WO2001062961A1 - Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn - Google Patents

Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn Download PDF

Info

Publication number
WO2001062961A1
WO2001062961A1 PCT/DE2001/000749 DE0100749W WO0162961A1 WO 2001062961 A1 WO2001062961 A1 WO 2001062961A1 DE 0100749 W DE0100749 W DE 0100749W WO 0162961 A1 WO0162961 A1 WO 0162961A1
Authority
WO
WIPO (PCT)
Prior art keywords
type
oligonucleotide
dna
oligonucleotides
solid phase
Prior art date
Application number
PCT/DE2001/000749
Other languages
German (de)
English (en)
Inventor
Alexander Olek
Kurt Berlin
Original Assignee
Epigenomics Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics Ag filed Critical Epigenomics Ag
Priority to AU4227901A priority Critical patent/AU4227901A/xx
Priority to US10/204,961 priority patent/US7405040B2/en
Priority to AU2001242279A priority patent/AU2001242279B2/en
Priority to JP2001561769A priority patent/JP2003523752A/ja
Priority to CA002401198A priority patent/CA2401198A1/fr
Priority to EP01915053A priority patent/EP1261740A1/fr
Publication of WO2001062961A1 publication Critical patent/WO2001062961A1/fr
Priority to AU2006236059A priority patent/AU2006236059A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to a method for the detection of 5-methylcytosine in genomic DNA samples.
  • the present invention describes a method for the detection of the methylation state of genomic DNA samples.
  • the method can also be used to detect point mutations and single nucleotide polymorphisms (SNPs).
  • 5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, a PCR Amplification completely lost the epigenetic information that the 5-methylcytosines carry.
  • Methylcytosine is based on the specific reaction of bisulfite with cytosine, which is converted into üracil after subsequent alkaline hydrolysis, which corresponds to the thymidine in its base-pairing behavior. 5-Methylcytosine, however, is not modified under these conditions. Thus the original DNA is punched so umgewan ⁇ that methylcytosine, which can be originally not distinguished by its hybridization behavior from cytosine, now normal through ", molecular biology techniques can be detected as the only remaining cytosine, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing, which is now being fully exploited.
  • the state of the art in terms of sensitivity is defined by a method which includes the DNA to be examined in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts on single-stranded DNA) and all precipitation and purification steps replaced by rapid dialysis (Olek, A. et al., Nucl. Acids. Res. 1996, 24,
  • two easy-to-use functionalizations are primary, aliphatic amines and thiols. Such amines are reacted quantitatively with N-hydroxysuccinimide esters, and thiols react quantitatively with alkyl iodides under suitable conditions.
  • One difficulty is in introducing such functionalization into DNA.
  • the simplest variant is the introduction by means of a PCR primer. Variants shown use 5'-modified primers (NH 2 and SH) and a bifunctional linker.
  • An essential part of immobilization on a surface is its condition. Systems described so far are mainly made of silicon or metal. Another method for binding a target DNA is based on using a short recognition sequence (for example 20 bases) in the target DNA for hybridization to a surface-immobilized oligonucleotide. Enzymatic variants for introducing chemically activated positions on a target DNA have also been described. Here, a 5'-NH 2 functionalization is carried out enzymatically on a target DNA. Fluorescent-labeled probes have been used in many cases for scanning an immobilized DNA array. The simple attachment of Cy3 and Cy5 dyes to the 5 'OH of the respective probe is particularly suitable for fluorescent labels. The fluorescence of the hybridized probes is detected, for example, using a confocal microscope. The dyes Cy3 and Cy5, among many others, are commercially available.
  • Matrix-assisted laser desorption / ionization mass spectrometry is a very powerful development for the analysis of biomolecules (Karas, M. and Hillenkamp, F. (1988), Laser desorption ionization of proteins with molecular masses exeeding 10000 daltons. Anal. Chem. 60: 2299-2301).
  • An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse and the analyte molecule is thus transported unfragmented into the gas phase. The ionization of the analyte is achieved by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones.
  • Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds. , Molecular Cloning: A Laboratory Manual, 1989.
  • the existing binding sites for a certain protein do not completely match in their sequence, but there are conserved sequences of at least 4 bases, which are inserted by inserting "wobbles", i.e. H. Positions where there are different bases can still be extended. Furthermore, these binding sites are at certain distances from each other.
  • SAR scaffold attach ent regions
  • MAR fragments have no conservative sequences, but consist of 70% A and T and are close to free-acting regions that regulate transcription in general and topoisomerase II recognition sites.
  • insulators In addition to promoters and enhancers, there are other regulatory elements for various genes, so-called insulators. These insulators can e.g. inhibit the effect of the enhancer on the promoter if they are between the enhancer and the promoter or, if they are between heterochromatin and a gene, protect the active gene from the influence of heterochromatin. Examples of such insulators are: 1. So-called LCR (locus control regions), which consists of several sites that are hypersensitive to DNAase I; 2. certain sequences such as SCS (specialized chromatin structures) or SCS ', 350 or 200 bp long and highly resistant to degradation by DNAase I and flanked on both sides by hypersensitive sites (spacing 100 bp each). The protein BEAF-32 binds to ses'. These insulators can be on either side of the gene.
  • LCR locus control regions
  • the object of the present invention is to provide a method which is particularly suitable for the simultaneous detection of cytosine methylations and SNPs in genomic DNA samples. It should preferably be possible to examine a large number of fragments at the same time.
  • the object is achieved according to the invention by a method for the detection of 5-methylcytosine in genomic DNA samples, the following steps being carried out: (a) a genomic DNA from a DNA sample is reacted chemically with a reagent, wherein 5-methylcytosine and cytosine react differently and thus they have a different base pairing behavior after the reaction show the DNA duplex;
  • the pretreated DNA is amplified using a polymerase and at least one oligonucleotide (type A) as a primer;
  • a set of oligonucleotides is hybridized to the amplified genomic DNA to form a duplex, this set of oligonucleotides consisting of different species of type B and type C, and said hybridized type B oligonucleotides having their 3 'end directly or adjacent at intervals of up to 10 bases to the positions to be examined for their methylation in the genomic DNA sample and wherein the second oligonucleotide (type C) hybridizes to a second region of the target molecule, so that the 5 'end the second oligonucleotide (type C) is separated by a gap the size of a single nucleotide or up to 10 nucleotides from the 3 'end of the first hybridized oligonucleotide (type B) at the location of said selected position; (d) the oligonucle
  • the oligonucleotides are incubated in the presence of a ligase, the adjoining first oligonucleotide of type B, which has been lengthened by the polymerase reaction, and the second oligonucleotide of type C being joined, and a ligation product is thereby obtained, provided that in the previous step an extension of the type B oligonucleotide was carried out in such a way that the 3 'end with the 3' hydroxy function of the extended oligonucleotide present is immediately adjacent to the 5 'end of the type C oligonucleotide; (f) it is detected whether a ligation product has formed.
  • the 5 'end of the first oligonucleotide (type B) is immobilized on a solid phase or that the 3' end of the second oligonucleotide (type C) is immobilized on a solid phase.
  • the amplified products generated in step b are bound to a solid phase at defined points. It is particularly preferred that at least one primer (type A) is bound to a solid phase during the amplification.
  • oligonucleotide sequences are arranged on a flat solid phase in the form of a rectangular or hexagonal lattice.
  • the markings attached to the extended oligonucleotides can be identified at any position on the solid phase at which an oligonucleotide sequence is located.
  • the solid phase surface consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
  • PCR polymerase chain reaction
  • the type A oligonucleotides used either contain only the bases T, A and C or else the bases T, A and G and / or that the type B and / or type C oligonucleotides used either contain only the bases T, A and C or the bases T, A and G contain.
  • the ligation products and / or the extension products are provided with a detectable label for the detection.
  • the markings are fluorescent markings or that the markings are radionuclides or that the markings are removable mass markings that can be detected in a mass spectrometer.
  • the elongated oligonucleotides and ligation products can be detected in total in the mass spectrometer and are therefore clearly labeled by their mass. It is further preferred according to the invention that a fragment of the elongated and / or ligated oligonucleotides can be detected in the mass spectrometer.
  • the fragment is generated by digestion with one or more exo- or endonucleases.
  • the fragments generated have a single positive or negative net charge for better detectability in the mass spectrometer.
  • the detection of the extended oligonucleotides and / or the ligation products is carried out and visualized by means of matrix assisted laser desorption / ionization mass spectrometry (MALDI) or by means of electrospray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption / ionization mass spectrometry
  • ESI electrospray mass spectrometry
  • polymerases are heat-resistant DNA polymerases and / or the ligases are thermostable ligases.
  • a method is also preferred in which, in addition to DNA methylation, SNPs are also detected and visualized.
  • the nucleotides used being terminating (type D 2) and / or chain-extending nucleotides (type D 1). It is particularly preferred here that the chain-terminating nucleotide (type D 2) is selected from a group which either contains bases T and C or bases G and A and / or the chain-extending nucleotides (type D 1) are selected from a group which contains either the nucleobases A, T and C or the bases G and A and T.
  • the fluorescently labeled dCTP derivative is Cy3-dCTP or Cy5-dCTP.
  • the amplification of several DNA sections is carried out in one reaction vessel.
  • the method according to the invention is very particularly preferred, the genomic DNA being obtained from a DNA sample in step a), sources of DNA e.g. B. cell lines, blood, sputum, stool, urine, brain Spinal fluid, paraffin-embedded tissue, histological slides, and all possible combinations thereof.
  • sources of DNA e.g. B. cell lines, blood, sputum, stool, urine, brain Spinal fluid, paraffin-embedded tissue, histological slides, and all possible combinations thereof.
  • methylation analyzes of the upper and lower DNA strand are carried out simultaneously.
  • the method involves the amplification, hybridization and extension reaction of an entire DNA or a fragment thereof.
  • the method can be used for the detection of methylcytosine and also of single nucleotide polymorphisms (SNPs) and mutations.
  • SNPs single nucleotide polymorphisms
  • the genomic DNA to be analyzed is preferably obtained from conventional sources for DNA, such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, histological see slides and all possible combinations thereof.
  • bisulfite disulfite, hydrogen sulfite
  • an addition takes place on the unmethylated cytosine bases.
  • the subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases into uracil.
  • the genomic DNA used is preferably fragmented before chemical treatment with a restriction endonuclease.
  • the pretreated DNA is preferably amplified using a heat-resistant polymerase and at least one primer (type A).
  • This primer can preferably contain 10-40 base pairs.
  • the amplification is carried out using type A primers by means of the polymerase chain reaction (PCR).
  • the amplification of several DNA fragments is carried out in one reaction vessel.
  • This can either be a so-called multiplex PCR, in which different primers each generate defined fragments.
  • Various defined amplifications are carried out in one reaction vessel.
  • primers amplify several fragments in a targeted and reproducible manner. This can be achieved, for example, by binding the fragments to repetitive elements in the genome, for example.
  • the primers bind to transcription factor binding sites, to promoters or other regulatory elements in genes.
  • the method the
  • Amplification takes place by extending primers that are bound to a solid phase.
  • a multiplex PCR in the broader sense can be carried out by binding different primers to different, defined locations of a solid phase.
  • the primer complementary to one strand e.g. forward primer
  • the primer complementary to the opposite strand e.g. reverse primer
  • the solid phase is flat, the different oligonucleotide sequences being arranged in the form of a rectangular or hexagonal lattice.
  • the different amplificates on the solid phase in the form of a right-angled or hexagonal grid are arranged.
  • several amplificates are generated directly on the solid phase.
  • the solid phase surface preferably consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
  • the oligonucleotides of type A either contain only the bases T, A and C or only the bases T, A and G.
  • a set of oligonucleotides consisting of two types of oligonucleotides, a first (type B) and a second (type C) oligonucleotide is hybridized to a selected position of the amplified genomic DNA.
  • the first oligonucleotide (type B) is a primer which hybridizes to a first region of the target sequence to be investigated in such a way that its 3 'end immediately or at intervals of up to 10 bases adjoins the positions which are relevant for their methylation in of the genomic DNA sample are to be examined.
  • the second oligonucleotide (type C) hybridizes to a second region of the target molecule so that the 5 'end of the second oligonucleotide (type C) is separated by a gap the size of a single nucleotide or up to 10 nucleotides from the 3' end of the first hybridized oligonucleotide (type B) is separated at the location of said selected position.
  • the type B oligonucleotides hybridized to the amplificates can be connected to a solid phase at their 5 'end or at another base or via their backbone, but not via their 3' end. Binding preferably takes place via the 5 'end.
  • the solid phase is flat, the different olives gonucleotide sequences (type B) are arranged in the form of a rectangular or hexagonal grid.
  • the type C oligonucleotides hybridized to the amplificates can be connected to a solid phase at their 3 'end or at another base or via their backbone, but not via their 5' end. Binding preferably takes place via the 3 'end.
  • the solid phase is flat, the different OHgonucleotide sequences (type C) being arranged in the form of a rectangular or hexagonal lattice.
  • the 5 'end of the type C oligonucleotide must be phosphorylated.
  • the 5 'end of the first oligonucleotide (type B) is immobilized on a solid phase.
  • the 3 'end of the second oligonucleotide (type C) is immobilized on a solid phase.
  • the amplification is already carried out on a solid phase, the 5 'end of a primer preferably being connected to the solid phase.
  • the amplification, hybridization, extension reaction and ligation are preferably carried out in solution and the ligation product is first applied to the solid phase for detection.
  • the solid phase surface preferably consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
  • the oligonucleotides of type B and / or type C contain either only the bases T, A and C or only the bases T, A and G.
  • the oligonucleotide (type B) with a known sequence of n nucleotides is extended with a heat-resistant polymerase by at most the number of nucleotides between the 3 'end of the type B OHgonucleotide and the 5' end of the type oligonucleotide C.
  • At least one nucleotide preferably carries a detectable label.
  • either the type B oligonucleotide or the type C oligonucleotide bears a detectable label.
  • the type of extension depends on the methylation status of the respective cytosine in the genomic DNA sample, or on any SNPs, point mutations or deletions, insertions and inversions that are present.
  • the nucleotides used are terminating (type D2) and / or chain-extending nucleotides (type D1).
  • the terminating nucleotide (type D2) is a 2 ', 3' dideoxynucleotide and the chain-extending nucleotide is a 2'-
  • nucleobases of type Dl are selected from a group which contain bases T, A and C or bases T, A and G.
  • nucleobases of type D2 are selected from a group which contains either bases T and C or bases G and A.
  • the extended type B oligonucleotides are preferably labeled using absorbing dyes and / or chemiluminescence and / or radioactive Isotopes and / or via fluorescent labels which are introduced via the nucleotides added in the fourth method step or else via the oligonucleotides of type B or C.
  • the immobilized oligonucleotide has no label. Labeling via the molecular mass of the elongated and ligated oligonucleotide is also preferred.
  • Process step incubated in the presence of a preferably thermostable ligase in order to connect the adjacent hybridized first (type B) and second (type C) oligonucleotide and thereby to obtain a ligation product, provided that in the previous step the oligonucleotide was extended such that a Deoxynucleoside directly adjacent to the 5 'end of the type C oligonucleotide.
  • the sixth method step it is detected whether a ligation product has formed.
  • the extended oligonucleotides at each position of the solid phase, at which an oligonucleotide sequence is located are examined for the presence of a label.
  • the detection of the extended oligonucleotides takes place via their fluorescence.
  • Different ligation products preferably have different fluorescence properties, which can be achieved, for example, by built-in nucleotides labeled with different dyes.
  • fragments of the extended oligonucleotide are generated by digestion with one or more exo- or endonucleases.
  • the markings of the nucleotides are detachable mass markings which can be detected in a mass spectrometer.
  • Detachable mass markings, the extended oligonucleotides as a whole or fragments thereof are, in a particularly preferred variant of the method, using matrix-assisted laser desorption / ionization
  • Mass spectrometry MALDI-MS
  • ESI electron spray mass spectrometry
  • the fragments detected in the mass spectrometer preferably have a single positive or negative net charge.
  • SNPs single nucleotide polymorphisms
  • cytosine methylations are analyzed in one experiment.
  • the lower and the upper strand of the DNA sample after the chemical pretreatment are analyzed in an experiment in order to ensure internal experimental control.
  • the invention further relates to a kit which contains chemicals and aids for carrying out the bisulfite
  • reaction and / or the amplification Contains reaction and / or the amplification, the hybridization, the extension reaction and the ligase reaction and / or polymerases and / or the documentation for performing the method.
  • Example 1 illustrates the invention.
  • the following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG position is to be examined for methylation.
  • the fragment is amplified by type A primers, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No .: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No .: 2).
  • the amplified DNA is hybridized to an oligonucleotide of type B (for example ATGTTGGATGTTGTTGAG (SEQ-ID or 3)) and a 5 '-phosphorylated oligonucleotide of type C (for example GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No .: 4)).
  • the extension reaction is then carried out with 2 ', 3' -dideoxycytidine triphosphate (ddCTP, as type D2), thymidine triphosphate (dTTP, as type D1) and 2'-deoxyadenosine triphosphate (dATP, as type D1). It is formed when a methylated cytosine was present, the extension product ATGTTGGATGTTGTTGAGAAAC (SEQ ID No .: 5), which carries no hydroxyl at the 3 'end, while in the presence of a non-methylated cytosine in the to be tested sequence, the extension product ATGTTGGATGTTGTTGAGAAA2 7 (SEQ -ID NO .: 6) with a 3'-0H function. In the following ligation reaction, therefore, only the ligation product can
  • ddTTP 3' -dideoxothymidine triphosphate
  • dCTP 2'-deoxycytidine triphosphate
  • dATP 2'-deoxy-adenosine triphosphate
  • the following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG position is to be examined for methylation.
  • the fragment is amplified by type A primers, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No .: 1) and
  • ACTTAACACTTACTATTTAAATCACAACCCAT SEQ ID No .: 2.
  • the 5 'end of the amplified DNA is attached to an oligonucleotide of type B immobilized on a solid phase surface (for example ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) and a 5' -phosphorylated oligonucleotide of type C (for example GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No .: 4)) hybridized.
  • extension reaction is then carried out with 2 ', 3' -dideoxycytidine triphosphate (ddCTP, as type D2), thymidine triphosphate (dTTP, as type D1) and 2'-deoxyadenosine triphosphate (dATP, as type D1).
  • ddCTP 3' -dideoxycytidine triphosphate
  • dTTP thymidine triphosphate
  • dATP 2'-deoxyadenosine triphosphate
  • ATGTTGGATGTTGTTGAGAAAT (SEQ-ID No.: 6) with a 3 'OH function is created.
  • ATGTTGGATGTTGTTGAGAAAT GTATAAAGTAAATTAGAAGGAAGAT
  • SEQ ID No.: 7 can be formed.
  • the oligonucleotide of type C GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4) is now fluorescence-labeled, a fluorescent label is only inserted if there is an unmethylated cytosine in the DNA sample to be examined.
  • a control can be performed using the same sequences, but with a different set of triphosphates.
  • ddTTP 3' -dideoxy-thy idin triphosphate
  • dCTP 2'-deoxy-cytidine triphosphate
  • dATP 2'-deoxy-adenosine triphosphate
  • Example 3 The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG position is to be examined for methylation.
  • the fragment is amplified by type A primers, namely by
  • ATTATGTTGGAGTAGTAGAGTTTAAATGGTT SEQ-ID No .: 1
  • ACTTAACACTTACTATTTAAATCACAACCCAT SEQ-ID o .: 2.
  • the amplified DNA is attached to an oligonucleotide of type B (for example ATGTTGGATGTTGTTGAG (SEQ-ID No .: 3)) and a 5 '-phosphorylated oligonucleotide of type C (both for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No .: 4)) hybridizes, the latter having its 3 'end bound to a solid phase surface.
  • type B for example ATGTTGGATGTTGTTGAG (SEQ-ID No .: 3)
  • a 5 '-phosphorylated oligonucleotide of type C both for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No .: 4)
  • extension reaction is then carried out using 2 ', 3' - dideoxycytidine triphosphate (ddCTP, as type D2), thymidine triphosphate (dTTP, as type D1) and 2'-deoxyadenosine triphosphate (dATP, as type D1).
  • ddCTP dideoxycytidine triphosphate
  • dTTP thymidine triphosphate
  • dATP 2'-deoxyadenosine triphosphate
  • Triphosphates are carried out. Analogously to the example above, in the extension reaction 2 ', 3' -dideoxythymidine triphosphate (ddTTP, as type D2), 2'-deoxycytidine triphosphate (dCTP, as type D1) and 2'-deoxy-adenosine triphosphate (dATP, as type Dl) carried out, after the ligase reaction the reverse only results in the incorporation of a label if a methylated cytosine has been present in the DNA sample to be examined.
  • ddTTP 3' -dideoxythymidine triphosphate
  • dCTP 2'-deoxycytidine triphosphate
  • dATP 2'-deoxy-adenosine triphosphate

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)

Abstract

L'invention concerne un procédé de mettre en évidence la présence de 5-méthylcytosine dans des échantillons d'ADN génomiques. Dans un premier temps, un ADN génomique issu d'un échantillon d'ADN est mis à réagir chimiquement avec un réactif, la 5-méthylcytosine et la cytosine réagissant différemment. L'ADN prétraité est ensuite amplifié à l'aide d'au moins une polymérase et d'au moins une amorce. A l'étape suivante, l'ADN génomique amplifié est hybridé sur au moins deux oligonucléotides, ces derniers étant assemblés par introduction d'au moins un oligonucléotide. Dans le cas du produit de ligation, un nucléotide porte un repère identifiable et la prolongation dépend du statut de méthylation de chaque cytosine dans l'échantillon d'ADN génomique. A l'étape suivante, les oligonucléotides prolongés sont examinés afin d'identifier la présence du repère.
PCT/DE2001/000749 2000-02-25 2001-02-23 Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn WO2001062961A1 (fr)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU4227901A AU4227901A (en) 2000-02-25 2001-02-23 Ligase/polymerase method for detecting cytosine methylation in dna samples
US10/204,961 US7405040B2 (en) 2000-02-25 2001-02-23 Ligase/polymerase method for detecting cytosine methylation in DNA samples
AU2001242279A AU2001242279B2 (en) 2000-02-25 2001-02-23 Ligase/polymerase method for detecting cytosine methylation in DNA samples
JP2001561769A JP2003523752A (ja) 2000-02-25 2001-02-23 Ｄｎａプローブにおいてシトシンのメチル化を検出するリガーゼ／ポリメラーゼ法
CA002401198A CA2401198A1 (fr) 2000-02-25 2001-02-23 Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn
EP01915053A EP1261740A1 (fr) 2000-02-25 2001-02-23 Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn
AU2006236059A AU2006236059A1 (en) 2000-02-25 2006-11-17 Ligase/polymerase method for detecting cytosine methylation in DNA samples

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10010281A DE10010281B4 (de) 2000-02-25 2000-02-25 Ligase/Polymerase-Verfahren zur Detektion von Cytosin-Methylierung in DNA Proben
DE10010281.6 2000-02-25

Publications (1)

Publication Number Publication Date
WO2001062961A1 true WO2001062961A1 (fr) 2001-08-30

Family

ID=7633312

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2001/000749 WO2001062961A1 (fr) 2000-02-25 2001-02-23 Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn

Country Status (7)

Country Link
US (1) US7405040B2 (fr)
EP (1) EP1261740A1 (fr)
JP (1) JP2003523752A (fr)
AU (3) AU2001242279B2 (fr)
CA (1) CA2401198A1 (fr)
DE (1) DE10010281B4 (fr)
WO (1) WO2001062961A1 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003038120A2 (fr) * 2001-10-26 2003-05-08 Epigenomics Ag Procede d'analyse d'un modele de methylation genomique
WO2007057231A1 (fr) 2005-11-17 2007-05-24 Epigenomics Ag Procede permettant de determiner le niveau de methylation de l’adn d’une position cpg dans des cellules identiques presentes dans un echantillon de tissu
EP1860200A1 (fr) * 2001-12-03 2007-11-28 Illumina, Inc. Procédés multiplexes de détection de methylation
US7364855B2 (en) * 2004-04-30 2008-04-29 Applera Corporation Methods and kits for methylation detection
EP1261741B1 (fr) * 2000-02-25 2008-05-14 Epigenomics AG Procede pour detecter simultanement la methylation de cytosine et des mutations dans des echantillons d'adn
EP2309005A1 (fr) 2009-08-03 2011-04-13 Eplgenomics AG Procédés pour la conservation de la complexité de la séquence d'ADN génomique
EP2319943A1 (fr) 2009-11-05 2011-05-11 Epigenomics AG Procédés pour la prédiction de l'efficacité thérapeutique de la thérapie contre le cancer
EP2479289A2 (fr) 2007-06-08 2012-07-25 Epigenomics AG Procédé pour l'analyse de la méthylation
EP2481810A1 (fr) 2005-04-15 2012-08-01 Epigenomics AG Procédé pour fournir un dérivé d'échantillon à distance
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
US8906626B2 (en) 2000-02-07 2014-12-09 Illumina, Inc. Multiplex nucleic acid reactions
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US7611869B2 (en) * 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US20110151438A9 (en) 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
DE10201138B4 (de) * 2002-01-08 2005-03-10 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungsmustern durch exponentielle Ligation hybridisierter Sondenoligonukleotide (MLA)
US20040101843A1 (en) * 2002-11-22 2004-05-27 Gerald Zon Detection of methylated DNA sites
US20060094016A1 (en) * 2002-12-02 2006-05-04 Niall Gormley Determination of methylation of nucleic acid sequences
AU2003900368A0 (en) * 2003-01-24 2003-02-13 Human Genetic Signatures Pty Ltd Assay for nucleic acid molecules
US7288373B2 (en) * 2003-05-02 2007-10-30 Human Genetic Signatures Pty Ltd. Treatment of methylated nucleic acid
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US7799525B2 (en) * 2003-06-17 2010-09-21 Human Genetic Signatures Pty Ltd. Methods for genome amplification
DE602004018801D1 (de) * 2003-09-04 2009-02-12 Human Genetic Signatures Pty Nukleinsäurenachweistest
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20060234252A1 (en) * 2004-07-02 2006-10-19 Applera Corporation Methods and kits for methylation detection
DE602005022740D1 (de) * 2004-09-10 2010-09-16 Human Genetic Signatures Pty Amplifikationsblocker umfassend interkalierende nukleinsäuren (ina) enthaltend interkalierende pseudonukleotide (ipn)
JP5116481B2 (ja) * 2004-12-03 2013-01-09 ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド シトシンの化学修飾により微生物核酸を簡素化するための方法
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
JP2008524990A (ja) * 2004-12-23 2008-07-17 ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド ヒトパピローマウイルスの検出
AU2006251866B2 (en) * 2005-05-26 2007-11-29 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
WO2007030882A1 (fr) * 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Essai pour un état de santé
US7820385B2 (en) * 2006-03-22 2010-10-26 The United States Of America As Represented By The Department Of Health And Human Services, Centers For Disease Control And Prevention Method for retaining methylation pattern in globally amplified DNA
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8084734B2 (en) * 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20080050738A1 (en) * 2006-05-31 2008-02-28 Human Genetic Signatures Pty Ltd. Detection of target nucleic acid
AU2008229628A1 (en) * 2007-03-16 2008-09-25 Human Genetic Signatures Pty Ltd Assay for gene expression
US8685675B2 (en) * 2007-11-27 2014-04-01 Human Genetic Signatures Pty. Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
CN101903521A (zh) * 2007-12-20 2010-12-01 人类遗传标记控股有限公司 核酸扩增相关污染物的清除
US8110796B2 (en) 2009-01-17 2012-02-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9490113B2 (en) * 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
ES2613743T3 (es) 2011-09-07 2017-05-25 Human Genetic Signatures Pty Ltd Ensayo de detección molecular
WO2021178210A1 (fr) 2020-03-03 2021-09-10 Codex Dna, Inc. Procédés pour l'assemblage d'acides nucléiques

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995021271A1 (fr) * 1994-02-07 1995-08-10 Molecular Tool, Inc. Analysetm d'elements genetiques induite par la ligase/polymerase de polymorphismes de mononucleotides et son utilisation dans des analyses genetiques
WO1999028498A2 (fr) * 1997-11-27 1999-06-10 Epigenomics Gmbh Procede de production d'empreintes de doigt complexes a methylation d'adn

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4988617A (en) * 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
US6013431A (en) 1990-02-16 2000-01-11 Molecular Tool, Inc. Method for determining specific nucleotide variations by primer extension in the presence of mixture of labeled nucleotides and terminators
US5728526A (en) * 1995-06-07 1998-03-17 Oncor, Inc. Method for analyzing a nucleotide sequence
CA2255774C (fr) * 1996-05-29 2008-03-18 Cornell Research Foundation, Inc. Detection de differences dans des sequences d'acides nucleiques utilisant une combinaison de la detection par ligase et de reactions d'amplification en chaine par polymerase
JP2002518060A (ja) * 1998-06-24 2002-06-25 グラクソ グループ リミテッド ヌクレオチド検出法
DE10010280B4 (de) * 2000-02-25 2006-08-10 Epigenomics Ag Verfahren zur Detektion von Cytosin-Methylierung in DNA Proben
DE10029915B4 (de) * 2000-06-19 2005-06-16 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungen

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995021271A1 (fr) * 1994-02-07 1995-08-10 Molecular Tool, Inc. Analysetm d'elements genetiques induite par la ligase/polymerase de polymorphismes de mononucleotides et son utilisation dans des analyses genetiques
WO1999028498A2 (fr) * 1997-11-27 1999-06-10 Epigenomics Gmbh Procede de production d'empreintes de doigt complexes a methylation d'adn

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GONZALGO M L AND JONES P A: "Rapid quantification of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE)", NUCLEIC ACIDS RESEARCH,GB,OXFORD UNIVERSITY PRESS, SURREY, vol. 25, no. 12, 1997, pages 2529 - 2531, XP002106409, ISSN: 0305-1048 *
GRIGG G AND CLARK S: "Sequencing 5-methylcytosine residues in genomic DNA", BIOESSAYS,GB,CAMBRIDGE, vol. 16, no. 6, June 1994 (1994-06-01), pages 431 - 436, XP002106411, ISSN: 0265-9247 *
XIONG Z AND LAIRD P W: "COBRA: a sensitive and quantitative DNA methylation assay", NUCLEIC ACIDS RESEARCH,GB,OXFORD UNIVERSITY PRESS, SURREY, vol. 25, no. 12, 1997, pages 2532 - 2534, XP002106407, ISSN: 0305-1048 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8906626B2 (en) 2000-02-07 2014-12-09 Illumina, Inc. Multiplex nucleic acid reactions
US10837059B2 (en) 2000-02-07 2020-11-17 Illumina, Inc. Multiplex nucleic acid reactions
US9850536B2 (en) 2000-02-07 2017-12-26 Illumina, Inc. Multiplex nucleic acid reactions
EP1261741B1 (fr) * 2000-02-25 2008-05-14 Epigenomics AG Procede pour detecter simultanement la methylation de cytosine et des mutations dans des echantillons d'adn
WO2003038120A3 (fr) * 2001-10-26 2003-12-11 Epigenomics Ag Procede d'analyse d'un modele de methylation genomique
WO2003038120A2 (fr) * 2001-10-26 2003-05-08 Epigenomics Ag Procede d'analyse d'un modele de methylation genomique
EP1860200A1 (fr) * 2001-12-03 2007-11-28 Illumina, Inc. Procédés multiplexes de détection de methylation
US7364855B2 (en) * 2004-04-30 2008-04-29 Applera Corporation Methods and kits for methylation detection
US10731215B2 (en) 2005-04-15 2020-08-04 Epigenomics Ag Method for determining the presence or absence of methylation in a sample
EP2481810A1 (fr) 2005-04-15 2012-08-01 Epigenomics AG Procédé pour fournir un dérivé d'échantillon à distance
WO2007057231A1 (fr) 2005-11-17 2007-05-24 Epigenomics Ag Procede permettant de determiner le niveau de methylation de l’adn d’une position cpg dans des cellules identiques presentes dans un echantillon de tissu
EP3095878A1 (fr) 2005-11-17 2016-11-23 Epigenomics AG Procédé pour la détermination du niveau de méthylation de l'adn d'une position cpg dans des cellules identiques dans un échantillon de tissu
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis
US10954554B2 (en) 2007-02-07 2021-03-23 Illumina Cambridge Limited Preparation of templates for methylation analysis
US11827927B2 (en) 2007-02-07 2023-11-28 Illumina Cambridge Limited Preparation of templates for methylation analysis
EP3101141A2 (fr) 2007-06-08 2016-12-07 Epigenomics AG Procédé pour l'analyse de la méthylation
EP2479289A2 (fr) 2007-06-08 2012-07-25 Epigenomics AG Procédé pour l'analyse de la méthylation
US8895268B2 (en) 2008-10-22 2014-11-25 Illumina, Inc. Preservation of information related to genomic DNA methylation
US9605311B2 (en) 2008-10-22 2017-03-28 Illumina, Inc. Tandem sequencing top and bottom strands of double stranded nucleic acid using arrays configured for single molecule detection
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
US10174372B2 (en) 2008-10-22 2019-01-08 Illumina, Inc. Preservation of information related to genomic DNA methylation
US9624530B2 (en) 2009-08-03 2017-04-18 Epigenomics Ag Methods for preservation of genomic DNA sequence complexity
EP2309005A1 (fr) 2009-08-03 2011-04-13 Eplgenomics AG Procédés pour la conservation de la complexité de la séquence d'ADN génomique
EP2319943A1 (fr) 2009-11-05 2011-05-11 Epigenomics AG Procédés pour la prédiction de l'efficacité thérapeutique de la thérapie contre le cancer

Also Published As

Publication number Publication date
AU2006236059A1 (en) 2006-12-07
EP1261740A1 (fr) 2002-12-04
US7405040B2 (en) 2008-07-29
AU4227901A (en) 2001-09-03
AU2001242279B2 (en) 2006-10-26
DE10010281B4 (de) 2005-03-10
US20030119025A1 (en) 2003-06-26
JP2003523752A (ja) 2003-08-12
CA2401198A1 (fr) 2001-08-30
DE10010281A1 (de) 2001-09-06

Similar Documents

Publication Publication Date Title
EP1261741B1 (fr) Procede pour detecter simultanement la methylation de cytosine et des mutations dans des echantillons d'adn
WO2001062961A1 (fr) Procede de ligase/polymerase pour detecter la methylation de cytosine dans des echantillons d'adn
EP1232287B1 (fr) Reseau oligomere comportant des oligomeres de pna et/ou d'adn sur une surface
DE10010282B4 (de) Verfahren zur Detektion von Cytosin-Methylierung in DNA Proben
WO2000044934A2 (fr) Procede d'identification de modeles de methylation de cytosine dans des echantillons d'adn genomiques
EP1228247B1 (fr) Procede pour la realisation controlable d'amplifications par pcr complexes
EP1292711B1 (fr) Procede pour l'analyse ultraparallele de polymorphismes
WO2001027317A2 (fr) Procede permettant de distinguer les modifications de methylation en position 5
DE10240746A1 (de) Verfahren zum Nachweis von Nukleinsäuresequenzen mittels spaltbarer Sondenmoleküle
DE10151069A1 (de) Verfahren zum Nachweis von DNA-Methylierung mittels markierten S-Adenosylmethioninanaloga
EP1242628A2 (fr) Procede d'analyse de sequences d'acide nucleique
DE10253068A1 (de) Verfahren zur Analyse von Methylierungsmustern in Nukleinsäuren mittels Massenspektrometrie
AU2007202468A1 (en) Method for detecting cytosine methylation in DNA samples

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WD Withdrawal of designations after international publication

Free format text: DE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 561769

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2401198

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2001242279

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2001915053

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001915053

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10204961

Country of ref document: US