WO2001036479A1 - G-protein coupled receptor - Google Patents

G-protein coupled receptor Download PDF

Info

Publication number
WO2001036479A1
WO2001036479A1 PCT/US2000/031240 US0031240W WO0136479A1 WO 2001036479 A1 WO2001036479 A1 WO 2001036479A1 US 0031240 W US0031240 W US 0031240W WO 0136479 A1 WO0136479 A1 WO 0136479A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
nucleic acid
mch
expression vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/031240
Other languages
English (en)
French (fr)
Inventor
Qingyun Liu
Terrence P. Mcdonald
Andrew D. Howard
Hisashi Iwaasa
Hideki Sano
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MSD KK
Merck and Co Inc
Original Assignee
Banyu Phamaceutical Co Ltd
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Banyu Phamaceutical Co Ltd, Merck and Co Inc filed Critical Banyu Phamaceutical Co Ltd
Priority to JP2001538968A priority Critical patent/JP2003514549A/ja
Priority to CA002392090A priority patent/CA2392090A1/en
Priority to EP00978622A priority patent/EP1233981A4/en
Publication of WO2001036479A1 publication Critical patent/WO2001036479A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • MCH Melanm-concentrating hormone
  • MCH has been localized p ⁇ ma ⁇ ly to neuronal cell bodies of the hypothalamus which are implicated in the control of food intake, including pe ⁇ karya of the lateral hypothalamus and zona inertia. (Knigge, et al, 1996. Peptides 17, 1063-1073.)
  • MCH mRNA is up regulated in fasted mice and rats, in the ob/ob mouse and in mice with targeted disruption in the gene for neuropeptide Y (NPY).
  • NPY neuropeptide Y
  • Injection of MCH centrally (ICV) stimulates food intake and MCH antagonizes the hypophagic effects seen with melanocyte stimulating hormone ( MSH).
  • MSH melanocyte stimulating hormone
  • MCH action is not limited to modulation of food intake as effects on the hypothalamic-pituitary-axis have been reported. (Nahon, 1994. Critical Rev. in Neurobiol 8, 221-262.) MCH may be involved in the body response to stress as MCH can modulate the stress-induced release of CRF from the hypothalamus and ACTH from the pituitary. In addition, MCH neuronal systems may be involved in reproductive or maternal function.
  • MCH-RI MCH-RI
  • HG67 nucleic acids and HG67 polypeptides.
  • HG67 also referred to herein as "MCH-R2"
  • MCH-R2 is a G-protein coupled receptor having a high degree of sequence identity with MCH-RI.
  • the ammo acid sequence for HG67 is provided by SEQ. ID. NO. 1.
  • the cDNA sequence of HG67 is provided by SEQ. ID. NO. 2.
  • HG67 polypeptides contain a region of at least 9 contiguous amino acids that is present in SEQ. ID. NO. 1. Such polypeptides may contain additional regions present, or not present, in SEQ. ID. NO. 1.
  • HG67 polypeptides include, for example, full length HG67, HG67 fragments, and chime ⁇ c polypeptides containing all or a portion of HG67 along with amino acid reg ⁇ on(s) not from HG67.
  • HG67 nucleic acids contain a region that encodes for a HG67 polypeptide or contains at least 18 contiguous nucleotides that is present in SEQ. ID. NO. 2 or the complement thereof. Such nucleic acid may contain additional regions present, or not present, in nucleic acid encoding for HG67 or present in SEQ. ID. NO. 2 or the complement thereof.
  • HG67 nucleic acids include, for example, nucleic acid encoding for all or a portion of HG67, nucleic acid containing all or a portion of SEQ. ID. NO. 2, and recombinant nucleic acid encoding all or a portion of HG67 and/or containing all or a portion of SEQ. ID. NO. 2.
  • a first aspect of the present invention describes a purified HG67 polypeptide.
  • the polypeptide comprises at least 9 contiguous amino acids of SEQ. ID. NO. 1.
  • a “purified polypeptide” represents at least 10% of the total protein present in a sample or preparation. In preferred embodiments, the purified polypeptide represents at least about 50%, at least about 75%, or at least about 95% of the total protein in a sample or preparation. Reference to “purified polypeptide” does not require that the polypeptide has undergone any purification and may include, for example, chemically synthesized polypeptide that has not been purified.
  • Another aspect of the present invention describes a purified HG67 nucleic acid.
  • the nucleic acid comprises either (a) a region of at least 18 contiguous bases present in either bases 1-180 or 396-1020 of SEQ. ID. NO.
  • nucleic acid can comprise or consist of a nucleic acid encoding for SEQ. ID. NO. 1 and can comprise or consist of the nucleic acid sequence of SEQ. ID. NO. 2.
  • a “purified nucleic acid” represents at least 10% of the total nucleic acid present in a sample or preparation. In preferred embodiments, the purified nucleic acid represents at least about 50%, at least about 75%, or at least about 95% of the total nucleic acid in a sample or preparation. Reference to “purified nucleic acid” does not require that the nucleic acid has undergone any purification and may include, for example, chemically synthesized nucleic acid that has not been purified. Another aspect of the present invention describes an expression vector.
  • the expression vector comprises a nucleotide sequence encoding for at least 9 contiguous amino acids provided in SEQ. ID. NO. 1, wherein the nucleotide sequence is transcriptionally coupled to an exogenous promoter.
  • Reference to a nucleotide sequence "transcriptionally coupled to an exogenous promoter" indicates the presence and positioning of an RNA promoter such that it can mediate transcription of the nucleotide sequence and that the promoter is not naturally associated with the nucleotide sequence.
  • Another aspect of the present invention describes a recombinant cell comprising an expression vector encoding for a region of at least 9 contiguous amino acids of SEQ. ID. NO. 1.
  • the expression vector contains a promoter that is transc ⁇ ptionally coupled to nucleic acid encoding for the region and is recognized by an RNA polymerase present in the cell
  • Another aspect of the present invention desc ⁇ bes a recombinant cell made by a process comp ⁇ sing the step of introducing into the cell an expression vector encoding for a region of at least 9 contiguous amino acids of SEQ. ID. NO. 1.
  • the expression vector contains a promoter that is transc ⁇ ptionally coupled to nucleic acid encoding for the region and is recognized by an RNA polymerase present in the cell.
  • the expression vector can be used to insert recombinant nucleic acid into the host genome or can exist as an autonomous piece of nucleic acid.
  • Another aspect of the present invention features a pu ⁇ fied antibody preparation comp ⁇ smg an antibody that binds to HG67.
  • a “pu ⁇ fied antibody preparation” is a preparation where at least 10% of the antibodies present bind to HG67.
  • antibodies binding to HG67 represent at least about 50%, at least about 75%, or at least about 95% of the total antibodies present.
  • Reference to "pu ⁇ fied antibody preparation” does not require that the antibodies in the preparation have undergone any pu ⁇ fication.
  • Another aspect of the present invention desc ⁇ bes a method of producing a polypeptide comp ⁇ sing at least 9 contiguous amino acids of SEQ. ID NO. 1.
  • the method involves the step of growing a recombinant cell able to express the polypeptide from an expression vector.
  • Another aspect of the present invention desc ⁇ bes a method for screening for a compound able to bind to HG67.
  • the method involves the following steps: (a) expressing a polypeptide comp ⁇ smg at least about 9 contiguous ammo acids of SEQ. ID. NO. 1 from recombinant nucleic acid; (b) providing to the polypeptide a test preparation comp ⁇ sing one or more test compounds; and (c) measu ⁇ ng the ability of the test preparation to bind to the polypeptide.
  • a test preparation contains one or more compounds being tested. In different embodiments a test preparation contains 10 or more compounds, 5 or more compounds, or 1 compound.
  • a "recombinant nucleic acid” is a nucleic acid containing one or more regions not naturally associated with each other. Examples of recombinant nucleic acid include an HG67 region present on a nucleic acid also containing one or more regulatory elements not naturally associated with the HG67 region, viral elements, or selectable markers.
  • Another aspect of the present invention describes a method for screening for HG67 activity. The method involves (a) contacting a cell expressing a recombinant nucleic acid encoding for a G-protein coupled receptor comprising at least 9 contiguous bases of SEQ. ID. NO. 1 with a test preparation comprising one or more test compounds; and (b) measuring the effect of the test preparation on the activity of the receptor.
  • HG67 activity is modulated by causing a decrease in the activity or expression of the receptor.
  • HG67 activity can be modulated using, for example, organic compounds active at the HG67 receptor and nucleic acid able to decrease HG67 expression.
  • Another aspect of the present invention describes a method for screening for a compound able to bind HG67 or a fragment thereof.
  • the method comprising the steps of: (a) expressing a polypeptide comprising the amino acid sequence of SEQ. ID. NO. 1 or fragment thereof from recombinant nucleic acid; (b) providing to the polypeptide a labeled MCH ligand and a test preparation comprising one or more test compounds; and (c) measuring the effect of the test preparation on binding of the labeled MCH ligand to the polypeptide.
  • a "MCH ligand” refers to a polypeptide that binds to HG67 at the
  • MCH binding site MCH binding site.
  • MCH ligands include human MCH, salmon MCH, and derivatives thereof.
  • Another aspect of the present invention describes a method for screening for a compound able to modulate HG67 activity.
  • the method comprises the steps of: (a) contacting a cell line expressing recombinant nucleic acid encoding for a polypeptide comprising (i) the amino acid sequence of SEQ. ID. NO. 1 or a fragment thereof that binds MCH and (ii) a region that functionally couples to a G protein, wherein the polypeptide is able to transduce an intracellular signal upon MCH ligand binding, with a MCH ligand and a test preparation comprising one or more test compounds; and (b) measuring the effect of the preparation on polypeptide activity.
  • Other features and advantages of the present invention are apparent from the additional descriptions provided herein including the different examples.
  • the provided examples illustrate different components and methodology useful in practicing the present invention. The examples do not limit the claimed invention. Based on the present disclosure the skilled artisan can identify and employ other components and methodology useful for practicing the present invention.
  • FIGURE 1 illustrates the nucleic acid sequence of GenBank Accession
  • Figures 2A and 2B illustrate a compa ⁇ son of SEQ. ID. NO. 2 with SEQ. ID. NO. 4.
  • SEQ. ID NO. 4 is the anti-strand of SEQ. ID. NO. 3.
  • Figure 3 illustrates [Ca2+]j by MCH and [Phel3,Tyrl9]-MCH in the HEK293T cells transiently expressing HG67.
  • Figure 4 illustrates activation of HG67 by human MCH in the aequo ⁇ n assay.
  • HEK293/seql7/G( ⁇ l5 cells were transfected with HG67 or vector only and then assayed against MCH two days post transfection.
  • RLU random luminescence units.
  • the EC 50 of MCH for HG67 and MCH-RI is 26 nM and 66 nM, respectively in these cells.
  • Figure 5 illustrate expression of HG67 and activation by MCH in HEK-293/aeq/17 cells
  • HG67 is a G-protem coupled receptor having an amino acid sequence identity of 39% with MCH-RI.
  • An internal region of HG67 is similar to an internal region of a deposited genomic nucleic acid sequence desc ⁇ bed in GenBank Accession Number AQ747249 ( Figure 1, SEQ. ID. NO. 3) Figure 2, provides a compa ⁇ son between SEQ. ID. NO. 2 and SEQ. ID. NO. 4 (the anti-sense strand of SEQ. ID. NO. 3).
  • HG67 nucleic acid was cloned from a human source (see Example 1). Such nucleic acid can be used as hyb ⁇ dization probes to distinguish between cells that produce HG67 transc ⁇ pts from human or non-human cells (including bacte ⁇ a) that do not produce such transc ⁇ pts Similarly, antibodies specific for HG67 can be used to distinguish between cells that express HG67 from human or non-human cells (including bacte ⁇ a) that do not express HG67.
  • HG67 provides a target to achieve a beneficial effect in a patient.
  • HG67 activity is modulated to achieve one or more of the following: weight loss, weight gain, treat cancer (e.g., colon or breast), reduce pain, treat diabetes, reduce stress or treat sexual dysfunction.
  • cancer e.g., colon or breast
  • Modulation of HG67 activity is preferably achieved by evoking a response at the MCH receptor or by altering a response evoked by a MCH receptor agonist or antagonist.
  • Compounds modulating MCH-R receptor activity include agonists, antagonists, and allosteric modulators.
  • HG67 antagonists and allosteric modulators negatively affecting activity will be used to achieve weight loss, treat cancer (e.g., colon or breast), reduce pain, reduce stress or teat sexual dysfunction; and HG67 agonists and allosteric modulators positively affecting activity will be used to produce a weight gain.
  • HG67 activity can also be affected by modulating HG67 expression.
  • Compounds modulating HG67 expression include cloned HG67 that can express HG67 in vivo, antisense nucleic acids targeted to HG67 transcripts and enzymatic nucleic acids targeted to HG67 transcripts.
  • a patient refers to a mammal, preferably a human. Reference to patient does not necessarily indicate the presence of a disease or disorder. The term patient includes subjects treated prophylactically and subjects afflicted with a disease or disorder.
  • HG67 activity is modulated to achieve a weight loss or to treat diabetes in a patient.
  • Diabetes mellitus can be treated by modulating HG67 activity to achieve, for example, one or both of the following: enhancing glucose tolerance or decreasing insulin resistance.
  • Excessive weight is a contributing factor to different diseases including hypertension, diabetes, dyslipidemias, cardiovascular disease, gall stones, osteoarthritis and certain forms of cancers. Bringing about a weight loss can be used, for example, to reduce the likelihood of such diseases and as part of a treatment for such diseases. Weight reduction can be achieved by modulating HG67 activity to obtain, for example, one or more of the following effects: reducing appetite, increasing metabolic rate, reducing fat intake or reducing carbohydrate craving. In another embodiment HG67 activity is modulated to increase weight in a patient. Increasing weight is particularly useful for a patient having a disease or disorder, or under going a treatment, accompanied by weight loss.
  • HG67 POLYPEPTIDES HG67 polypeptides contain a HG67 region that is at least 9 contiguous amino acids in length. HG67 polypeptides have a variety of uses, such as providing a component for a functional receptor; being used as an immunogen to produce antibodies binding to HG67; being used as a target to identify compounds binding to the HG67; and/or being used in assays to measure the ability of a compound to effect HG67 activity.
  • chimeric polypeptides containing one or more regions from HG67 and one or more regions not from HG67 the region(s) not from HG67 can be used, for example, to achieve a particular purpose or to produce a polypeptide that can substitute for HG67 or a fragment thereof.
  • Particular purposes that can be achieved using chimeric HG67 polypeptides include providing a marker for isolation, functional analysis of different receptor regions, enhancing an immune response, and altering G-protein coupling.
  • a HG67 polypeptide comprises or consists of the amino acid sequence of SEQ. ID. NO. 1.
  • a HG67 polypeptide comprises or consists of a SEQ. ID. NO. 1 contiguous region at least 18 amino acids in length, at least 27 amino acids in length, at least 54 amino acids in length or a region that is selected from the group consisting of: amino acids 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-110, 111-120, 121-130, 131- 140, 141-150, 151-160, 161-170, 171-180, 181-190, 191-200, 201-210, 211-220, 221- 230, 231-240, 241-250, 251-260, 261-270, 271-280, 281-290, 291-300, 301-310, 311- 320, 321-330, and 331-340 of SEQ.
  • the HG67 polypeptide comprises or consists of a sequence selected from the group consisting of: MNPFHASCWNTSA (SEQ. ID. NO. 5); MIGHCSTGLV (SEQ. ID. NO. 6); MYQQNKDARCCNPS (SEQ. ID. NO. 7); MVLVLVVVFILSAA (SEQ. ID. NO. 8); and MEQPTLAFYVGYYLSI (SEQ. ID. NO. 9).
  • HG67 polypeptides also include functional G-protein receptors that respond to MCH and have a sequence similarity of at least about 85%, preferably at least 95% with SEQ. ID. NO. 1.
  • Sequence similarity for polypeptides can be determined by BLAST. (Altschul, et al, 1997. Nucleic Acids Res. 25, 3389-3402, hereby incorporated by reference herein.) In one embodiment sequence similarity is determined using tBLASTn search program with the following parameters MATRIX:BLOSUM62, PER RESIDUE GAP COST: 11, and Lambda ratio: 1.
  • Polypeptides can be produced using standard techniques including those involving chemical synthesis and those involving biochemical synthesis. Techniques for chemical synthesis of polypeptides are well known in the art (See e.g., Vincent, in Peptide and Protein Drug Delivery, New York, N.Y . Dekker, 1990.) Biochemical synthesis techniques for polypeptides are also well known in the art. Such techniques employ a nucleic acid template for polypeptide synthesis. The genetic code providing the sequences of nucleic acid t ⁇ plets coding for particular amino acids is well known the art.
  • HG67 transduces a G-protein coupled mtracellular signal upon ligand binding.
  • the identification of the amino acid and nucleic acid sequences of HG67 provide tools for obtaining functional receptors related to HG67 from other sources, for producing HG67 chime ⁇ c G-protein coupled receptors, and for producing functional de ⁇ vatives of SEQ. ID. NO. 1.
  • HG67 polypeptides can be readily identified and obtained based on their sequence simila ⁇ ty to HG67. Both the ammo acid and nucleic acid sequences of HG67 can be used to help identify and obtain HG67 polypeptides. For example, SEQ ID NO: 1
  • ID. NO. 1 can be used to produce degenerative nucleic acid probes or p ⁇ mers for identifying and cloning nucleic acid encoding for a HG67 polypeptide, and SEQ. ID.
  • NO. 2 or fragments thereof can be used under conditions of moderate st ⁇ ngency to identify and clone nucleic acid encoding HG67 polypeptides.
  • the use of degenerative probes and moderate st ⁇ ngency conditions for cloning is well known in the art. Examples of such techniques are desc ⁇ bed by
  • HG67 obtained from a particular source
  • derivatives can be produced having receptor activity.
  • Such derivatives include polypeptides with amino acid substitutions, additions and deletions. Changes to HG67 to produce a derivative having essentially the same properties should be made outside of the HG67 binding domain and in a manner not altering the tertiary structure. The ability of a polypeptide to have HG67 activity can be confirmed using techniques such as those measuring G-protein activity.
  • Amino acids are can be divided into different groups as follows: neutral and hydrophobic (alanine, valine, leucine, isoleucine, proline, tyrptophan, phenylalanine, and methionine); neutral and polar (glycine, serine, threonine, tryosine, cysteine, asparagine, and glutamine); basic (lysine, arginine, and histidine); and acidic (aspartic acid and glutamic acid). Generally, in substituting different amino acids it is preferable to exchange amino acids having similar properties.
  • such changes are made taking into account the position of the amino acid to be substituted in the polypeptide.
  • arginine can substitute more freely for nonpolor amino acids in the interior of a polypeptide then glutamate because of its long aliphatic side chain.
  • Antibodies recognizing HG67 can be produced using a polypeptide containing SEQ. ID. NO. 1 or a fragment thereof as an immunogen.
  • a polypeptide used as an immunogen consists of a polypeptide of SEQ. ID. NO. 1 or a SEQ. ID. NO. 1 fragment at least 9 amino acids in length.
  • Antibodies to HG67 have different uses such as being used to identify the presence of HG67 and to isolate HG67 polypeptides. Identifying the presence of HG67 can be used, for example, to identify cells producing HG67. Such identification provides an additional source of HG67 and can be used to distinguish cells known to produce HG67 from cells that do not produce HG67. For example, antibodies to HG67 can distinguish human cells expressing HG67 from human cells not expressing HG67 or non-human cells (including bacteria) that do not express HG67.
  • HG67 or a fragment thereof can be used in binding studies to identify compounds binding to the receptor. Such studies can be performed using different formats including competitive and non-competitive formats. Further competition studies can be carried out using additional compounds determined to bind to HG67.
  • the particular HG67 sequence involved in ligand binding can be readily identified by using labeled compounds that bind to the receptor and different receptor fragments. Different strategies can be employed to select fragments to be tested to narrow down the binding region. Examples of such strategies include testing consecutive fragments about 15 amino acids in length starting at the N-terminus, and testing longer length fragments. If longer length fragments are tested, a fragment binding to a compound can be subdivided to further locate the binding region.
  • Fragments used for binding studies can be generated using recombinant nucleic acid techniques.
  • binding studies are performed using HG67 expressed from a recombinant nucleic acid. More preferably, recombinantly expressed HG67 consists of the SEQ. ID. NO. 1 amino acid sequence.
  • Binding assays can be performed using individual compounds or preparations containing different numbers of compounds.
  • a preparation containing different numbers of compounds having the ability to bind to HG67 can be divided into smaller groups of compounds that can be tested to identify the compound(s) binding to HG67.
  • Binding assays can be performed using recombinantly produced HG67 present in different environments.
  • environments include, for example, cell extracts and purified cell extracts containing the HG67 recombinant nucleic acid; and also include, for example, the use of a pu ⁇ fied HG67 receptor polypeptide produced by recombinant means which is introduced into a different environment.
  • MCH as a ligand for HG67 provides a means for producing receptor activity, and provides a target for binding to the receptor and for alte ⁇ ng receptor activity.
  • MCH ligands can readily be designed based on the structure of MCH. Examples of MCH ligands include human MCH, salmon MCH, and de ⁇ vatives thereof. Suitable de ⁇ vatives can be identified empi ⁇ cally, for example, by deleting or substituting one or more amino acids of human MCH and testing the resulting polypeptide. Techniques for producing a polypeptide of a particular sequence are well known in the art. (Phe 13 Tyr 19 )-MCH is an example of an MCH de ⁇ vative that binds HG67.
  • MCH ligands can be employed.
  • labels include radiolabels, luminescent molecules, haptens and enzyme substrates
  • the ability of a particular label to interfere with binding can readily be determined by compa ⁇ ng the ability of MCH labeled with the particular label to compete against MCH binding.
  • Assays involving a functional G-protein receptor containing one or more HG67 regions can be employed for different purposes such as selecting for compounds active at HG67, evaluating the ability of a compound to effect receptor activity, and mapping the activity of different HG67 regions.
  • HG67 activity can be measured using different techniques such as detecting a change the intracellular conformation of HG67, measu ⁇ ng G-protem activity, or measu ⁇ ng the level of intracellular messengers.
  • Recombinantly expressed receptor can be used to facilitate determining whether a compound is active at that receptor or another receptor.
  • HG67 can be expressed by an expression vector in a cell line such as HEK 293, COS 7, or CHO, not normally expressing the receptor, wherein the same cell line without the expression vector or with an expression vector not encoding HG67 can act as a control.
  • Gi and Gs activity can be measured using techniques such as a melonaphore assay, assays measu ⁇ ng cAMP production, assays measu ⁇ ng inhibition of cAMP accumulation, and assays measu ⁇ ng binding of 35s- GTP.
  • cAMP can be measured using different techniques such as radioimmunoassay and indirectly by cAMP responsive gene reporter proteins.
  • Gq activity can be measured using techniques such as those measuring intracellular Ca 2+ .
  • techniques well known in the art that can be employed to measure Ca 2+ include the use of dyes such as Fura-2 and the use of Ca 2+ - bioluminescent sensitive reporter proteins such as aequorin.
  • An example of a cell line employing aequorin to measure G-protein activity is HEK293/aeql7. (Button, et al, 1993. Cell Calcium 14, 663-671, and Feighner, et al, 1999. Science 284, 2184- 2188, both of which are hereby incorporated by reference herein.)
  • Chimeric HG67 can be used to assay for compounds active at the receptor and to obtain information concerning different regions of the receptor.
  • a chimeric HG67 receptor contains an N-terminal extracellular domain; a transmembrane domain made up of transmembrane regions (preferably 7 transmembrane regions), extracellular loop regions, and intracellular loop regions; and an intracellular carboxy terminus domain; where one or more domains comprise at least one region of at least 9 contiguous amino acids present in SEQ. ID. NO. 1.
  • a chimeric HG67 contains the extracellular domain of HG67; and/or contains one or more regions of at least 18 contiguous amino acids present in SEQ. ID. NO. 1.
  • the specificity of G-protein coupling is determined by intracellular domain(s). Chimeric HG67 can be produced to functionally couple to a desired G- protein.
  • Functional assays can be performed using individual compounds or preparations containing different compounds.
  • a preparation containing different compounds where one or more compounds affect HG67 activity can be divided into smaller groups of compounds to identify the compound(s) affecting HG67 activity.
  • Functional assays can be performed using recombinantly produced HG67 present in different environments.
  • Such environments include, for example, cell extracts and purified cell extracts containing the HG67 expressed from recombinant nucleic acid and an appropriate membrane for the polypeptide; and the use of a purified HG67 produced by recombinant means that is introduced into a different environment suitable for measuring G-protein activity.
  • Screening for HG67 receptor active compounds is facilitated through the use of a MCH ligand in the assay.
  • the use of a MCH ligand a screening assay provides for HG67.
  • the effect of test compounds on such activity can be measured to identify, for example, alloste ⁇ c modulators and antagonists Additionally, such assays can be used to identify agonists.
  • HG67 nucleic acid contains a region that encodes for at least 9 contiguous amino acids of SEQ. ID. NO. 1 or contains at least 18 contiguous bases present in SEQ. ID. NO. 2
  • HG67 nucleic acid have a va ⁇ ety of uses, such as being used as a hybndization probe or PCR p ⁇ mer to identify the presence of HG67 nucleic acid; being used as a hybndization probe or PCR p ⁇ mer to identify nucleic acid encoding for receptors related to HG67, and/or being used for recombinant expression of HG67 polypeptides.
  • Regions in HG67 nucleic acid that do not encode for a HG67 segment or are not found in SEQ. ID. NO. 2, if present, are preferably chosen to achieve a particular purposes. Examples of additional regions that can be used to achieve a particular purpose include capture regions that can be used as part of a sandwich assay, reporter regions that can be probed to indicate the presence of the nucleic acid, expression vector regions, and regions encoding for other polypeptides
  • HG67 nucleic acid also includes nucleic acid encoding a functional G- protein that responds to MCH and has a sequence simila ⁇ ty of at least about 85%, preferably at least 95% with SEQ. ID. NO. 1; and nucleic acid having a sequence simila ⁇ ty of at least about 85%, preferably 90% with SEQ. K). NO. 2. Sequence simila ⁇ ty for nucleic acid can be determined by FASTA. (Pearson 1990.
  • the guidance provided in the present application can be used to obtain the nucleic acid sequence encoding for HG67 related receptors from different sources and to construct a receptor having HG67 activity. Obtaining nucleic acids encoding for HG67 related receptors from different sources is facilitated using sets of degenerative probes and p ⁇ mers and by the proper selection of hybndization conditions.
  • Sets of degenerative probes and pnmers are produced taking into account the degeneracy of the genetic code. Adjusting hybndization conditions is useful for controlling probe or p ⁇ mer specificity to allow for hybndization to nucleic acids having similar sequences.
  • nucleic acid detection techniques are descnbed, for example, in Sambrook, et al, in Molecular Cloning, A Laboratory Manual, 2 n Edition, Cold Spnng Harbor Laboratory Press, 1989.
  • PCR cloning techniques are desc ⁇ bed, for example, in White, Methods in Molecular Cloning, volume 67, Humana Press, 1997 HG67 probes and p ⁇ mers can be used to screen nucleic acid bra ⁇ es containing, for example, genomic DNA or cDNA.
  • Such bra ⁇ es are commercially available, and can be produced using techniques such as those desc ⁇ bed in Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-1998.
  • Nucleic acid having a desired sequence can be synthesized using chemical and biochemical techniques. Examples of chemical techniques are described in Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-
  • Biochemical synthesis techniques involve the use of a nucleic acid template and appropriate enzymes such as DNA and/or RNA polymerases. Examples of such techniques include in vitro amplification techniques such as PCR and transcription based amplification, and in vivo nucleic acid replication. Examples of suitable techniques are provided by Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-1998, Sambrook et al, in Molecular Cloning, A Laboratory
  • Probes for HG67 contain a region that can specifically hyb ⁇ dize to HG67 target nucleic acid under approp ⁇ ate hybndization conditions and can distinguish HG67 nucleic acid from non-target nucleic acids. Probes for HG67 can also contain nucleic acid that are not complementary to HG67 nucleic acid.
  • non-complementary nucleic acid that is present has a particular purpose such as being a reporter sequence or being a capture sequence.
  • additional nucleic acid need not have a particular purpose as long as the additional nucleic acid does not prevent the HG67 nucleic acid from distinguishing between target and non-target.
  • Hybndization occurs through complementary nucleotide bases. Hybndization conditions determine whether two molecules, or regions, have sufficiently strong interactions with each other to form a stable hybnd.
  • Tm The degree of interaction between two molecules that hyb ⁇ dize together is reflected by the Tm of the produced hybnd. The higher the Tm the stronger the interactions and the more stable the hybnd. Tm is effected by different factors well known m the art such as the degree of complementanty, the type of complementary bases present (e.g., A-T hybndization versus G-C hybndization), the presence of modified nucleic acid, and solution components. (E.g., Sambrook, et al, in Molecular Cloning, A Laboratory Manual, 2 nd Edition, Cold Spnng Harbor Laboratory Press, 1989.)
  • Stable hybnds are formed when the Tm of a hybnd is greater than the temperature employed under a particular set of hybndization assay conditions.
  • the degree of specificity of a probe can be vaned by adjusting the hybndization stnngency conditions. Detecting probe hybndization is facilitated through the use of a detectable label. Examples of detectable labels include luminescent, enzymatic, and radioactive labels.
  • stnngency conditions are provided in Sambrook, et al, in Molecular Cloning, A Laboratory Manual, 2 nd Edition, Cold Spnng Harbor Laboratory Press, 1989.
  • An example of high stnngency conditions is as follows- Prehybndization of filters containing DNA is earned out for 2 hours to overnight at 65°C buffer composed of 6 X SSC, 5 X Denhardt's solution, and 100 ⁇ g/ml denatured salmon sperm DNA. Filters are hyb ⁇ dized for 12 to 48 hours at 65°C in prehybndization mixture containing 100 ⁇ g/ml denatured salmon sperm DNA and 5- 20 X 10 6 cpm of 32 P-labeled probe.
  • Washing of filters is done at 37°C for 1 hour in a solution containing 2 X SSC, 0.1% SDS. This is followed by a wash in 0.1 X SSC, 0.1% SDS at 50°C for 45 minutes before autoradiography.
  • Other procedures using conditions of high stnngency would include, for example, either a hybndization step earned out in 5 X SSC, 5 X Denhardt's solution, 50% formamide at 42°C for 12 to 48 hours or a washing step earned out in 0.2 X SSPE, 0.2% SDS at 65°C for 30 to 60 minutes.
  • Probes are composed of nucleic acids or denvatives thereof such as modified nucleic acid and peptide nucleic acid.
  • Modified nucleic acid includes nucleic acid with one or more altered sugar groups, altered internucleotide linkages, and/or altered nucleotide punne or pynmidine bases References desc ⁇ bing modified nucleic acid include WO 98/02582, U.S. Patent No. 5,859,221 and U.S. Patent No. 5,852,188, each of which are hereby incorporated by reference herein.
  • HG67 polypeptides can be expressed from recombinant nucleic acid in a suitable host or in a test tube using a translation system. Recombinantly expressed HG67 polypeptides are preferably used in assays to screen for compounds that bind to HG67 and modulate the activity of the receptor.
  • expression is achieved in a host cell using an expression vector.
  • An expression vector contains recombinant nucleic acid encoding for a polypeptide along with regulatory elements for proper transc ⁇ ption and processing.
  • the regulatory elements that may be present include those naturally associated with the recombinant nucleic acid and exogenous regulatory elements not naturally associated with the recombmant nucleic acid.
  • Exogenous regulatory elements such as an exogenous promoter can be useful for expressing recombinant nucleic acid a particular host.
  • a "recombmant nucleotide sequence” is a sequence that is present on a nucleic acid containing one or more nucleic acid regions not naturally associated with that sequence. Examples of such regions that may be present include one or more regulatory elements not naturally associated with the sequence, viral elements, and selectable markers.
  • an expression vector includes a transc ⁇ ptional promoter, a ⁇ bosome binding site, a terminator, and an optionally present operator. Another preferred element is a polyadenylation signal providing for processing m eukaryotic cells.
  • an expression vector also contains an ong of replication for autonomous replication a host cell, a selectable marker, a limited number of useful restnction enzyme sites, and a potential for high copy number. Examples of expression vectors are cloning vectors, modified cloning vectors, specifically designed plasmids and viruses. Expression vectors providing suitable levels of polypeptide expression m different hosts are well known in the art.
  • Mammalian expression vectors well known in the art include pcDNA3 (Invitrogen), pMClneo (Stratagene), pXTl (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593), pBPV-l(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460), pCI- neo (Promega) and .lambda.ZD35 (ATCC 37565).
  • Bactenal expression vectors well known in the art include pETlla (Novagen), lambda gtll (Invitrogen), pcDNAII (Invitrogen), and pKK223-3 (Pharmacia).
  • Fungal cell expression vectors well known in the art include pYES2 (Invitrogen), Pichia expression vector (Invitrogen).
  • Insect cell expression vectors well known in the art include Blue Bac HI (Invitrogen).
  • Recombinant host cells may be prokaryotic or eukaryotic.
  • Examples of recombinant host cells include the following: bactena such as E. coli; fungal cells such as yeast; mammalian cells such as human, bovme, porcine, monkey and rodent; and insect cells such as Drosophila and silkworm denved cell lines.
  • L cells L-M(TK.sup.-) ATCC CCL 1.3
  • L cells L-M ATCC CCL 1.2
  • 293 ATCC CRL 1573
  • Raji ATCC CCL 86
  • CV-1 ATCC CCL 70
  • COS-1 ATCC CRL 1650
  • COS-7 ATCC CRL 1651
  • CHO-K1 ATCC CCL 61
  • 3T3 ATCC CCL 92
  • NIH/3T3 ATCC CRL 1658
  • HeLa ATCC CCL 2
  • C127I ATCC CRL 1616
  • BS-C-1 ATCC CCL 26
  • MRC-5 ATCC CCL 171
  • Expression vectors may be introduced into host cells using standard techniques. Examples of such techniques include transformation, transfection, hpofection, protoplast fusion, and electroporation.
  • Nucleic acid encoding for a polypeptide can be expressed m a cell without the use of an expression vector employing, for example, synthetic mRNA or native mRNA Additionally, mRNA can be translated m vanous cell-free systems such as wheat germ extracts and reticulocyte extracts, as well as in cell based systems, such as frog oocytes. Introduction of mRNA into cell based systems can be achieved, for example, by microinj ection.
  • MODULATING HG67 EXPRESSION HG67 expression can be modulated as a means for increasing or decreasing HG67 activity Such modulation includes inhibiting HG67 nucleic acid activity to reduce HG67 expression or supplying HG67 nucleic acid to increase HG67 activity.
  • HG67 nucleic acid activity can be inhibited using nucleic acids recognizing HG67 nucleic acid and affecting the ability of such nucleic acid to be transcnbed or translated. Inhibition of HG67 nucleic acid activity can be used, for example, in target validation studies.
  • a preferred target for inhibiting HG67 translation is mRNA.
  • the ability of mRNA encoding HG67 to be translated into a protein can be effected by compounds such as anti-sense nucleic acid and enzymatic nucleic acid.
  • Anti-sense nucleic acid can hybndize to a region of a target mRNA.
  • anti-sense activity can be brought about by different mechanisms such as blocking the initiation of translation, preventing processing of mRNA, hybnd arrest, and degradation of mRNA by RNAse H activity.
  • Enzymatic nucleic acid can recognize and cleave another nucleic acid molecule.
  • Preferred enzymatic nucleic acids are nbozymes.
  • Nucleic acid can be introduced into cells present in different environments using in vitro, in vivo, or ex vivo techniques.
  • Nucleic acid coding for the HG67 can be used, for example, to cause an increase in weight or to create a test system (e.g., a transgenic animal) for screening for compounds affecting HG67 expression. Nucleic acids can be introduced and expressed in cells present in different environments.
  • Using the present application as a guide compounds able to modulate HG67 can be obtained and used to achieve a beneficial effect in a patient. Such effects can be obtained, for example, by altering weight or relieving stress using a compound active at HG67.
  • Altering weight is particularly useful for gaining weight in an under weight patient or losing weight in an over weight patient.
  • farm animals can be treated to gain weight.
  • Under weight patients include those having a body weight about 10% or less, 20% or less, or 30% or less, than the lower end of a "normal" weight range or Body Mass Index ("BMI").
  • Over weight patients include those having a body weight about 10% or more, 20% or more, 30% or more, or 50% or more, than the upper end of a "normal” weight range or BMI.
  • "Normal" weight ranges are well known in the art and take into account factors such as a patient age, height, and body type.
  • BMI measures your height/weight ratio. It is determined by calculating weight in kilograms divided by the square of height in meters. The BMI "normal" range is 19-22.
  • HG67 activity is altered using a non-prote HG67 agonist or antagonist.
  • Agonist and antagonists are preferably organic compounds compnsing one or more aryl or heteroaryl and having a molecule weight between about 150 and 900.
  • HG67 modulating compounds can be provided in kit.
  • kit typically contains an active compound in dosage forms for administration
  • a dosage form contains a sufficient amount of active compound such that a beneficial effect can be obtained when administered to a patient dunng regular intervals, such as 1 to 6 times a day, dunng the course of 1 or more days.
  • a kit contains instructions indicating the use of the dosage form for weight reduction (e g., to treat obesity or overweight) or stress reduction, and the amount of dosage form to be taken over a specified time pe ⁇ od.
  • HG67 active compounds having approp ⁇ ate functional groups can be prepared as acidic or base salts.
  • Pharmaceutically acceptable salts include conventional non-toxic salts or the quaternary ammonium salts that are formed, e g., from inorganic or organic acids or bases.
  • salts include acid addition salts such as acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochlo ⁇ de, hydrobromide, hydroiodide, 2- hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylprop ⁇ onate, picrate, pivalate, propionate, succmate, tartrate,
  • HG67 active compounds can be administered using different routes including oral, nasal, by injection, and transmucosally Active ingredients to be administered orally as a suspension can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain microcrystalhne cellulose for imparting bulk, algmic acid or sodium algmate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners/flavonng agents.
  • compositions may contain microcrystalhne cellulose, dicalcium phosphate, starch, magnesium stearate and lactose and/or other excipients, binders, extenders, disintegrants, diluents and lub ⁇ cants
  • compositions can be prepared according to techniques well known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailabi ty, fluorocarbons, and/or other solubihzmg or dispersing agents.
  • the compounds may also be administered in intravenous (both bolus and infusion), mtrape ⁇ toneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts
  • the injectable solutions or suspensions may be formulated using suitable non-toxic, parenterally-acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution or isotonic sodium chlo ⁇ de solution, or suitable dispersing or wetting and suspending agents, such as stenle, bland, fixed oils, including synthetic mono- or diglyce ⁇ des, and fatty acids, including oleic acid
  • these compositions When rectally administered in the form of supposito ⁇ es, these compositions may be prepared by mixing the drug with a suitable non-irntating excipient, such as cocoa butter, synthetic glyce ⁇ de esters or polyethylene glycols, which are solid at ordinary temperatures, but quidify and/or dissolve in the rectal cavity to release the drug.
  • a suitable non-irntating excipient such as cocoa butter, synthetic glyce ⁇ de esters or polyethylene glycols, which are solid at ordinary temperatures, but quidify and/or dissolve in the rectal cavity to release the drug.
  • Suitable dosing regimens for the therapeutic applications of the present invention are selected taking into account factors well known in the art including age, weight, sex and medical condition of the patient; the seventy of the condition to be treated; the route of administration; the renal and hepatic function of the patient, and the particular compound employed. Guidelines for pharmaceutical administration and pharmaceutical compositions are provided in, for example, Remington 's Pharmaceutical Sciences 18" Edition, supra, and Modern Pharmaceutics 2" Edition, supra.
  • Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug.
  • the daily dose for a patient is expected to be between 0.01 and 1,000 mg per adult patient per day.
  • Example 1 Cloning HG67
  • the full-length coding sequence of HG67 was cloned using the strategy and procedures described previously by McDonald, et al. 1998. Biochem. Biophys. Res. Commun., 247, 266-270. Pooled cDNA libraries of fetal brain, testis, placenta, and prostate were used for the cloning. The following primers were used for PCR and sequencing reactions: SEQ. ID. NO. 15 CTGACATCTATATCTGCAACCTGG
  • PCR reactions were carried out using SEQ. ID. NO. 15 and SEQ. ID. NO. 16 primers to screen superpools of arrayed cDNA libraries. Positive pools were identified.
  • PCR-based race reactions were carried out using vector and gene- specific primers as follows: SEQ. ID. NO. 15 + SEQ. ID. NO. 21 (vector primer) or SEQ. ID. NO. 20 (vector primer), and SEQ. ID. NO. 16 + SEQ. ID. NO. 21 or SEQ. ID. NO. 20.
  • the PCR products from these reactions were used as templates to carry out secondary PCR reactions using primers nested within the primary reactions, i.e., SEQ. ID. NO. 17 (inside of SEQ. ID. NO. 15) + SEQ. ID. NO. 22 (vector primer) or SEQ. ID. NO. 19 (vector primer) for templates from SEQ. ID. NO. 15-containing primary reactions, and SEQ. ID. NO.18 (inside of SEQ. ID. NO. 16) + SEQ. ID. NO. 22 or SEQ. ID. NO. 19 for templates from SEQ. ID. NO.16- containing primary reactions.
  • Amplified products were purified and sequenced using Ml 3 forward and reverse primers, and the SEQ. ID. NO. 17 and SEQ. ID. NO. 18 primers. The sequences were analyzed and assembled, resulting in the identification of an open reading frame of 1023 nucleotides encoding a polypeptide of 340 amino acids and a stop codon. A full-length clone was obtained by PCR from a fetal brain library.
  • HG67 cDNA Sequence (SEP. ID. NO. 2) ATGAATCCATTTCATGCATCTTGTTGGAACACCTCTGCCGAACTTTTAAAC AAATCCTGGAATAAAGAGTTTGCTTATCAAACTGCCAGTGTGGTAGATAC AGTCATCCTCCCTTCCATGATTGGGATTATCTGTTCAACAGGGCTGGTTGG CAACATCCTCATTGTATTCACTATAATAAGATCCAGGAAAAAAAACAGTCC CTGACATCTATATCTGCAACCTGGCTGTGGCTGATTTGGTCCACATAGTTG GAATGCCTTTTCTTATTCACCAATGGGCCCGAGGGGGAGAGTGGGTGTTT GGGGGGCCTCTCTCTGCACCATCATCACATCCCTGGATACTTGTAACCAATTT GCCTGTAGTGCCATCATGACTGTAATGAGTGTGGACAGGTACTTTGCCCTC GTCCAACCATTTCGACTGACACGTTGGAGAACAAGGTACAAGACCATCCG GATCAATTTGGGCCTTTGGGCAGCTTCCTTTA
  • Notl site of pEFl/V5-HisB plasmid vector (Invitrogen, Carlsbad, CA).
  • the resultant construct was transfected into HEK-293T cells using Effectene (Qiagen, Hilden, Germany) or LipofectAmine PLUS (Life Technologies) according to the manufacture's instructions.
  • Human embryonic kidney cells constitutively expressing SV40 large T antigen (HEK-293T) were maintained in D-MEM/F-12 medium (Life Technologies, Rockville, MD) supplemented with 10% fetal bovine serum, 100 units/ml penicillin-G and 100 ⁇ g/ml streptomycin at 37°C with 5% C0 2 in a humidified atmosphere.
  • the intracellular calcium ion concentration ([Ca 2+ ],) was measured fluorometrically using a Ca + -sensitive fluorescent dye, fura-2.
  • HEK293T cells transiently transfected with pEFl/V5-HisB plasmid vector harboring HG67 cDNA were harvested by phosphate-buffered saline containing 2 mM EDTA 48 hours after transfection, and washed once with the assay buffer (Hanks' balanced salt solution, 10 mM HEPES, 0.1% BSA, pH 7.4).
  • the cells were suspended with the buffer containing 2 ⁇ M fura-2 acetoxymethylester (Dojin, Kumamoto, Japan) into the cell density of 1.0 x 10 7 cells/ml and incubated at 37°C for 60 minutes with gently shaking.
  • the fura-2-loaded cells were washed twice with the buffer and re-suspended with the buffer to 1.0 x 10 6 cells/ml.
  • 0.5 ml of the resultant suspension was stirred continuously at 37°C in a glass cuvette during the measurement.
  • HEK293T cells were seeded into 24-well culture plates coated with poly-L-Lys at 1 x 10 5 cells/well and were cultured dunng over-night.
  • the adherent cells were transfected with pEFl/V5-H ⁇ sB/MCH-2R plasmid (see Example 2) Forty- eight hours after transfection, the transfected monolayer cells were nnsed with D- MEM/F-12 medium containing 10% fetal bovine serum, 15 mM HEPES and 0.1% bacitracm. The cells were then incubated in 220 ⁇ l/ well of the same medium with [ 125 I]-MCH (100 pM, NEN Life Science Products, Boston, MA) for 30 minutes at 37°C.
  • the cells were washed three times with the ice cold medium and lysed with 500 ⁇ l/well of 2 M NaGH.
  • the lysates were transferred into test tubes and the cell- bound radioactivity was measured by a CPBLA Quantum ⁇ - counter (Packard Instrument, Menden, CT). Nonspecific binding was defined in the presence of 1 ⁇ M cold MCH.
  • HEK/293/aeql7/G ⁇ l5 were grown in Dulbecco's Modified Medium (DMEM, GIBCG-BRL, Gaithersburg, MD, USA) + 10% fetal bovme serum (heat inactivated), 1 mM sodium pyruvate, 500 ⁇ g/ml Geneticin, 200 ⁇ g/ml zeocin, 100 ⁇ g/ml streptomycin, 100 units/ml penicillin.
  • Plasmid DNA of HG67 and MCH-RI were transfected into HEK293/aeql7/G ⁇ l5 using L ⁇ pofectamme-2000 (Gaithersburg, MD, USA) following the conditions suggested by GIBCG-BRL.
  • the cells were then washed once with Versene (GIBCO-BRL, Gaithersburg, MD, USA), detached using Enzyme-free cell dissociation buffer (GIBCO-BRL, Gaithersburg, MD, USA), diluted into ECB (Ham's F12 nutnent mixture (GIBCO-BRL) + 0.3 mM CaCl 2 , 25 mM HEPES, pH7.3, 0.1% fetal bovme serum). The cell suspension was centnfuged at 500x g for 5 minutes. The supernatant was removed, and the pellet was resuspended in 10 mL ECB. The cell density was determined by counting with a hemacytometer and adjusted to 500,000 cells/ml m ECB.
  • HG67 expression using the aequorin-expressing stable reporter cell line 293-AEQ17 was performed employing a Luminoskan RT luminometer (Labsystems Inc., Gaithersburg, MD). 293-AEQ17 cells (8 x 10 5 cells plated 18 hours before transfection in a T75 flask) were transfected with 22 ⁇ g human HG67/pIRESpuro plasmid DNA:264 ⁇ g lipofectamine.
  • the cells were harvested, washed once in ECB medium and resuspended to 500,000 cells/ml.
  • Membrane binding assays were performed on transiently-transfected COS-7 cells using MCH-R2 in the plasmid vector pCIneo, or on a CHO line stably expressing MCH-R2 in the plasmid vector pEFl/V5-HisB.
  • COS-7 cells were cultured in Dulbecco's modified Eagle medium (Gibco BRL) with 10% heat inactivated fetal calf serum.
  • a suspension of 7 x 10 6 COS-7 cells were transfected with 20 ⁇ g of pCIneo/MCH-R2 plasmid by electroporation (Strader, et al., 1987. Proc. Natl. Acad. Sci. U.S.A. 84(13), 4384-8), and cells were harvested after 60-72 hours.
  • Membranes were prepared from transient and stable transfectants by hypotonic lysis, frozen in liquid nitrogen, and stored at -80°C as described (MacNeil, et al, 1994. Biochem. Biophys. Res. Commun. 198, 328-334).
  • SPA scintillation proximity assay
  • Binding buffer contained 50 mM Tris pH 7.4, 8 mM MgCl 2 , 12% glycerol, 0.1% BSA (Sigma, St. Louis, MO) and protease inhibitors (4 ⁇ g/ml of leupeptin (Sigma, St. Louis, MO), 40 ⁇ g/ml of Bacitracin (Sigma, St. Louis, MO), 5 ⁇ g/ml of Aprotinin (Roche Molecular Biochem., Indianapolis, IN), and 100 ⁇ M AEBSF (Roche Molecular Biochem., Indianapolis, IN)).
  • Assays were optimized with respect to membrane preparations: for CHO/MCH-R1 membranes, 1 ⁇ g of membranes per well yielded a > 6x specific binding window and for COS or CHO MCH-R2 membranes, 8 ⁇ g of membrane protein yielded a window of about 3x. Specific binding is defined as the difference between total binding and non-specific binding conducted in the presence of 500 nM unlabeled MCH. Beads were coated with membranes for 20 minutes and dispensed to the 96 wells, various concentrations of test compounds in DMSO were added (final DMSO concentration l%-2%), then 25 nCi of [ 125 I]Phe ,3 Tyr 19 -MCH was added to the wells. After equilibrating at room temperature for 3 hours, the plates were read in a TopCount (Packard, Meriden, CT). IC 50 calculations were performed using Prism 3.0 (GraphPad Software, San Diego, CA).
  • MCH-R2 appears to activate G ⁇ q. MCH very potently stimulated IP turnover through MCH-R2. MCH-R2 displayed an EC 50 of 2.8 nM while MCH-RI showed an EC 50 of about 90nM. Intracellular calcium mobilization through MCH-R2 was not affected by different concentrations of pertussis toxin (PTX), while MCH-RI signaling was reduced in a dose dependent manner to about 50%. The results of incomplete PTX-inhibition of MCH-RI signaling is in contrast to Lembo, et al, 1999. Nat Cell Biol. 1(5), 267-71, who found complete PTX inhibition of MCH-1R signaling and might be attributed to different expression levels of recombinant receptor. A recent report indicates a PTX insensitive MCH response in insulin producing cells such as CRI-Gl and RLNm5F. (Tadayyon, et al, 2000. 275(2), 709- 712).
  • MCH-R2 is specifically expressed in the brain. Within the brain, high levels of MCH-R2 were detected in the cerebral cortex, hippocampus, and hypothalamus. Other areas of expression included caudate nucleus, putamen and thalamus.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Cardiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Zoology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Child & Adolescent Psychology (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Emergency Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2000/031240 1999-11-16 2000-11-14 G-protein coupled receptor Ceased WO2001036479A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2001538968A JP2003514549A (ja) 1999-11-16 2000-11-14 Gタンパク質共役受容体
CA002392090A CA2392090A1 (en) 1999-11-16 2000-11-14 G-protein coupled receptor
EP00978622A EP1233981A4 (en) 1999-11-16 2000-11-14 RECEPTOR COUPLED TO A G-PROTEIN

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US16587199P 1999-11-16 1999-11-16
US60/165,871 1999-11-16
US18897700P 2000-03-13 2000-03-13
US60/188,977 2000-03-13
US19802900P 2000-04-18 2000-04-18
US60/198,029 2000-04-18

Publications (1)

Publication Number Publication Date
WO2001036479A1 true WO2001036479A1 (en) 2001-05-25

Family

ID=27389191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/031240 Ceased WO2001036479A1 (en) 1999-11-16 2000-11-14 G-protein coupled receptor

Country Status (5)

Country Link
US (1) US6593108B1 (https=)
EP (1) EP1233981A4 (https=)
JP (1) JP2003514549A (https=)
CA (1) CA2392090A1 (https=)
WO (1) WO2001036479A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002003070A1 (en) 2000-07-05 2002-01-10 Takeda Chemical Industries, Ltd. Method for screening mch receptor antagonist/agonist
US7125885B2 (en) 2001-05-04 2006-10-24 Amgen Inc. Fused heterocyclic compounds
US7141391B2 (en) 2001-11-13 2006-11-28 Neurogen Corporation Monkey and canine melanin concentrating hormone receptors
US7253179B2 (en) 2002-11-06 2007-08-07 Amgen Inc. Fused heterocyclic compounds

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1265925A2 (en) * 2000-02-23 2002-12-18 PHARMACIA & UPJOHN COMPANY G protein-coupled receptors
JP4780365B2 (ja) * 2000-07-05 2011-09-28 武田薬品工業株式会社 Mch受容体アンタゴニスト・アゴニストのスクリーニング方法
WO2002097394A2 (en) * 2001-05-31 2002-12-05 Merck & Co., Inc. Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
KR100820095B1 (ko) 2006-12-14 2008-04-07 부경대학교 산학협력단 양식 넙치의 멜라닌 농축 호르몬 수용체

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5686597A (en) * 1995-06-06 1997-11-11 Incyte Pharmaceuticals, Inc. Thrombin receptor homolog

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9214857D0 (en) * 1992-07-13 1992-08-26 Medical Res Council Human nucleic acid fragments and their use
EP0848060A3 (en) 1996-12-11 2000-02-02 Smithkline Beecham Corporation Novel human 11CB splice variant
EP1153932A1 (en) * 1999-02-19 2001-11-14 Takeda Chemical Industries, Ltd. Novel g protein-coupled receptor protein and dna thereof
CA2296792A1 (en) 1999-02-26 2000-08-26 Genset S.A. Expressed sequence tags and encoded human proteins
JP2003505082A (ja) 1999-07-26 2003-02-12 ジェネンテック・インコーポレーテッド 新規なポリヌクレオチドとその使用法
WO2001007606A1 (en) 1999-07-27 2001-02-01 Smithkline Beecham Plc Axor21, a g-protein coupled receptor
CA2390547A1 (en) * 1999-11-17 2001-05-25 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human g protein-coupled receptors
EP1265925A2 (en) * 2000-02-23 2002-12-18 PHARMACIA & UPJOHN COMPANY G protein-coupled receptors
JP2005229804A (ja) * 2000-03-24 2005-09-02 Astellas Pharma Inc 新規なメラニンコンセントレーティングホルモン受容体

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5686597A (en) * 1995-06-06 1997-11-11 Incyte Pharmaceuticals, Inc. Thrombin receptor homolog

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1233981A4 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002003070A1 (en) 2000-07-05 2002-01-10 Takeda Chemical Industries, Ltd. Method for screening mch receptor antagonist/agonist
EP1298439A4 (en) * 2000-07-05 2005-11-23 Takeda Pharmaceutical PROCESS FOR SCREENING MHC RECEPTOR ANTAGONISTS OR AGONISTS
US7273710B2 (en) 2000-07-05 2007-09-25 Takeda Pharmaceutical Company Limited Method for screening MCH receptor antagonist/agonist
US7125885B2 (en) 2001-05-04 2006-10-24 Amgen Inc. Fused heterocyclic compounds
US7141391B2 (en) 2001-11-13 2006-11-28 Neurogen Corporation Monkey and canine melanin concentrating hormone receptors
US7253179B2 (en) 2002-11-06 2007-08-07 Amgen Inc. Fused heterocyclic compounds

Also Published As

Publication number Publication date
EP1233981A4 (en) 2003-02-12
CA2392090A1 (en) 2001-05-25
JP2003514549A (ja) 2003-04-22
US6593108B1 (en) 2003-07-15
EP1233981A1 (en) 2002-08-28

Similar Documents

Publication Publication Date Title
US6599718B1 (en) Growth hormone secretagogue related receptors and nucleic acids
JPH10295376A (ja) ヒトgpr14レセプターのクローニング
US6593108B1 (en) Nucleic acid molecule encoding a melanin-concentrating hormone receptor 2 polypeptide
US7198910B1 (en) Nucleic acid encoding melanin-concentrating hormone receptor
US6242572B1 (en) Human G protein coupled lysophosphatidic acid receptor
WO2000050563A9 (en) G protein-coupled receptor resembling galanin receptors
US7148026B2 (en) Dog melanin-concentrating hormone receptor
WO2001068706A1 (en) Melanin concentrating hormone receptor chimeric and fusion proteins
US7208282B2 (en) Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
US20040248129A1 (en) Rhesus monkey, dog and feeret melanin-concentrating hormone type 1 receptor
US20050069883A1 (en) Melanin-concentrating hormone receptor antagonist binding protein
JP2002525077A (ja) T型カルシウムチャンネル
WO2000059529A1 (en) Mouse edg1
CA2427763A1 (en) Cell lines expressing a mch receptor
JPH11253182A (ja) Gaba bp ポリペプチドおよびポリヌクレオチド
US7314861B2 (en) Melanin-concentrating hormone analogs
US7029878B2 (en) Melanin concentrating hormone receptor chimeric and fusion proteins
JP2004522422A (ja) Mch受容体を発現する細胞系
JP2002511488A (ja) 新規化合物
JP2002537773A (ja) サル性腺刺激ホルモン放出ホルモン受容体

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 538968

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2392090

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2000978622

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000978622

Country of ref document: EP