WO2001042503A2 - Appareil et methodes de criblage de medicaments - Google Patents

Appareil et methodes de criblage de medicaments Download PDF

Info

Publication number
WO2001042503A2
WO2001042503A2 PCT/US2000/032387 US0032387W WO0142503A2 WO 2001042503 A2 WO2001042503 A2 WO 2001042503A2 US 0032387 W US0032387 W US 0032387W WO 0142503 A2 WO0142503 A2 WO 0142503A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sample
drug candidate
high integrity
drug
Prior art date
Application number
PCT/US2000/032387
Other languages
English (en)
Other versions
WO2001042503A3 (fr
Inventor
Anthony P. Shuber
Original Assignee
Exact Sciences Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Exact Sciences Corporation filed Critical Exact Sciences Corporation
Priority to AU18044/01A priority Critical patent/AU1804401A/en
Priority to JP2001544374A priority patent/JP2003516162A/ja
Priority to EP00980832A priority patent/EP1238106A2/fr
Priority to CA002393864A priority patent/CA2393864A1/fr
Publication of WO2001042503A2 publication Critical patent/WO2001042503A2/fr
Publication of WO2001042503A3 publication Critical patent/WO2001042503A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • genomic instability a disruption in genomic stability, such as a mutation, has been linked to the onset or progression of certain diseases. Accordingly, various aspects of genomic instability have been proposed as reliable markers for disease. For example, mutations in the BRCA genes have been proposed as markers for breast cancer, and mutations in the p53 cell cycle regulator gene have been associated with numerous cancers, especially colorectal cancer. It has been suggested that specific mutations might be a basis for molecular screening assays for the early stages of certain types of cancer. See, e.g., Sidransky, et al., Science, 256: 102-105 (1992).
  • genomic disease markers has been especially intense in the area of cancer detection.
  • Cancer is characterized by uncontrolled cell growth which can be associated with one or more genetic mutations. Such mutations can cause the affected cells to avoid cell death.
  • a mutation in a tumor suppressor gene can cause cells to avoid apoptosis - a type of cell death thought to be under direct genetic control.
  • apoptosis cells lose their membranes, the cytoplasm condenses, and nuclear chromatin is split into oligonucleotide fragments of characteristically short length.
  • those characteristic DNA cleavage patterns have been proposed as an assay for apoptosis.
  • the present invention provides screening methods for drug selection and for determining drug activity.
  • Methods of the invention take advantage of the recognition that nucleic acid integrity observed in a tissue or a body fluid sample is a marker for disease, and that preservation of nucleic acid integrity in cellular debris increases with disease severity.
  • nucleic acid integrity also is useful as a marker for use in drug selection and in determining drug efficacy against a wide range of diseases.
  • apoptosis or programmed cell death causes general cellular disruption, including disruption of the cell membrane and degradation of nucleic acids. This process results in small (about 140 bp to about 200 bp) nucleic acid fragments.
  • Diseased cells such as cancer or pre-cancer cells, lose the ability to undergo apoptosis, and their nucleic acids are not degraded through apoptosis. Nonetheless, a percentage of those cells are sloughed or discarded (e.g., for lack of nutrients, mechanical shearing, etc. ), resulting in a population of cells and cellular debris that contain high integrity nucleic acids as well as high integrity proteins, membranes, and other cellular components.
  • the invention provides methods for screening drug candidates for activity and efficacy that include determining whether a drug candidate produces a decrease in an amount of a high integrity component observed in a patient sample.
  • Preferred high integrity components are nucleic acids or a proteins.
  • Preferred methods of the invention are conducted by obtaining tissue or body fluid sample from a patient having a disease, determining an amount of high integrity nucleic acid present in the sample, treating a patient with a drug candidate, and obtaining a second tissue or body fluid sample to determine whether the amount of high integrity nucleic acid has been reduced. The same method can be carried out on an animal model of a disease.
  • Methods of the invention also are performed in vitro or ex vivo.
  • the efficacy of a pharmaceutical preparation against disease is measured by its ability to reduce the presence of high integrity nucleic acid directly in a tissue or body fluid sample obtained from a patient known or suspected to have a target disease or an animal model of a disease.
  • Methods of the invention also are useful to monitor a patient's response to treatment. For example, the efficacy of a treatment is high if that treatment (e.g., administration of a drug candidate or cocktail of drug candidates) produces a decrease in high integrity cellular components observed in post-treatment samples obtained from the patient.
  • methods of the invention are useful to screen the efficacy of any treatment means (e.g., drug(s), radiation, diet, surgery, and/or exercise) and are not limited to screening for pharmaceutical activity and efficacy.
  • Methods of the invention are also useful as in vitro or ex vivo drug candidate screens. In preferred methods, a tissue or body fluid is obtained from a patient or an animal model having a known disease.
  • the sample is screened against one or more candidate drugs by applying the candidate to the sample, or a portion thereof, and observing the effect on nucleic acid integrity in the sample as compared to a pretreatment standard for the disease in question.
  • the standard may be a pretreatment measurement of nucleic acid integrity in the sample or an empirically known standard (e.g., healthy patients).
  • Screening assays of the invention may be multiplexed in order to allow screening of a plurality of intra-patient or inter-patient samples simultaneously.
  • the levels of high integrity nucleic acids are indicative of the disease status of the tissue or body fluid being measured.
  • a drug candidate that is capable of reducing nucleic acid integrity in a sample is a potential medicament effective in treating the disease.
  • the sample is a disease state cell culture.
  • Preferred patient samples are preferably prepared from specimens likely to contain sloughed cellular debris.
  • specimens include, but are not limited to, stool, blood serum or plasma, sputum, pus, and colostrum. Additionally, some specimens do not contain an abundance of intact (non-exfoliated) cells, such as stool, sputum, urine, bile, pancreatic juice, and blood serum or plasma, all of which contain shed cells or cellular debris.
  • Other samples include cerebrospinal fluid, seminal fluid, breast nipple aspirate, and biopsy tissue, but any tissue or body fluid can be used.
  • high integrity nucleic acid refers to long segments of nucleic acid relative to the length of nucleic acid segments in a normal sample. Those segments typically are greater than about 170 bp, and preferably greater than about 200 bp, in order to exceed the typical length of a fragment resulting from apoptotic degradation.
  • disease state sample refers to any sample, whether taken directly from a patient known to have a particular disease, suspected to have a particular disease, or being screened for a particular disease; provided as an animal model or taken from an animal model of a disease; grown as a cell culture that has characteristics of a particular disease or that is diagnostic for or is used as a diagnostic for a particular disease; or harvested from such a cell culture.
  • drug candidate means a composition of matter that is being investigated for a pharmacological or other activity or that is known to have a pharmacological or other activity, but is being tested to see if it has any type of activity in a particular subject, such as a patient.
  • Efficacy of a drug candidate is one example of a pharmacological activity.
  • clinical outcome can be characterized as an activity of a drug candidate.
  • Nucleic acid is measured by any known means.
  • nucleic acid integrity is measured by the ability to amplify long nucleic acids in the sample.
  • Any nucleic acid locus can be used as a template in an amplification reaction conducted in a tissue sample, fluid sample, or cell culture sample. It is not required that the target genomic loci be associated with any specific disease, because an increase or decrease in amplifiable nucleic acid about any locus is itself diagnostic.
  • amplification reaction a polymerase chain reaction
  • RNA amplification reaction
  • Primers are designed to amplify the locus or loci chosen for analysis.
  • a standard amount of amplification product is determined by amplification of a locus, or a portion thereof, being screened in an untreated disease state sample or, alternatively, in a known normal sample (e.g., an intact, wild-type nucleic acid). Also, in certain embodiments, a standard amount is determined by reference to the art.
  • Each amplification reaction in the series is designed to amplify a fragment of a different length. In certain embodiments, the target fragment lengths are about 200 bp, about 400 bp, about 800 bp, about 1.3 Kb, about 1.8 Kb, and about 2.4 Kb.
  • Primers for amplification are designed according to knowledge in the art in order to amplify template, if present, of the desired length at the desired locus.
  • a normal sample which has undergone or which is undergoing apoptosis, typically contains few or no fragments of significant length.
  • a series of amplification reactions targeting fragments from about 200 bp to about 2.4 Kb and longer reveals disease state samples that contain nucleic acids that have avoided apoptosis as evidenced by the amplification of large fragments.
  • the efficacy of a drug candidate being used to treat a patient can be assayed by examining the absence or presence of high integrity nucleic acid.
  • in vitro or ex vivo disease state samples exhibiting these fragments can be treated with a drug candidate to assess drug candidate activity.
  • the standard amount can be a molecular weight marker on, for example, an electrophoretic gel.
  • methods of the invention can be carried out by hybrid capture. For example, hybrid capture and subsequent analysis of the captured fragments can be used to determine the nucleic acid integrity of a sample.
  • screening of drug candidate activity in disease state samples combines detecting amounts of nucleic acid in the sample with an assay for apoptotic cell activity.
  • a positive screen is one that produces both: (1) an amount of nucleic acid that is less than the amount expected to be present in untreated disease state sample, and (2) an amount of apoptotic cell activity that is greater than that expected to be present in a disease state sample.
  • a plurality of genomic loci can be analyzed to determine an amount of amplifiable nucleic acid present at each locus. Analysis across multiple loci using methods of the invention may increase the sensitivity of the screening assay.
  • a method for screening drug candidate activity includes the steps of determining a baseline level of high integrity nucleic acid in a first sample that is obtained from a patient having a disease; treating the patient with a drug candidate; and determining whether the high integrity nucleic acid in a second sample that is obtained from the patient is reduced.
  • high integrity nucleic acid is more than about 200 bp in length.
  • the determining steps include amplifying a target nucleic acid to determine the presence of high integrity nucleic acid in the samples.
  • the target nucleic acid is amplified with one forward primer and at least two reverse primers. In other embodiments, the target nucleic acid is amplified with at least two pairs of forward and reverse primers.
  • the determining steps can include capturing the high integrity nucleic acid.
  • the high integrity nucleic acid is captured on a support-based complementary nucleic acid probe.
  • diet, exercise, and radiation are examples of additional, non-pharmacological treatments that can be assessed according to methods of the invention.
  • a positive screen is determined by the presence of a lower amount of high integrity nucleic acid in the second sample relative to an amount of high integrity nucleic acid in the first sample.
  • a positive screen indicates activity of the drug candidate.
  • a positive screen indicates induction of programmed cell death.
  • a positive screen indicates induction of apoptotic activity. Examples of samples include stool, sputum, pus, blood serum, blood plasma, urine, saliva, colostrum, bile, and pancreatic juice.
  • the drug candidate can be any composition of matter, including a nucleic acid, a peptide, and a chemical compound.
  • the drug candidate is a candidate for an anti- cancer drug.
  • activity of a drug candidate is predictive of alleviation of disease symptoms by the drug candidate.
  • a kit for screening the activity of a drug candidate includes a first primer that is complementary to a first segment of a target nucleic acid; a second primer that is complementary to a second segment of the target nucleic acid; and a third primer that is complementary to a third segment of the target nucleic.
  • the second segment is located at least about 170 base pairs from the first segment and the third segment is located at least about 170 base pairs from the first segment.
  • a method for screening drug candidate activity includes the steps of determining a baseline level of high integrity nucleic acid in a sample from a subject having a disease; treating the sample with a drug candidate; and determining whether high integrity nucleic acid in the sample is reduced.
  • the subject is an animal model of a disease.
  • a method for screening drug candidate activity includes the steps of determining a baseline level of high integrity nucleic acid in a sample from an animal model of a disease; treating the animal model with a drug candidate; and determining whether the high integrity nucleic acid in a second sample obtained from the animal model is reduced.
  • Figures 1 A and B are gel photographs of results of amplification of DNA in stool from a total of 30 patients and controls.
  • the band intensity relates to the amount of amplifiable DNA in the sample.
  • Lanes N are negative controls
  • lanes 1, 3, 11, and 18 are results from patients which are indicative of the presence off cancer or adenoma
  • lanes 2, 4, 5-10, 12-17, and 19-30 are results from patients which are indicative of the absence of cancer or adenoma.
  • the remaining lanes are markers or standards.
  • Figure 2 shows a schematic representation of the placement of the primers for amplification in a method of the present invention.
  • a single forward primer, Fi is used in conjunction with a series of reverse primers, Ri to R , chosen to amplify progressively longer portions of the target.
  • Figure 3 shows a schematic representation of the placement of the primers for amplification in a method of the present invention.
  • a series of forward and reverse primer pairs, (Fi , Ri) to (F 3 , R 3 ), are chosen to amplify portions of the target spaced at intervals along the target.
  • the invention provides methods and kits for screening drug activity.
  • Methods of the invention provide information based upon the integrity of nucleic acids in a biological sample.
  • Normal biological samples typically contain cellular debris that includes a majority of short-fragment, low integrity nucleic acids (especially DNA) which are the result of degradation by apoptosis.
  • DNA low integrity nucleic acids
  • a disease state sample for example, when a mutation has caused genomic instability, the normal cell cycle may be disrupted and apoptotic degradation of nucleic acid and other cellular components may not occur at the rate expected in a normal sample. This situation leads to the presence of high integrity nucleic acid in the disease state sample.
  • Methods of the invention utilize this realization to screen for drug activity.
  • This screen for drug activity and efficacy can be performed by analyzing samples containing nucleic acid from a patient under treatment with a drug candidate at various time points or by analyzing samples containing nucleic acid from an animal model of a disease treated with a drug candidate.
  • this screen can be performed by treating samples obtained from a patient known or suspected to have a disease, from an animal model of a disease, or from a cell culture representing a disease, in vitro or ex vivo, and analyzing the integrity of nucleic acid in such samples.
  • Drug candidate activity in such systems typically, provides a lead for rational drug design and/or indicates a likelihood of drug candidate activity in vivo and/or indicates a likelihood of alleviating symptoms of a disease in vivo.
  • kits can be developed based on methods of the invention.
  • the nucleic acid being analyzed according to methods of the invention is selected from a coding region of a gene, or a portion thereof, a noncoding nucleic acid region, or a portion thereof, a regulatory element of a gene, or a portion thereof, and/or an unidentified fragment of genomic DNA.
  • the nucleic acid being interrogated is RNA.
  • any genomic locus is amenable to screening according to the invention. The particular locus or loci chosen for analysis depends, in part, on the disease being screened, the class of drug candidate being screened, and the convenience of the investigator.
  • the locus or loci chosen for analysis be correlated with any specific disease, because any portion of the genome (even those unrelated to disease) may be used in methods of the invention.
  • disease-associated loci examples include p53, ape, MSH-2, dec, scr, c-myc, B-catnenin, mlh- 1, pms-1, pms-2, pol-delta, and bax.
  • the target fragment may optionally be an oncogene, a tumor suppressor, or any other marker associated with cancer.
  • cancer-associated markers are based on the general recognition that samples indicative of a disease state contain a greater amount of intact nucleic acids and a greater amount of long fragment nucleic acids (generally, high integrity nucleic acids). Accordingly, any convenient target nucleic acid locus may be used in the methods of the invention.
  • the amount of amplification product may be determined by any suitable or convenient means. Typically, the amount of amplification product is determined by gel electrophoresis. Labels, such as fluorescent or radioactive labels, may be used. The amounts of amplification product produced may be compared to standard amounts by any suitable or convenient means, including, but not limited to visual comparison, machine-driven optical comparison, densitometry, mass spectroscopy, hybrid capture, and other known means.
  • the amplification reaction itself can be any means for amplifying nucleic acid, including, but not limited to, PCR, RT-PCR, OLA, rolling circle, single base extension, and others known in the art.
  • the amplification product can also be measured by signal amplification techniques, such as branch chain amplification (Chiron). Methods of the invention are useful with any platform for the identification, amplification, sequencing, or other manipulation of nucleic acids. For example, methods of the invention can be applied to ligase chain reaction, strand displacement (Becton- Dickinson), and others.
  • the probability that any given set of PCR primers will amplify a DNA fragment having a length exceeding the primer distance is expressed as
  • % of Fragments Amplified (FL-PD)/(FL+PD) where FL is fragment length (in base pairs) and PD is primer distance (in base pairs). This equation assumes that sample DNA fragment lengths are uniformly distributed (i.e., there is no favored locus at which breaks occur).
  • nucleic acid sequences of different lengths in a sample are amplified, if present, in order to generate a profile of amplification products indicative of activity of the drug candidate. For example, a sample is exposed to a set of PCR primers.
  • the primers include a single forward primer, which may be a capture probe used to capture target fragments, and a plurality of downstream reverse primers which hybridize to portions of a contiguous sequence (if present) in the sample. Amplifications using these primers will result in a series of amplification products, each having a different length, if the contiguous target sequence is present in the sample. The length of the amplification products are determined by the spacings between the forward primer and each of the downstream reverse primers. An example is shown in Figure 2, which is a schematic representation showing placement of the primers for amplification.
  • amplification will result in a series of fragments the length of which is dictated by the spacing of the primers.
  • a patient, animal model, or other disease state sample treated with an active drug candidate will produce a profile of amplification products in the assay described above that differs from the profile obtained from a disease state sample of an earlier time point during treatment or an untreated disease state sample.
  • a difference that is indicative of drug candidate activity generally is predictive of activity in vivo and/or the ability to alleviate symptoms of a disease in vivo.
  • the forward primer is designed to hybridize at least about 170 bp upstream, and preferably about 200 bp, upstream of the first reverse primer, and about 2.3 Kb upstream of the last reverse primer.
  • Other reverse primers are designed to hybridize at various locations between the first and last reverse primers.
  • intervals between the forward primer and the various reverse primers can be about 200 bp (Fj-Ri), about 400 bp (F ⁇ -R 2 ), about 800 bp (Fj-R 3 ), about 1.3 Kb, (F1-R4), about 1.8 Kb (F 1 -R 5 ), and about 2.3 Kb (Fi-Rs).
  • the forward primer is at least about 170 bp upstream from a first and second reverse primer. The number and spacing of reverse primers is chosen at the convenience of the skilled artisan.
  • a hybrid capture probe is used to anchor a target sequence, preferably on a solid support (e.g., beads).
  • a plurality of probes are then placed at various distances downstream of the capture probe.
  • Those probes can be pairs of forward and reverse primers as discussed above, or they can be signal amplification probes, such as those used in Ligase Chain Reaction (LCR), and others used in the identification of sequences.
  • LCR Ligase Chain Reaction
  • the plurality of probes hybridize along the length of a target fragment if the target is present in the sample.
  • LCR Ligase Chain Reaction
  • the capture probe immobilizes a target sequence, if present in the sample.
  • Probes that hybridize to sequence downstream of the capture probe are placed into each well, such that each downstream probe is spaced a unique distance apart from the common capture probe, and each well contains only one type of downstream probe.
  • Signal is then generated by, for example, amplification, or by standard ELIS A procedure followed by amplification, or by LCR, or other methods mentioned above.
  • the presence of signal in each well indicates the presence of sequence of at least the length between the capture probe and the downstream probe.
  • each well receives multiple different downstream probes, which may be distinctly labeled, and the presence of label(s) is correlated with the length of sequence presence in the sample.
  • methods of the invention include conducting a series of amplification reactions on a contiguous nucleic acid target fragment, each amplification reaction includes one forward primer and one reverse primer, such that pairs of forward and reverse primers are spaced at intervals on a contiguous fragment suspected to be in the sample.
  • FIG 3. An example of this arrangement is shown in Figure 3.
  • the spacings between each forward and reverse primer pair are equivalent.
  • the forward primer is about 170 bp to about 200 bp from reverse primer and at least about 170 bp to about 200 bp from a second forward primer.
  • the assay described above will result in a series of same-size fragments for most if not all of the primer pairs.
  • Such an array of amplification products evidences a contiguous target sequence indicative of disease (see above).
  • a normal sample should produce little or no amplification product, but in any case will not produce the contiguous array of amplification products expected from a sample containing a relatively intact diagnostic target sequence.
  • each of the methods described above are based upon the principle that an intact nucleic acid, or a segment of an intact nucleic acid, in a sample is diagnostic.
  • variations on the methods described above are contemplated. Such variations include the placement of primers, the number of primers used, the target sequence, the method for identifying sequences, and others.
  • a forward primer may, for example, be used to amplify fragments between two reverse primers.
  • Other variations in primer pair placement are within the skill in the art, as are details of the amplification reactions to be conducted.
  • capture probes may be used in methods of the invention in order to isolate a chosen target sequence.
  • amplification reactions are conducted on a series of different genomic loci. Preferably, from about 2 to about 7 loci are used. However, the precise number of interrogated loci is determined by the individual investigator based upon the disease to be detected, based upon the class of drug candidate to be used, or based upon convenience.
  • primers are designed to amplify nucleic acid, such as DNA, at each of the chosen loci as described above.
  • a sample from a patient or animal model undergoing treatment with a drug candidate or an in vitro or ex vivo disease state sample in which at least one locus, preferably at least two loci, and most preferably at least three loci produce(s) reduced levels of detectable high integrity nucleic acid amplification product relative to a first sample taken from a patient earlier in the time course of treating the patient or relative to an untreated disease state sample, is considered a positive drug candidate screen.
  • the lengths of fragments to be amplified in this assay may be varied, but are preferably at least about 170 bp each in length. It is not necessary that the same length fragments be amplified at each of the chosen loci, but it is preferred that the same length fragments be amplified at each of the chosen loci.
  • samples being treated with a drug candidate can be followed over time. Samples are taken from a patient before treatment begins, and at time points extending over the course of treatment. These samples are analyzed for the integrity of nucleic acid contained within. By monitoring the level of high integrity nucleic acid, a patient's treatment progress can be tracked. This information can be useful, for example, as an early indication of the efficacy of a particular treatment.
  • the drug candidate can be administered once, or at intervals, during the treatment period. In one time course the drug candidate can be examined at 2 hours, 4 hours, 6 hours, and 8 hours after the drug treatment has begun. In a longer term time course study the drug candidate can be examined at 48 hours, 1 week, 2 weeks, and 4 weeks after the drug treatment has begun. In comparison to earlier time point samples, the total amount of amplified high integrity nucleic acid (or amplifiable high integrity nucleic acid) detected in later time point samples is expected to be lower if the drug candidates are active or effective in a patient.
  • the total amount of amplified high integrity nucleic acid (or amplifiable high integrity nucleic acid) detected in later time point samples is expected to be similar or slightly lower if the drug candidates are inactive or ineffective.
  • the pattern of fragments amplified from high integrity nucleic acid can be analyzed. Fewer fragments (particularly the longer fragments) are expected to be present and/or a lesser amount of some or all of the fragments are expected to be present in a later time course samples as compared to those present in earlier time course samples in a patient being treated with an active or effective drug candidate.
  • the fragments will remain the same, increase in number and/or amount (e.g., band intensity), or will slightly diminish in number and/or amount in later time course samples as compared with earlier time course sample in a patient being treated with an inactive or ineffective drug candidate.
  • These same principals can be applied to a drug screen using animal models for a particular disease state. The integrity of nucleic acid in samples taken from the animal model being treated with a drug candidate is monitored over time and activity is assessed as described above.
  • methods of the invention for screening drugs allow for one or a multitude of compounds (e.g., simultaneously) to be screened for activity.
  • a disease state sample is placed into an experimental container, such as a wells of a multi-well sample plate.
  • the sample is exposed to one or more compounds and analyzed for its content of high integrity nucleic acid.
  • the total amount of amplified high integrity nucleic acid is expected to be lower in samples treated with active drug candidates, and the total amount of amplified high integrity nucleic acid (or amplifiable high integrity nucleic acid) will be similar, increased, or slightly lower in samples treated with inactive drug candidates.
  • the pattern of fragments amplified from high integrity nucleic acid can be analyzed. Fewer fragments (particularly the longer fragments) are expected to be present and/or a lesser amount of some or all of the fragments are expected to be present in a sample treated with an active drug candidate as compared to those present in an untreated sample. The fragments will remain the same, will increase, or will slightly diminish in number or amount (e.g., band intensity) in samples treated with an inactive drug candidate.
  • a dose-response curve can be generated.
  • disease state samples such as, but without limitation, animal models and tissue cultures
  • a curve can be drawn relating drug candidate dosage to activity (as measured by the level of high integrity nucleic acid).
  • the drug activity can be assayed ex vivo.
  • tissue or fluid can be removed from a patient prior to treatment. This sample can be treated with various drug candidates that might be expected to alleviate the symptoms of a disease. Activity is assayed as described above. A drug candidate showing the most activity for the sample can be chosen as a drug candidate that is likely to alleviate symptoms of a disease in the patient from which the sample was taken. In another embodiment tissue is removed from an animal model and is treated with a drug candidate. Activity is assessed as described above and can be used to screen drug candidates.
  • Methods of the invention also can be used to screen or to "qualify" samples for further analysis (e.g., genetic, biochemical, cytological, or other analyses).
  • the sample to be qualified is examined for the presence of high integrity nucleic acid, and, if present, the high integrity nucleic acid indicates that a sample likely can be used as a sample for in vitro, ex vivo (for example, when qualifying an animal model) screening, or in vivo animal model screening.
  • disease state samples that provide the basis of drug candidate activity screening can be chosen according to this method.
  • Some of the diseases for which samples are qualified, and for which methods of the invention can detect changes in the integrity of nucleic acid include, but are not limited to, colon cancers and adenomas; lymphomas; and stomach, lung, liver, pancreas, prostate, kidney, testicular, bladder, uterus, or ovarian cancers or adenomas. Additionally, diseases such as inflammatory bowel syndrome, inflammatory bowel disease, Crohn's disease, and others, in which a genomic instability is thought to play a role, can be examined. Moreover, the profile of amplifiable DNA in a sample is correlated with proteins that have been associated with disease. For example, up regulation of the apoptosis protein, survivin, is correlated with increased amounts of amplifiable DNA, as is the Ras oncogene, as well as other oncogenes and their gene products.
  • Methods of the invention also are useful as assays for apoptosis.
  • the presence of amplified fragments of high integrity nucleic acid or large quantities of high integrity nucleic acid in a sample indicates that the sample was derived from cells that did not proceed through apoptosis.
  • the absence of such fragments or quantities indicates that cells that contributed to the sample underwent apoptosis.
  • an apoptotic activity assay of the invention either alone or in combination with other assays for genomic instability, also are useful as screens for disease.
  • programmed cell death is measured in a similar way to apoptotic activity, with the induction of programmed cell death being correlated with an increase in apoptotic activity in many systems.
  • the following example relates to screening for colon cancer in voided stool samples. Based upon the principles upon which the invention is based (see above), the same analysis can be performed on other samples, such as those mentioned above, with the same results as shown herein.
  • preferred methods of the invention comprise obtaining at least a cross-sectional or circumferential portion of a voided stool as taught in U.S. patent number 5,741,650, and co-pending, co-owned U.S. patent number 5,952,178, both of which are incorporated by reference herein. While a cross-sectional or circumferential portion of stool is desirable, methods provided herein are conducted on random samples obtained from voided stool, which include smears or scrapings. Once obtained, the stool specimen is homogenized.
  • a preferable buffer for homogenization is one that contains at least 16 mM ethylenediaminetetraacetic acid (EDTA).
  • EDTA ethylenediaminetetraacetic acid
  • a preferred buffer for stool homogenization includes phosphate buffered saline, 20- 100 mM NaCl or KC1, at least 150 mM EDTA, and optionally a detergent (such as SDS) and a proteinase (e.g., proteinase K).
  • nucleic acid is preferably isolated from the stool sample. Isolation or extraction of nucleic acid is not required in all methods of the invention, as certain detection techniques can be adequately performed in homogenized stool without isolation of nucleic acids. In a preferred embodiment, however, homogenized stool is spun to create a supernatant containing nucleic acids, proteins, lipids, and other cellular debris. The supernatant is treated with a detergent and proteinase to degrade protein, and the nucleic acid is phenol-chloroform extracted. The extracted nucleic acids are then precipitated with alcohol. Other techniques can be used to isolate nucleic acid from the sample. Such techniques include hybrid capture, and amplification directly from the homogenized stool. Nucleic acids can be purified and/or isolated to the extent required by the screening assay to be employed. Total DNA is isolated using techniques known in the art.
  • human DNA fragments obtained above can be determined by numerous means. For example, human DNA can be separated using gel electrophoresis. A 3% agarose gel is prepared using techniques known in the art. See Ausubel et al., Short Protocols in Molecular Biology, John Wiley & Sons, 1195, pgs. 2-23-2-24, incorporated by reference herein. The size of human DNA fragments is then determined by comparison to known standards. Fragments greater than about 200 bp provide a positive screen. While a diagnosis can be made on the basis of the screen alone, patients presenting a positive screen are preferably advised to seek follow-up testing to render a confirmed diagnosis.
  • a preferred means for determining human DNA fragment length uses PCR. Methods for implementing PCR are well-known. In the present invention, human DNA fragments are amplified using human-specific primers. Amplicon of greater than about 200 bp produced by PCR represents a positive screen. Other amplification reactions and modifications of PCR, such as ligase chain reaction, reverse-phase PCR, Q-PCR, and others may be used to produce detectable levels of amplicon.
  • Amplicon may be detected by coupling to a reporter (e.g., fluorescence, radioisotopes, and the like), by sequencing, by gel electrophoresis, by mass spectrometry, or by any other means known in the art, as long as the length, weight, or other characteristic of the amplicons identifies them by size.
  • a reporter e.g., fluorescence, radioisotopes, and the like
  • An experiment is conducted to determine treatment outcome over time in cancer or adenoma patients.
  • Stool samples are obtained and frozen, and DNA is isolated. The samples are screened by hybrid capturing human DNA and determining the amount of amplifiable DNA having at least 200 base pairs.
  • Each frozen stool specimen weighing from 7-33 grams, is thawed and homogenized in 500 mM Tris, 16 mM EDTA, and 10 mM NaCl, pH 9.0 at a volume to mass ratio of 3 : 1.
  • Samples are then rehomogenized in the same buffer to a final volume to mass ratio of 20:1 and spun in glass macro beads at 2356 x g. The supernatant is collected and treated with SDS and proteinase k.
  • the DNA is then phenol-chloroform extracted and precipitated with alcohol. The precipitate is suspended in 10 mM Tris and 1 mM EDTA (1 x TE), pH 7.4. Finally, the DNA is treated with RNase.
  • the BRCA2 probe is 5'CTAAGTTTGAATCCATGCTTTGCTCTTCTTGATTATT3' (SEQ ID NO 9).
  • the APC1 probe is 5'CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG3' (SEQ ID NO 10).
  • the p53 probe hybridizing to a portion of exon 5, is 5'TACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGG3' (SEQ ID NO:4).
  • the APC2 probe is
  • a 300 ⁇ l aliquot of sample is placed in 300 ⁇ l of 6 M guanidine isothiocyanate buffer with 10 ⁇ l of each capture probe, and incubated overnight at 25 C.
  • Captured DNA is isolated using 100 ⁇ l capture beads incubated for one hour at room temperature. The DNA is eluted off the beads and PCR amplified under standard PCR conditions.
  • amplification reactions are conducted using forward and reverse primers through the 5 loci for each sample.
  • Forward and reverse primers are spaced to amplify fragments of 200 bp, 400 bp, 800 bp, 1.3 Kb, 1.8 Kb, and 2.4 Kb.
  • Each of 30 PCR reactions is run for 36 cycles.
  • Amplicon is run on a 3% Seakeam gel, and stained with ethidium bromide. The results are shown in Figures 1A and IB. Each figure represents the results for 15 of the 30 patients.
  • patients with cancer or adenoma have an increased yield of amplifiable DNA. That is especially true at the 1.8 Kb level and above.
  • patients with cancer or adenoma not only produce more amplifiable DNA in their stool, but also produce larger DNA fragments than are produced in the stool of patients who do not have cancer.
  • both an increased yield of amplifiable DNA and the presence of high molecular weight DNA, especially that at 1.8 Kb and above, are indicative of patient disease status.
  • Those patients (lanes 1, 3, 11, and 18) that have high integrity nucleic acid are treated with an anti-cancer drug candidate.
  • the patients are given a dose of the drug candidate at intervals dictated by the pharmacokinetics exhibited by the drug candidate being administered, and other factors that are known to those skilled in the art.
  • the patients are treated and monitored over a period of a month. Samples are taken from each patient for analysis at 48 hours, 1 week, 2 weeks and 4 weeks.
  • Patients that do not have high integrity nucleic acid are either excluded from treatment and analysis (for example, in the case where only patients that are diagnosed with cancer are treated with a drug candidate known to have efficacy as an anti-cancer drug) or are included in subsequent monitoring and given a placebo treatment (for example, in a clinical study relating to the efficacy of a drug candidate).
  • the patients without high integrity nucleic acid are excluded from treatment, and the patients having high integrity nucleic acid are treated.
  • patients 1 and 3 responded favorably to the drug treatment.
  • these patients have a profile of nucleic acid integrity more similar to that of a normal than to an untreated disease state.
  • bands representing the longest fragments being amplified were absent first, followed by bands representing shorter fragments being amplified (but still greater than 200 bp).
  • Patient 4 showed some response to the drug treatment, but not as great as that for patients 1 and 3.
  • the longest fragments were absent after 2 weeks as compared to 1 week for patients 1 and 3.
  • Example 2 Another experiment is conducted to determine treatment outcome over time in cancer or adenoma patients utilizing several loci that are different from those used in Example 1.
  • Stool samples were collected from 9 patients who presented with symptoms or a medical history that indicated that a colonoscopy should be performed. Each stool sample was frozen. Immediately after providing a stool sample, each patient was given a colonoscopy in order to determine the patient's disease status. Based upon the colonoscopy results, and subsequent histological analysis of biopsy samples taken during colonoscopy, individuals were placed into one of two groups: normal or abnormal. The abnormal group consisted of patients with cancer or with an adenoma of at least 1 cm in diameter. Based upon these results, 4 of the 9 patients were placed into the abnormal group.
  • Samples from the abnormal group are analyzed further, and the normals are not further amalyzed.
  • the samples are screened by hybrid capturing human DNA, and determining the amount of amplifiable DNA having at least 200 base pairs.
  • Each frozen stool specimen weighing from 7-33 grams, is thawed and homogenized in 500 mM Tris, 16 mM EDTA, and 10 mM NaCl, pH 9.0 at a volume, to mass ratio of 3 : 1.
  • Samples are then rehomogenized in the same buffer to a final volume-to-mass ratio of 20:1, and spun in glass macro beads at 2356 xg.
  • the supernatant is collected and treated with SDS and proteinase k.
  • the DNA is then phenol-chloroform extracted and precipitated with alcohol.
  • the precipitate is suspended in 10 mM Tris and 1 mM EDTA (1 x TE), pH 7.4. Finally, the DNA is treated with RNase.
  • apc-1309 was 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG 3' (SEQ ID NO: 2)
  • apc- 1378 was 5'CAGATAGCCCTGGACAAACAATGCCACGAAGCAGAAG 3' (SEQ ID NO: 3).
  • Each sample is amplified using forward and reverse primers through 7 loci (Kras, exon 1, APC exon 15 (3 separate loci), p53, exon 5, p53, exon 7, and p53, exon 8) in duplicate (for a total of 14 amplifications for each locus). Seven separate PCRs (40 cycles each) are run in duplicate using primers directed to detect fragments in the sample having 200 base pairs or more. Amplified DNA is placed on a 4% Nusieve (FMC Biochemical) gel (3% Nusieve, 1% agarose), and stained with ethidium bromide (0.5 ⁇ g/ml).
  • the resulting amplified DNA is graded based upon the relative intensity of the stained gels. Seven different loci that are amplified. All four abnormal patients have amplifiable DNA of 200 bp or greater in length. The results are the same regardless of which locus was amplified. The four abnormal patients are then treated with a drug candidate for a period of four weeks. As shown in Table 2, below, a similar result to that in Example 1 is obtained for these four patients.
  • methods of the invention are used in patients who had a colorectal adenoma or colorectal cancer.
  • a stool sample is obtained from each of these patients and prepared, as described above.
  • Fragments of the 5 different loci referred to in Example 1 are amplified using primers spaced 200, 400, 800, 1300, 1800, and 2400 base pairs apart using the protocol described above in Example 1.
  • Each amplification is scored such that successful amplification of a fragment receives a score of 1, and no amplification receives a score of 0. Because five loci were interrogated using 6 primer pairs each, the maximum score is 30 (successful amplification of all 6 fragments at all five loci).
  • the cutoff for a positive screen is set at 21. The results are shown below. Tables 3 and 4 indicate which patients are positive for an adenoma or a carcinoma based upon this scoring system. Table 3. Scoring for patients to determine if patients have an adenoma.
  • Table 4 Scoring for patients to determine if patients have a carcinoma.
  • the score of the patients which reflects successful amplification of a fragment, which, in turn, reflects the level of high integrity nucleic acid, as described above, is shown for a time course of treatment with an anti-cancer drug candidate in Tables 5 and 6. Because the cut-off for a positive screen for a diseased patient is set to 21, when the score of a patient drops below 21, the drug treatment is considered effective. As shown in Tables 5 and 6, the length of time it takes for a score to drop below 21 varies from patient to patient, and the magnitude of the change also varies. Some patients do not respond to treatment, as indicated by a score that does not drop below 21 or by a score that does not change at all. EXAMPLE 4
  • This example shows how methods of the invention can screen drug candidates for activity in an animal (non-human) model of a disease ("diseased animal") using the presence or absence of amplifiable high integrity nucleic acid as a marker for activity.
  • an experiment can provide leads for drug development and/or predict which compounds are likely to be active in vivo and/or predict which compounds are likely to alleviate symptoms of a disease in vivo.
  • An animal model of a disease is used as the test subject, and a normal animal is used as a control. Because the assay is to be conducted in triplicate, for each drug candidate to be tested, three diseased animals are treated with the drug candidate. As controls, a diseased animal is treated with a sham treatment, such as the carrier in which the drug candidate is suspended for administration; a normal animal is treated with the sham treatment; and a normal animal is treated with the drug candidate.
  • a sham treatment such as the carrier in which the drug candidate is suspended for administration
  • a normal animal is treated with the sham treatment
  • a normal animal is treated with the drug candidate.
  • the animals are given these treatments periodically over a period of three weeks.
  • samples are taken from the animals, the samples are prepared, and the samples are analyzed for nucleic acid integrity, as described above. Samples are taken at a time before treatment, at 48 hours post-treatment, 1 week post-treatment, 2 weeks post-treatment, and 3 weeks post-treatment. Analysis is accomplished as described above. Briefly, DNA is extracted from these samples. PCR is used to amplify the extracted DNA about a locus suspected to be associated with the disease. One forward primer is used with six reverse primers .
  • the forward primer is separated from each reverse primer by 200 bp (Fi-Ri), 400 bp (F ⁇ -R 2 ), 800 bp (F 1 -R 3 ), 1.3 Kb, (F 1 -R 4 ), 1.8 Kb (F,-R 5 ), and 2.3 Kb (Fi-R ⁇ ).
  • the PCR product is run out on a separation gel.
  • the untreated diseased animal is expected to show bands for fragments (amplified high integrity nucleic acid) at most, if not all, of the primer pairs (200 bp (F 1 -R 1 ), 400 bp (F R 2 ), 800 bp (F1-R3), 1.3 Kb, (F1-R4), 1.8 Kb (F R 5 ), and 2.3 Kb (FpR 6 )).
  • the normal animal treated with the sham treatment is expected to show very little, if any, amplified high integrity nucleic acid.
  • bands corresponding to fragments of 400 bp (F 1 -R 2 ), 800 bp (F 1 -R 3 ), 1.3 Kb, (F1-R4), 1.8 Kb (F1-R5), and 2.3 Kb (Fi-R*) are expected to be substantially absent in the untreated normal sample. More particularly, a very light band, or no band at all, is expected for the 200 bp fragment (Fi-Rj), and no other bands, especially those corresponding to longer fragments, are expected. A similar pattern is expected for the normal animal treated with the drug candidate. In this case, the pattern of bands, representing the fragments amplified with the various primer pairs, is used as the marker of high integrity nucleic acid, and, thus, drug candidate activity.
  • the profile of amplified high integrity nucleic acid from a treated diseased animal sample will be different from that of the untreated diseased animal sample. More particularly, if the drug candidate has an activity, fewer bands and/or lighter bands from a treated diseased animal sample will be seen relative to the untreated diseased animal sample. The stronger the activity of the drug candidate, the fewer the bands that will be seen and/or the lighter the bands that will be seen. It is expected that the most powerfully active drug candidates will produce a band pattern similar to that of the normal animal sample. Moreover, during the time course of the experiment, samples taken from the diseased animal over the time course will show changes in the number and/or level of intensity of the bands that are seen, if the drug candidate is active. Hypothetical expected results are shown in Table 7, below.
  • Drug candidates that are promising can be studied further.
  • the same experiment can be run by treating diseased animals with various doses of a particular drug candidate, and comparing the pattern of amplified fragments from the treated diseased animal samples with an untreated diseased animal sample and with normal animal samples, as described above.
  • a dose-response curve can be constructed to represent the effects of drug candidate dosage on drug candidate activity.
  • This example shows how methods of the invention can screen compounds that induce apoptotic activity or programmed cell death using the presence or absence of amplifiable high integrity nucleic acid as a marker.
  • these experiments are carried out the same way as in Example 4, and a similar endpoint to that in Example 4 is examined to determine if an induction of apoptotic activity or programmed cell death has occurred. If the compound induces apoptotic activity and/or programmed cell death, the profile of amplified high integrity nucleic acid in a sample from a treated diseased (or normal) animal will be different from that of the untreated diseased (or normal) animal sample.
  • the compound induces apoptotic activity and/or programmed cell death, fewer bands and/or lighter bands will be seen in a sample from a treated diseased (or normal) animal relative to the untreated diseased (or normal) animal sample. The more induction of apoptotic activity and/or programmed cell death, the fewer the bands that will be seen and/or the lighter the bands that will be seen.
  • EXAMPLE 6 This example shows how methods of the invention can screen drug candidates for activity in a specimen taken from an animal model (non-human) of a disease ("diseased animal") using the presence or absence of amplifiable high integrity nucleic acid as a marker for activity. Such an experiment can provide leads for drug development and/or predict which compounds are likely to be active in vivo and/or predict which compounds are like to alleviate symptoms of a disease in vivo.
  • An animal model of a disease is used as the test subject, and a normal animal is used as a control. Because the assay is to be conducted in triplicate, for each drug candidate to be tested, a tissue specimen from each of three diseased animals is removed and each specimen is treated with the drug candidate. As controls, a tissue specimen from a diseased animal is treated with a sham treatment, such as the carrier in which the drug candidate is suspended; a tissue specimen from a normal animal is treated with the sham treatment; and a tissue specimen from a normal animal is treated with the drug candidate.
  • a sham treatment such as the carrier in which the drug candidate is suspended
  • a tissue specimen from a normal animal is treated with the sham treatment
  • a tissue specimen from a normal animal is treated with the drug candidate.
  • tissue specimens are cultured and are given these treatments as a bolus dose and incubated for 8 hours.
  • samples are taken from the cultured specimens, the samples are prepared, and the samples are analyzed for nucleic acid integrity, as described above.
  • Samples are taken at a time before treatment, at 2 hours post-treatment, 4 hours post-treatment, 6 hours post-treatment, and 8 hours post-treatment. Analysis is accomplished as described above. Briefly, DNA is extracted from these samples. PCR is used to amplify the extracted DNA about a locus suspected to be associated with the disease. One forward primer is used with six reverse primers .
  • the forward primer is separated from each reverse primer by 200 bp (Fi-Ri), 400 bp (F R 2 ), 800 bp (F R 3 ), 1.3 Kb, (F R_ , 1.8 Kb (Fj-R 5 ), and 2.3 Kb (F,-R 6 ).
  • the PCR product is run out on a separation gel.
  • samples from the untreated tissue specimen from the diseased animal are expected to show bands for fragments (amplified high integrity nucleic acid) at most, if not all, of the primer pairs (200 bp (Fi-Rj), 400 bp (F ⁇ -R 2 ), 800 bp (Fi- R 3 ), 1.3 Kb, 1.8 Kb (F R 5 ), and 2.3 Kb (F R 6 )).
  • Samples from the tissue specimen, that are treated with the sham treatment, taken from the normal animal are expected to show very little, if any, amplified high integrity nucleic acid.
  • bands corresponding to fragments of 400 bp (F,-R 2 ), 800 bp (F,-R 3 ), 1.3 Kb, (F1-R4), 1.8 Kb (F,-R 5 ), and 2.3 Kb (F,-R 6 ) are expected to be substantially absent in samples from the untreated tissue specimen taken from the normal animal. More particularly, a very light band, or no band at all, is expected for the 200 bp fragment (Fj-Ri), and no other bands, especially those corresponding to longer fragments, are expected. A similar pattern is expected for samples from the tissue specimen treated with the drug candidate from the normal animal.
  • the pattern of bands representing the fragments amplified with the various primer pairs, is used as the marker of high integrity nucleic acid, and, thus, drug candidate activity.
  • the drug candidate has activity
  • the profile of amplified high integrity nucleic acid obtained from samples taken from treated tissue specimens of the diseased animal will be different from that of samples from the untreated tissue specimen from the diseased animal. More particularly, if the drug candidate has an activity, fewer bands and/or lighter bands will be seen in samples taken from treated tissue specimens from diseased animals relative to samples from the untreated tissue specimen from the diseased animal. The stronger the activity of the drug candidate, the fewer the bands that will be seen and/or the lighter the bands that will be seen.
  • Drug candidates that are promising can be studied further.
  • the same experiment can be run by treating tissue specimens from diseased animals with various doses of a particular drug candidate, and comparing the pattern of amplified fragments in samples taken from these treated tissue specimens with the pattern obtained from samples taken from tissue specimens from untreated diseased animals and with normal animals, as described above.
  • a dose-response curve can be constructed to represent the effects of drug candidate dosage on drug candidate activity.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne des matériels et des méthodes de criblage de médicaments et de candidats médicamenteux en fonction de leur activité par détermination de la présence ou de l"absence d"acide nucléique à haute intégrité dans un échantillon.
PCT/US2000/032387 1999-12-07 2000-11-28 Appareil et methodes de criblage de medicaments WO2001042503A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU18044/01A AU1804401A (en) 1999-12-07 2000-11-28 Apparatus and methods for drug screening based on nucleic acid analysis
JP2001544374A JP2003516162A (ja) 1999-12-07 2000-11-28 核酸分析に基づく薬物スクリーニングのための装置および方法
EP00980832A EP1238106A2 (fr) 1999-12-07 2000-11-28 Appareil et methodes de criblage de medicaments
CA002393864A CA2393864A1 (fr) 1999-12-07 2000-11-28 Appareil et methodes de criblage de medicaments

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16945799P 1999-12-07 1999-12-07
US60/169,457 1999-12-07

Publications (2)

Publication Number Publication Date
WO2001042503A2 true WO2001042503A2 (fr) 2001-06-14
WO2001042503A3 WO2001042503A3 (fr) 2001-12-27

Family

ID=22615780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/032387 WO2001042503A2 (fr) 1999-12-07 2000-11-28 Appareil et methodes de criblage de medicaments

Country Status (5)

Country Link
EP (1) EP1238106A2 (fr)
JP (1) JP2003516162A (fr)
AU (1) AU1804401A (fr)
CA (1) CA2393864A1 (fr)
WO (1) WO2001042503A2 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US6911308B2 (en) 2001-01-05 2005-06-28 Exact Sciences Corporation Methods for detecting, grading or monitoring an H. pylori infection
US7981612B2 (en) 1999-12-07 2011-07-19 Mayo Foundation For Medical Education And Research Methods of screening for supracolonic neoplasms based on stool samples containing a nucleic acid marker indicative of a neoplasm
US9777314B2 (en) 2005-04-21 2017-10-03 Esoterix Genetic Laboratories, Llc Analysis of heterogeneous nucleic acid samples
WO2019110750A1 (fr) * 2017-12-07 2019-06-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés de dépistage d'un cancer chez un sujet
US10435735B2 (en) 2014-03-07 2019-10-08 Dna Genotek Inc. Composition and method for stabilizing nucleic acids in biological samples
US11002646B2 (en) 2011-06-19 2021-05-11 DNA Genotek, Inc. Devices, solutions and methods for sample collection
CN113261532A (zh) * 2020-02-17 2021-08-17 中山大学 一种肺癌动物模型的构建方法
US11572581B2 (en) 2002-06-07 2023-02-07 DNA Genotek, Inc. Compositions and methods for obtaining nucleic acids from sputum

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006047787A2 (fr) 2004-10-27 2006-05-04 Exact Sciences Corporation Methode de surveillance de la progression ou la recurrence d'une maladie

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3413464A (en) * 1965-04-29 1968-11-26 Ibm Method for measuring the nucleic acid in biological cells after enhancement in an acidic solution
US5882865A (en) * 1996-03-22 1999-03-16 The Johns Hopkins University Cancer drug screen based on cell cycle uncoupling
US5976800A (en) * 1996-06-28 1999-11-02 The Regents Of The University Of California Enhancement of cancer cell death

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6586177B1 (en) * 1999-09-08 2003-07-01 Exact Sciences Corporation Methods for disease detection
US6919174B1 (en) * 1999-12-07 2005-07-19 Exact Sciences Corporation Methods for disease detection

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3413464A (en) * 1965-04-29 1968-11-26 Ibm Method for measuring the nucleic acid in biological cells after enhancement in an acidic solution
US5882865A (en) * 1996-03-22 1999-03-16 The Johns Hopkins University Cancer drug screen based on cell cycle uncoupling
US5976800A (en) * 1996-06-28 1999-11-02 The Regents Of The University Of California Enhancement of cancer cell death

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
EADS CINDY A ET AL: "CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression." CANCER RESEARCH, vol. 59, no. 10, 15 May 1999 (1999-05-15), pages 2302-2306, XP002170143 ISSN: 0008-5472 *
GIACONA MARY BETH ET AL: "Cell-free DNA in human blood plasma: Length measurements in patients with pancreatic cancer and healthy controls." PANCREAS, vol. 17, no. 1, July 1998 (1998-07), pages 89-97, XP000992791 ISSN: 0885-3177 *
See also references of EP1238106A2 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US7981612B2 (en) 1999-12-07 2011-07-19 Mayo Foundation For Medical Education And Research Methods of screening for supracolonic neoplasms based on stool samples containing a nucleic acid marker indicative of a neoplasm
US6911308B2 (en) 2001-01-05 2005-06-28 Exact Sciences Corporation Methods for detecting, grading or monitoring an H. pylori infection
US11572581B2 (en) 2002-06-07 2023-02-07 DNA Genotek, Inc. Compositions and methods for obtaining nucleic acids from sputum
US9777314B2 (en) 2005-04-21 2017-10-03 Esoterix Genetic Laboratories, Llc Analysis of heterogeneous nucleic acid samples
US11002646B2 (en) 2011-06-19 2021-05-11 DNA Genotek, Inc. Devices, solutions and methods for sample collection
US11536632B2 (en) 2011-06-19 2022-12-27 DNA Genotek, Inc. Biological collection system
US11549870B2 (en) 2011-06-19 2023-01-10 DNA Genotek, Inc. Cell preserving solution
US11592368B2 (en) 2011-06-19 2023-02-28 DNA Genotek, Inc. Method for collecting and preserving a biological sample
US10435735B2 (en) 2014-03-07 2019-10-08 Dna Genotek Inc. Composition and method for stabilizing nucleic acids in biological samples
US11198899B2 (en) 2014-03-07 2021-12-14 Dna Genotek Inc. Composition and method for stabilizing nucleic acids in biological samples
WO2019110750A1 (fr) * 2017-12-07 2019-06-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés de dépistage d'un cancer chez un sujet
US11814686B2 (en) 2017-12-07 2023-11-14 Institut National de la Santéde la Recherche Médicale Method for screening and treating a subject for a cancer
CN113261532A (zh) * 2020-02-17 2021-08-17 中山大学 一种肺癌动物模型的构建方法

Also Published As

Publication number Publication date
AU1804401A (en) 2001-06-18
EP1238106A2 (fr) 2002-09-11
WO2001042503A3 (fr) 2001-12-27
JP2003516162A (ja) 2003-05-13
CA2393864A1 (fr) 2001-06-14

Similar Documents

Publication Publication Date Title
US6849403B1 (en) Apparatus and method for drug screening
US7811757B2 (en) Methods for disease detection
Mee et al. The psoriatic transcriptome closely resembles that induced by interleukin-1 in cultured keratinocytes: dominance of innate immune responses in psoriasis
Dieckgraefe et al. Analysis of mucosal gene expression in inflammatory bowel disease by parallel oligonucleotide arrays
US20200056244A1 (en) Methods of treating a subject with a high gleason score prostate cancer
CA2393709C (fr) Methodes permettant l'identification d'acides nucleiques indicatifs de cancer
US20230366034A1 (en) Compositions and methods for diagnosing lung cancers using gene expression profiles
KR20100016525A (ko) 녹내장 진행 리스크의 판정 방법
CN104745575A (zh) 用于检测细胞增殖性异常或疾病程度分级的基因组合物及其用途
AU2022203356A1 (en) Methods of detecting prostate cancer
US20220093251A1 (en) Novel biomarkers and diagnostic profiles for prostate cancer
WO2001042503A2 (fr) Appareil et methodes de criblage de medicaments
US20030180747A1 (en) Pancreatic cancer diagnosis and therapies
CN115605608A (zh) 帕金森氏病的检测方法
US7465542B2 (en) Methods and compositions for determining risk of treatment toxicity
KR102202120B1 (ko) 알츠하이머 질환의 진단 또는 치료를 위한 Ｕｂｅ２ｈ의 용도
US20030082644A1 (en) Diagnostic detection of nucleic acids
CN116287180A (zh) 检测标志物的试剂在制备用于诊断哮喘的试剂盒中的应用
CN116440152A (zh) Wtap的抑制剂在制备治疗特应性皮炎药物中的应用
CN116377053A (zh) 冠状动脉扩张症的诊断生物标志物及其应用
NZ771630B2 (en) Methods of detecting prostate cancer
CN103525821A (zh) 用于诊断纯发-甲外胚叶发育不良的方法和组合物

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

ENP Entry into the national phase in:

Ref country code: JP

Ref document number: 2001 544374

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2393864

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 18044/01

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2000980832

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000980832

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000980832

Country of ref document: EP