WO2001049736A1 - Nouveau polypeptide, proteine humaine rs3, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine rs3, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001049736A1 WO2001049736A1 PCT/CN2000/000662 CN0000662W WO0149736A1 WO 2001049736 A1 WO2001049736 A1 WO 2001049736A1 CN 0000662 W CN0000662 W CN 0000662W WO 0149736 A1 WO0149736 A1 WO 0149736A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- polypeptide
- polynucleotide
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human RS3 protein 13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
- Ribosomes are the sites where eukaryotic or prokaryotic proteins are translated. They are assembled from rRNA and proteins. Divided into two subunits. Ribosome protein S3 (RS3: ribosome protein S3) is a component located on the small ribosomal subunit and is involved in the initiation of translation. In eukaryotic cells, it can cross-link with the initiation factors eIF-2 and elF-3, and may be directly involved in the ribosome niRNA-aminoacyl tRNA interaction during translation. In addition, RS3 may have other functions.
- RS3 small nuclear RNA
- U15A human small nuclear RNA
- RS3 protein is also involved in DNA repair, a function that has been studied more in recent years. However, only human and insect RS3 proteins have been reported.
- Ionizing radiation, chemical carcinogens, and oxygen free radicals produced by cell metabolism can cause DNA damage. If the damage cannot be repaired in time, it will accumulate with age and eventually lead to tumors and other aging-related diseases.
- the main product of DNA damage caused by free radicals is 8- oxoguanylic acid (referred to as 8-0X0 -G). It is a highly mutated form of base modification caused by oxygen pressure. The incorporation of this base-modified form results in GT switching. Base excision repair is the main form of repair for this type of DNA damage.
- the mutated base is released from the nucleotide chain by N-glycosyltransferase activity, and a purine / apyrimidine (AP: apurine / apyrimidine) site is formed locally.
- AP purine / apyrimidine
- Most N-glycosyltransferases also have AP lyase activity, which cuts the phosphodiester bond through ⁇ and ⁇ elimination reactions, thereby forming a nucleotide gap locally and repaired by DNA polymerase.
- Drosophila RS3 protein has N-glycosyltransferase and AP lyase activity in vitro and in vivo, and can repair damaged DNA. The same was found in human RS3 protein.
- Xeroderma pigmentosa is a serious genetic disease. Due to the deletion or mutation of the gene encoding AP endonuclease I, patients could not repair the damage caused by ultraviolet rays. In this patient, RS3 activity could not be detected, although there was no significant change in RS3 expression. The role of RS3 protein in this genetic disease remains to be seen One step research.
- Fancini-s anemia is a genetic disease with the development of leukemia and solid tumors. Elevated 8-oxo-G levels and reduced RS3 in these patients suggest that changes in RS3 may be the cause of Fanconi's anemia.
- RS3 expression was also found to be increased in adenomatous polyps and colorectal cancer.
- Ribosomal proteins S6, S8, S12, L5, L25, and L26 are also added at the same time.
- adenomatous polyps are generally considered to be precancerous lesions of the colorectal colon, they suggest that changes in ribosomes are early events of malignancy.
- the RS3 protein In terms of the overall function of the RS3 protein, it can both repair DNA damage and participate in protein translation.
- the RS3 protein has a nuclear localization signal, and it enters the cytoplasm after assembling pre-ribosomal particles in the nucleus. It can also be recruited into the nucleus during DNA damage repair. So the dual function of RS3 protein is possible.
- the intron transcript of the RS3 protein-encoding gene is snRNA, suggesting a certain relationship between RNA splicing and regulation of translation.
- the human RS3 protein 13 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human RS3 protein 13 proteins involved in these processes, especially The amino acid sequence of this protein was identified.
- the isolation of the new human RS3 protein 13 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so isolation of its coding DNA is very important.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human RS3 protein 13.
- Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human RS3 protein 13.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human RS3 protein 13.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human RS3 protein 13. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 2039-2383 in SEQ ID NO: 1; and (b) a sequence having 1-3205 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human RS 3 protein 13 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human RS 3 protein 1 3 protein in vitro, which includes detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human RS 3 protein 1 3.
- FIG. 1 is a comparison diagram of amino acid sequence homology of the RS 3 protein of the present inventor with a total of 44 amino acids and domains of RS 3 protein at 68-1-12.
- the upper sequence is the human RS 3 protein 1 3 and the lower sequence is the RS 3 protein domain.
- "I” and ":” and ".” Indicate that the probability that the same amino acid appears between the two sequences decreases in order.
- FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of the isolated human RS3 protein 1 3.
- 1 3kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human RS 3 protein 1 3, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human RS 3 protein 1 3.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human RS 3 protein 13 when combined with human RS 3 protein 13.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human RS3 protein 13.
- RS 3 protein 13 refers to a change in the function of human RS 3 protein 13, including an increase or decrease in protein activity, Changes in binding properties and any other biological, functional or immune properties of human RS3 protein 13.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human RS3 protein 13 using standard protein purification techniques.
- Substantially pure human RS3 protein 13 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human RS3 protein 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: The number of matching residues in the sequence sequence ⁇ 100
- Residues of order ⁇ I4- Number of intermediate residues-The number of spacer residues X in sequence 3 can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in enzymology 183 : 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; Asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human RS 3 protein 1 3.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human RS 3 protein 1 3 means that human RS 3 protein 1 3 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human RS 3 protein 1 3 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human RS 3 protein 1 3 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human RS 3 protein 1 3, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human RS 3 protein 1 3.
- fragment means that the human RS 3 protein 1 3 of the present invention remains substantially the same Biological function or activity of the polypeptide.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a 3205 base polynucleotide sequence and its open reading frame (2039-2383) encodes 114 amino acids. This polypeptide has the characteristic sequence of the RS 3 protein, and it can be deduced that the human RS 3 protein 13 has the structure and function represented by the RS 3 protein.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human RS3 protein 13.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human RS3 protein 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human RS3 protein 13 transcripts; (4) passing Immunological techniques or determination of biological activity to detect protein products expressed by genes The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 Nucleotide, preferably at least 100 octanucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human RS3 protein 13 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human RS3 protein 13 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding the human RS3 protein 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human RS 3 protein 1 3 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human RS 3 protein 13 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- Ribosome protein S3 (RS3: ribosome protein S3) is a component located on the small ribosomal subunit and is involved in the initiation of translation. In eukaryotic cells, it can be cross-linked with the initiation factors eIF-2 and elF-3, and may be directly involved in the ribosomal mRNA-aminoacyl tRNA interaction during translation. In addition, human small nuclear RNA, U15A, is transcribed from the intron of the gene encoding RS3.
- Drosophila RS3 protein has N-glycosyltransferase and AP lyase activity in vitro and in vivo, and can repair damaged DNA. The same was found in human RS3 protein. Pogue-Geile et al. Found that RS3 is overexpressed in rectal colon cancer cells. Abnormal RS3 expression is closely related to xeroderma pigmentosa, Fancini's anemia, adenoma-like polyps, and colorectal cancer.
- polypeptide of the present invention contains a specific conserved sequence necessary for RS3 protein activity mot if.
- abnormal expression of the specific RS3 protein motif will cause abnormal function of the polypeptide containing the motif of the present invention, resulting in abnormal DNA repair function, error in protein translation, and related diseases such as tumors and embryo development Disorders, growth disorders, etc.
- the abnormal expression of the human RS3 protein 13 of the present invention will produce various diseases, especially pigmented dry skin disease, Fancini's anemia, adenoma-like polyps, colorectal cancer, other tumors, embryonic developmental disorders, and growth and development disorders Sexually transmitted diseases, including but not limited to:
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus,
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- Abnormal expression of the human RS3 protein 13 of the present invention will also produce certain hereditary, hematological diseases, and diseases of the immune system.
- polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases, for example, they can treat various diseases, especially xeroderma pigmentosa, Fancini's anemia, adenomatous polyps, colorectal cancer, Other tumors, embryonic disorders, growth disorders, some hereditary, hematological and immune system diseases.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human RS3 protein 13.
- Agonists enhance biological functions such as human RS3 protein 13 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
- mammalian cells or a membrane preparation expressing human RS3 protein 13 can be cultured with labeled human RS3 protein 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human RS3 protein 13 include antibodies, compounds, receptor deletions and analogs. Antagonists of human RS3 protein 13 can bind to human RS3 protein 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human RS3 protein 13 When screening compounds as antagonists, human RS3 protein 13 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human RS3 protein 13 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human RS3 protein 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human RS3 protein 13 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- the invention also provides antibodies directed against the human RS3 protein 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human RS3 protein 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human RS3 protein 13 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma Technology, etc.
- Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against human RS3 protein 13.
- Anti-human RS3 protein 13 antibodies can be used in immunohistochemistry to detect human RS3 protein 13 in biopsy specimens.
- Monoclonal antibodies that bind to human RS3 protein 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human RS3 protein 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human RS3 protein 13 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human RS3 protein 13. Administration of an appropriate amount of antibody can stimulate or block the production or activity of human RS3 protein 13.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human RS3 protein 13 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human RS3 protein 13 detected in the test can be used to explain the importance of human RS3 protein 13 in various diseases and to diagnose diseases in which human RS3 protein 13 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human RS3 protein 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can It is used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human RS3 protein 13.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human RS3 protein 13 to inhibit endogenous human RS3 protein 13 activity.
- a variant human RS3 protein 13 may be a shortened human RS3 protein 13 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human RS3 protein 13.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human RS3 protein 13 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human RS3 protein 13 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human RS3 protein 13 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human RS3 protein 13 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human RS3 protein 13 can be used for the diagnosis of diseases related to human RS3 protein 13.
- the polynucleotide encoding human RS3 protein 13 can be used to detect the expression of human RS3 protein 13 or the abnormal expression of human RS3 protein 13 in a disease state.
- the DNA sequence encoding human RS3 protein 13 can be used to hybridize biopsy specimens to determine the expression of human RS3 protein 13.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
- Human RS3 protein 13 specific primers can also be used to detect human RS3 protein 13 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- Human RS3 protein 13 mutant forms include points compared to normal wild-type human RS3 protein 13 DNA sequences Mutations, translocations, deletions, recombinations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosome localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human RS3 protein 13 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human RS3 protein 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- the sequence of the human RS3 protein 1 :; of the present invention and the protein sequence encoded by the same were used in a profile scan program (Basic local alignment search tool) in GCG [Al schul, SF et a 1. J. Mol. Biol. 1990 215: 403-10], performing domain analysis in databases such as prosotti.
- the human RS3 protein 13 of the present invention is homologous to the domain RS3 protein at 68-112, and the homology result is shown in FIG. 1 with a homology rate of 0.21 and a score of 9.56; the threshold value is 8.82.
- Example 3 Cloning of a gene encoding human RS3 protein 13 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5'- GTTGCCTGTGTGTTCCCCACCCAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l of KC1, 10 ⁇ l / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / L dNTP, lOpmol primer, 1U in a 50 ⁇ 1 reaction volume Taq DNA polymerase (C 1 on tech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-E 1 mer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-3205bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human RS 3 protein 13 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 1 ( ⁇ cpm / ml)) and a nitrocellulose membrane to which RNA was transferred Hybridize overnight at 42 ° C in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human RS3 protein 13
- Primer3 5'- CATGCTAGCATGAGAGCCAATTCACCTGGGACCT-3 '(Seq ID No: 5)
- Primer4 5'- CCCGAGCTCTCAGTGTAAGCTGAGTAAACAGGCC -3' (Seq ID No: 6)
- These two primers contain Nhel and Sacl restriction sites respectively, The coding sequences of the 5 'end and 3' end of the gene of interest are followed, and the Nhe I and Sa c I restriction sites correspond to the expression vector plasmid pET- 28 b (+) (No Vagen product, Cat. No. 69865.3).
- PCR reaction was "PCR reaction conditions were: total volume of 50 ⁇ 1 containing 10 pg plasmid pBS- 0816H12, primer Primer- 3 Primer- 4 minutes and the other is 1 j] Opniol, Advantage polymerase Mix
- Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles. Nhel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH50C by the calcium chloride method.
- the LB plate with a final concentration of 3 was cultured overnight, and the positive clones were selected by colony PCR method and sequenced. The positive clones with the correct sequence were selected (PET-0816H12).
- the recombinant plasmid was transformed into the large intestine by the calcium chloride method.
- BL21 DE3) plySs (Novagen).
- the host strain BL2] pET-0816H12 was cultured at 37 ° C to the logarithmic scale.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely identical or complementary to the polynucleotide of the present invention SEQ ID NO:]; the second type of probes are partially related to the invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 1 8-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 "C for 2 hours.
- 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA)
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21431/01A AU2143101A (en) | 1999-12-29 | 2000-12-25 | A new polypeptide-human rs3 protein and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99127231.5 | 1999-12-29 | ||
CN99127231A CN1301767A (zh) | 1999-12-29 | 1999-12-29 | 一种新的多肽——人rs3蛋白13和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001049736A1 true WO2001049736A1 (fr) | 2001-07-12 |
Family
ID=5284819
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000662 WO2001049736A1 (fr) | 1999-12-29 | 2000-12-25 | Nouveau polypeptide, proteine humaine rs3, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301767A (fr) |
AU (1) | AU2143101A (fr) |
WO (1) | WO2001049736A1 (fr) |
-
1999
- 1999-12-29 CN CN99127231A patent/CN1301767A/zh active Pending
-
2000
- 2000-12-25 AU AU21431/01A patent/AU2143101A/en not_active Abandoned
- 2000-12-25 WO PCT/CN2000/000662 patent/WO2001049736A1/fr active Application Filing
Non-Patent Citations (2)
Title |
---|
HATTORI M. ET AL.: "A novel method for making nested deletions and its application for sequencing of a 300 kb region of human APP locus", NUCLEIC ACIDS RES., vol. 25, no. 9, 1997, pages 1802 - 1808 * |
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 11, 1998, pages 1097 - 1108 * |
Also Published As
Publication number | Publication date |
---|---|
AU2143101A (en) | 2001-07-16 |
CN1301767A (zh) | 2001-07-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002026972A1 (fr) | Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide | |
WO2001074879A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001049736A1 (fr) | Nouveau polypeptide, proteine humaine rs3, et polynucleotide codant pour ce polypeptide | |
WO2001072796A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2001049724A1 (fr) | Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide | |
WO2001048195A1 (fr) | Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2002026810A1 (fr) | Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001046244A1 (fr) | Nouveau polypeptide, adn polymerase 17, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001087962A1 (fr) | Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide | |
WO2001075018A2 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide | |
WO2001081399A1 (fr) | Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001087951A1 (fr) | Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001083682A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001049723A1 (fr) | Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide | |
WO2001070803A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |