WO2001075001A2 - A novel polypeptide, cyclic adenosine 9-dependant human protein kinase and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a cyclic adenosine 9 dependant human protein kinase, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumor, hemopathy, HIV infection, immunological disease, and various inflammation, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the cyclic adenosine 9-dependant human protein kinase.

Description

 A new peptide, a human cyclic adenylate-dependent protein kinase inhibitor-9

 And a polynucleotide encoding such a polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human cyclic adenine-dependent protein kinase inhibitor-9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 In many complex life processes, such as the spatial and temporal order of cell differentiation, the guidance of cell migration, and the composition of tissue structures, cell communication and cell interaction and coordination are required, which involve many intermediate regulatory molecules to transmit signals. . Intercellular communication is necessary for the occurrence of multicellular organisms and the construction of tissues, to coordinate cell functions, and to control cell growth and division. Cell communication refers to the transmission of information from one cell to another through a medium to produce a corresponding response. Cell recognition is an important part of the cell communication process.

 The transmission of information between cells is mainly completed by various intermediate transmitters. The way of information transmission across the membrane can be divided into two types depending on the location of the signal receptor: Lipophilic signal molecules, such as steroid hormones can pass through The plasma membrane binds to intracellular receptors to transmit various information; hydrophilic signal molecules often bind to specific receptors on the plasma membrane to transmit information, including ion channel-coupled receptors, receptors with catalytic functions, and G protein-coupled receptors, which are divided into cAMP signaling pathways and inositol phospholipid signaling channels.

 The receptor coupled to the G protein is the role of the receptor with enzymes or ion channels. Through the coupling of GTP-bound regulatory proteins, a second messenger is generated in the cell, thereby transmitting external signals across the membrane to the cell. The cAMP signal channel is the signal channel through which the extracellular signal binds to its corresponding receptor, causing the change of the second messenger cAMP level in the cell and causing the cell response. It increases the intracellular cAMP level through adenylate cyclase, The activity of activated protein kinases phosphorylates specific proteins and causes cellular responses [S Lars en T., Johans en AK eta 1., 1997, Adv Second Mes s enger Phosphoprot e in Res, 31: 191-204].

Different protein kinases in various organisms have been cloned and their actions are regulated by changes in the second messenger cAMP in the organism. Both type I and type II cAMP-dependent protein kinases are composed of catalytic subunits and regulatory subunits, and their role in the body is also regulated by the synergy of these two subunits. When the catalytic subunit is combined with type I and type II regulatory subunits, its catalytic activity is inhibited. The adenylate cyclase on the catalytic unit of the cAMP signal channel binds to the plasma membrane. In the presence of manganese ions, adenylate cyclase catalyzes ATP to produce cAMP, thereby increasing the level of cAMP in the cell. The combination of cAMP generated in cells with the regulatory subunits of cAMP-dependent protein kinases will inhibit the role of regulatory subunits, thereby promoting the role of catalytic subunits, allowing the enzymes to perform normal physiological activities, and activating the activity of protein kinases to make special The protein is phosphorylated, which in turn causes a corresponding cellular response. Deletion of the regulatory subunit cAMP binding site will lead to overexpression of protein kinase regulatory subunits, thereby inhibiting the role of catalytic subunits, and then affecting a series of related signal transduction processes. It is through this pathway that organisms coordinate and control the activity of protein kinases. Mutation or abnormal expression of any of the enzyme's catalytic subunits and regulatory subunits will cause abnormal function of the protein, resulting in abnormal signal transduction pathways, and then trigger a series of related metabolic disorders [BjT. Gjertsen, Gunnar Mellgren et al., 1995, J Biol Chem, 270: 20599-20607] ₀

 cAMP-dependent protein kinases also play important regulatory roles in the cell cycle of organisms. Studies have found that reducing the activity of cAMP-dependent protein kinase is necessary for cells to enter the M phase of the cell cycle. When the catalytic subunit of cAMP-dependent protein kinase in the cell loses function, the cell can smoothly enter the cell cycle and complete cell proliferation. the process of. The regulatory subunit of cAMP-dependent protein kinase plays an important regulatory role in this process. By combining the regulatory subunit with the catalytic subunit, the activity of the known catalytic subunit and the catalytic activity of the protein kinase are promoted, thereby promoting cells. Enter the cell cycle and complete the corresponding proliferation process. It can be seen that cAMP-dependent protein kinase regulatory subunits participate in a variety of important physiological metabolic processes through the synergistic effect with catalytic subunits in the body, and abnormal expression of these will lead to abnormalities in multiple metabolic pathways, thereby triggering various related Disease.

 The analysis of the gene chip revealed that among the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L02 cell line, The expression profile is very similar to the expression profile of human cAMP-dependent protein kinase regulatory subunits, so the functions of the two may also be similar. The present invention is named human cyclic adenine-dependent protein kinase inhibitor-9.

As mentioned above, the human cyclic adenylate-dependent protein kinase inhibitor-9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more human cyclic adenylate-dependent protein kinase inhibitor-9 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the novel human cyclic adenylate-dependent protein kinase inhibitor-9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for the disease, and it is therefore important to isolate its coding DNA. Disclosure of invention It is an object of the present invention to provide an isolated novel polypeptide, a human cyclic adenylate-dependent protein kinase inhibitor-9, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cyclic adenylate-dependent protein kinase inhibitor-9.

 Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human cyclic adenylate-dependent protein kinase inhibitor-9.

 Another object of the present invention is to provide a method for producing a human cyclic adenylate-dependent protein kinase inhibitor-9.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human cyclic adenylate-dependent protein kinase inhibitor-9.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the human cyclic adenylate-dependent protein stimulator inhibitor -9 against the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human cyclic adenylate-dependent protein kinase inhibitor-9.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1237 to 1485 in SEQ ID NO: 1; and (b) a sequence having 1 -1 in SEQ ID NO: 1 769-bit sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a human cyclic adenylate-dependent protein kinase inhibitor-9 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

The invention also relates to an in vitro detection of human cyclic adenine-dependent protein kinase inhibitor-9 protein abnormalities. A method for expressing a related disease or disease susceptibility, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention in the preparation for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection, immune diseases and various types of inflammation or other human cyclic adenylate-dependent protein kinases. Use of inhibitors-9 drugs for diseases caused by abnormal expression.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine with leucine, and non-conservative changes, such as tryptophan Acid replaces glycine.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

An "agonist" refers to a molecule that, when combined with a human cyclic adenylate-dependent protein kinase inhibitor-9, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human cyclic adenylate-dependent protein kinase inhibitor-9. "Antagonist" or "inhibitor" refers to a biological activity that blocks or regulates human cyclic adenylate-dependent protein kinase inhibitor-9 when combined with human cyclic adenylate-dependent protein kinase inhibitor-9. Or immunologically active molecules. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human cyclic adenylate-dependent protein kinase inhibitor-9.

 "Regulation" refers to changes in the function of human cyclic adenylate-dependent protein kinase inhibitor-9, including any increase or decrease in protein activity, changes in binding characteristics, and any Changes in other biological, functional or immune properties.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human cyclic adenylate-dependent protein kinase inhibitor-9 using standard protein purification techniques. Essentially pure human cyclic adenylate-dependent protein kinase inhibitor-9 produces a single main band on non-reducing polyacrylamide gels. The purity of human cyclic adenylate-dependent protein kinase inhibitor-9 peptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program

 (Lasergene software package, DNASTAR, Inc., Mad son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of human cyclic adenine-dependent protein kinase inhibitor-9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human cyclic adenylate-dependent protein kinase inhibitor-9" means that human cyclic adenylate-dependent protein kinase inhibitor-9 is substantially free of other proteins, lipids, and sugars naturally associated with it. Or other substances. Those skilled in the art can purify human cyclic adenylate-dependent protein kinase inhibitor-9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human cyclic adenylate-dependent protein kinase inhibitor-9 peptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide-a human cyclic adenylate-dependent protein kinase inhibitor-9, its base It was originally composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives, and analogs of human cyclic adenylate-dependent protein kinase inhibitor-9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human cyclic adenylate-dependent protein kinase inhibitor-9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1769 bases in length and its open reading frame 1237-1485 encodes 82 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with the human cAMP-dependent protein kinase regulatory subunit, and it can be deduced that the human cyclic adenylate-dependent protein kinase inhibitor-9 has human cAMP-dependent protein kinase regulation. Subunits have similar functions.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optionally the additional Plus coding sequences) and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xS SC, 0.1 ° /. SDS, 60 ° C; or (2) adding denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; Or (3) hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably At least 100 nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human cyclic adenylate-dependent protein kinase inhibitor-9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human cyclic adenylate-dependent protein kinase inhibitor-9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available. Way to get (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcription of human cycloadenylate-dependent protein kinase inhibitor-9 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human cyclic adenylate-dependent protein kinase inhibitor-9 gene expression. .

 Amplification of DNA / RNA by PCR (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) can be preferably used, and the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human cyclic adenylate-dependent protein kinase inhibitor-9 coding sequence, and the recombinant technology to produce A method of inventing the polypeptide.

In the present invention, a polynucleotide sequence encoding a human cyclic adenylate-dependent protein kinase inhibitor-9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "carrier" refers to the Bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors are well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chera. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a human cyclic adenylate-dependent protein kinase inhibitor-9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989), and the DNA sequence can be effectively linked to expression An appropriate promoter in the vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human cyclic adenylate-dependent protein kinase inhibitor-9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a gene containing the polynucleotide or the recombinant vector. Engineered host cells. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma Cells etc.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human cyclic adenylate-dependent protein kinase inhibitor-9 (Scence, 1 984; 224: 1431). Generally speaking, there are the following steps:

 (1) A polynucleotide (or variant) encoding a human human cyclic adenylate-dependent protein kinase inhibitor-9 of the present invention, or a suitable host transformed or transduced with a recombinant expression vector containing the polynucleotide cell;

(2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Figure 1 is a gene chip expression profile comparison of the human cyclic adenylate-dependent protein kinase inhibitor-9 and the human cAMP-dependent protein kinase regulatory subunit. The upper graph is a graph of the expression profile of human cyclic adenylate-dependent protein kinase inhibitor-9, and the lower sequence is the graph of the expression profile of human cAMP-dependent protein kinase regulatory subunits.

Figure 2 is a polyacrylamide gel electrophoresis of isolated human cyclic adenylate-dependent protein kinase inhibitor-9. (SDS-PAGE). 9KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human cyclic adenylate-dependent protein kinase inhibitor-9

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ^ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5 cc. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones 0125c07 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0125c07 clone is 1769bp (as shown in Seq IDNO: 1), and there is a 249bp open reading frame (0RF) from 1237bp to 1485bp, which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS- 0125c07 and the encoded protein was named human cyclic adenylate-dependent protein kinase inhibitor-9. Example 2: Cloning of a gene encoding human cyclic adenylate-dependent protein kinase inhibitor-9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- AGGGAAGAGGACACCTTTTCCATG -3 '(SEQ ID NO: 3)

 Primer2: 5'- AAAAGGTCTTGCTGTGTTGCCCAG -3, (SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Prinier2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tris-

CI, (ρΗ8.5), 1.5 ol / L MgCl ₂ , 200 μ raol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (product of C 1 on tech). The reaction was performed on a PE 9600 DN A thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. Set β-act in at the same time during RT-PCR For positive control and template blank as negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1769bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human cyclic adenylate-dependent protein kinase inhibitor-9 gene expression: Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method includes acid thiocyanate Guanidinephenol-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- "PdATP was used to prepare labeled DNA probes by random primers. The DNA probes used were PCR amplified human cyclic adenylate-dependent protein kinase inhibitor-9 coding region sequences (1237bp to 1485bp). 32P-labeled probes (about 2 x 10 ⁶ cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 X SSC- 5 X Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, wash the filter in 1 X SSC- 0.1% SDS at 55 ° C for 30 min. Then, Analysis and quantification using Phosphor Imager. Example 4: In vitro expression, isolation and purification of recombinant human cyclic adenylate-dependent protein kinase inhibitor-9

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'- CATGCTAGCATGGAAAGCAATGAAGTGTTTCTA -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTTAAATTGTGGTATATATACACGG -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site. PCR was performed using the pBS-0125c07 plasmid containing the full-length target gene as a template. The PCR reaction conditions are: a total volume of 50 μ 1 containing 10 pg of pBS- 0125c07 plasmid, primers? !! ^! ^! ^ And? !! ^! !! ^-Separate! !! For ^^! ^ 丄, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BaraHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed with colibacillus DH5α by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (^ g / ml)), positive clones were screened by colony PCR and performed. Sequencing. A positive clone (pET-0125c07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / mi) in LB liquid medium, host strain BL21 _(P ET- 0125c0 ⁷⁾ at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 to allow ol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge was used which could bind 6 histidine (6His-Tag).

(Novagen) chromatography, to obtain a purified human protein cyclic adenylate-dependent protein kinase inhibitor -9. After SDS-PAGE electrophoresis, a single band was obtained at 9 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human cyclic adenylate-dependent protein kinase inhibitor-9 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human cyclic adenylate-dependent protein kinase inhibitor-9 specific peptides:

 NH2-Met-Glu-Ser-Asn-Glu-Val-Phe-Leu-Arg-Val-Val-Ala-Phe-Glu-Lys-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avraraeas, et al. Immunochemistry, 1969; 6: 43. Immunize with ½g of the hemocyanin peptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin peptide complex and incomplete Freund's adjuvant to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive home-free serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody specifically binds to human cyclic adenylate-dependent protein kinase inhibitor-9. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter membrane hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods, etc., all of which fix the polynucleotide sample to be tested on the filter Substantially identical step-hybridization was applied after membrane. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5-TGGAAAGCAATGAAGTGTTTCTAAGAGTAGTGGCTTTTGAA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'- TGGAAAGCAATGAAGTGTTTCTAAGAGTAGTGGCTTTTGAA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods that are not listed in the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manuals, such as the Guide to Molecular Cloning Experiments (Second Edition 1998) [US] Sambrook et al., Science Press.

Sample Preparation: T / CN01

 1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ral / g) with cold homogenization buffer (0.25 mol / L sucrose; ²⁵ ol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml) and apply a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C Shake gently overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix well. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ ”to check the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Sample film preparation:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection solution of the first peak is combined, the "P-Probe" (the second peak is free _γ - ^32P -dATP) is prepared.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml was added).

CT DNA (calf thymus DNA). ) After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice). 4) 0.1xSSC, 0.1 ° / «SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Example 7 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of different full-length cDNAs were prepared as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μ _ηΐ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. Its specific method steps There have been various reports in the literature, and the post-sampling processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

It was extracted with a ho method from human mixed structure with body specific tissue (or via stimulated cell line) total mRNA, and treated with Oligotex mRNA Midi Kit (available from QiaGen Inc.) purified mRNA, the other points ¹ J fluorescence by reverse transcription Cy3dUTP reagent (5-Amino-propargy 1-2 · -deoxyuri dine 5--triphate coupled to Cy3 fluorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargy) was used. 2'-deoxyur idine 5--tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification. For specific steps and methods, see:

Schena,

M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-

10619. Schena, M., Shalon, Dari., Davis, R. W. (1995) Science. 270. (20): 467-480.

(Three) cross

 Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization

Solution (purchased from TeleChera) was used for hybridization for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, and non-starved L02 cell line. Draw a graph based on these 11 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of the human cyclic adenylate-dependent protein kinase inhibitor-9 and the human cAMP-dependent protein kinase regulatory subunits are very similar.

Industrial applicability The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The role of protein kinases is regulated by changes in the second messenger cAMP in the body. Type I cAMP-dependent protein kinases are composed of catalytic subunits and regulatory subunits, and their role in the body is also regulated by the synergy of these two subunits. Mutation or abnormal expression of any of the enzyme's catalytic subunits and regulatory subunits will lead to abnormal function of the protein, resulting in abnormal signal transduction pathways, which will cause a series of related metabolic disorders.

 cAMP-dependent protein kinases also show important regulatory effects during the cell cycle of organisms. The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human cAMP-dependent protein kinase type I regulatory subunit, and both have similar biological functions. It regulates the transmission of the cell signal system and the regulation of the cell cycle in the body, and its abnormal expression will cause the normal physiological function of the cell to be impaired and cause related diseases.

 It can be seen that the abnormal expression of the human cyclic adenylate-dependent protein kinase inhibitor-9 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss

 Growth and development disorders: mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

The abnormal expression of the human cyclic adenylate-dependent protein kinase inhibitor-9 of the present invention will also produce certain hereditary, hematological diseases and the like. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cyclic adenylate-dependent protein kinase inhibitor-9. Agonists enhance human cyclic adenylate-dependent protein kinase inhibitor-9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human cyclic adenylate-dependent protein kinase inhibitor-9 can be cultured with labeled human cyclic adenylate-dependent protein kinase inhibitor-9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human cyclic adenylate-dependent protein kinase inhibitor-9 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human cyclic adenylate-dependent protein kinase inhibitor-9 can bind to human cyclic adenylate-dependent protein kinase inhibitor-9 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.

 When screening compounds as antagonists, human cyclic adenylate-dependent protein kinase inhibitor-9 can be added to the bioanalytical assay. The effect of this interaction is used to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human cyclic adenylate-dependent protein kinase inhibitor-9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human cyclic adenylate-dependent protein kinase inhibitor-9 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a human cyclic adenylate-dependent protein kinase inhibitor-9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human cyclic adenylate-dependent protein kinase inhibitor-9 directly into immunized animals (eg, home immunity, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human cyclic adenylate-dependent protein kinase inhibitor-9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975,

256: 495-497), three tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) It can also be used to produce single chain antibodies against human cyclic adenylate-dependent protein kinase inhibitor-9.

 Antibodies against human cyclic adenylate-dependent protein kinase inhibitor-9 can be used in immunohistochemistry to detect human cyclic adenylate-dependent protein kinase inhibitor-9 in biopsy specimens.

 Monoclonal antibodies that bind to human cyclic adenylate-dependent protein kinase inhibitor-9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human cycloadenylate-dependent protein kinase inhibitors-9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human cyclic adenylate-dependent protein kinase inhibition Agent-9 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human cyclic adenylate-dependent protein kinase inhibitor-9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human cyclic adenylate-dependent protein kinase inhibitor-9.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human cyclic adenylate-dependent protein kinase inhibitor-9 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The levels of human cyclic adenylate-dependent protein kinase inhibitor-9 detected in the test can be used to explain the importance of human cyclic adenylate-dependent protein kinase inhibitor-9 in various diseases and to diagnose human circular gland Diseases where glycoside-dependent protein kinase inhibitor-9 works.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human cyclic adenylate-dependent protein kinase inhibitor-9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cyclic adenylate-dependent protein kinase inhibitor-9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cyclic adenylate-dependent protein kinase inhibitor-9 to inhibit endogenous human cyclic adenylate-dependent protein kinase inhibitor-9 activity. For example, a variant human cyclic adenylate-dependent protein kinase inhibitor-9 may be a shortened human cyclic adenylate-dependent protein kinase inhibitor-9 that lacks a signaling domain, although it can interact with downstream substrates. Binding, but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human cyclic adenylate-dependent protein kinase inhibitor-9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human cyclic adenylate-dependent protein kinase inhibitor-9 into a cell . Construction of a protein encoding a human cyclic adenine-dependent protein Methods for recombinant viral vectors of enzyme inhibitor-9 polynucleotides can be found in existing literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding human cyclic adenylate-dependent protein kinase inhibitor-9 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human cycloadenylate-dependent protein kinase inhibitor-9 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

 The polynucleotide encoding human cyclic adenine-dependent protein kinase inhibitor-9 can be used for the diagnosis of diseases related to human cyclic adenylate-dependent protein kinase inhibitor-9. Polynucleotide encoding human cyclic adenylate-dependent protein kinase inhibitor-9 can be used to detect the expression of human cyclic adenylate-dependent protein kinase inhibitor-9 or the inhibition of human cyclic adenylate-dependent protein kinase in disease states Agent-9 abnormal expression. For example, a DNA sequence encoding human cyclic adenylate-dependent protein kinase inhibitor-9 can be used to hybridize biopsy specimens to determine the expression of human cyclic adenylate-dependent protein kinase inhibitor-9. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are all mature and open technologies, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes. diagnosis. RNA-polymerase chain reaction (RT-PCR) in vitro amplification using human cyclic adenylate-dependent protein kinase inhibitor-9 specific primers can also detect the transcription products of human cyclic adenylate-dependent protein kinase inhibitor-9.

Detection of mutations in the human cyclic adenylate-dependent protein kinase inhibitor-9 gene can also be used to diagnose human cyclic adenylate-dependent protein kinase inhibitor-9-related diseases. Human cyclic adenine-dependent protein kinase inhibitor-9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human cyclic adenine-dependent protein kinase inhibitor-9 DNA sequences. Wait. Mutations can be detected using existing techniques such as Sout hern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones to metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human cyclic adenylate-dependent protein kinase inhibitor-9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human cyclic adenine-dependent protein kinase inhibitor -9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

1. An isolated polypeptide-human cyclic adenylate-dependent protein kinase inhibitor-9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide, or the like Or derivatives.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (C) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 1237-1485 in SEQ ID NO: 1 or the sequence of positions 1-1769 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human cyclic adenylate-dependent protein kinase inhibitor-9 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under conditions in which a human cyclic adenylate-dependent protein kinase inhibitor-9 is expressed;

 (b) Isolation of a peptide having human cyclic adenylate-dependent protein kinase inhibitor-9 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human cyclic adenylate-dependent egg Leukokinase-9 antibody that specifically binds.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of a human cyclic adenylate-dependent protein kinase inhibitor-9.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human cyclic adenylate-dependent protein kinase inhibitor-9 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human cyclic adenylate-dependent protein kinase inhibitor-9. Agents; or for identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip. Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of the human cyclic adenylate-dependent protein kinase inhibitor-9.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and various types of inflammation drugs.