WO2001044511A2 - Methods and compositions for detection of mycobacterium avium complex species - Google Patents

Methods and compositions for detection of mycobacterium avium complex species Download PDF

Info

Publication number
WO2001044511A2
WO2001044511A2 PCT/US2000/033872 US0033872W WO0144511A2 WO 2001044511 A2 WO2001044511 A2 WO 2001044511A2 US 0033872 W US0033872 W US 0033872W WO 0144511 A2 WO0144511 A2 WO 0144511A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
primer
nucleic acid
mac
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/033872
Other languages
English (en)
French (fr)
Other versions
WO2001044511A3 (en
Inventor
Steven T. Brentano
Roger L. Lankford
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gen Probe Inc
Original Assignee
Gen Probe Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gen Probe Inc filed Critical Gen Probe Inc
Priority to EP00984359A priority Critical patent/EP1252331B1/en
Priority to JP2001545588A priority patent/JP2003516765A/ja
Priority to CA2389533A priority patent/CA2389533C/en
Priority to AT00984359T priority patent/ATE312204T1/de
Priority to DE60024679T priority patent/DE60024679T2/de
Publication of WO2001044511A2 publication Critical patent/WO2001044511A2/en
Publication of WO2001044511A3 publication Critical patent/WO2001044511A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • This invention relates to in vitro diagnostic detection of pathogenic bacteria, and specifically relates to compositions and assays for amplifying nucleic acid of Mycobacterium avium complex (MAC) organisms (e.g., M. avium, M. intracellulare) by using in vitro nucleic acid amplification.
  • MAC Mycobacterium avium complex
  • M. avium complex organisms include M. avium, M. intracellulare and other species that are difficult to differentiate from these, such as M. paratuberculosis.
  • MAC organisms are frequently found in clinical samples and are common causative agents of opportunistic infections in immunocompromised individuals, such as HIV-infected individuals or individuals undergoing chemotheraphy or using immunosuppressive drugs (Good et al., 1982, J. Infect. Dis. 146: 829-833; Gill et al., 1985, J. Clin. Microbiol. 22: 543-546). Therefore, assays that can detect MAC species and distinguish them from other species are important for clinical diagnosis.
  • Clinical diagnostic assays for Mycobacterium species often rely on time-consuming methods that analyze bacterial physical characteristics [e.g., staining and microscopic detection), physiological characteristics (e.g., growth on defined media) and/or biochemical characteristics (e.g., membrane lipid composition). Such methods often require relatively high bacterial concentrations in the sample and may require a high degree of experience and expertise to properly determine the infective species. Diagnostic assays that require in vitro growth of the bacteria are costly both in terms of delayed or inappropriate early treatment of the patient and in terms of the amount of laboratory equipment and space required to culture Mycobacterium, which is often difficult to grow in vitro.
  • bacterial physical characteristics e.g., staining and microscopic detection
  • physiological characteristics e.g., growth on defined media
  • biochemical characteristics e.g., membrane lipid composition
  • the present invention provides compositions and in vitro nucleic acid amplification methods that produce relatively long amplified nucleic acid sequences to allow detection of MAC species present in a biological sample.
  • Summary of the Invention there is provided a method of detecting Mycobacterium avium complex (MAC) species present in a biological sample. The method includes the steps of: providing a biological sample containing nucleic acid from at least one MAC species selected from the group consisting of M. tuberculosis, M. avium, M. intracellulare, and M.
  • MAC Mycobacterium avium complex
  • the nucleic acid comprising 16S ribosomal RNA (rRNA) or DNA encoding 16S rRNA; amplifying the 16S rRNA or DNA in an in vitro nucleic acid amplification mixture comprising at least one polymerase activity, and at least one first primer having a sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:6 and at least one second primer having a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, to produce an amplified nucleic acid; and detecting the amplified nucleic acid.
  • rRNA ribosomal RNA
  • DNA DNA encoding 16S rRNA
  • the detecting step further comprises hybridizing the amplified nucleic acid to at least one probe and detecting a signal resulting from the amplified nucleic acid that is hybridized to the probe.
  • the detecting step uses at least one labeled probe comprising sequence complementary to a portion of the amplified nucleic acid.
  • Another embodiment of the method further includes the step of using at least one capture oligonucleotide that specifically hybridizes to nucleic acid from at least one MAC species to bind the nucleic acid from the MAC species to an immobilized nucleic acid, to purify the nucleic acid from the MAC species from other components in the sample before the amplifying step.
  • the amplifying step amplifies 16S rRNA from M. tuberculosis, M. avium, M. intracellulare, M. paratuberculosis or any combination thereof.
  • the amplifying step uses a combination selected from the group consisting of: the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:9; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:9; the first primer
  • the amplifying step uses a combination of at least one first primer having a sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:3 and at least one second primer having a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9.
  • Some preferred embodiments use a combination selected from the group consisting of: the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:9; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:9; the first primer having the sequence of SEQ ID NO:3, and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:3, and the second primer having the sequence of SEQ ID NO:8; and the first primer having the sequence of
  • the amplifying step uses transcription-mediated amplification and a combination of primers selected from the group consisting of: the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:1 , and the second primer having the sequence of SEQ ID NO:9; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:2, and the second primer having the sequence of SEQ ID NO:8; the first primer having the sequence of SEQ ID NO:3, and the second primer having the sequence of SEQ ID NO:7; the first primer having the sequence of SEQ ID NO:3, and the second primer having the sequence of SEQ ID NO:8; and the first primer having the sequence of SEQ ID NO:3, and the second primer having the sequence of SEQ ID
  • compositions for amplifying 16S rRNA sequence or DNA encoding 16S rRNA from at least one Mycobacterium avium complex (MAC) species comprising one or more oligonucleotides having a base sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:9.
  • the composition further comprises at least one oligonucleotide for detecting amplified MAC 16S rRNA sequence or DNA encoding 16S rRNA comprising one or more oligonucleotides having a base sequence selected from the group consisting of SEQ ID NO:11 to SEQ ID NO:18.
  • kits containing one or more oligonucleotides having a base sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:9.
  • the kit further comprises one or more oligonucleotides having a base sequence selected from the group consisting of SEQ ID NO:11 to SEQ ID NO:18.
  • Diagnostic assays that rely on in vitro nucleic acid amplification must specifically amplify the intended target nucleic acid while avoiding amplification of contaminating nucleic acids that may be airborne or present in water, reagents or laboratory ware that is used in the assay. Amplification of contaminating nucleic acids could result in false positive results that would lead to misdiagnosis or unnecessary patient treatment.
  • False positive results may occur if the sample contains nucleic acid resulting from non-MAC Mycobacterium species or other bacteria that contain similar sequences (e.g., M. fortuitum) and are often environmental contaminants.
  • Contaminating nucleic acids are generally partially degraded sequences (i.e., relatively short) compared to the target sequence present in the intact MAC organism present in the biological sample. If relatively short MAC sequences are amplified, the contaminating and/or degraded sequences present in the sample may also be amplified, leading to false positive results. Contaminating sequences that can be amplified but not detected in the assay may also compete with the MAC target for primers and/or nucleic acid polymerization substrates, leading to false negative results.
  • the present invention uses primers that hybridize specifically to a target sequence such that a relative long sequence (e.g., greater than 200 residues) located between the primer binding sites is amplified.
  • a relative long sequence e.g., greater than 200 residues
  • the present invention includes amplification oligonucleotides and in vitro nucleic acid amplification methods that use these oligonucleotides as amplification primers to detect MAC species in a sample.
  • These oligonucleotide primers specifically amplify relative long stretches (about 280 to 320 nt) of 16S ribosomal RNA (rRNA) or genomic DNA encoding ribosomal RNA sequences in in vitro amplification methods.
  • rRNA 16S ribosomal RNA
  • Biological samples that may contain such target sequences are preferably derived from humans, and more preferably are processed sputum samples.
  • the present methods may be combined with additional oligonucleotide compositions and methods that aid in the amplification or detection of the amplified MAC sequences.
  • MAC target sequences present in a sample may be partially purified from other components of the sample before amplification by using additional nucleic acid oligomers to select the MAC sequences (sometimes called “capture oligonucleotides”).
  • additional nucleic acid oligomers to select the MAC sequences (sometimes called "capture oligonucleotides”).
  • detection of the amplified nucleic acids may rely on labeled or unlabeled nucleic acid oligomers that hybridize specifically to the amplified MAC nucleic acids ("probes" or "labeled probes").
  • the nucleic acid sequences of the present invention are useful for amplifying relatively long nucleic acid sequences of MAC species, thus allowing detection of MAC species while avoiding the problems associated with amplifying short segments of contaminating nucleic acids described above.
  • the compositions and methods of the present invention are useful for detecting infections caused by MAC organisms, while limiting the incidence of false positives that may result from contaminating nucleic acids in the sample.
  • by amplifying relatively long target sequences even if the amplified sequence is partially degraded it may still be specifically detected (i.e., retain sufficient sequence information), thus avoiding false negative results.
  • biological sample any tissue or material derived from a living or dead human which may contain Mycobacterium nucleic acid or any bacterial culture derived from such material.
  • a sample may be sputum, respiratory tissue or exudates, peripheral blood, plasma or serum, cervical swab samples, biopsy tissue, gastrointestinal tissue, urine, feces, semen or other body fluids, tissues or bacterial cultures (in liquid or on solid media).
  • the biological sample may be treated to physically disrupt cell structure and release intracellular nucleic acids into a solution that may contain other components (e.g., enzymes, buffers, salts, detergents and the like).
  • other components e.g., enzymes, buffers, salts, detergents and the like.
  • nucleic acid is meant a multimeric compound comprising nucleosides or nucleoside analogs that have nitrogenous heterocyclic bases, or base analogs, where the nucleosides are covalently linked via a backbone structure to form a polynucleotide.
  • Nucleic acid includes conventional ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), and analogs thereof.
  • a nucleic acid backbone may comprise a variety of known linkages, including, for example, one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages or combinations thereof.
  • Sugar moieties of the nucleic acid may be ribose or deoxyribose, or similar compounds containing substitutions, e.g., 2' methoxy substitutions and/or 2' halide substitutions.
  • Nitrogenous bases may be conventional bases (A, G, C, T, U), known analogs thereof (e.g., inosine (I) and others, such as described in The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992), or known derivatives of purine or pyrimidine bases (PCT No. WO 93/13121) and "abasic" residues in which the backbone includes no nitrogenous base for one or more residues (U.S. Pat.
  • a nucleic acid may comprise only conventional sugars, bases and linkages, as found in RNA and DNA, or may include both conventional components and substitutions (e.g., conventional bases linked via a methoxy backbone, or a nucleic acid containing a mixture of conventional bases and one or more base analogs).
  • RNA and DNA may include both conventional components and substitutions (e.g., conventional bases linked via a methoxy backbone, or a nucleic acid containing a mixture of conventional bases and one or more base analogs).
  • oligonucleotide or "oligomer” is meant a nucleic acid having generally less than 1 ,000 residues, including polymers in a size range having a lower limit of about 2 to 5 nucleotide residues and an upper limit of about 500 to 900 nucleotide residues.
  • Preferred oligomers are in a size range having a lower limit of about 5 to about 15 residues and an upper limit of about 50 to 600 residues; more preferably, in a range having a lower limit of about 10 residues and an upper limit of about 100 residues.
  • Oligomers may be purified from naturally occurring sources, but preferably are synthesized using well-known methods.
  • amplification oligonucleotide or “amplification oligomer” is meant an oligonucleotide that hybridizes to a target nucleic acid, or its complement, and participates in an in vitro nucleic acid amplification reaction.
  • an amplification oligonucleotide contains at least about 10 contiguous bases, and more preferably at least about 12 contiguous bases, that are complementary to a region of the target nucleic acid sequence (or its complement).
  • the contiguous bases preferably are complementary to at least 80%, more preferably at least 90%, of the target sequence site to which the amplification oligonucleotide binds.
  • An amplification oligonucleotide is preferably about 10 to about 60 bases long and may include modified nucleotides or base analogs, or modified backbone linkages.
  • Amplification oligonucleotides and oligomers may be referred to as "primers” or “promoter primers.”
  • a “primer” refers generally to an oligonucleotide that hybridizes to a template nucleic acid and has a 3' end that is extended in a polymerization reaction, usually an enzyme-mediated reaction.
  • the 5' region of the primer may be non-complementary to the target nucleic acid and include additional bases, such as a promoter sequence (hence referred to as a "promoter primer”).
  • promoter primer any oligomer that can function as a primer can be modified to include a 5' promoter sequence, and thus could function as a promoter primer.
  • any promoter primer can serve as a primer independent of its promoter functions.
  • amplification is meant any known in vitro procedure for obtaining multiple copies of a target nucleic acid sequence, its complement or fragments thereof that relies on a polymerase-mediated extension of an amplification oligonucleotide or primer.
  • In vitro nucleic acid amplification refers to production of amplified sequences that may contain less than the complete target region sequence or its complement.
  • Such amplification methods include, for example, transcription-mediated amplification (TMA), replicase-mediated amplification, polymerase chain reaction (PCR) amplification and strand-displacement amplification (SDA).
  • Replicase- mediated amplification uses self-replicating RNA molecules, and a replicase such as QB-replicase specific for the self-replicating RNA (U.S. Pat. No. 4,786,600; PCT No. WO 90/14439).
  • PCR amplification uses DNA polymerase, primers and a series of thermal cycling reactions to synthesize multiple copies of the two complementary strands of DNA or cDNA (U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Methods in Enzymology, 1987, Vol. 155: 335-350).
  • SDA uses a primer that contains a recognition site for a restriction endonuclease such that the endonuclease nicks one strand of a hemimodified DNA duplex that includes the target sequence, followed by amplification in a series of primer extension and strand displacement steps (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and U.S. Pat. No. 5,422,252).
  • transcription-mediated amplification or “transcription-associated amplification” is meant any type of in vitro nucleic acid amplification that uses an RNA polymerase to produce multiple RNA transcripts from a nucleic acid template.
  • RNA polymerase activity generally employ an RNA polymerase activity, a DNA polymerase activity, deoxyribonucleoside triphosphates, ribonucleoside triphosphates, and a promoter primer and a second non- promoter primer, and may optionally include one or more additional oligonucleotides (sometimes referred to as "helpers").
  • helpers additional oligonucleotides
  • TMA transcription- mediated amplification
  • probe is meant a nucleic acid oligomer that hybridizes specifically to a target sequence in a nucleic acid or its complement, preferably in an amplified nucleic acid, under conditions that promote hybridization, thereby allowing detection of the nucleic acid. Detection may either be direct (i.e., resulting from a probe hybridizing directly to the target sequence or amplified nucleic acid) or indirect (i.e., resulting from a probe hybridizing to an intermediate molecular structure that links the probe to the target sequence or amplified nucleic acid).
  • a probe's "target” generally refers to a sequence within (i.e., a subset of) the amplified nucleic acid sequence, that hybridizes specifically to at least a portion of a probe oligomer using hydrogen bonding (i.e., base pairing).
  • “Sufficiently complementary” sequences allow stable hybridization of a probe oligomer to a target sequence in selected hybridization conditions, even if the two sequences are not 100% complementary.
  • a probe may be labeled or unlabeled, depending on the detection method used.
  • sufficiently complementary is meant a contiguous nucleic acid base sequence that hybridizes to another base sequence by hydrogen bonding between a series of complementary bases.
  • Complementary sequences may be complementary at each position using standard base pairing (e.g., G:C, A:T or A:U pairing) or may contain one or more residues that are not complementary using standard hydrogen bonding (including abasic residues), but in which the complementary sequence specifically hybridizes with another base sequence in appropriate hybridization conditions.
  • Contiguous bases are preferably at least about 80%, more preferably at least about 90% complementary to a sequence to which the oligomer hybridizes.
  • Sample components include nucleic acids in a generally aqueous solution that may include other materials (e.g., proteins, carbohydrates, lipids).
  • a separating or purifying step for nucleic acid removes at least about 70%, more preferably at least about 90% and, even more preferably, at least about 95% of the other sample components.
  • Purifying a target nucleic acid may be referred to as "target capture” (see PCT No. WO 98/50583).
  • capture oligonucleotide or “capture oligomer” or “capture probe” is meant at least one nucleic acid oligomer that provides means for specifically joining a target sequence and an immobilized oligomer by using base pair hybridization.
  • immobilized probe or “immobilized nucleic acid” or “immobilized oligomer” is meant a nucleic acid that joins, directly or indirectly, a capture oligomer to a solid support to facilitate separation of bound target sequence from unbound material in a sample.
  • label is meant a molecular moiety or compound that can be detected or lead to a detectable response.
  • a label is joined, directly or indirectly, to a nucleic acid probe or to the nucleic acid to be detected (e.g., to the amplified nucleic acid).
  • Direct labeling can occur through bonds or interactions that link the label to the probe (e.g., covalent bonds or non-covalent interactions).
  • Indirect labeling can occur through use of a bridging moiety or "linker” (e.g., additional oligonucleotide) which is directly or indirectly labeled.
  • Labels include any known detectable moiety (e.g., radionuclide, ligand, such as biotin or avidin, enzyme or enzyme substrate, reactive group, chromophore, such as a dye or colored particle, luminescent compound such as a bioluminescent, phosphorescent or chemiluminescent compound, or fluorescent compound).
  • the label on a labeled probe is detectable in a homogeneous assay system (i.e., in a mixture, bound labeled probe exhibits a detectable signal compared to unbound labeled probe; see U.S. Pat. Nos. 5,283,174 and 5,639,604).
  • Preferred labels for use in a homogenous assay are chemiluminescent compounds, more preferably acridinium ester ("AE") compounds (U.S. Pat. Nos. 5,656,207, 5,658,737 and 5,639,604).
  • AE acridinium ester
  • Methods of attaching labels to nucleic acids and detecting labels are well known in the art (e.g., see Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Chapter 10; U.S. Pat. Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174 and 4,581 ,333; and EP Pat. App. No. 0 747706).
  • a "homogeneous detectable label” refers to a label whose presence can be detected based on whether the label is on a probe hybridized to a target sequence. That is, a homogeneous detectable label can be detected without physically removing hybridized from unhybridized forms of the labeled probe.
  • Known homogeneous detectable labels and methods of detecting them are described in detail in U.S. Pat. Nos. 5,283,174, 5,656,207 and 5,658,737.
  • compositions or methods of the present invention include additional component(s), composition(s) or method step(s) that do not materially change the basic and novel characteristics of the present invention. Such characteristics include the ability to produce relatively long amplified Mycobacterium sequences that allow specific detection of MAC species sequences. Components, compositions, or method steps that have a material effect on the basic characteristics of the present invention would fall outside of this term. Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the relevant art. General definitions of many such terms are found in, for example Dictionary of Microbiology and Molecular Biology, 2nd ed.
  • the present invention includes compositions, specifically nucleic acid amplification oligomers, individually or in combinations, that are used in in vitro nucleic acid amplification methods used to detect MAC species.
  • the present invention also includes methods using such amplification oligomers in in vitro nucleic acid amplification to detect MAC species.
  • additional DNA sequences may be used to capture MAC target sequences from a biological sample before amplification of the MAC sequence.
  • a variety of methods are known in the art for specifically detecting amplified nucleic acid.
  • a labeled probe is preferably used to detect the amplified MAC nucleic acid sequences. More preferably, the labeled probe detects the amplified MAC nucleic acid in a homogeneous detection assay.
  • Primer sequences of the present invention are used to amplify relatively long sequences contained within 16S rRNA sequences of Mycobacterium.
  • primers were designed by comparing known 16S rRNA sequences from M. tuberculosis, M. avium and M. intracellulare and selecting regions in which the sequences were relatively conserved and sufficiently spaced apart to allow amplification of at least 200 residues of rRNA sequence. That is, the sequences were aligned by matching regions of the same or similar sequences and the sequences were compared using well known molecular biology techniques. Although sequence comparisons may be facilitated by using computerized algorithms, those skilled in the art can readily perform such comparisons manually.
  • oligomers When the relatively conserved regions of the compared sequences were selected, specific oligomers were designed containing a subset of the conserved sequence having a GC content of about 40% to 60%, a T m greater than 60°C and relatively little or no predicted secondary structure (e.g., hairpin structures), all determined by using standard methods. Designed oligomers having sequences of SEQ ID NO:1 to SEQ ID NO:3 and SEQ ID NO:7 to SEQ ID NO:9 were synthesized. Amplifying the MAC target region using at least two primers can be accomplished using a variety of known nucleic acid amplification reactions, but preferred embodiments use an isothermal transcription-mediated amplification (TMA) reaction (U.S. Pat. Nos.
  • TMA isothermal transcription-mediated amplification
  • TMA uses a promoter-primer that contains a 5' promoter sequence, a second primer, a reverse transcriptase, an RNA polymerase, substrates for nucleic acid polymerization (dNTPs and rNTPs) and appropriate salts and buffers in solution to produce multiple RNA transcripts from a nucleic acid template.
  • the promoter-primer hybridizes specifically to the target RNA and reverse transcriptase creates a first strand cDNA by extension from the 3' end of the promoter-primer.
  • the cDNA hybridizes with the second primer. Hybridization may be facilitated by denaturing the RNA-DNA duplex or by using RNase H activity associated with the reverse transcriptase to remove the RNA in the RNA-DNA duplex.
  • the second primer binds to the cDNA distal to the first primer and a new strand of DNA is synthesized from the 3' end of the second primer using reverse transcriptase, producing a double-stranded DNA with a functional promoter sequence at one end.
  • RNA polymerase binds to the double-stranded promoter sequence and transcription produces multiple transcripts, i.e., amplified products of the target sequence or "amplicons.” Amplicons then are further used in the TMA process, serving as a template for a new cycle of replication, thus generating large amounts of single-stranded amplified nucleic acid (i.e., about 100 to 3,000 copies of RNA transcripts synthesized from a single template).
  • Primer sequences (SEQ ID NO:1 to SEQ ID NO:9) bind specifically to a MAC target sequence or a complement of a MAC target sequence, although primer sequences may contain sequences that do not bind to the target sequence or its complement.
  • T7 promoter primers (SEQ ID NO:1 to SEQ ID NO:3) include a 5' T7 promoter sequence (shown separately in SEQ ID NO:10) attached to a 3' sequence that binds to the target or its complement.
  • a target-specific primer sequence with or without an attached promoter sequence, may be useful as a primer in a variety of in vitro amplification conditions.
  • the assays of the present invention include the steps of providing a biological sample containing MAC target rRNA or DNA encoding 16S rRNA, optionally using target capture to partially purify the target, in vitro nucleic acid amplification and detection of the amplified nucleic acid products.
  • the amplification mixture includes MAC target rRNA, at least one promoter primer that hybridizes to the target sequence, at least one second primer that hybridizes specifically to a first strand cDNA made from the target using the T7 promoter primer, and substrates and cofactors for enzymatic polymerization by using reverse transcriptase and T7 RNA polymerase.
  • the amplified nucleic acid products may be detected using any of a variety of known methods, including, for example, gel analysis or hybridizing the amplified products, or portions thereof, to at least one complementary probe sequence.
  • the probe may be an oligonucleotide that contains a reverse complementary sequence of a primer sequence (SEQ ID N0:11 to SEQ ID N0:16).
  • SEQ ID N0:11 to SEQ ID N0:16 a reverse complementary sequence of a primer sequence
  • Those skilled in the art can readily determine other probe sequences that hybridize to amplified MAC sequences produced using the primers disclosed herein (i.e., any sequence that hybridizes specifically to a portion of the amplified target produced by using any two functionally compatible amplification oligonucleotides of the present invention).
  • the probe may be labeled or the amplification product may be labeled.
  • a labeled probe may be hybridized to the amplified nucleic acid and detected in a homogeneous system (U.S. Pat. Nos. 5,185,439, 5,283,174, 5,585,481 and 5,639,604).
  • an immobilized probe may be used to capture and labeled amplified nucleic acids that are then detected in the resulting labeled nucleic acid:immobilized probe complex.
  • Target capture is optionally included in the method to increase the concentration or purity of the MAC target nucleic acid before in vitro amplification.
  • target capture involves a relatively simple method of hybridizing and isolating the target nucleic acid, as described in detail in PCT No. WO 98/50583. Briefly, an oligonucleotide attached to a solid support is mixed with the target nucleic acid under appropriate hybridization conditions to allow the target nucleic acid to be releasably attached to the solid support.
  • Target capture may result from direct hybridization between the MAC nucleic acid and the immobilized oligonucleotide on the solid support, or may be indirectly via one or more oligonucleotides forming a hybridization complex that links the MAC nucleic acid to the immobilized oligonucleotide.
  • a preferred solid support is a particle that can be readily separated from the solution (e.g., a paramagnetic particle that can be isolated from the mixture by applying a magnetic field to the vessel). The MAC target nucleic acid linked to the solid support is washed and then amplified upon exposure to the appropriate primers, substrates and enzymes in an in vitro amplification reaction.
  • a typical amplification assay that is an embodiment of the present invention includes the following steps and conditions.
  • a sample contains either a known amount of purified rRNA isolated from M. avium in a buffer solution or contains bacteria (e.g., 0.5 ml of sputum sediment or bacterial culture).
  • bacteria e.g., 0.5 ml of sputum sediment or bacterial culture.
  • the assay proceeds directly to in vitro nucleic acid amplification because no cell lysis is needed.
  • bacteria-containing samples the sample is mixed with a lysis buffer (e.g., 10 mM HEPES, 0.25-0.5 % (w/v) lithium lauryl sulfate, pH 8) in a tube and intracellular nucleic acid is released using standard methods (e.g., sonication).
  • a lysis buffer e.g. 10 mM HEPES, 0.25-0.5 % (w/v) lithium lauryl sulfate, pH 8
  • a 50 ⁇ l sample of sputum sediment was mixed with 200 ⁇ l of the lysis buffer and the sample was incubated at room temperature for 15 min in a sonication water bath, optionally followed by heat killing of remaining organisms by incubating at 95°C for 15 min.
  • sample preparation methods are well known (U.S. Pat. Nos. 5,364,763, 5,374,522 and 5,837,452).
  • target capture is optionally included to partially purify MAC target nucleic acid from other sample components in the mixture
  • the procedure is substantially as described in PCT No. WO 98/50583. Briefly, 250 ⁇ l of the bacterial lysate is mixed with an equal volume of buffer containing a target capture oligomer (usually 5 pmols) that is complementary to part of the 16S rRNA sequence to be amplified, and 50 ⁇ g of paramagnetic particles (0.7-1.05 ⁇ particles, Seradyn, Indianapolis, IN) to which are attached immobilized probe that is complementary to at least part of the target capture oligomer (e.g., poly-dT ⁇ . 24 ).
  • a target capture oligomer usually 5 pmols
  • paramagnetic particles 0.7-1.05 ⁇ particles, Seradyn, Indianapolis, IN
  • the target capture mixture is heated (e.g., 60-70 °C for 15-20 min) and then cooled to room temperature to allow hybridization, after which a magnetic field is applied (5 min) to attract magnetic particles with the attached complex containing the MAC target RNA to a location on the reaction container (U.S. Pat. No. 4,895,650).
  • the particles are washed twice with a washing buffer (e.g., 1 ml of 10 mM HEPES, 6.5 mM NaOH, 1 mM EDTA, 150 mM NaCI, 0.1% (w/v) sodium lauryl sulfate) and again separated.
  • Particles with attached target can be used directly in a nucleic acid amplification reaction.
  • amplification reagent solution 40 mM Tris-HCI, pH 7.5, 17.5 mM KCI, 20 mM MgCb, 5% polyvinylpyrrolidone, 1 mM each dNTP, 4 mM each rNTP
  • primer oligomers at least one promoter primer and a second primer, at 2.5 to 30 pmols of each
  • the amplification reagent solution substituted 74 mM Tris-HCI for 40 mM Tris-HCI, 6.15 mM MgCI 2 for 20 mM MgCI 2 , 23 mM K-acetate for 20 mM KCI, 0.62 mM dNTP for 1 mM dNTP and added 7.7% (v/v) DMSO. The mixture was incubated at 90-100°C for 15 min, then at 42°C for 5 min.
  • enzyme reagent a solution of 250 U of MMLV reverse transcriptase and 500 U of T7 RNA polymerase per reaction, in 50 mM HEPES, 1 mM EDTA, 10% (v/v) TritonTM X-100 or TweenTM-40, 120 mM KCI, and 20% (v/v) glycerol.
  • the amplification mixture was shaken gently and incubated at 42°C for 1-2 hr.
  • Negative controls consisted of all of the same reagents but used an equal volume of water or buffer without MAC nucleic acid in place of the MAC target.
  • Amplified sequences were detected generally using an acridinium ester (AE)-labeled probe (usually 5.5 pmol per reaction) which was detected by chemiluminescence in a suitable luminometer (e.g., LEADERTM luminometer, Gen-Probe Incorporated, San Diego, CA) and expressed in relative light units (RLU) substantially as described previously (U.S. Pat. No. 5,658,737 at column 25, lines 27-46; Nelson et al., 1996, Biochem. 35:8429-8438 at 8432). Generally, the average (mean) of detected RLU for replicate assays are reported.
  • the probes were SEQ ID NO:17 and helper probe SEQ ID NO:18. The following non-limiting examples demonstrate aspects of preferred embodiments of the present invention.
  • Example 1 In Vitro Amplification of M. avium rRNA Using Different Primers Using the amplification and labeled probe detection methods described above, the efficiencies of transcription-mediated amplification were tested using different combinations and concentrations of promoter primers and second primers.
  • the promoter primer and second primer were present in the reaction at 7.5, 15 or 30 pmols each per reaction; and the negative control for each set of conditions contained no target RNA.
  • the primers used were a T7 promoter primer of SEQ ID NO:1 (GAAATTAATACGACTCACTATAGGGAGACCACA CCCGTAGGAGTCTGGGCCGTATCTCA) and a second primer of SEQ ID NO:7 (GCAAGTCGAACGGAAAGGCCTCTTCGGAGGTA).
  • the target sequences were purified M. avium 16S rRNA present in the amplification reaction at 400 or 2000 copies per reaction (1 fg or 5 fg, respectively). For each set of conditions, three replicate assays were performed.
  • Amplification for 2 hr at 42°C was assessed based on the relative light units (RLU) detected after hybridization of the amplification products with an AE-labeled probe (SEQ ID NO: 17) with an unlabeled helper probe (SEQ ID NO:18), using previously described detection methods (U.S. Pat. Nos. 5,595,874 and 5,639,604).
  • RLU relative light units
  • Table 1 presents the results obtained with these combinations of amplification oligonucleotides. Each result represents the mean of three replicate assays for each condition.
  • Table 1 Detected RLU (mean) following amplification of M. avium rRNA Using SEQ ID NO:1 and SEQ ID N0:7
  • a second set of reactions were performed substantially the same as the first set, using the same primer and target concentrations, but using a different combination of primer sequences.
  • the promoter primer was SEQ ID NO: 1
  • Example 2 In Vitro Amplification of MAC rRNA Using Different Combinations of Primers Using the amplification and labeled probe detection methods substantially as described in Example 1 , the efficiencies of transcription-mediated amplification were tested using different combinations of primers SEQ ID NO 1 with SEQ ID NO 8, and SEQ ID NO 1 with SEQ ID NO 9
  • the T7 promoter primer was SEQ ID NO 1 and second primer was SEQ ID NO 8 (CGAACGGAAAGGCCTCTTCGGAGGTACT), each present in each reaction at 7 5 15 or 30 pmols the negative control reactions for each primer concentration contained no target RNA
  • the target sequences were purified M avium 16S rRNA at 400 or 2000 copies per reaction
  • three replicate assays were performed
  • the T7 promoter primer was SEQ ID N0 1 and second primer was SEQ ID NO 9 (GAGTGGCGAACGGGTGAGTAACACGTG), with each reaction performed as for the first combination reactions
  • triplicate assays were performed Table 3 presents the results (mean RLU) obtained with these combinations of amplification oligonucleotides
  • Table 3 Amplified MAC Nucleic Acid Detected (mean RLU)
  • the T7 promoter primer was SEQ ID NO 1 and second primer was SEQ ID NO 9, assayed as in Example 2
  • the T7 promoter primer was SEQ ID NO 2 (GAAA ⁇ AATACGACTCACTATAGGGAGACCACATGCCTCCCGTAGGAGTCTGGGCCGTATC) and second primer was SEQ ID NO 8, each present in each reaction at 7 5, 15 or 30 pmols, the negative control reactions for each primer concentration contained no target RNA
  • the target sequences were purified M avium 16S rRNA at 400 or 2000 copies per reaction
  • Table 4 presents the results (mean RLU) obtained with these combinations of amplification oligonucleotides Note that the negative control for the set of assays using 15 pmol of SEQ ID NO 2 and SEQ ID NO 8 primers reports the results of two replicate assays Table 4 Amplified MAC Nucleic Acid Detected (mean RLU)
  • the T7 promoter primer was SEQ ID NO:2 (see Example 3) and second primer was SEQ ID NO:7 (see Example 1).
  • Table 5 presents the results (mean RLU) obtained with this combination of amplification oligonucleotides.
  • Tc ⁇ ble 5 Detected RLU (mean) Following MAC Nucleic Acid Amplification Using SEQ ID N0:2 and SEQ ID NO:7
  • the efficiencies of transcription-mediated amplification were tested using the combinations of primers of SEQ ID NO:1 with SEQ ID NO:7, and SEQ ID NO:1 with SEQ ID NO:8.
  • primers were used at concentrations of 2.5, 5.0, 7.5 or 15 pmols of each primer in the combination.
  • the T7 promoter primer was SEQ ID NO:1 (see Example 1) and the second primer was either SEQ ID NO:7 (see Example 1) or SEQ ID NO:8 (see Example 2).
  • the target sequences were purified M. avium 16S rRNA at 0, 400 or 1000 copies per reaction. For each set of conditions, three replicate assays were performed. Table 7 presents the results (mean RLU) obtained with these combinations of amplification oligonucleotides.
  • the efficiencies of transcription-mediated amplification were tested using the combinations of primers of SEQ ID NO:3 with SEQ ID NO:7, SEQ ID NO:3 with SEQ ID NO:8, and SEQ ID NO:2 with SEQ ID NO:8.
  • the primers were used at concentrations of 2.5, 5.0, 7.5 or 15 pmols of each primer in the combination.
  • the T7 promoter primer was SEQ ID NO:1 (see Example 1 ) or SEQ ID NO:2 (see Example 3)
  • the second primer was either SEQ ID NO:7 (see Example 1) or SEQ ID NO:8 (see Example 2).
  • the target sequences were purified M.
  • avium 16S rRNA at 0, 100, 400 or 1000 copies per reaction. For each set of conditions, three replicate assays were performed. Table 8 presents the results (mean RLU of triplicate assays, except as indicated for "two assays") obtained with these combinations of amplification oligonucleotides.
  • This example shows that false positives do not occur at high frequency in amplification reactions as described in Examples 1 to 6.
  • Environmental contamination may result from the presence of MAC organisms or nucleic acids in water, reagents, laboratory wares (e.g., tubes, pipetting devices) used in the assay or may enter the assay from a variety of sources (e.g., water baths, sinks, aerosols) in the laboratory.
  • the false positive frequency due to amplification of environmental contaminants was initially estimated based on the number of reactions that provided positive signal (generally, greater than 100,000 RLU) when the reaction mixture contained no added MAC target RNA (i.e., the negative control reactions) described in Examples 1 to 6.
  • the determined false positive frequency was 1.4% (2 of 144 reactions).
  • compositions and methods of the present invention do not have a high frequency of false positive results due to spurious environmental contamination.
  • Example 8 In Vitro Amplification of MAC rRNA Using Polymerase Chain Reaction This example shows that combinations of the MAC primers of the present invention can be used to amplify
  • M. intracellulare and M. avium are grown in vitro using standard microbiology methods and about 10 6 bacteria/ml are lysed by suspending the bacteria in 10 mM HEPES, 0.5 % (w/v) lithium lauryl sulfate, pH 8 and then incubating the tube at room temperature for 15 min in a sonication water bath.
  • the negative control for amplification is an equal volume of sterile water used in place of the target solution.
  • PCR amplification is performed for each target with each combination of primers in 45 ⁇ I reactions, each containing 50 mM KCI, 10mM Tris (pH 8.3), 1.5 mM MgCI 2 , 0.001% (w/v) gelatin, 5% (v/v) dimethylsulfoxide, 0.33 ⁇ M of each primer in a primer combination, 200 ⁇ M of each dNTP, and 0.75 U of Taq polymerase (AmpliTaqTM; Perkin-Elmer, Norwalk, Conn.) Thermal cycling is performed using a first cycle at 94° C for 5 min, then 30 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 1 min, and a final cycle of 72°C for 10 min (in a Perkin-Elmer 9600TM thermal cycler).
  • the combinations of primers tested include: SEQ ID NO:1 with SEQ ID N0:7; SEQ ID NO:1 with SEQ ID NO:8; SEQ ID NO:1 with SEQ ID NO:9; SEQ ID NO:2 with SEQ ID NO:7; SEQ ID NO:2 with SEQ ID NO:8; SEQ ID NO:2 with SEQ ID NO:9; SEQ ID NO:3 with SEQ ID NO:7; SEQ ID NO:3 with SEQ ID NO:8; SEQ ID NO:3 with SEQ ID NO:9; SEQ ID NO:4 with SEQ ID NO:7; SEQ ID NO:4 with SEQ ID NO:8; SEQ ID NO:4 with SEQ ID NO:9; SEQ ID NO:5 with SEQ ID NO:7; SEQ ID NO:5 with SEQ ID NO:8; SEQ ID NO:5 with SEQ ID NO:9; SEQ ID NO:6 with SEQ ID NO:7; SEQ ID NO:6 with SEQ ID NO:8; and SEQ ID NO:6
  • the amplification products are analyzed by agarose gel electrophoresis, to detect the presence or absence of a band of DNA of about 250-300 nt, relative to know size markers. No band is visible on the gel for the negative control, but for each combination of primers the appropriately sized band is seen.
  • the band of amplified DNA is about 280 nt long; for the combination of SEQ ID NO:2 and SEQ ID NO:7 or SEQ ID NO:8, the band of amplified DNA is about 285-290 nt long; and for the combination of SEQ ID NO:3 and SEQ ID NO:7 or SEQ ID NO:8, the band of amplified DNA is about 315 nt long. All of the other combinations tested produce amplified DNA of about 280-320 nt long as detected on a gel relative to known size markers.
  • the amplification products are also analyzed by hybridization with a probe that is the reverse complement of at least one of the primers used in the combination, selected appropriately from the group consisting of SEQ ID NO:11 to SEQ ID NO:16 (i.e., complementary to at least one primer used in the amplification).
  • a probe that is the reverse complement of at least one of the primers used in the combination, selected appropriately from the group consisting of SEQ ID NO:11 to SEQ ID NO:16 (i.e., complementary to at least one primer used in the amplification).
  • the amplified nucleic acid hybridizes specifically with the appropriate probe.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US2000/033872 1999-12-15 2000-12-15 Methods and compositions for detection of mycobacterium avium complex species Ceased WO2001044511A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP00984359A EP1252331B1 (en) 1999-12-15 2000-12-15 Methods and compositions for detection of mycobacterium avium complex species
JP2001545588A JP2003516765A (ja) 1999-12-15 2000-12-15 鳥型結核菌(Mycobacteriumavium)複合体種の検出のための方法および組成物
CA2389533A CA2389533C (en) 1999-12-15 2000-12-15 Methods and compositions for detection of mycobacterium avium complex species
AT00984359T ATE312204T1 (de) 1999-12-15 2000-12-15 Methoden und zusammensetzungen zur detektion von spezies des mycobacterium avium-komplexes
DE60024679T DE60024679T2 (de) 1999-12-15 2000-12-15 Methoden und zusammensetzungen zur detektion von spezies des mycobacterium avium-komplexes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17120299P 1999-12-15 1999-12-15
US60/171,202 1999-12-15

Publications (2)

Publication Number Publication Date
WO2001044511A2 true WO2001044511A2 (en) 2001-06-21
WO2001044511A3 WO2001044511A3 (en) 2002-02-21

Family

ID=22622910

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/033872 Ceased WO2001044511A2 (en) 1999-12-15 2000-12-15 Methods and compositions for detection of mycobacterium avium complex species

Country Status (8)

Country Link
US (2) US6747141B2 (enExample)
EP (1) EP1252331B1 (enExample)
JP (1) JP2003516765A (enExample)
AT (1) ATE312204T1 (enExample)
CA (1) CA2389533C (enExample)
DE (1) DE60024679T2 (enExample)
ES (1) ES2253279T3 (enExample)
WO (1) WO2001044511A2 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7361746B2 (en) 1999-12-15 2008-04-22 Gen-Probe Incorporated Methods and compositions for detection of Mycobacterium avium complex species

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7101701B2 (en) * 2004-10-08 2006-09-05 The Trustees Of The University Of Pennsylvania Method to reduce contamination when culturing mycobacteria
US8758990B2 (en) * 2005-07-28 2014-06-24 Id-Fish Technology, Inc. Methods for detecting and differentiating Mycobacterium genus and Mycobacterium avium complex in a sample or culture
US8097412B2 (en) * 2008-07-12 2012-01-17 Biodiagnostics, Inc. DNA-based test for detection of annual and intermediate ryegrass
KR101158647B1 (ko) * 2010-05-27 2012-06-26 울산대학교 산학협력단 이중 실시간 중합효소연쇄반응법과 융해곡선분석을 이용하는 결핵균과 항산성비결핵균의 검출 방법
CN107805666A (zh) * 2016-09-07 2018-03-16 江苏奇天基因生物科技有限公司 一种利用等温核酸扩增技术检测鸟胞内分枝杆菌复合体的方法

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IE81145B1 (en) * 1989-04-20 2000-05-03 Thomas Gerard Barry Generation of specific probes for target nucleotide sequences
US5766849A (en) 1989-07-11 1998-06-16 Gen-Probe Incorporated Methods of amplifying nucleic acids using promoter-containing primer sequence
JPH0361487A (ja) 1989-07-31 1991-03-18 Nippon Flour Mills Co Ltd 豚流行性肺炎マイコプラズマの検出方法
JP3016395B2 (ja) 1990-04-24 2000-03-06 寶酒造株式会社 マイコプラズマの検出方法
DE69230305T2 (de) 1991-08-15 2000-07-20 F. Hoffmann-La Roche Ag, Basel Primerpaar zum Nachweis von Mycobacterium
FR2683227B1 (fr) * 1991-10-31 1994-03-04 Pasteur Institut Sequences nucleotidiques hybridant avec les souches bacteriennes du complexe mycobacterium avium-intracellulare, leur utilisation comme amorces oligonucleotidiques et sondes nucleiques.
CA2134357C (en) 1992-04-28 2009-01-06 Philip W. Hammond Nucleic acid probes to mycobacterium tuberculosis
US5851763A (en) 1992-09-17 1998-12-22 Institut Pasteur Rapid detection of antibiotic resistance in mycobacterium tuberculosis
CA2135073C (en) 1992-05-06 2002-11-19 Daniel L. Kacian Nucleic acid sequence amplification method, composition and kit
WO1994016108A1 (en) * 1993-01-15 1994-07-21 The Public Health Research Institute Of The City Of New York, Inc. Sensitive nucleic acid sandwich hybridization assays and kits
US6136529A (en) 1993-09-03 2000-10-24 Gen-Probe Incorporated Nucleic acid probes to Mycobacterium avium complex
JPH07155200A (ja) 1993-12-10 1995-06-20 Toyobo Co Ltd 抗酸菌属細菌の検出及び菌種同定用オリゴヌクレオチド
US5712095A (en) 1994-06-16 1998-01-27 Becton Dickinson And Company Rapid and sensitive detection of antibiotic-resistant mycobacteria using oligonucleotide probes specific for ribosomal RNA precursors
FR2733755B1 (fr) * 1995-05-03 1997-07-11 Bio Merieux Fragment nucleotidique de l'arn ribosomique 16s de corynebacteries, sondes et amorces derivees, reactif et procede de detection
US5925518A (en) 1995-05-19 1999-07-20 Akzo Nobel N.V. Nucleic acid primers for amplification of a mycobacteria RNA template
GB9526218D0 (en) 1995-12-21 1996-02-21 Gene Shears Pty Ltd DNA Sequences
US5667994A (en) * 1996-02-28 1997-09-16 Becton, Dickinson And Company Amplification and detection of mycobacterium avium complex species
EP0818465A1 (en) 1996-07-12 1998-01-14 Institute of Molecular Biotechnology (IMB) Department of Genome Analysis Genomic sequence of Rhizobium sp. NGR234 symbiotic plasmid
AU4549997A (en) 1996-10-04 1998-05-05 Dako A/S Novel probes for the detection of mycobacteria
EP0866071B1 (en) 1997-03-20 2004-10-20 F. Hoffmann-La Roche Ag Modified primers
DK0975807T3 (da) 1997-05-02 2007-01-29 Gen Probe Inc To-trins hybridisering og indfangning af et polynukleotid
US6465638B2 (en) 1997-06-25 2002-10-15 Ortho-Clinical Diagnostics, Inc. Multiplexed PCR assay for detecting disseminated Mycobacterium avium complex infection
US5985569A (en) * 1997-09-26 1999-11-16 Becton, Dickinson And Company Primers for amplification of a genus specific sequence of the mycobacterium 16S rRNA gene
EP1044282A1 (en) 1997-12-30 2000-10-18 Universidade Federal De Minas Gerais A method for the diagnosis, identification and characterization of m. tuberculosis and other mycobacteria by shift mobility assay
US6747141B2 (en) 1999-12-15 2004-06-08 Gen-Probe Incorporated Methods and compositions for detection of mycobacterium avium complex species
CA2389523C (en) 1999-12-17 2012-03-06 Gen-Probe Incorporated Nucleic acid amplification and detection of mycobacterium xenopi 16s ribosomal rna (rrna) or dna encoding 16s rrna in a biological sample
WO2001066797A2 (en) 2000-03-03 2001-09-13 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Multiplex hybridization system for identification of pathogenic mycobacterium and method of use

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7361746B2 (en) 1999-12-15 2008-04-22 Gen-Probe Incorporated Methods and compositions for detection of Mycobacterium avium complex species

Also Published As

Publication number Publication date
EP1252331A2 (en) 2002-10-30
JP2003516765A (ja) 2003-05-20
US6747141B2 (en) 2004-06-08
WO2001044511A3 (en) 2002-02-21
US7361746B2 (en) 2008-04-22
ES2253279T3 (es) 2006-06-01
US20020012918A1 (en) 2002-01-31
DE60024679D1 (de) 2006-01-12
CA2389533A1 (en) 2001-06-21
DE60024679T2 (de) 2006-08-24
CA2389533C (en) 2010-10-05
EP1252331B1 (en) 2005-12-07
ATE312204T1 (de) 2005-12-15
US20040224348A1 (en) 2004-11-11

Similar Documents

Publication Publication Date Title
CA2673017C (en) Methods and compositions for nucleic acid amplification
EP2288726A2 (en) Inactivatable target capture oligomers for use in the selective hybridization and capture of target nucleic acid sequences
US7879581B2 (en) Nucleic acid amplification and detection of mycobacterium species
AU781192B2 (en) Nucleic acid amplification and detection of mycobacterium species
US7361746B2 (en) Methods and compositions for detection of Mycobacterium avium complex species
WO2009105592A2 (en) Compositions and methods for detection of propionibacterium acnes nucleic acid
WO2005028679A2 (en) Method and kit for identifying vancomycin-resistant enterococcus
US7326533B2 (en) Detection rpoB sequences of Mycobacterium tuberculosis
AU2001294599B2 (en) Detection of rpoB sequences of Mycobacterium tuberculosis
AU2001294599A1 (en) Detection of rpoB sequences of Mycobacterium tuberculosis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 2389533

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2000984359

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 545588

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 2000984359

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2000984359

Country of ref document: EP