases in vivo.
- members of the ATP-dependent helicase superfamily contain multiple conserved sequence motifs, some of which are specific to members of the family; while others exist not only in the family members but also in some ATP-binding proteins Also exists.
- One of these sequence motifs is the "D-E-A-D box” and is present in the B motif of the ATP-binding protein.
- Other members of the helicase superfamily contain a "DE-AH box” which has histidine residues in place of asparagine in the "DEA-D box”.
- the structure motif of this box is the helix Specific to the enzyme superfamily.
- This sequence fragment is a key site for regulating the hydrolysis of ATP. Mutation of this motif will lead to the inhibition of ATP hydrolysis, which will affect the normal physiological function of the enzyme. ATP-dependent helicase It is an important regulator in the process of development and differentiation, which is usually related to the occurrence of some diseases of the nervous system, immune system, tumors and cancer in the body.
- the human helicase 1 3 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes Of the human helicase 13 protein, especially the amino acid sequence of this protein. Isolation of the new helicase 1 3 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its code for MA. '' Purpose of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a human helicase 1 3.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human helicase 1 3.
- Another object of the present invention is to provide a method for producing human helicase 1 3.
- Another object of the present invention is to provide an antibody against the polypeptide-human helicase 13 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human helicase 1 3.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human helicase 13. Summary of invention
- the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1724-1978 in SEQ ID NO: 1; and (b) a sequence having 1-2183 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human helicase 13 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human helicase 13 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human helicase 13.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the helicase 13 and the human helicase 8 of the present invention.
- the upper graph is a graph of the expression profile of human helicase 13 and the lower graph is a graph of the expression profile of human helicase 8.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA -
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 means prostate
- 21 indicates the fetal heart
- 22 indicates the heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human helicase 13 isolated. 1 3kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human helicase 13, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human helicase 13.
- An "antagonist” or “inhibitor” refers to a molecule that, when combined with human helicase 13, can block or regulate the biological or immunological activity of human helicase 13.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human helicase 13.
- Regular refers to a change in the function of human helicase 13, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human helicase 13. '
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human helicase 13 using standard protein purification techniques.
- the substantially pure human helicase 13 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human helicase 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and?, Which can specifically bind to the epitope of human helicase 13.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human helicase 13 means that human helicase 13 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human helicase 13 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human helicase 13 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human helicase 13, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammals) using recombinant techniques. Cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human helicase 13.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human helicase 13 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted An amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (in) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
- conservative amino acid residues preferably conservative amino acid residues
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 2183 bases in length and its open reading frame 1724-1978 encodes 84 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human helicase 8 and it can be deduced that the human helicase 13 has a similar function to human helicase 8.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DM forms include cDNA, genomic DM, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be days Naturally occurring allelic or non-naturally occurring variants.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc.
- polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human helicase 13.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human helicase 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) selection of antibody strips from expression libraries to detect polynuclear clones with common structural characteristics Nucleotide fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mMA plasmid or phage cDNA library.
- kits are also commercially available (Qiagene).
- construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but not Limited to): (l) DM-DM or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of transliteration of human helicase 13; (4) through immunological techniques Or measure biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the gene itself or the fragment of the present invention can of course be used as a probe.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human helicase 13 gene.
- a method (Sa iki, et al. Science 1985; 230: 1 350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human helicase 13 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human helicase 1 3 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- pMSXND expression vectors expressed in mammalian cells Lee and Na thans, J Bio Chem. 263: 3521, 1988
- baculovirus-derived vectors expressed in insect cells in short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector.
- An important expression vector It is characterized by containing replication origins, promoters, marker genes and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human helicase 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human helicase 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human helicase 13 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the ATP-dependent helicase superfamily is a large family of proteins. ATP-dependent helicases play an important role in many cell activities, such as cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mRM transport, and mRM degradation. .
- the ATP-dependent helicase family has structural features characteristic of DEAD and DEAH boxes. Helicases are considered to be important factors in cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded RNA [Arr i E. et al., 1998].
- human helicase 13 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, and growth disorders.
- diseases include, but are not limited to, canceration of various tissues: Gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, Thyroid tumors, uterine fibroids, ovarian tumors, neuroblastomas, astrocytomas, ependymal tumors, glioblastomas, colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, Bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelium Tumor,
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, congenital umbilical hernia, hyaline membrane disease, congenital pulmonary cyst, atelectasis, polycystic kidney disease, double ureter, umbilical fistula, cryptorchidism, Congenital inguinal hernia, double uterus, vaginal atresia, hermaphroditism, atrial septal defect, ventricular septal defect, abnormal arterial stem separation, aortic or pulmonary stenosis, pulmonary stenosis, open ductus arteriosus, neural tube defects, congenital hydrocephalus , Iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- the abnormal expression of the human helicase 13 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human helicase 13.
- Agonists enhance human helicase 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human helicase 13 can be cultured with labeled human helicase 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human helicase I 3 include selected antibodies, compounds, receptor deletions, and the like.
- An antagonist of human helicase 13 can bind to human helicase 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
- human helicase 13 When screening compounds as antagonists, human helicase 13 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human helicase 13 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human helicase 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 13 molecules of human helicase are generally labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human helicase 13 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human helicase 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human helicase 13 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human helicase 13.
- Anti-human helicase 13 antibodies can be used in immunohistochemical techniques to detect human helicase 13 in biopsy specimens.
- Monoclonal antibodies that bind to human helicase 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins against a specific bead site in the body.
- human helicase 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human helicase 13-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human helicase 13. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human helicase 13.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human helicase 13 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human helicase 13 detected in the test can be used to explain the importance of human helicase 13 in various diseases and to diagnose diseases in which human helicase 13 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human helicase 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can It is used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human helicase 13.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human helicase 13 to inhibit endogenous human helicase 13 activity.
- a mutated human helicase 13 may be a shortened human helicase 13 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human helicase 13.
- Viral-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human helicase 13 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human helicase 13 can be found in existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding human helicase 13 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human helicase 13 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like R molecule that can specifically decompose specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RM.
- This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human helicase 13 can be used for the diagnosis of diseases related to human helicase 13.
- the polynucleotide encoding human helicase 13 can be used to detect the expression of human helicase 13 or the abnormal expression of human helicase 13 in a disease state.
- a DNA sequence encoding human helicase 13 can be used to hybridize biopsy specimens to determine the expression of human helicase 13.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human helicase 13 specific primers can also be used to detect transcripts of human helicase 13 by performing RM-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RM-polymerase chain reaction
- Detection of mutations in the human helicase 13 gene can also be used to diagnose human helicase 13-related diseases.
- Human helicase 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human helicase 13 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries. .
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human helicase 13 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human helicase 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms CDM via reverse transcription.
- the Smar t cDNA kit (purchased from C 1 on t ech) was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with an existing public DM sequence database (Genebank).
- Genebank public DM sequence database
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imerl 5'- AACAGCTCAATAAATGCTGGCTAG -3, (SEQ ID NO: 3)
- Primer2 5,-GCACGGCTGCGATAAGACGAAGCT -3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions containing 50mmol / L KCl in a reaction volume of 50 ⁇ 1, 10mmol / L Tr i s- HCl, pH8 5, 1. 5ramol / L MgCl 2, 20 ( ⁇ mol / L dNTP, l. Opmol primer, 1U Taq DNA polymerase (product of Clontech). Reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
- the amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
- DNA sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1- 2183bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human helicase 13 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-ImM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human helicase 13 coding region sequence (1724bp to 1978bp;) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC- 5 x Denhardt, s solution and 200 ⁇ ⁇ ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 'x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human helicase 13
- Primer3 5'- CCCCATATGATGCGCTTCCCCCGGGAACAAGCT-3, (Seq ID No: 5)
- Priraer4 5'- CATGGATCCTCAGAGCCTTAATCTGTTCTCCAG -3, (Seq ID No: 6)
- These two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
- the Ndel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
- PCR was performed using the PBS-0819fll plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0819fll containing 10pg, primers Pr imer-3 and Pr imer-4 were lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
- coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (Vg / ral)), the positive clones were screened by colony PCR method and sequenced. The correct positive clone (PET-0819 ⁇ 1) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. In LB liquid containing kanamycin (final concentration 30 ⁇ / ⁇ 1) In the medium, the host strain BL21 (pET-0819fll) was cultured at 37 ° C.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences
- the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Compare and analyze the data on a carrier such as silicon and then use fluorescence detection and computer software to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target D for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. Schema, M., Chai, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
- the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
- the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips.
- the specific method steps have been reported in the literature.
- the sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-1 ri pha te coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech)
- Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent Cy5dUTP (purchased from Amersham Phamacia Biotech) ) MRNA, probes were prepared after purification.
- Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-1 ri pha te coupled to Cy3 f luorescent dye, purchased from Amers
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU56057/01A AU5605701A (en) | 2000-03-24 | 2001-03-23 | A novel polypeptide, human helicase 13 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115129.0 | 2000-03-24 | ||
CN00115129A CN1315540A (zh) | 2000-03-24 | 2000-03-24 | 一种新的多肽——人解螺旋酶13和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075027A2 true WO2001075027A2 (fr) | 2001-10-11 |
WO2001075027A3 WO2001075027A3 (fr) | 2002-02-21 |
Family
ID=4584598
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000382 WO2001075027A2 (fr) | 2000-03-24 | 2001-03-23 | Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315540A (zh) |
AU (1) | AU5605701A (zh) |
WO (1) | WO2001075027A2 (zh) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997027334A1 (en) * | 1996-01-23 | 1997-07-31 | Viropharma Incorporated | Methods for identifying inhibitors of rna viruses |
US5888792A (en) * | 1997-07-11 | 1999-03-30 | Incyte Pharmaceuticals, Inc. | ATP-dependent RNA helicase protein |
EP0913474A2 (en) * | 1997-10-28 | 1999-05-06 | Smithkline Beecham Corporation | Dbpa, a helicase from Staphylococcus aureus |
US5989858A (en) * | 1997-10-28 | 1999-11-23 | Smithkline Beecham Corporation | Dead-type ATP-dependent RNA helicase (DbpB) from Staphylococcus aureus |
WO2000005388A1 (de) * | 1998-07-22 | 2000-02-03 | Aventis Research & Technologies Gmbh & Co. Kg | Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH10327866A (ja) * | 1997-05-29 | 1998-12-15 | Eijiin Kenkyusho:Kk | ヘリカーゼをコードするヒトの遺伝子,cdc28−#3 |
-
2000
- 2000-03-24 CN CN00115129A patent/CN1315540A/zh active Pending
-
2001
- 2001-03-23 WO PCT/CN2001/000382 patent/WO2001075027A2/zh active Application Filing
- 2001-03-23 AU AU56057/01A patent/AU5605701A/en not_active Abandoned
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997027334A1 (en) * | 1996-01-23 | 1997-07-31 | Viropharma Incorporated | Methods for identifying inhibitors of rna viruses |
US5888792A (en) * | 1997-07-11 | 1999-03-30 | Incyte Pharmaceuticals, Inc. | ATP-dependent RNA helicase protein |
EP0913474A2 (en) * | 1997-10-28 | 1999-05-06 | Smithkline Beecham Corporation | Dbpa, a helicase from Staphylococcus aureus |
US5989858A (en) * | 1997-10-28 | 1999-11-23 | Smithkline Beecham Corporation | Dead-type ATP-dependent RNA helicase (DbpB) from Staphylococcus aureus |
WO2000005388A1 (de) * | 1998-07-22 | 2000-02-03 | Aventis Research & Technologies Gmbh & Co. Kg | Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung |
Non-Patent Citations (2)
Title |
---|
HAGEN F.K. AND NEHRKE K.: 'cDNA cloning and expression of a family of UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase sequence homologs from caenorhabditis elegans' J. BIOL. CHEM. vol. 273, no. 14, 1998, pages 8268 - 8277 * |
SULSTON J.E. AND WATERSTON R.: 'Toward a complete human genome sequence' GENOME RES. vol. 8, no. 11, 1998, pages 1097 - 1108 * |
Also Published As
Publication number | Publication date |
---|---|
CN1315540A (zh) | 2001-10-03 |
WO2001075027A3 (fr) | 2002-02-21 |
AU5605701A (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001075027A2 (fr) | Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001062782A1 (fr) | Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2001085923A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001066578A1 (fr) | Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide | |
WO2001087951A1 (fr) | Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001083682A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide | |
WO2001083542A1 (en) | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2002000698A1 (fr) | Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001072806A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 8, et polynucleotide codant pour ce polypeptide | |
WO2001072794A1 (fr) | Nouveau polypeptide, helicase 16, et polynucleotide codant pour ce polypeptide | |
WO2001075037A2 (en) | A new polypeptide- human dihydroorotase 40 and the polynucleotide encoding it | |
WO2001048199A1 (fr) | Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide | |
WO2001087975A1 (fr) | Nouveau polypeptide, adn ligase humaine 9, et polynucleotide codant ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001074894A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide | |
WO2001072809A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 9, et polynucleotide codant pour ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |