WO2001068877A1 - Novel polypeptide---human excitatory amino acid transporter protein 10 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns novel polypeptide---human excitatory amino acid transporter protein 10 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. neural psychogenic diseases, glutamate transporter disturbance diseases, a variety of tumor, growth disturbance diseases, homeopathy, infection of HIV, inflammation, immunological diseases etc. utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes human excitatory amino acid transporter protein 10.

Description

A new peptide, a human excitatory aminoacyltransferrin 10, and a polynucleotide encoding the same TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human excitatory amino acid transporter 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Hanging background

 Glutamate reabsorption plays an important role in synaptic regulation and extracellular glutamate regulation. Glutamate transport in the central nervous system and peripheral nervous system is mediated by a class of membrane proteins that transmembrane 6-10 times, called transporters. The transporter transports one molecule of glutamic acid and two units of sodium ions while transporting one unit of potassium ions, thereby forming a unit of positive net charge. Recent studies have shown that this charge transfer process is voltage-dependent and occurs with the transport of chloride ions activated by the transport substrate. Different subtypes of transporters transport glutamate and chloride in different proportions.

 The human brain has three glutamate transporters, EAAT1, EAAT2, and EAAT3 (excitatory amino acid transporters, exci ta t ory ami no ac i d t rans por ter). These three subtypes are found throughout the human brain, and EAAT1 is highest expressed in the cerebellum. EAAT1 and EAAT3 are also found in many non-neural tissues, while EAAT2 is mainly restricted to expression in the brain.

 The pharmacological properties of different subtypes of human transporters also differ. Many compounds that inhibit glutamate transport (such as serine-0-sulfate, L-trans-tetrahydropyrrole-2, 4-dicarboxylic acid, L-cysteine, and D-arginine, etc.) Induced inward currents suggest that they are competitive substrates for transport. In contrast, two glutamate analogs, potassium alum and potassium alum dihydrogen, can selectively and competitively block the glutamate transport of EAAT2, but they are not themselves transported. This obstruction process is not voltage-dependent. This indicates that the binding site of potassium alum and EAAT2 is located outside the membrane electric field. EAAT1 and EAAT3 are not sensitive to these two analogs [J Neruos c 1994 Sep; 14 (9): 559-69].

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated L02 In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention is very similar to the expression profile of the human EAAT1 protein, so their functions may also be similar. The invention is named human excitatory amino acid transporter 10.

As mentioned above, the human excitatory amino acid transporter 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need in the art to identify more human excitatory amino acid transporter 10 proteins involved in these processes, and in particular to identify the amino acid sequence of such proteins. Isolation of the new human excitatory amino acid transporter 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide, a human excitatory amino acid transporter 10, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human excitatory amino acid transporter 10.

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a human excitatory amino acid transporter 10.

 Another object of the present invention is to provide a method for producing a human excitatory amino acid transporter 10. Another object of the present invention is to provide antibodies against the human excitatory amino acid transporter protein 10 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, human excitatory amino acid transporter protein 10.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormality of human excitatory amino acid transporter 10. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 The polynucleotide sequences of (c) and (a) or (b) have at least 70 »/. Identical polynucleotides.

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 365-6 sequence at position 31; and (b) a sequence having positions 1-3205 in SEQ ID NO: 1.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human excitatory amino acid transporter protein 10, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human excitatory amino acid transporter 10 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of neuropsychiatric diseases, glutamate transport disorders, various tumors, growth and development disorders, inflammation, immune diseases, and blood diseases. , The use of drugs for HIV infection or other diseases caused by abnormal expression of human excitatory amino acid transporter 10.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

 Fig. 1 is a comparison diagram of gene chip expression profiles of the excitatory amino acid transporter 10 and human EAAT1 protein of the present invention. The upper graph is a graph of the expression profile of the human excitatory amino acid transporter 10, and the lower graph is the graph of the expression profile of the human EAAT1 protein.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human excitatory amino acid transporter 10. OKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also be Refers to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with a human excitatory amino acid transporter 10, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a human excitatory amino acid transporter 10.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with a human excitatory amino acid transporter 10, can block or regulate the biological or immunological activity of the human excitatory amino acid transporter 10. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human excitatory amino acid transporter 10.

 "Regulation" refers to a change in the function of human excitatory amino acid transporter 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human excitatory amino acid transporter 10 Change of nature.

"Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human excitatory amino acid transporter 10 using standard protein purification techniques. A substantially pure human excitatory amino acid transporter 10 can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human excitatory amino acid transporter 10 polypeptide can be analyzed by amino acid sequence. "Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "CTG-A" can be combined with the complementary sequence "GA-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence and sequence

^ Sequence of residues - the sequence of spacer residues - the sequence of residues ^X ^ interval may be measured as Jotun Hein percentage identity (Hein between nucleic acid sequences or by using Cluster method known in the art J. , (1990) Methods in enzymology 183: 625-645) ₀

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with a fluorenyl, acyl, or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of human excitatory amino acid transporter 10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human excitatory amino acid transporter 10" means that human excitatory amino acid transporter 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human excitatory amino acid transporter 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human excitatory amino acid transporter 10 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human excitatory amino acid transporter 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (such as bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated, or they may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of the human excitatory amino acid transporter 10. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human excitatory amino acid transporter 10 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues Group is substituted by a conservative or non-conservative amino acid residue (preferably a conservative amino acid residue), and the substituted amino acid may or may not be encoded by a genetic codon; or (II) such a type in which one or more amino acids A group on a residue is substituted by another group to include a substituent; or (II) a method in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); Or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusion of an additional amino acid sequence into a mature polypeptide. As set forth herein, such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a 3205 base polynucleotide sequence, and its open reading frame 365-631 encodes 88 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human EAAT1 protein, and it can be deduced that the human excitatory amino acid transporter 10 has a similar function to human EAAT1 protein.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be coded or non-coded. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human excitatory amino acid transporter 10.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human excitatory amino acid transporter 10 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA 'library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) measuring the level of the transcript of human excitatory amino acid transporter 10; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination. In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human excitatory amino acid transporter 10 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PIUS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human excitatory amino acid transporter 10 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.

 In the present invention, a polynucleotide sequence encoding a human excitatory amino acid transporter 10 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct proteins containing human excitatory amino acid transporters 10 DNA sequences and expression vectors with appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human excitatory amino acid transporter 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 _2, steps well known in the art used alternative is to use MgCl _2.. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human excitatory amino acid transporter 10 (Science, 1984; 224: 1431). Generally have The following steps:

 (1) using the polynucleotide (or variant) encoding the human-human excitatory amino acid transporter 10 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 Glutamate reabsorption plays an important role in synaptic regulation and extracellular glutamate regulation. Glutamate transport in the central and peripheral nervous systems is mediated by a class of transport membrane proteins. Different subtypes have different ratios of glutamate and chloride ion transporters. The human brain's glutamate transporter, EAAT1, is found throughout the human brain and is highest expressed in the cerebellum. EAAT1 and EAAT3 are also found in many non-neurological tissues.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human EAAT1 protein, and both have similar biological functions. It regulates the transport of glutamate and transporting chloride ions in the body, especially important for the neurotransmitter transmission of nerve cells, and its abnormal expression will cause the material transport and metabolism of some tissues such as nerve tissue, liver tissue, and kidney tissue. Abnormalities and related diseases.

 It can be seen that the abnormal expression of the human excitatory amino acid transporter 10 in the present invention will produce various diseases, especially neuropsychiatric diseases, glutamate transport disorders, various tumors, growth and development disorders, inflammation, Immune diseases, including but not limited to:

Neuropsychiatric disorders: schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia, neurodegenerative diseases: Alzheimer's disease, Parkinson's disease, chorea, depression Depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, myasthenia gravis, bradykinesia

 Disorders of glutamate transport: glutamate deficiency, propionate, isovalerate Tumors in various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor , Uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibromatosis, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharynx Cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Growth and development disorders: mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The abnormal expression of the human excitatory amino acid transporter 10 in the present invention will also produce certain hereditary, bloody diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially neuropsychiatric diseases, glutamate transport disorders, various tumors, growth and development Obstructive diseases, inflammation, immune diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human excitatory amino acid transporters 1 0. Agonists enhance human excitatory amino acid transporters 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing a human excitatory amino acid transporter 10 can be cultured together with a labeled human excitatory amino acid transporter 10 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.

 Antagonists of human excitatory amino acid transporter 10 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human excitatory amino acid transporter 10 can bind to human excitatory amino acid transporter 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function. biological functions.

When screening compounds as antagonists, human excitatory amino acid transporter 10 can be added In bioanalytical assays, whether a compound is an antagonist is determined by determining its effect on the interaction between human excitatory amino acid transporter 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human excitatory amino acid transporter 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human excitatory amino acid transporter 10 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human excitatory amino acid transporter 10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human excitatory amino acid transporter 10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies to human excitatory amino acid transporter 10 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrson et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human excitatory amino acid transporter 10.

 Antibodies to human excitatory amino acid transporter 10 can be used in immunohistochemistry to detect human excitatory amino acid transporter 10 in biopsy specimens.

 Monoclonal antibodies that bind to human excitatory amino acid transporter 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human excitatory amino acid transporter 1 0 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill human excitatory amino acid transporter 10 positive cell.

The antibodies of the present invention can be used to treat or prevent diseases related to human excitatory amino acid transporter 10. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human excitatory amino acid transporter 10. The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human excitatory amino acid transporter 10. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human excitatory amino acid transporter 10 detected in the test can be used to explain the importance of human excitatory amino acid transporter 1 0 in various diseases and to diagnose diseases where human excitatory amino acid transporter 1 0 functions .

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.

 Polynucleotides encoding human excitatory amino acid transporter 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human excitatory amino acid transporter 10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human excitatory amino acid transporter 10 to inhibit endogenous human excitatory amino acid transporter 10 activity. For example, a mutated human excitatory amino acid transporter 10 may be a shortened human excitatory amino acid transporter 10 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of excitatory amino acid transporter 10. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding a human excitatory amino acid transporter 10 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human excitatory amino acid transporter 10 can be found in the existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding human excitatory amino acid transporter 10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human excitatory amino acid transporter 10 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds. The polynucleotide encoding human excitatory amino acid transporter 10 can be used for the diagnosis of diseases related to human excitatory amino acid transporter 10. The polynucleotide encoding human excitatory amino acid transporter 10 can be used to detect the expression of human excitatory amino acid transporter 10 or the abnormal expression of human excitatory amino acid transporter 10 in a disease state. For example, the DNA sequence encoding human excitatory amino acid transporter 10 can be used to hybridize biopsy specimens to determine the expression status of human excitatory amino acid transporter 10. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human excitatory amino acid transporter 10 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the human excitatory amino acid transporter 10 transcript.

 Detection of mutations in the human excitatory amino acid transporter 10 gene can also be used to diagnose human excitatory amino acid transporter 10-related diseases. Human excitatory amino acid transporter 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human excitatory amino acid transporter 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the gene map data. These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human excitatory amino acid transporter 10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human excitatory amino acid transporter 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions are not indicated in the following examples. Generally, conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

 Example 1 Cloning of human excitatory amino acid transporter 10

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RM using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0242M2 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0242bl2 clone is 3205bp (as shown in Seq IDN0: 1), and there is a 267bp open reading frame (0RF) from 365bp to 631bp, which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0242bl2, and the protein encoded was named human excitatory amino acid transporter 10. Example 2 The gene encoding human excitatory amino acid transporter 10 was cloned by RT-PCR. The total RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. The following primers are used for PCR amplification:

 Priraerl: 5, — CTGCTGTTCAGATTCTTTTGTCCC -3 '(SEQ ID NO: 3)

 Primer2: 5,-TGCACGGCTGCGAGAAGACTAAGC -3, (SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl ₂ , 20 (^ mol / L dNTP, lOpmol primer, 1U Taq in a reaction volume of 50 μ1 DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94.C 30sec; 55 ° C 30sec; 72.C 2min. At RT-PCR At the same time, β-actin was set as the positive control and the template blank was used as the negative control. The amplified products were purified using QIAGEN's kit and TA cloning kit was connected to the pCR vector (Invitrogen's product). The DNA sequence analysis results showed that the PCR product The DNA sequence is exactly the same as that of 1-3205bp shown in SEQ ID NO: 1.

Northern blot analysis of human excitatory amino acid transporter 10 gene expression Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue homogenate of phenol, 1 volume and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Electrophoresed on ImM EDTA-2.2M formaldehyde-1.2% agarose gel - with _20μ δ RNA, containing 20mM 3- (N- morpholino) propanesulfonic acid (H7.0) -5mM sodium acetate. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DM probe labeled with a- ³² P dATP by random priming method. The D probe used is the PCR amplified human excitatory amino acid transporter 10 coding region sequence (365bp to 631bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0, (pH7.4)-5 x SSC- 5 x Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC- 0.1% SDS at 55 ° C for 30 minutes. Then, use Phosphor Imager was used for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human excitatory amino acid transporter 10 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed The sequence is as follows:

Primer3: 5'- CATGCTAGCATGCAGATTTGCCCTAGGGGTGCC —3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTCAGCAGAGGCAGCCATAATACCA -3, (Seq ID No: 6) These two primers contain Nhel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The PCR reaction was performed using the pBS-0242bl2 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0242W2 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5cc using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 μ ₈ / π1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0242bl2) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. Containing kanamycin (final concentration of 3 (^ g / ml) of LB liquid medium, host strain BL21 _(P ET-0242bl2) cultured at 37 ° C to logarithmic phase, IPTG was added to a final concentration of lmmol / L, continue to culture for 5 hours. Centrifuge to collect bacterial cells, sonicate the bacteria, centrifuge to collect the supernatant, and use an affinity chromatography column His. Bind that can bind to 6 histidines (6His-Tag). Quick Car tr idge (product of Novagen) was subjected to chromatography to obtain a purified human excitatory amino acid transporter protein 10 of interest. After SDS-PAGE electrophoresis, a single band was obtained at lOKDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human excitatory amino acid transporter 10 antibody

 The following peptides specific to human excitatory amino acid transporter 10 were synthesized using a peptide synthesizer (product of PE):

 NH2-Met-Gln-I l e-Cys-Pro-Arg-Gly-Ala-Trp-Phe-Ser-I l e-Gln-Val-Ser- COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody specifically binds to human excitatory amino acid transporter 10. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are subjected to a series of membrane washing steps Get rid of. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGCAGATTTGCCCTAGGGGTGCCTGGTTTAGTATTCAGGTT -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGCAGATTTGCCCTAGGGGTCCCTGGTTTAGTATTCAGGTT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; M. Manak; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue on ice and hold phosphate buffered Solution (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0. ² 5mol / L sucrose; 25mmol / L Tris-HCl, pH7.5; 25 ol / L NaCl; 25mmol / L MgCl 2) was suspended precipitate (approximately 10ml / g). 4) At 4 C, homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1 to 5 ml per 0.1 _{g of the} original tissue sample), and centrifuge at 1000 _g for 10 minutes. 7) Resuspend the pellet with lysis buffer (lral per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 _g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml) and apply a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml 5) Incubate at 50 ^U C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Cool 180 vol. 2 mol / L sodium acetate and 2 vol. Add ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully lysed, add approximately 1 ul per 1-5 x lO ⁶ cells extracted

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution at a final concentration of 100 ug / ml 37 C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml 37 C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenylhydrazone: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, mix 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix well-20 ° C 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A _26fl and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5mol / L NaCl for 5 minutes (twice), dry and put in 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) After the collection of the first peak is combined, the ³² P-Probe (the second peak is free γ- ² P-dATP) is prepared.

 Pre-hybridization

 Place the sample membrane in a plastic bag and add 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, .lmg / ml CT DNA (calf thymus DNA)). After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 0 ° C for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice). 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1 ° /. Wash in SDS at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1 touch, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene microarray or gene microarray (D Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μηι. The spotted slides are hydrated, dried, and placed Cross-link in an ultraviolet cross-linker, and then dry after elution to fix the DM on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2½SDS wash for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex raRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription! ] Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) fluorescent reagent Cy3dUTP (5-Amino-propargyl) ^-2 '-deoxyur idine 5'- triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619.

Schena, M., Shalon, Dari., Davis, R.W. (1995) Science.270 (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> <SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray The 3000 scanner (purchased from General Scanning, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Draw a graph based on these 13 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profile of human excitatory amino acid transporter 10 and human EAAT1 protein according to the present invention are very similar.

Claims

Profit requirement

1. An isolated polypeptide-a human excitatory amino acid transporter 10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID D NO: 2, or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID D NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 365-631 in SEQ ID NO: 1 or a sequence of positions 1-3205 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human excitatory amino acid transporter 10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human excitatory amino acid transporter 10;

(b) isolating a polypeptide having human excitatory amino acid transporter 10 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to a human excitatory amino acid transporter 10.

 1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human excitatory amino acid transporter 10.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence shown in SEQ ID D NO: 1 or a fragment thereof.

 13. Use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of the human excitatory amino acid transporter 10 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimetic, agonist, antagonist or inhibitor of human excitatory amino acid transporter 10; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with a human excitatory amino acid transporter 10 abnormality.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.