WO2001074128A2 - A novel polypeptide, microtubulin 11 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, microtubulin 11 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001074128A2 WO2001074128A2 PCT/CN2001/000226 CN0100226W WO0174128A2 WO 2001074128 A2 WO2001074128 A2 WO 2001074128A2 CN 0100226 W CN0100226 W CN 0100226W WO 0174128 A2 WO0174128 A2 WO 0174128A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human tubulin
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human tubulin 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
- Movement is one of the most prominent characteristics of all living beings.
- many diverse physiological activities such as the change and maintenance of cell morphology, intracellular material transport, endocytosis and efflux, immune behavior, and cell division, are all accompanied by various forms of movement.
- the skeletal system in the cell is the basis of this movement.
- the cytoskeleton is divided into three types of protein fibers: microfilaments, microtubules, and medium fibers.
- Microtubules are unique and ubiquitous structures of eukaryotic cells. Microtubules have the same morphology in different cell types. Most microtubules are found in the cytoplasmic matrix, but they are part of the complete composition of motor organs such as cilia and flagella, as well as parts of the centrosome.
- Microtubules are formed by the polymerization of tubulin and a small amount of microtubule-binding proteins.
- Tubulin exists as two monomers, ⁇ and ⁇ -tubulin.
- the natural subunits assembled into microtubules are heterodimers.
- the main assembly method is as follows: some existing dimers form short filaments, and they are expanded into sheet-like bands by adding dimers at both ends and sides. When the lamellar band widens to 13 strands, it is closed to form a microtubule. New dimers are continuously added to the ends of this microtubule to extend it. Low temperatures, high fluid pressures, and high calcium ion concentrations are all assembly equilibriums that tend to disaggregate.
- Microtubules are not only a component of cilia, flagella and other motor organs, but also a centrosome. In addition, microtubules play an important role in the transport of matter within nerve cells. Many axonal nutrients, such as vesicles, protein particles, actin, inclusions, calmodulin, and other metabolic enzymes, are transported through microtubules.
- the arrangement of chromosomes on the equatorial plate and the motive force towards the poles also come from the continuous aggregation and disaggregation of tubulin.
- the expression profile of the peptide is very similar to the expression profile of the tubulin ⁇ subunit, so the functions of the two may also be similar.
- the invention is named human tubulin 1 1.
- human tubulin 11 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. It is necessary to identify more human tubulin 11 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human tubulin 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for disease 1 and it is therefore important to isolate its coding for DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human tubulin 1 1.
- Another object of the present invention is to provide a method for producing human tubulin 11.
- Another object of the present invention is to provide an antibody against the polypeptide-human tubulin 11 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human tubulin 11 against the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to human tubulin 1 1 abnormalities.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 78 to 1091 in SEQ ID NO: 1; and (b) a sequence having 1-1493 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human tubulin 11 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human tubulin 11 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of embryonic developmental disorders, various tumors, neurological diseases, growth disorders, inflammation, immune diseases, blood diseases, HIV infection or Use of other drugs for diseases caused by abnormal expression of human tubulin 11.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active means that natural, recombinant, or synthetic proteins and fragments thereof Ability to induce a specific immune response in a substance or cell and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human tubulin 11, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human tubulin 11.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human tubulin 11 when bound to human tubulin 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human tubulin 11.
- Regular refers to a change in the function of human tubulin 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human tubulin 11.
- substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
- Those skilled in the art can purify human tubulin 11 using standard protein purification techniques.
- Substantially pure human tubulin 11 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human tubulin 11 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALI GN program (La sergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGAL IGN program can compare two or more sequences according to different methods such as Cl us ter method (Higgs, DG and PM Sharp (1988) Gene 73: 237-244). 0 C l us ter method checks all pairs The distance between them arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as: Totun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and 1 ⁇ , which can specifically bind to the epitope of human tubulin 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human tubulin 11 means that human tubulin 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human tubulin 11 using standard protein purification techniques. Substantially pure polypeptide coagulated in non-reducing polyacrylamide A single main band can be produced on the glue. The purity of human tubulin 11 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human tubulin 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human tubulin 1 1.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human tubulin 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non-conserved amino acid residues
- the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by Other group substitutions include substituents; or (in) one in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such one in which additional The polypeptide sequence formed by the fusion of the amino acid sequence into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence). As explained herein, such fragments, 00 derivatives and analogs are considered It is within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1493 bases in length and its open reading frame 783-1 091 encodes 102 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to the tubulin ⁇ subunit, and it can be inferred that the human tubulin 11 has a similar function to the tubulin o subunit.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 50 »/», preferably 70% identity).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human tubulin 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human tubulin 11 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human tubulin 11 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human tubulin 11 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human tubulin 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human tubulin 11 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human tubulin 11 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Labora tory Manua, cold Harbor Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human tubulin 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
- MgC 12 If necessary, the transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human tubulin 11 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of human tubulin 11 and tubulin c subunit of the present invention.
- the upper figure is a graph of the expression profile of human tubulin 11 and the lower sequence is the graph of the expression profile of the tubulin o subunit.
- FIG. 1 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human tubulin 11 isolated.
- HKDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0048hl 1 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0048hll clone contained a full-length cDNA of 1493bp (as shown in SeqIDN0: l), and a 309bp open reading frame (0RF) from 783bp to 1091bp, encoding a new protein (such as Seq ID NO: 2 (Shown).
- This clone P BS-0048hll and the encoded protein was named human tubulin 11.
- Example 2 Cloning of a gene encoding human tubulin 11 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5,-GTGGGGATAGCATTTCATTCCTGA -3, (SEQ ID NO: 3)
- Primer2 5,-ATAGCGCCACTGCACTCCAGTCTG -3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (ontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1493bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human tubulin 11 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate (P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1), mixed After centrifugation. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the human tubulin 11 coding region sequence (783b P to 1091bp) amplified by PCR shown in FIG. 1.
- the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM H 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human tubulin 11
- Primer3 5'- CATGCTAGCATGGAAATTAGCAGACAGAAGGTT -3, (Seq ID No: 5)
- Primer4 5,-CCCAAGCTTTCAGCCTTCTTGAGGAATCCCAGA -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and Hindlll restriction sites, respectively.
- the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and Hindlll restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the pBS-0048hll plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0048hll plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (PET-0048hll) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0048hll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mol / L. Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified human protein tubulin 11 was purified.
- a peptide synthesizer (product of PE company) was used to synthesize the following human tubulin 11-specific peptides:
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30 »/. -70%, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - ] 2P-dATP) is prepared.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Transcription analysis!] Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent, was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino- propargyl- 2'- deoxyuridine 5'- triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification. For specific steps and methods, see:
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- the scanner purchased from General Scanning Company, USA
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, and non-starved L02 cell line.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- the cytoskeleton system is the basis for the change and maintenance of cell morphology, intracellular material transport, endocytosis and efflux, immune behavior, and cell division.
- Tubulin is a major cytoskeleton protein. Most microtubules are found in the cytoplasmic matrix. However, they are part of the cilia and part of the centrosome. In addition, microtubules play an important role in the transport of matter within nerve cells. Many axonal nutrients, such as vesicles, protein particles, actin, inclusions, calmodulin, and other metabolic enzymes, are transported through microtubules. In addition, during cell division, the arrangement of chromosomes on the equatorial plate and the power to move to the poles also come from the continuous aggregation and disaggregation of tubulin.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human tubulin cc subunit, and both have similar biological functions. It has a variety of important functions in the body, regulating changes and maintenance of cell morphology Support, intracellular material transport, endocytosis and efflux, immune behavior, cell division, especially in terms of nerve cell material transport, cell division and proliferation, etc., have abnormal expression, which will produce embryonic development, cell division and proliferation, and nerve cell function. Adverse effects and related diseases.
- human tubulin 11 of the present invention will produce various diseases, especially embryonic developmental disorders, various tumors, neurological diseases, disorders of growth and development, inflammation, and immune diseases. These diseases include But not limited to:
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, Tumors of the thymus, nasopharyngeal carcinoma, larynx, trachea, fibroids, fibrosarcoma, lipomas, liposarcomas
- Neurological diseases Alzheimer's disease, Parkinson's disease, Chorea, Depression, Amnesia, Huntington's disease, Epilepsy, Migraine, Dementia, Multiple sclerosis, Glioblastoma, Meningiomas, Nerves Fibroids, Pituitary Adenomas, Myasthenia Gravis, Myasthenia, Duchenne Muscular Dystrophy, Schizophrenia, Depression, Trigeminal Neuralgia
- Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- human tubulin 11 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, various tumors, neurological diseases, and developmental disorders. , Inflammation, immune diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human tubulin 11. Agonists enhance biological functions such as human tubulin 11 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, In the presence, mammalian cells or membrane preparations expressing human tubulin 11 are cultured with labeled human tubulin 11. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human tubulin 1 1 include antibodies, compounds, receptor deletions, and the like that have been screened.
- Antagonists of human tubulin 11 can bind to human tubulin 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human tubulin 11 When screening compounds as antagonists, human tubulin 11 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human tubulin 11 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human tubulin 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human tubulin 11 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human tubulin 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human tubulin 11 directly into immunized animals (eg rabbits, mice, rats, etc.).
- immunized animals eg rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant .
- Techniques for preparing monoclonal antibodies to human tubulin 11 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human tubulin 11.
- Anti-human tubulin 11 antibodies can be used in immunohistochemistry to detect human tubulin 11 in biopsy specimens.
- Monoclonal antibodies that bind to human tubulin 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human tubulin 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human tubulin 11 positive cells.
- the antibodies in the present invention can be used to treat or prevent human tubulin 11-related diseases. Give proper A dose of the antibody can stimulate or block the production or activity of human tubulin 11.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human tubulin 11 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human tubulin 11 detected in the test can be used to explain the importance of human tubulin 11 in various diseases and to diagnose diseases in which human tubulin 11 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human tubulin 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human tubulin 11.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human tubulin 11 to inhibit endogenous human tubulin 11 activity.
- a variant human tubulin 11 may be a shortened human tubulin 11 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human tubulin 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human tubulin 11 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human tubulin 11 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human tubulin 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human tubulin 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human tubulin 11 can be used for the diagnosis of diseases related to human tubulin 11.
- the polynucleotide encoding human tubulin 11 can be used to detect the expression of human tubulin 11 or the abnormal expression of human tubulin 11 in a disease state.
- the DNA sequence encoding human tubulin 11 can be used to Biopsy specimens were hybridized to determine human tubulin 11 expression.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human tubulin 11-specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human tubulin 11 transcription products.
- Detection of mutations in the human tubulin 11 gene can also be used to diagnose human tubulin 11-related diseases.
- Human tubulin 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human tubulin 11 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so Northern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cD clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping Resolution and corresponds to one gene per 20 kb).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human tubulin 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human tubulin 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- AIDS & HIV (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU42243/01A AU4224301A (en) | 2000-03-02 | 2001-02-26 | A novel polypeptide, microtubulin 11 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00111820.X | 2000-03-02 | ||
CN00111820A CN1311216A (en) | 2000-03-02 | 2000-03-02 | New polypeptide-human microtubulin 11 and polynucleotide for coding said polypeptide |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001074128A2 true WO2001074128A2 (en) | 2001-10-11 |
WO2001074128A3 WO2001074128A3 (en) | 2002-06-06 |
Family
ID=4581716
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000226 WO2001074128A2 (en) | 2000-03-02 | 2001-02-26 | A novel polypeptide, microtubulin 11 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1311216A (en) |
AU (1) | AU4224301A (en) |
WO (1) | WO2001074128A2 (en) |
-
2000
- 2000-03-02 CN CN00111820A patent/CN1311216A/en active Pending
-
2001
- 2001-02-26 WO PCT/CN2001/000226 patent/WO2001074128A2/en active Application Filing
- 2001-02-26 AU AU42243/01A patent/AU4224301A/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
DATABASE PROTEIN [Online] 05 January 1999 OHTANI K. ET AL. Retrieved from NCBI, accession no. GI:4098637 Database accession no. (AAD00355.1) * |
DATABASE PROTEIN [Online] 22 October 1999 CHEN Z. ET AL. Retrieved from NCBI, accession no. GI:6093304 Database accession no. (AAF03480.1) * |
Also Published As
Publication number | Publication date |
---|---|
AU4224301A (en) | 2001-10-15 |
WO2001074128A3 (en) | 2002-06-06 |
CN1311216A (en) | 2001-09-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001074879A1 (en) | A novel polypeptide - homo ribosome protein s3-12 and polynucleotide encoding said polypeptide | |
WO2001075123A1 (en) | Novel polypeptide--- a human hepatic nuclear factor 12 and polynucleotide encoding it | |
WO2001083538A1 (en) | A novel polypeptide, a human k-ras gene protein 36 and the polynucleotide | |
WO2001074128A2 (en) | A novel polypeptide, microtubulin 11 and the polynucleotide encoding the polypeptide | |
WO2001074869A1 (en) | A novel polypeptide - human heat shock protein 15 and the polynucleotide encoding said polypeptide | |
WO2001094371A1 (en) | A novel peptide - human ribosomal protein s4-10 and the polynucleotide coding this novel peptide | |
WO2002012297A1 (en) | A novel polypeptide- human tropodulin 9 and the polynucleotide encoding said polypeptide | |
WO2001087954A1 (en) | A novel polypeptide, a human clathrin light chain 9 and the polynucleotide encoding the polypeptide | |
WO2001055381A1 (en) | A novel polypeptide, a human transcription regulatory factor 80 and the polynucleotide encoding the polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001064721A1 (en) | A NOVEL POLYPEPTIDE-HUMAN ATPase 30 AND THE POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2001049727A1 (en) | A novel polypeptide-bacteria chemotactic signal transducer 9 and the polynucleotide encoding said polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001075036A2 (en) | A novel polypeptide, human immunophiline 14 and the polynucleotide encoding the polypeptide | |
WO2001066588A1 (en) | A novel polypeptide, human interleukin binding factor 1-12 and the polynucleotide encoding thereof | |
WO2001083728A1 (en) | A novel polypeptide - human excitatory amino acid transporter 9 and the polynucleotide encoding said polypeptide | |
WO2001070983A1 (en) | A novel polypeptide, a human prostate specific membrane antibody proteine 9 and the polynucleotide encoding the polypeptide | |
WO2001079439A2 (en) | A novel polypeptide, a human cannabinoid receptor protein 19 and the polynucleotide encoding the polypeptide | |
WO2002048357A1 (en) | A novel polypeptide, a human c0p9 compound subunit 37.62 and the polynucleotide encoding the polypeptide | |
WO2001074877A1 (en) | A novel polypeptide-human excitatory amino acid transporter 12 and the polynucleotide encoding said polypeptide | |
WO2001074892A1 (en) | A novel polypeptide-human prostate-specific membrane antibody protein 12 and a polynucleotide encoding the same | |
WO2001066589A1 (en) | A novel polypeptide, beta transductin 11 and the polynucleotide encoding thereof | |
WO2001087968A1 (en) | A novel polypeptide -human ribosomal protein s4-36 and a polynucleotide encoding the same | |
WO2001075057A2 (en) | A novel polypeptide, human ribosomal s4 protein 12 and the polynucleotide encoding the polypeptide | |
WO2001075059A2 (en) | A novel polypeptide, human gtp-regulatory protein 11 and a polynucleotide encoding the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |