WO2001029211A9 - Method for directed evolution by random chimeragenesis on transient templates - Google Patents
Method for directed evolution by random chimeragenesis on transient templatesInfo
- Publication number
- WO2001029211A9 WO2001029211A9 PCT/US2000/029046 US0029046W WO0129211A9 WO 2001029211 A9 WO2001029211 A9 WO 2001029211A9 US 0029046 W US0029046 W US 0029046W WO 0129211 A9 WO0129211 A9 WO 0129211A9
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- template
- oligonucleotides
- polynucleotide
- stranded
- chimeric
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1031—Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
Definitions
- directed evolution The process of altering genetic functions through generation of mutants, and/or chimeric genetic recombinants, coupled with selection and/or screening is termed "directed evolution.” Recombination between altered or otherwise non- identical polynucleotide targets allows the consolidation of favorable mutations that originally occurred on separate copies of the target, as well as the elimination of detrimental mutations (Harayama, S. Trends Biotechnol, 16:76-82 (1998)).
- Methods of directed evolution include the "sexual PCR” method, which involves cleaving a population of target DNA using DNase I, followed by the reassembly/recombination of DNA fragments by a self-primed Polymerase Chain Reaction (hereinafter "PCR") (W.P.C. Stemmer, (1994) Nature, 370:389-391; United States Patent Nos. 5,605,793 and 5,811,238).
- PCR Polymerase Chain Reaction
- RPR Random Priming Recombination
- StEP Stauding Extension Process
- An essential step for both of these methods is a PCR step.
- RPR utilizes elongation of randomly annealed primers to synthesize fragments from a given template. These fragments are then used for the reassembly step in the sexual PCR method.
- StEP involves the binding of a primer to the terminus of a population of a mutant or wild-type template.
- a brief round of polymerization extends the primers, however, extension is prematurely halted, resulting in a DNA fragment shorter than the original template.
- the short fragment is denatured from its original template and allowed to reanneal, potentially to a template with a different mutation.
- Subsequent brief rounds of polymerization and denaturation further extend these fragments, eventually producing newly synthesized strands as long as the template strand.
- the result of these methods of directed evolution are "chimeric" polynucleotides, so called because they include sequences from more than one parent gene.
- these methods can suffer from "blind spots" in the gene or polypeptide of interest, where exchanges between parental DNA from two or more sources is rare or nonexistent due to the manner in which the DNA is fragmented or because regions of homology of a certain size are generally required to allow homologous recombination between the parental DNA.
- Chimeric polynucleotides contain nucleotide sequences from multiple sources, typically related sequences or otherwise similar polynucleotides, referred to herein as "parent polynucleotides". Any number of parent polynucleotides can be utilized. In particular embodiments two, three and four parents are present. The partial sequences are usually presented in the form of an "oligonucleotide population".
- the method facilitates the recombination of regions of parent polynucleotides derived or isolated from any suitable source of nucleic acid, including known sequences, unknown or uncharacterized sequences, e.g., nucleic acid molecules isolated from environmental or other sources, and regions of randomly generated sequence, into a chimeric polynucleotide.
- the method allows for deletion and/or insertion of sequences from reference parent polynucleotides compared to the resultant chimeric polynucleotides.
- the present method termed “Random Chimeragenesis on Transient Templates” (hereinafter the “RACHITTTM method”) results in low levels of siblings (clones produced by replication rather than separate recombination events), inactive proteins or unshuffled parental clones.
- the method also yields an unprecedented predominance of highly chimeragenic (mosaic) clones and provides the unique ability to effect frequent recombination between close and even adjacent alleles. These observed improvements are in the key mechanisms that determine the diversity and evolutionary potential of gene shuffled libraries. These elements combined indicate an ability to explore more diverse permutations of multiple mutations with the RACHITTTM method than has been possible using other methods.
- the ability to capture untapped regions of sequence space better allows the evolution of polynucleotides encoding proteins having desired characteristics.
- the advantages of the RACHITTTM method can be attributed, at least in part, to the aspects of the method as described below.
- the RACHITTTM method utilizes a single round of hybridization, as opposed to reiterative thermocycling, and thus lends itself to greater specificity in similar or more divergent pairings. When necessary, it also incorporates "flap" trimming to result in perfectly duplexed ligatable/extendable ends from otherwise unproductive fragments. Trimming also allows incorporation of fragments much smaller that those generated by DNase I. In addition, many DNA ligases allow ligation of mismatched termini. Where flaps are not perfectly trimmed, such low-fidelity ligation may contribute to incorporation of fragments with adjacent mismatches.
- RACHITTTM Ligation of adjacent fragments from the same parent also allows linking of larger stretches from any given parent than were present after DNase I cleavage.
- the RACHITTTM method typically exploits a bottom strand template from one parent and top strand fragments from the same and/or other parents. This prevents parental fragments from reannealing to their own complementary strands.
- the present invention is drawn to a method for forming at least one chimeric polynucleotide including the steps of contacting a single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template and treating the hybridized oligonucleotides to form a chimeric polynucleotide.
- the population of oligonucleotides can be random.
- the method can further include steps of trimming flaps and filling in gaps.
- the invention is directed to a method for forming a chimeric polynucleotide including contacting a single-stranded polynucleotide template with a population of oligonucleotides under conditions such that at least two oligonucleotides hybridize to a given template, and wherein the population of oligonucleotides comprises oligonucleotides such that two or more regions of the template are complementary to two or more oligonucleotides of the population; and ligating the hybridized oligonucleotides such that one chimeric polynucleotide, is generated.
- the invention is directed to a method for forming at least one chimeric polynucleotide including contacting a single-stranded polynucleotide template with a population of oligonucleotides, wherein at least two of the oligonucleotides hybridize to the same template, and containing at least one flap; removing flaps; and ligating the hybridized oligonucleotides such that one chimeric polynucleotide, is generated.
- In another embodiment of the present invention is drawn to a method for generating at least one chimeric polynucleotide, wherein one or more characteristics of the chimeric polynucleotide is altered in comparison to at least one reference polynucleotide.
- This embodiment includes the steps of generating a population of oligonucleotides, comprising randomly fragmenting at least one polynucleotide; contacting at least one single-stranded polynucleotide template with the population of oligonucleotides under conditions wherein at least two oligonucleotides hybridize to the template; optionally removing flaps filling in gaps between hybridized oligonucleotides; ligating hybridized oligonucleotides to form at least one chimeric polynucleotide, hybridized to a template; selectively amplifying the chimeric polynucleotides and selecting or screening at least one chimeric polynucleotide having said specified characteristic altered in comparison to the reference polynucleotide.
- the invention is directed to a method for forming a chimeric polynucleotide including contacting a single-stranded template with a random population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template, filling in gaps between the hybridized oligonucleotides, and ligating the hybridized oligonucleotides such that a chimeric polynucleotide is formed.
- the populations of oligonucleotides can be random.
- the method can further include a step of trimming flaps. Both 3' and 5' flaps can be trimmed.
- the template can include a coding region.
- a template-length chimeric polynucleotide can be formed.
- the population of oligonucleotides can be produced by fragmenting a single-stranded nucleic acid. Alternatively, the population of oligonucleotides can be produced synthetically.
- a plurality of chimeric polynucleotides can be formed. The number of chimeric polynucleotides formed and the number of single-stranded templates can be in a ratio of about 1.
- the invention is directed to a non-reiterative process for forming a template-length chimeric polynucleotide including contacting a single- stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; and ligating the hybridized oligonucleotides, thereby forming a template-length chimeric polynucleotide.
- the method can further include a step of filling-in gaps.
- the method can further include a step of trimming flaps.
- the invention is directed to a method for forming a chimeric polynucleotide including the steps of contacting a single-stranded template with a population of oligonucleotides produced by fragmenting a single-stranded nucleic acid or by chemical synthesis under conditions such that at least two of the oligonucleotides hybridize to the template; and ligating the hybridized oligonucleotides, thereby forming a template-length chimeric polynucleotide.
- the population of oligonucleotides can be random.
- the method can further include a step of filling-in gaps.
- the method can further include a step of trimming flaps.
- the invention is directed to a method for forming a plurality of chimeric polynucleotides on single-stranded polynucleotide templates, wherein the number of chimeric polynucleotides formed and the number of single- stranded templates is in a ratio of about 1 including the steps of contacting a single- stranded template with a population of oligonucleotides produced by fragmenting a single-stranded nucleic acid or by chemical synthesis, under conditions such that at least two of the oligonucleotides hybridize to the template; and ligating the hybridized oligonucleotides, thereby forming a template-length chimeric polynucleotide.
- the method can further include a step of filling-in gaps.
- the method can further include a step of trimming flaps.
- the invention is directed to a kit for performing a method of directed evolution comprising components for fragmenting oligonucleotides, for filling-in gaps, for trimming flaps, for proofreading, for incorporating uracils in templates and for modifying templates.
- the kit can further include instructions for performing a method of directed evolution.
- the invention is directed to a kit for performing a method of directed evolution comprising components consisting of lambda exonuclease and DNase I.
- the kit can further include additional instructions for performing a method of directed evolution.
- the kit can also include components such as those for filling-in gaps, for trimming flaps, for proofreading, for incorporating uracils in templates and for modifying templates.
- the invention is directed to a kit for performing a method of directed evolution comprising components consisting of lambda exonuclease, deoxyuracil triphosphate and uracil DNA glycosolase.
- the kit can further include instructions for performing a method of directed evolution.
- the kit can further include additional components such as those useful for filling-in gaps, for trimming flaps and for proofreading.
- the present invention is also related, at least in part, to the discovery that mRNA is particularly well suited for forming the template for the RACHITTTM method. The utilization of an mRNA template allows for convenient production of templates and a higher affinity of binding when completed with DNA oligonucleotides..
- mRNA templates can be rapidly removed or degraded from the formed chimeric polynucleotides using reagents or enzymes specific for RNA. This is particularly advantageous when selective amplification of the chimeric polynucleotide is desired.
- the present invention is directed to a method for forming a chimeric polynucleotide including the steps of preparing a single-stranded template containing RNA; contacting the single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; and treating the hybridized oligonucleotides such that at least one contiguous chimeric polynucleotide is formed.
- the template can be mRNA.
- the method can include the step of selectively amplifying the chimeric polynucleotide relative to the mRNA template. This selective amplification can be achieved by an in vitro nucleic acid amplification.
- the step of treating the hybridized oligonucleotides can be an enzymatic treatment.
- the population of oligonucleotides can include oligonucleotides generated by in vitro amplification or synthetic production. At least one oligonucleotide in the population of oligonucleotides can include a region of random sequence. Additionally, the single-stranded template can include at least one region of random or partially random sequence.
- the method of the present invention can also include the additional step of selecting a chimeric polynucleotide for a particular characteristic.
- the method of the present invention can also include additional steps such as trimming flaps, filling in gaps between hybridized oligonucleotides and/or ligating hybridized oligonucleotides.
- the step of trimming flaps can precede, follow, or occur concurrently with the step of filling in gaps between hybridized oligonucleotides.
- Gaps can be filled in using a polymerase with reverse transcriptase activity.
- Hybridized oligonucleotides can be ligated using ligases, such as Taq DNA ligase or T4 DNA ligase.
- the single-stranded mRNA template can be protected during the step of trimming flaps, by annealing one or more pre-selected oligonucleotides to either or both ends of the template.
- the present invention is directed to a method for generating at least one chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule is altered in comparison to at least one reference polynucleotide, including the steps of preparing a single- stranded polynucleotide template containing mRNA; contacting the single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; trimming flaps; filling in gaps between adjacently hybridized oligonucleotides; ligating immediately adjacently hybridized oligonucleotides to form at least one chimeric polynucleotide; selectively amplifying the chimeric polynucleotide with respect to the single-stranded polynucleotide template; and selecting or screening at least one chimeric polynucleotide, wherein a specified characteristic is altered in comparison to the reference polyn
- the present invention is directed to a chimeric polynucleotide prepared according to the method of the invention.
- the invention is directed to a method for preparing an mRNA transient template for use in forming a chimeric polynucleotide including the steps of preparing a DNA molecule comprising a suitable vector and an insert to be transcribed; transforming a suitable cell with the DNA molecule such that transcription of the DNA molecule occurs; lysing the transformed cell; and purifying the transcribed mRNA product from the cell lysate.
- the method of the present invention can include the step of protecting the mRNA template.
- the present invention is also directed to the template formed by the method described herein.
- the present invention is directed to a method for preparing an mRNA transient template in vitro for use in forming a chimeric polynucleotide including the steps of: preparing a DNA molecule comprising a suitable promoter and an insert to be transcribed; transcription of the DNA molecule utilizing elements required for transcription; and purifying the transcribed mRNA product.
- the elements required for transcription can include a DNA-dependent RNA polymerase ⁇ i.e., a polymerase with "transcriptase" activity). Additionally, the elements required for transcription can include wheat germ or reticulocyte extracts.
- the method can include the step of protecting the mRNA template.
- the present invention is directed to the template formed by the method described herein.
- the method comprises preparing the single-stranded template. Two or more genes can be recombined in the process.
- the population of oligonucleotides can include cDNA or fragments thereof.
- the present invention is also related, at least in part, to the discovery of modifications of single-stranded templates used to assemble oligonucleotides prior to recombination.
- the present invention optimizes a combined trimming, polymerization and ligation step (hereinafter "TPL").
- TPL combined trimming, polymerization and ligation step
- Such modifications to the single-stranded template lead to an increase in the degree of chimeragenesis in the products by limiting polymerization during the TPL step to filling in only short gaps between adjacently hybridized oligonucleotides. Since filling in gaps between oligonucleotides results in the synthesis of sequences complementary to the template, the overall degree of chimeragenesis of the eventual product is typically lowered when long gaps are filled in.
- limiting the polymerization step to short gaps can increase the overall degree of chimeragenesis of the product polynucleotide. Moreover, this improvement also increases the overall proportion of chimeric products formed by limiting the formation of non-chimeric products.
- Modifications to the single-stranded template include both physical and chemical modifications. Methods for making and using the modified polynucleotide templates are also provided.
- the present invention is directed to a method for forming at least one chimeric polynucleotide including the steps of preparing a single- stranded polynucleotide template; modifying the single-stranded polynucleotide template such that the degree of chimeragenesis is altered; contacting the modified template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; filling in gaps between hybridized oligonucleotides on the template; and ligating adjacently hybridized oligonucleotides to form the chimeric polynucleotide.
- the invention is directed to modifications of the single-stranded template or other components utilized by the method that affect the step of filling in gaps between hybridized oligonucleotides on the template.
- the filling in of gaps can be accomplished using a DNA polymerase such as T4 DNA polymerase, Taq DNA polymerase or Pfu polymerase.
- a modification of a template can be either a chemical or physical modification. Such modifications include enzymatic modification of nucleotide residues or the annealing of short, e.g., 6-100, e.g., 6-20 bases, oligonucleotides to the single-stranded polynucleotide template.
- the invention can include additional steps of trimming flaps, amplification and selection of chimeric polynucleotides with specific properties.
- the present invention is directed to a method for preparing at least one chimeric polynucleotide.
- the method includes the steps of preparing a single- stranded polynucleotide template containing a plurality of uracil residues, contacting the template with a population of oligonucleotides in which at least two of the oligonucleotides hybridize to the template, treating the template with an enzyme, filling in gaps between hybridized oligonucleotides on the template, and ligating adjacently hybridized oligonucleotides to form the chimeric polynucleotide.
- the template can be treated with an enzyme such as a uracil glycosylase, such that the template is modified.
- the filling in of gaps can be performed by a DNA polymerase such as T4 DNA polymerase, Taq DNA polymerase or Pfu polymerase.
- the method can utilize templates which contain between 0.01 and 45% uracil residues.
- the method can also include additional steps of trimming flaps, amplification and selection of chimeric polynucleotides with specific properties.
- a method for preparing a chimeric polynucleotide includes the steps of preparing a single-stranded polynucleotide template; hybridizing a pre-selected oligonucleotide to the template; contacting the template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; filling in gaps between hybridized oligonucleotides on the template; and ligating adjacently hybridized oligonucleotides to form the chimeric polynucleotide.
- the pre-selected oligonucleotides can be such that they are resistant to nucleotide extension, e.g., the oligonucleotides terminate in a dideoxy residue. Additionally, the pre-selected oligonucleotides can contain uracil residues.
- the method can further include a step of removing the pre-selected oligonucleotide and replacing it with an oligonucleotide that allows for nucleotide extension.
- the replacement of a uracil-containing oligonucleotide can be accomplished, for example, by treating the oligonucleotide with an enzyme such as UDG prior to nucleotide extension.
- This embodiment of the invention can also further comprise the steps of annealing a second pre-selected oligonucleotide immediately adjacent to the first pre-selected oligonucleotide, and allowing for nucleotide extension from this second oligonucleotide.
- the filling in of gaps can be performed by a DNA polymerase such as T4 DNA polymerase, Taq DNA polymerase or Pfu polymerase.
- the method can also include the steps of trimming flaps, and selection and amplification of chimeric polynucleotides with specific properties.
- the invention is a method for preparing a modified single-stranded polynucleotide template suitable for use in forming a chimeric polynucleotide with an increased degree of chimeragenesis relative to a chimeric polynucleotide formed using an un-modified single-stranded polynucleotide template, including the steps of: obtaining a single-stranded polynucleotide by a method selected from the group consisting of isolating a polynucleotide from a suitable nucleic acid source, synthetically manufacturing a polynucleotide, cleaving the polynucleotide from a larger polynucleotide, and amplifying a polynucleotide obtained by any of these methods; and treating the single-stranded template such that the template is modified an a manner that the step of filling in gaps is altered, thereby increasing the degree of chimeragenesis of the polynucleotide product obtained as
- the modification can be a chemical modification, e.g., one that creates an abasic residue in the polynucleotide template, or a physical modification, e.g., annealing a pre-selected oligonucleotide to the polynucleotide template.
- the present invention is related, at least in part, to the discovery that the single-stranded polynucleotide template can be prepared in vivo using a vector derived from a bacteriophage genome that contains an inserted polynucleotide of interest.
- the bacteriophage is Ml 3 which, as a mature phage particle, contains a single-stranded DNA copy of its genome.
- inserts can be amplified and isolated as single-stranded polynucleotides contained within the M13-derived vector, thus abrogating the need to eliminate the complementary strand of a double-stranded molecule present when polynucleotides are prepared via a different method.
- Oligonucleotides can assemble onto sequences corresponding to the polynucleotide insert contained in the Ml 3- derived vector.
- the template can be synthesized so as to facilitate the selective amplification of the chimeric polynucleotide product relative to the template.
- the present invention is directed to a method for forming a chimeric polynucleotide including the steps of: contacting a single-stranded template comprising a phage vector and a polynucleotide insert with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; and treating the hybridized oligonucleotides such that at least one contiguous chimeric polynucleotide is formed.
- the phage vector can be derived from bacteriophage Ml 3.
- the single-stranded template can be isolated from a biological source.
- the bacteriophage can be amplified in a bacterial strain defective in one or more dUTPases and uracil N-glycosylases, such as a bacterial strain containing a genome with a dut ' /ung ' genotype. Further, the single- stranded template can contain at least one uracil residue.
- Treating the hybridized oligonucleotides can be accomplished by an enzymatic treatment.
- the template and at least one parent polynucleotide used to form the population of oligonucleotides can encode a desulfurizing enzyme or fragment thereof.
- the population of oligonucleotides can include oligonucleotides generated by in vitro amplification or synthetic production.
- the population of oligonucleotides can also include oligonucleotides with a region of random or partially random sequence. Additionally, the single-stranded template can include at least one region of random or partially random sequence.
- This method can be repeated using one or more chimeric polynucleotides to generate the template or the population of oligonucleotides.
- the further steps of trimming flaps, filling in gaps between hybridized oligonucleotides and/or ligating hybridized oligonucleotides can be included in the method of the present invention.
- the step of trimming flaps can precede, follow, or occur concurrently with the step of filling in gaps between adjacently hybridized oligonucleotides.
- Gaps can be filled in using a polymerase such as T4 DNA polymerase, Taq DNA polymerase or Pfu polymerase.
- Hybridized oligonucleotides can be ligated by using appropriate ligases such as Taq DNA ligase or T4 DNA ligase.
- the present invention is directed to a method for generating at least one chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule are altered in comparison to at least one reference polynucleotide, including the steps of: contacting a single-stranded template comprising a phage vector and a polynucleotide insert with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; trimming flaps; filling in gaps between hybridized oligonucleotides; ligating hybridized oligonucleotides to form at least one chimeric polynucleotide; selectively amplifying the chimeric polynucleotide with respect to the single-stranded polynucleotide template; and selecting or screening at least one chimeric polynucleotide, wherein a specified characteristic is altered in comparison to the reference polynucleotide.
- the single-stranded template can be derived from bacteriophage Ml 3.
- the single-stranded template can contain at least one uracil residue.
- the treating of the hybridized oligonucleotides can be accomplished by an enzymatic treatment.
- the template and at least one parent polynucleotide used to form the population of oligonucleotides can encode a desulfurizing enzyme or fragment thereof.
- the population of oligonucleotides can include oligonucleotides generated by in vitro amplification or synthetic production.
- the population of oligonucleotides can include at least one oligonucleotide with a region of random or partially random sequence.
- the single-stranded template can include at least one region of random or partially random sequence.
- the method of this embodiment can be repeated with one or more chimeric polynucleotides used to generate the template or population of oligonucleotides.
- the present invention is directed to a method for generating at least one chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule are altered in comparison to at least one reference polynucleotide, including the steps of: contacting the single-stranded template including of a phage vector and a polynucleotide insert with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; treating the hybridized oligonucleotides such that a heteroduplex polynucleotide containing a contiguous chimeric polynucleotide and the single-stranded template is formed; and transforming a bacterial strain with the heteroduplex.
- the single-stranded template can be derived from bacteriophage M13.
- This method can further include the steps of trimming flaps, filling in gaps or ligating immediately adjacently hybridized oligonucleotides.
- This method can also further include the steps of selectively amplifying the chimeric polynucleotide over the single-stranded template; and selecting chimeric polynucleotides with optimized properties when compared to the reference polynucleotide.
- the invention is directed to a method for the production of a library of chimeric polynucleotides including the steps of: preparing a plurality of single-stranded templates that have a phage vector and a polynucleotide insert; contacting the single-stranded templates with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to more than one template; and treating the oligonucleotides hybridized to each template such that more than one contiguous chimeric polynucleotide is formed, thereby generating the library of chimeric polynucleotides.
- the invention is directed to a library of chimeric polynucleotides produced by the method described herein.
- the invention is directed to a method for producing a single-stranded polynucleotide template for use in forming a chimeric polynucleotide including the steps of: inserting a polynucleotide into a phage vector; transforming bacterial strain with the vector containing the insert; inducing phage growth; harvesting phage particles; and isolating single-stranded DNA from the phage particles; thereby resulting in the recovery of the single-stranded polynucleotide template.
- the present invention is directed to the single-stranded polynucleotide template produced according to the method described herein.
- a method for forming a chemically modified single-stranded polynucleotide template for use in a method of directed evolution comprising preparing a double- stranded polynucleotide comprising the single-stranded polynucleotide template and a complementary polynucleotide strand; denaturing the double-stranded polynucleotide; adding a single-stranded oligonucleotide capable of annealing to the strand complementary to the single-stranded template; and isolating the single-stranded polynucleotide template from its complementary strand and from the added oligonucleotide, thus yielding the purified single-stranded polynucleotide template.
- a method for generating a chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule is altered in comparison to a reference polynucleotide comprising the steps of preparing a double-stranded polynucleotide comprising a single-stranded polynucleotide template and a complementary polynucleotide strand, denaturing the double-stranded polynucleotide; adding a single-stranded oligonucleotide capable of annealing to the strand complementary to the single-stranded template; isolating the single-stranded polynucleotide template from its complementary strand and from the added oligonucleotide, thus yielding the purified single-stranded polynucleotide template; contacting the single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; trimming
- a method for forming a chemically modified single-stranded polynucleotide template for use in a method of directed evolution comprising preparing a double- stranded polynucleotide comprising the chemically modified single-stranded polynucleotide template and a complementary polynucleotide strand; denaturing the double-stranded polynucleotide; and isolating the single-stranded polynucleotide template from its complementary strand, thus yielding the purified single-stranded polynucleotide template.
- a method for generating a chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule is altered in comparison to a reference polynucleotide comprising the steps of contacting the single-stranded template comprising a chemically modified single-stranded polynucleotide, which modification allows the single-stranded template to be immobilized on a solid matrix, and sequences derived from parent polynucleotides, with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; selectively amplifying the chimeric polynucleotide with respect to the single-stranded polynucleotide template; and selecting or screening the chimeric polynucleotide, wherein a characteristic is altered in comparison to the reference polynucleotide.
- a method for generating at least one chimeric polynucleotide, wherein one or more characteristics of the chimeric molecule is altered in comparison to at least one reference polynucleotide comprising the steps of contacting a single-stranded template comprising sequences derived from at least one parent polynucleotide and at least one additional sequence whereby the single-stranded template is about 25% larger than a parent polynucleotide, with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; selectively amplifying the chimeric polynucleotide with respect to the single-stranded polynucleotide template; and selecting or screening at least one chimeric polynucleotide, wherein a specified characteristic is altered in comparison to the reference polynucleotide.
- the invention is directed to method for forming a chimeric polynucleotide including preparing a random population of oligonucleotides from at least one nucleic acid with a preselected nucleotide sequence, contacting a single-stranded template with the population of oligonucleotides under conditions such that at least two of the oligonucleotides hybridize to the template, and ligating the hybridized oligonucleotides such that a chimeric polynucleotide is formed.
- the method can further include a step of filling in gaps.
- the oligonucletides comprise lengths in the range from about 10 nucleotides to about 200 nucleotides.
- the hybridization conditions have been optimized to promote the annealing of short oligonucleotides.
- the treatment to form the chimeric polynucleotide can utilize a cryophilic enzyme.
- the invention is directed to a method for producing a single-stranded polynucleotide template for use in forming a chimeric polynucleotide including the steps of transcribing a double-stranded polynucleotide comprising a phage promoter to create an RNA transcript, reverse transcribing the RNA transcript to create a hybrid polynucleotide, and degrading the RNA strand of the hybrid polynucleotide, thus resulting in a single-stranded polynucleotide template for use in forming a chimeric polynucleotide.
- the invention is direct to the chimeric polynucleotide formed.
- the invention is directed to a method of forming a randomly fragmented population oligonucleotides for use in forming at least one chimeric polynucleotide including treating a double-stranded polynucleotide comprising a parent polynucleotide such that a plurality of modified bases are formed on either or both strand, and treating the double-stranded polynucleotide such that single-strand nicks are created as a result of the treatment and the modified bases, thus forming a randomly fragmented population of oligonucleotides for use in forming at least one chimeric polynucleotide.
- the invention is direct to the chimeric polynucleotide formed.
- the invention is directed to a method of forming a population of single-stranded oligonucleotides for use in forming at least one chimeric polynucleotide including obtaining at least two double-stranded polynucleotides, treating the double-stranded polynucleotides with an exonuclease, thereby obtaining from each double-stranded polynucleotide a strand containing a 3' phosphate, annealing the 3 1 phosphate strands to form heteroduplex nucleic acids, treating the heteroduplex nucleic acids with an enzyme that cleaves mismatches to yield homoduplexes, and treating the homoduplexes with an enzyme to degrade the strand containing the incorporated uracils, thereby forming a population of single- stranded oligonucleotides for use in directed evolution.
- the enzyme that cleaves mismatches is a branch resolving enzyme.
- the branch resolving enzyme can be T4 endonuclease N ⁇ or T7 endonuclease I.
- the method can further include fractionation of the single-stranded oligonucleotides based on size.
- the first and second double-stranded nucleic acid can be from a single source.
- the invention is directed to the population of single- stranded oligonucleotides produced according to the method.
- the invention is directed to a method of forming a population of oligonucleotides for use in forming at least one chimeric polynucleotide including obtaining a double-stranded nucleic acid polynucleotide, obtaining a second double-stranded nucleic acid, denaturing both double-stranded nucleic acids thereby obtaining single-stranded polynucleotides, annealing the single- stranded polynucleotides to form heteroduplex nucleic acids, and treating the heteroduplex nucleic acids with an enzyme that cleaves mismatches to yield oligonucleotides, thereby forming a population of oligonucleotides for use in forming at least one chimeric polynucleotide.
- the invention is directed to the population of oligonucleotides formed. BRDEF DESCRIPTION OF THE DRAWINGS
- Figure 1 is a schematic diagram illustrating an embodiment of a method of the present invention.
- Figure 2 is a schematic diagram showing an example of an oligonucleotide transient template heteroduplex.
- Figures 3A, 3B, 3C and 3D set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszA from Rhodococcus sp. strain IGTS8 (SEQ ID NOS: 8 and 9, respectively).
- Figures 4A, 4B and 4C set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszB from Rhodococcus sp. strain IGTS8 (SEQ ID NOS: 10 and 11, respectively).
- Figures 5A, 5B and 5C set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszC from Rhodococcus sp. strain IGTS8 (SEQ ID NOS: 12 and 13, respectively).
- Figures 6A, 6B, 6C and 6D set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszA from Sphingomonas sp. strain AD 109 (SEQ ID NOS: 14 and 15, respectively).
- Figures 7A, 7B and 7C set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszB from Sphingomonas sp. strain AD 109 (SEQ ID NOS: 16 and 17, respectively).
- Figures 8A, 8B and 8C set forth the DNA sequence and predicted amino acid sequence of the desulfiirization gene dszC from Sphingomonas sp. strain AD 109 (SEQ ID NOS: 18 and 19, respectively).
- Figure 9 shows the results of a microtiter- format assay for DBT monooxygenase activity of 7 chimeric clones obtained by the method of the present invention.
- Figure 10 shows a DNA sequence alignment of a dszC chimera of the present invention (SEQ ID NO: 3) with the parental sequences of dszC from Nocardia sp. strain A3H1 (SEQ ID NO: 23) and Rhodococcus sp. strain IGTS8 (SEQ ID NO: 24).
- Figure 11 is an illustration of the life cycle of a representative virulent bacteriophages.
- Figure 12 depicts an embodiment of the present invention using an immobilized single-stranded template.
- Figure 13 is a schematic of various arrangements of the flanking and parent sequences in the single-stranded transient template.
- Figure 14 is a schematic representation of one arrangement of a transient template with a plurality of parent-derived sequences.
- Figure 15 is a schematic representation of a method of generating donor fragments utilizing a structure-specific endonuclease.
- Figures 16A and 16B are schematic representations of a method of using preselected oligonucleotides which hybridize to either end of the template.
- Chimeric polynucleotides contain nucleotide sequences from multiple sources, typically related sequences or otherwise similar polynucleotides, referred to herein as "parent polynucleotides". Any number of parent polynucleotides can be utilized. In particular embodiments two, three and four parents are present. The partial sequences are usually presented in the form of an "oligonucleotide population".
- the present method facilitates the recombination of regions of parent polynucleotides derived or isolated from any suitable source of nucleic acid, including known sequences, unknown or uncharacterized sequences, e.g., nucleic acid molecules isolated from environmental or other sources, and regions of randomly generated sequence, into a chimeric polynucleotide.
- the present method allows for deletion and/or insertion of sequences from reference parent polynucleotides compared to the resultant chimeric polynucleotides.
- the RACHITTTM method results in low levels of siblings (additional clones produced by replication rather than separate recombination events), inactive proteins or unshuffled parental clones.
- the method also yields an unprecedented predominance of highly chimeragenic (mosaic) clones and provides the unique ability to effect frequent recombination between close and even adjacent alleles. These observed improvements are in the key mechanisms that determine the diversity and evolutionary potential of gene shuffled libraries.
- These elements combined indicate an ability to explore more diverse permutations of multiple mutations with the RACHITTTM method than has been possible using other methods.
- the ability to capture untapped regions of sequence space better allows the evolution of polynucleotides encoding proteins having desired characteristics.
- the advantages of the RACHITTTM method can be attributed, at least in part, to the aspects of the method as described below.
- the RACHITTTM method utilizes a single round of hybridization, as opposed to reiterative thermocycling, and thus lends itself to greater specificity in similar or more divergent pairings. When necessary, it also incorporates "flap" trimming to result in perfectly duplexed ligatable/extendable ends from otherwise unproductive fragments. Trimming also allows incorporation of fragments much smaller that those generated by DNase I. In addition, many DNA ligases allow ligation of mismatched termini. Where flaps are not perfectly trimmed, such low-fidelity ligation may contribute to incorporation of fragments with adjacent mismatches.
- RACHITTTM Ligation of adjacent fragments from the same parent also allows linking of larger stretches from any given parent than were present after DNase I cleavage.
- the RACHITTTM method typically exploits a bottom strand template from one parent and top strand fragments from the same and/or other parents. This prevents parental fragments from reannealing to their own complementary strands.
- the invention is drawn to a method of forming at least one chimeric polynucleotide including the steps of contacting at least one single- stranded polynucleotide template with a population of oligonucleotides, under conditions wherein at least two oligonucleotides hybridize to the template and treating the hybridized oligonucleotides to form at least one chimeric polynucleotide.
- the methods described herein comprise process steps involved in the formation of chimeric polynucleotides.
- Figure 1 depicts schematically the steps utilized by one embodiment of the present invention in forming a chimeric polynucleotide.
- fragments of a population of related oligonucleotides are generated 10 by, for example, random cleavage or partial DNA synthesis or degradation. These oligonucleotide fragments are assembled onto a single-stranded template 20 in such a way as to allow for fragments derived from different molecules to assemble onto the same template. In some cases, overlaps occur, thus creating "flaps" 30.
- overlaps is intended to include the unhybridized portion of an oligonucleotide that is otherwise hybridized to a template. In other cases, regions of the template remain single-stranded, thus creating "gaps" 40.
- Flaps are trimmed and gaps are filled in prior to the generation of a contiguous chimeric polynucleotide by ligating the assembled oligonucleotides 50.
- the product chimeric oligonucleotide can then be selectively cloned, amplified, selected or screened with respect to the template 60 for optimized traits of interest 70.
- the template is selected such that it contains "target" sequences that are related to the parent polynucleotides that are used to generate the population of oligonucleotides.
- Target sequences are related to the parent polynucleotides such that they allow for annealing of parent-derived oligonucleotides.
- the template allows for the assembly of parent-derived oligonucleotides which, following the completion of the steps of the methods of the invention, result in the formation of a chimeric polynucleotide product.
- the template of the present invention can be formed from combinations of any molecules which allow for sequence specific annealing of oligonucleotides.
- examples of such molecules include nucleic acids such as DNA, e.g., cDNA, RNA, e.g. , mRNA, and other molecules such as "Peptide Nucleic Acids” (hereinafter "PNA").
- PNA Peptide Nucleic Acids
- the term PNA as used herein includes polymers, e.g., naturally occurring polyamides (pseudopeptides) which can hybridize to nucleic acids, e.g.
- Such molecules can comprise natural bases, e.g., adenine, thymine, cytosine, guanine and uracil, analog bases, e.g. , inosine, bromouracil and nitroindole, or modified bases e.g., biotin labeled or a digoxygenin labeled or a combination thereof.
- a template of the invention can be of any length.
- the template can be from about 10 to about 100,000 nucleotides in length. In a particular embodiment of the present invention, the template can be from about 100 to about 10,000 nucleotides in length. In a more particular embodiment, the template can be from about 200 to about 1000 nucleotides in length.
- the template can also be about the length of a gene of interest, such genes can be in the form of a genomic copy or a cDNA copy, e.g., without introns.
- the template can comprise the entire coding sequence or a portion of the coding sequence of a gene of interest.
- the template comprises a significant portion of the coding sequence of a gene, e.g., 50%, 60%, 70%), 80%, 90%) or 95% of the coding sequence of a gene.
- regulatory sequences can also be included in the template. Templates of a shorter length, for example, from about 10 to 250 nucleotides in length are also considered to be within the scope of the invention and are useful in particular embodiments.
- the template can be produced in vitro using enzymatic or chemical means. Methods of in vitro production of nucleic acid sequences are well known in the art.
- the template can be circular or linear.
- the template is preferably single-stranded.
- the template can comprise sequences in addition to target sequences, thus creating a template which is larger than the parent polynucleotides.
- the template can be nicked or gapped, wherein "gapped" refers to a partially double-stranded molecule comprising a target sequence and regions flanking the target sequence, wherein all or a portion of the target sequence is single stranded.
- the template can include or preserve one or more regions with functional characteristics or structural motifs of the parent polynucleotides.
- These regions can include nucleic acid structural motifs, protein binding domains, metal binding domains, nucleic acid binding domains, domains with enzymatic activity, or fragments of these domains.
- These regions can include ribozymes, deoxyribozymes, promoters, enhancers, origins of replication, open reading frames, or fragments thereof.
- aptamers are small single- or double-stranded DNA or RNA molecules that bind specific molecular targets (Bock et al, Nature 355:564-566, 1992; Ellington and Szostak, Nature 346:818-822, 1990; and, Werstuck and Green, Science 282:296-298, 1998, the teachings of which are hereby inco ⁇ orated by reference in their entireties).
- the template of the present invention can also include sequences that are not known to have any particular function. These sequences can be selected from any known source of nucleic acid, including sequences synthesized in vitro; or these sequences can be random or partially random.
- Random or partially random sequences can be generated by synthesizing a polynucleotide based on a known sequence, except that a portion of the sequence is randomized, e.g., randomizing the last 50 nucleotides, or wherein certain positions within the sequence are randomized, e.g., randomizing particular codon(s) of a coding sequence or wherein certain bases are randomized, e.g., randomizing all adenines.
- sequences can further encode proteins or domains of proteins including folding structures or structural motifs; binding domains such as protein binding domains, metal binding domains, co-factor binding domains, lipid binding domains and nucleic acid binding domains; domains with enzymatic function; sites for allosteric or competitive inhibition and the like; or fragments of these domains.
- binding domains such as protein binding domains, metal binding domains, co-factor binding domains, lipid binding domains and nucleic acid binding domains
- domains with enzymatic function sites for allosteric or competitive inhibition and the like
- fragments of these domains can also include amino acid sequences that are not known to have any particular function or can be randomized amino acid sequence.
- the present invention utilizes an RNA template, prepared by methods known to those of skill in the art, which allows for the selective amplification of the chimeric polynucleotide over the mRNA template.
- RNA template prepared by methods known to those of skill in the art, which allows for the selective amplification of the chimeric polynucleotide over the mRNA template.
- the utilization of an RNA template allows for the convenient production of single- stranded polynucleotide template molecules without a double-stranded intermediate.
- RNA preferably, mRNA
- transient template is intended to reflect that the template is not directly inco ⁇ orated into the resulting chimeric molecules.
- mRNA template can be prepared using methods known to those of skill in the art (see Molecular Cloning.- A Laboratory Manual, second edition, edited by Sambrook, Fritsch, & Maniatis. Cold Spring Harbor Laboratory (1989), 18.81-18.88, the teachings of which are hereby inco ⁇ orated by reference in its entirety).
- mRNA can be synthesized by in vitro transcription reactions utilizing commercially available bacteriophage DNA- dependent RNA polymerases (e.g., those derived from T3 or T7), or cell extracts containing all components necessary for transcription (e.g., wheat germ extracts or reticulocyte extracts).
- the template can be derived from a larger molecule, e.g., the template can be a fragment of an mRNA molecule.
- RNA is inherently less stable than DNA and this can be alleviated at least in part by adding the 5' cap and poly-A tail.
- RNA RNA double-stranded by adding short DNA oligonucleotides.
- DEPC diethylpyrocarbonate
- an mRNA transcript can be utilized as a template for the present invention either before or after post-transcriptional modification (e.g., generation of the 5' cap, polyadenylation, methylation, and splicing).
- post-transcriptional modification e.g., generation of the 5' cap, polyadenylation, methylation, and splicing.
- the term "mRNA" as used herein, is not intended to be limiting as to the specific state of modification of the transcript.
- the present invention is directed to a method for forming a chimeric polynucleotide including the steps of preparing a single-stranded template containing RNA; contacting the single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; and treating the hybridized oligonucleotides such that at least one contiguous chimeric polynucleotide is formed.
- the template can be isolated from an organism, such as an eubacterial, archeal, eukaryotic or viral organism.
- the template can also be formed using an mRNA intermediate.
- a double-stranded DNA molecule comprising a transcriptional promoter can be transcribed to generate a single-stranded mRNA molecule.
- This mRNA molecule can then be reverse transcribed using a RNA-dependent DNA polymerase (a "reverse transcriptase”), resulting in a RNA:DNA hybrid.
- a reverse transcriptase RNA-dependent DNA polymerase
- Such hybrids can be treated with nucleases such as RNase H, which selectively degrade the RNA strand, thus resulting in a single-stranded DNA molecule which is an exact copy of one of the starting strands. If the starting double-stranded DNA molecule contained target sequences, then the result of transcription followed by reverse transcription and RNA digestion is a single-stranded template suitable for use in the RACHITTTM method.
- nucleases such as RNase H
- a template can be modified to regulate the degree of chimeragenesis of the formed chimeric polynucleotide. Such modification will also increase the overall proportion of chimeric products formed.
- modifications can be physical or chemical.
- An example of a physical modification is modifying the template by annealing a specific oligonucleotide to the template.
- An example of a chemical modification is covalently attaching a specific chemical group to nucleotide residues contained in the polynucleotide.
- the present invention utilizes a single-stranded polynucleotide template isolated from a bacteriophage.
- an Ml 3 bacteriophage is utilized.
- Ml 3 bacteriophage particles contain the bacteriophage genome as a single-stranded DNA molecule that can be used as a "vector.”
- the term "vector" is intended to include any DNA molecule that can contain and replicate an exogenous DNA polynucleotide of interest, and that can be amplified and isolated by methods commonly known to those of ordinary skill in the art.
- Figure 11 depicts a typical bacteriophage infection event into a host bacterium 90.
- Virulent filamentous bacteriophages e.g., M13
- Adso ⁇ tion onto the host cell surface and subsequent entry of the phage genome into the host cell is sometimes mediated by the F-encoded pilus.
- M13 a single-stranded DNA molecule is inserted and the host machinery is recruited to synthesize the complementary strand. Genes are transcribed to promote phage head assembly as well as other late life cycle events.
- the DNA circle is replicated, typically by a rolling circle mechanism, which produces many copies of the single-stranded genome. These copies are processed and packaged into the newly assembled phage heads.
- the host cell is lysed and the new phage particles are released to repeat the cycle in other hosts.
- the phage life cycle provides a mechanism for the amplification of a single-stranded DNA molecule.
- the present invention is a method for forming a chimeric polynucleotide including the steps of preparing a single-stranded template containing bacteriophage DNA with an insert; contacting the single-stranded template with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template; and treating the hybridized oligonucleotides such that at least one contiguous chimeric polynucleotide is formed.
- the step of treating the hybridized oligonucleotides can be an enzymatic treatment.
- the population of oligonucleotides includes oligonucleotides generated by in vitro or in vivo amplification or synthetic production. At least one oligonucleotide in the population of oligonucleotides can include a region of random or partially random sequence. Additionally, the single-stranded template can include at least one region of random or partially random sequence.
- the method utilizes bacteriophage Ml 3 vector DNA (for review, see Messing, J. Methods Enzymol 1983. 101:20-78) containing a polynucleotide of interest as a transient template during the RACHITTTM method.
- the single-stranded template can be prepared using many methods known to those of skill in the art.
- the nucleic acid for use as a template can be synthetically manufactured or isolated from any suitable source of nucleic acid.
- a polynucleotide of interest can be cloned into bacteriophage Ml 3 DNA and amplified by infecting a suitable host bacterial strain.
- the template can be derived from a larger molecule, e.g., the template can be a fragment of an isolated bacteriophage genome.
- Ml 3 is a bacteriophage capable of infecting, for example, Escherichia coli
- the mature phage particle contains a circular single-stranded DNA copy of the phage genome.
- the insertion of convenient restriction sites into the phage genome allows for the use of these phage-derived vectors in the production of single- stranded copies of specific polynucleotide sequences.
- Such M13-derived vectors with convenient restriction sites are commercially available (e.g. , M 13mp 18 and M13mpl9; New England BioLabs, Beverly, MA).
- the present invention utilizes parent-derived polynucleotide sequences inserted into M13-derived vectors.
- Single- stranded templates amplified as part of a phage-derived vector, avoid double- stranded in vitro DNA intermediates required by other methods of preparation, and, thus, do not require a step of digesting one polynucleotide strand of a double- stranded molecule in order to produce a single-stranded template.
- a polynucleotide sequence of interest can be inserted into the vector and a single-stranded copy can be isolated for use in subsequent directed evolution. Additionally, when Ml 3 infects an E.
- coli strain that is defective in dUTPase and uracil N-glycosylase activity (hereinafter referred to as "dut ' /ung '" strains), phage particles containing circular single-stranded DNA molecules containing uracil residues can be isolated. Oligonucleotides can be annealed to these uracil-containing molecules during the RACHITTTM method, and the resultant partially or fully double-stranded molecules can be transformed into an appropriate host cell which has dUTPase and uracil N-glycosylase activities.
- the host cell then completes the synthesis of the second strand on partially double-stranded molecules with the previously annealed oligonucleotides inco ⁇ orated into the newly synthesized strand.
- the uracil containing strand is not replicated and a newly synthesized strand is made.
- the host replication and repair machinery preferentially corrects mismatches between strands by selecting the strand without uracils as the correct strand.
- the newly synthesized stand containing hybridized RACHITTTM oligonucleotides is replicated and the original single stranded template is lost to degradation and dilution.
- the template can be derived from a double-stranded DNA molecule.
- Many methods are known in the art for isolating a single strand of a double-stranded DNA molecule.
- a double-stranded molecule can be generated by restriction endonuclease digestion or by PCR with a primer such that one strand is protected from exonucleases. Treating the double-stranded product with an exonuclease, such as bacteriophage ⁇ exonuclease, specifically eliminates the non-protected (i.e., the non-template) strand.
- the single-stranded template can be separated and purified away from its complementary strand.
- a double-stranded molecule obtained, for instance, as the result of an in vitro amplification of parent polynucleotides or through isolation from natural sources, can be denatured to separate the template strand from the non-template strand.
- the present invention describes methods for specific removal of the non- template strand. For example, after denaturing the template from its complementary strand, one or more oligonucleotides can be annealed to the non-template strand, thus rendering this complex containing the non- template strand both larger and partially double-stranded.
- the template and non- template strands are now distinguishable by techniques known in the art such as electrophoresis, chromatography and gel filtration.
- the present invention is further directed to preparing a single-stranded template that is chemically modified at one end.
- the modification is such that it allows for the specific immobilization of the template strand rather than immobilization of the non-template strand.
- a double-stranded polynucleotide can be generated using a primer pair to a parent polynucleotide in which one of the primers is biotinylated. The result is a molecule in which one strand is biotinylated and the other is not.
- the two strands can be separated after denaturation if they are exposed to a streptavidin-agarose matrix. Streptavidin binds biotin, and, thus, binds all polynucleotide strands which are biotinylated.
- the non-template strand complementary to the single-stranded template can be simply washed away.
- FIG. 12 A general overview of this approach is diagramed in Figure 12.
- This Figure shows the contacting of a double-stranded polynucleotide 190, one strand of which has been chemically modified (denoted by an asterisk), with a solid matrix containing an affinity moiety specific to the chemical group which is used to modify the template strand 200. Attachment of the polynucleotide to the matrix 210 followed by denaturation and washing, yields a single-stranded template attached to a solid matrix 220. This can be used as a substrate for the RACHITTTM method.
- the transient template can be separated from the chimeric RACHITTTM product by denaturation and washing 240.
- the chimeric product is isolated and specifically amplified with respect to the single-stranded transient template.
- This method for preparing a single-stranded transient template can be automated, and also advantageously requires fewer enzymatic steps than other methods of preparation, improves template stability, generates potentially re-usable templates, and allows for both easy purification of the single-stranded template and the subsequent specific amplification of the chimeric RACHITTTM product over the transient template.
- the single-stranded template also contains sequences ("flanking" sequences) derived from sources other than parent polynucleotides, thus making the templates longer than the parent polynucleotide.
- sequences derived from sources other than parent polynucleotides, thus making the templates longer than the parent polynucleotide.
- the a ⁇ angement of parent, or "target,” and flanking sequences is diagramed in Figure 13.
- Target sequences 290 are made longer by adding flanking sequences 300 to the 5' end 310, the 3' end 320 or to both ends 330 of the parent-derived sequence.
- Use of a larger template allows for easier purification of the single-stranded template and for the selective amplification of the chimeric polynucleotide product.
- Figure 14 depicts another a ⁇ angement of the transient template.
- two target sequences 360 and 370 are separated by a nucleotide sequence that does not bind the oligonucleotide fragments 380, i.e., a "linker" sequence.
- the two target sequences can be derived from the same or different parent polynucleotides.
- An advantage of using such a template is that, after the two chimeric polynucleotides are formed 390 and 400, both ends of the template/chimera hybrid are double- stranded, and, thus, resistant to exonuclease activity.
- the present invention is directed to a method for forming a chimeric polynucleotide including the steps of contacting a single-stranded template containing sequences derived from a parent polynucleotide and at least one additional sequence whereby the single-stranded template is at least about 10%>, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90% larger than the parent polynucleotide, with a population of oligonucleotides, under conditions such that at least two of the oligonucleotides hybridize to the template generating a chimeric strand; selectively amplifying the chimeric polynucleotide with respect to the single- stranded polynucleotide template; and selecting or screening at least one chimeric polynucleotide, wherein a specified characteristic is altered in comparison to the reference polynucleotide.
- the template of the present invention is derived from at least one parent polynucleotide.
- the template of the present invention also contains sequences in addition to the parent-derived sequences. These additional sequences increase the length of the template, in a preferred embodiment, by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90%.
- Such a template can be isolated or synthesized by methods known in the art.
- single-stranded DNA templates can be synthesized in vitro in enzymatic amplification reactions or using automated DNA synthesizers.
- parent polynucleotides can be isolated from an organism, such as a eubacterial, archeal, eukaryotic or viral organism.
- the template of the present invention can contain elements that allow for the selective amplification of the resultant chimeric polynucleotides over the templates.
- the additional sequences present in the template of the present invention result in the formation, after the RACHITTTM method is employed, of a partially double-stranded molecule - one strand being the template and the other strand being the chimeric polynucleotide. Since the chimeric polynucleotide was formed based on parent-derived sequences, the template strand will be about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90% longer.
- the chimeric product can be separated from the template by methods designed to separate molecules based on size (e.g., electrophoresis and size-exclusion chromatography), charge (e.g., ion-exchange chromatography), or sequence (e.g., DNA affinity chromatography). Moreover, separation can be accomplished by synthesizing the single-stranded template such that it contains an affinity moiety that can be selectively bound or eluted during affinity chromatography. Examples of such moieties are biotin and digoxygenin, which can be affinity separated along with the molecule to which each is attached, using avidin or anti-digoxygenin antibodies, respectively.
- a template of the invention is contacted with a population of oligonucleotides to form a chimeric polynucleotide.
- the oligonucleotides of the present invention comprise molecules that hybridize to the templates of the invention, e.g., nucleic acids, such that the oligonucleotide sequences can ultimately be joined to form contiguous chimeric molecules.
- the population of the oligonucleotides comprises a random population.
- the term "random" as used herein is intended to reflect an absence of preselection. Such absence can be of any degree; it need not be a total absence of preselection, nor does the term indicate a requirement for an absence of preference or bias.
- oligonucleotides can range over a span of values and any one component can occupy any of these values.
- a population of oligonucleotides which is generated by the digestion of two genes with a restriction enzyme is a "random population" when the particular oligonucleotides formed by the process are not preselected, for example, during a partial digestion. This is true even when the gene sequences are known and the restriction enzyme preferentially cleaves a particular site.
- Sequences can be random if at least one position in the sequence is not specifically defined (for example, if at least one position of an oligonucleotide could be and is either one of two or more nucleotides).
- the randomly fragmented population of oligonucleotides can include oligonucleotides wherein a portion of the oligonucleotides comprise random or partially random sequence as described herein.
- the oligonucleotides can include both DNA and RNA and modifications thereof.
- the DNA or RNA can comprise natural bases, e.g., adenine, thymine, cytosine, guanine and uracil, analog bases, e.g.
- oligonucleotides can comprise single or double-stranded molecules. Double-stranded oligonucleotides can be made single-stranded, for example, by denaturing prior to hybridization. Methods of denaturing and annealing oligonucleotide sequences, including peptide nucleic acid sequences, are well known in the art. Oligonucleotides can be single-stranded and of opposite orientation when compared to the orientation of the template.
- the oligonucleotides of the population do not hybridize to each other, e.g., do not self- anneal.
- the oligonucleotides of the population do not hybridize to each other, e.g., do not self- anneal.
- one of skill in the art can skew the availability of any given oligonucleotide to hybridize to a template by including an oligonucleotide capable of hybridizing to the oligonucleotide.
- Oligonucleotides can be of any length, for example, from about 5 to about 50,000 nucleotides in length. In a particular embodiment, oligonucleotides can be from about 16 to about 400 nucleotides in length. In a still more particular embodiment, the oligonucleotides can be from about 20 to about 200 nucleotides in length. Additionally, in certain embodiments, oligonucleotides can be quite small, ranging in size, for example, from about 5 to 10 nucleotides; preferably ranging from about 10 to 50 nucleotides in length.
- the population of oligonucleotides can include DNA that is reverse transcribed from RNA (hereinafter known as "cDNA").
- cDNA can comprise all or a portion of at least one cDNA library.
- a "cDNA library” is used herein to describe a population of DNA molecules in which the DNA molecules represent all or a portion of at least two different genes.
- the population of oligonucleotides can contain nucleic acid from at least two, three or four different genes which can be recombined to form a chimeric molecule.
- a population of oligonucleotides can comprises molecules generated using any one of the methods described herein or any combinations thereof.
- a random population of oligonucleotides can be generated by randomly fragmenting, digesting or elongating at least one polynucleotide of interest.
- a random population of oligonucleotides can be generated using chemical, physical or enzymatic techniques.
- the invention features a method of generating donor fragments for use in the RACHITTTM method, where the method take advantage of the activity of structure-specific endonucleases, e.g., branch resolving enzymes, e.g., T4 endonuclease VII or T7 endonuclase I.
- the donor fragments for the RACHITTTM method can be generated via structure-specific endonucleases, e.g., branch resolving enzymes, e.g., T4 endonuclease VII or T7 endonuclase I.
- structure-specific endonucleases e.g., branch resolving enzymes, e.g., T4 endonuclease VII or T7 endonuclase I.
- the action of such enzymes can be advantageously utilized by obtaining double-stranded nucleic acid to be used as the donor, inco ⁇ orating uracil residues into a second double-stranded nucleic acid which is not intended to be the source of the donor fragments, treating both nucleic acids with lambda exonuclease to degrade the strand in each that contains a 5' phosphate, annealing the remaining strand from each to form a heteroduplex, treating the heteroduplex with an enzyme that recognizes mismatches (e.g., a branch resolving enzyme such as T4 endonuclease VII or T7 endonuclase I) to yield homoduplexes of varying lengths, and treating the homoduplexes with an enzyme, e.g., uracil DNA glycosylase, to degrade the strand containing the inco ⁇ orated uracils, yielding single-stranded donor fragments.
- an enzyme e.g.,
- FIG. 15 shows the double-stranded donor nucleic acid 430, and the second double-stranded nucleic acid 440, with uracils inco ⁇ orated into it.
- Single-stranded polynucleotides are generated 450 and 460, respectively, which are annealed to form a heteroduplex containing mismatches 470.
- the heteroduplex is treated with an enzyme that recognizes mismatches to yield homoduplexes of varying lengths 480.
- the size of the donor fragments generated with this method can be manipulated in a number of ways.
- the donor fragments can be size fractionated by any of a number of methods well-known in the art (e.g., agarose gel electrophoresis). Duration of treatment with the branch resolving enzyme can also be used to alter the size of the donor fragments produced. If known, the amount of mismatch between the two nucleic acid sources can also be determinative of the size of the homoduplexes, and therefore donor fragments, produced.
- the method described above selects for sequence diversity.
- the two source nucleic acids can be chosen on this basis, e.g., the source genetic material can be two species related by varying degrees.
- a single source can be used, e.g., a mixed culture from a soil sample, instead of two different nucleic acid sources.
- this method can also be utilized to create donor fragments from specific areas of the genome, or from particular domains of a gene. For example, choosing source nucleic acids that are known to differ in sequence in a binding domain can produce donor fragments for the RACHITTTM method that are specific for that domain.
- any nucleic acid with similarity to the template can be used to generate the oligonucleotides of the present invention.
- sufficient similarity means that the sequence of the oligonucleotide need not reflect the exact sequence of the template.
- Conditions are chosen to allow such sequences (and those having low similarity or similar sequences interrupted with dissimilar sequences) to hybridize the template, such that chimeric polynucleotides are formed.
- non-complementary bases or insertions or deletions can be interspersed in sequences.
- a variant of a polynucleotide or polypeptide refers to a molecule that is substantially similar to either the entire polynucleotide or polypeptide molecule, or a fragment thereof.
- variant refers to an amino acid sequence that is altered by one or more amino acids, wherein either a biological function, structure or antigenicity of said sequence or combination thereof is maintained in the variant.
- the variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g. , replacement of leucine with isoleucine.
- variants may have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations may also include amino acid deletions or insertions, or both.
- variant refers to a sequence that is altered by one or more nucleotides.
- the variant may have silent variations, wherein the change does not alter the amino acid encoded by the triplet comprising said variation or the variation is not silent, that is, alterations in encoded amino acids are generated.
- altered version refers to a polynucleotide sequence or a polypeptide sequence, wherein the nucleotide sequence has one or more differences in sequence from a native or wildtype version of said sequence.
- native or wildtype as used herein includes all alleles of the naturally occurring sequence.
- homologs refers to two or more sequences that share significant similarity but are not identical.
- Two DNA sequences are "substantially similar" when at least about 50%, preferably at least about 75%, and most preferably at least about 90 or 95% of the nucleotides match over the defined length of the DNA sequences, e.g., when they share at least about 50%, preferably about 75%, and most preferably at least about 90 or 95% sequence identity over the defined length of the sequence.
- Sequences that are substantially similar can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York; Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press.
- the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been inco ⁇ orated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
- the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, j., et al, Nucleic Acids Res.
- the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-11 (1989)) which has been inco ⁇ orated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- amino acid sequences having, for example, greater than 90 percent identity are considered substantially similar, e.g., those with 90, 91, 92, 93, 94, 95, 96, 97, 98 and 99 percent identity.
- Preferred methods for fragmenting parent polynucleotides in order to generate populations of oligonucleotides are those methods which produce fragments without particular sequence patterns.
- chemical techniques of fragmenting polynucleotides include techniques that use conditions such as pH extremes, hydroxy radical formation, chemical radical formation and chemical catalysis. Methods of fragmenting oligonucleotides or polynucleotides using these chemical techniques are well known in the art.
- the methods of fragmenting by chemical techniques can be used to generate defined or random ends. For example, nucleic acid can be hydrolyzed after defined bases (such as after only guanosine). Nucleic acid can also be hydrolyzed, generating undefined termini. Such methods are well known in the art.
- Methods of preparation can be selected to provide particular types of oligonucleotides, for example, in one embodiment, exposure to extreme pH, e.g. acid pH or basic pH, can be used to generate fragments with random termini.
- extreme pH e.g. acid pH or basic pH
- hydroxyl radicals e.g. , supplied using Fenton or Udenfriend reagent, react with the deoxyribose in DNA, resulting in cleavage of the DNA strand.
- the upstream DNA product strand is left with a 3' phosphate, and the downstream DNA strand possesses a 5' phosphate. This method results in near uniform cleavage at any base within a target, and the frequency of cleavage can be regulated.
- Physical techniques of fragmenting oligonucleotides include heat, freezing, ionizing radiation and shearing.
- a polymerase is used to synthesize oligonucleotides of variable length. Methods of such syntheses are well known in the art.
- conditions of synthesis can be chosen such that said polymerase falls off the polynucleotide from which said oligonucleotides serve as primers, or such that the polymerase otherwise terminates synthesis at random points along the polynucleotide.
- Oligonucleotides can be generated with random alterations. Oligonucleotides with random termini can be generated by using polymerases that are known to have exonuclease activity, under conditions permitting exonuclease activity for example, T4 DNA polymerase, Pol I or Pol in, among others.
- Oligonucleotides can be produced by removing bases or generating adducts in a oligonucleotide using techniques well known in the art. For example, bases in oligonucleotides can be removed or adducted by many well known chemical methods to result in either abasic sites or modified bases. Inco ⁇ oration of the uracil in a DNA polynucleotide, for example, can lead to the formation of abasic sites when treated enzymatically. The percent of uracils contained in a DNA polynucleotide can be controlled, and, thus, the number and average distance between uracil residues which eventually result in abasic sites can be regulated. These sites can be produced, for example, between 15 and 5000 bases apart (Kunkel et al, Meth. Enzymol
- Strand cleavage of the phosphodiester bond at those modified sites can then be effected using chemicals such as piperidine, or enzymes such as abasic endonucleases or lyases.
- Oligonucleotides having defined ends can be generated using endonucleases having sequence recognition sites. Such enzymes are known in the art and refe ⁇ ed to herein as "restriction endonucleases" and many are commercially available. A random population of fragments can be generated by performing a limited or incomplete digestion of the nucleic acid source of oligonucleotides. Oligonucleotides having random termini can be generated by using non specific endonucleases such as mung bean nuclease, SI nuclease or DNase I. Alternatively, oligonucleotides having undefined ends can be generated, exonucleases such as Exo in can be used to non-specifically trim oligonucleotide sequences.
- a randomly fragmented population of oligonucleotides is generated using endonucleases which indiscriminately cleave single-stranded DNA, such as S 1 nuclease or mung bean nuclease.
- endonucleases which indiscriminately cleave single-stranded DNA, such as S 1 nuclease or mung bean nuclease.
- double-stranded parent polynucleotides are denatured and allowed to reanneal. If parents of related but not identical sequence are used, then, after annealing, double-stranded molecules will be formed with single-stranded mismatched "bubble" regions that form due to slight differences in sequence. These bubble sequences are susceptible to cleavage by single-stranded exonucleases.
- An oligonucleotide of interest or a fragment thereof can be amplified in vitro.
- Such in vitro amplification includes enzymatic methods such as PCR and chemical synthesis.
- short oligonucleotides preferably from about 5 to 100 nucleotides in length
- an oligonucleotide of interest or a fragment thereof can be amplified in vivo by, for example, plasmid or chromosomal replication in an appropriate host cell.
- the present invention is directed to a method of generating chimeric polynucleotides.
- a random population of oligonucleotides can be generated, for example, by random fragmentation of polynucleotides of interest.
- the method involves randomly assorting oligonucleotides on a single-stranded polynucleotide template based on their ability to hybridize the template.
- randomly assorting is intended to include those processes in which two or more oligonucleotides can hybridize to the template in a manner such that the possibility exists, that even though only one oligonucleotide actually hybridizes to a particular template sequence, that any one of two or more oligonucleotides could have hybridized to that particular sequence. It is clear to one of skill in the art that the method of the present invention can be carried out under a range of hybridization stringencies, from low stringency to high stringency, based on the amount of similarity or differences between the oligonucleotides and the template. In one embodiment of the present invention, the oligonucleotides are hybridized or annealed to the template (or templates) under conditions of low stringency.
- Conditions of hybridization can be selected such that two or more oligonucleotides or portions thereof can compete for hybridization to a given region of a template and thus compete to be included in a resulting chimeric polynucleotide.
- a population of chimeric polynucleotides can be generated, representing a library of chimeras, which can be selected or screened to isolate chimeric polynucleotides with desired characteristics.
- the random assortment of oligonucleotides on a template to generate a chimeric polynucleotide can be facilitated by the population of oligonucleotides.
- a random population of oligonucleotides can be provided that hybridizes to two or more distinct regions of a template.
- a random population of oligonucleotides can be provided in which hybridization of two or more oligonucleotides terminates at different nucleotides of the template.
- a random population of oligonucleotides can be provided that hybridizes to two or more distinct regions of a template and independently with respect to two or more regions, the hybridization of two or more oligonucleotides terminates at different nucleotides of the template.
- Conditions sufficient to allow alignment between sequences of low similarity or sequences of high similarity interrupted with sequences of low or no sequence similarity can be low stringency conditions. Such conditions can readily be determined by one of ordinary skill in the art. Specific consideration to hybridization and wash conditions is required in cases where relatively small oligonucleotides are being annealed, or in cases where there is a substantial amount of mismatch between the two strands. The energetics favoring hybridization indicate that longer stretches of homology are more favorable. Thus, when either short sequences are involved or there is limited potential for standard Watson-Crick base-pairing, hybridization conditions can be adjusted to a lower stringency to allow for hybridization.
- adjusting hybridization and wash conditions is done by, for example, adjusting the ionic strength of the reaction mixture or adjusting the temperature at which the hybridization is performed.
- certain purified proteins such as the E. coli RecA protein, aid in homologous base pairing and can be included to facilitate hybridization of polynucleotide strands.
- Conditions for stringency are as described in WO 98/40404, the teachings of which are inco ⁇ orated herein by reference.
- examples of highly stringent, stringent, reduced and least stringent conditions are provided in WO 98/40404 in the Table on page 36.
- Examples of stringency conditions for solutions during and after hybridization are shown in the table below which is from WO98/40404 to Jacobs et al, highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R.
- the hybnd length is that anticipated for the hyb ⁇ dized reg ⁇ on(s) of the hybridizing polynucleotides
- the hyb ⁇ d length is assumed to be that of the hybridizing polynucleotide
- the hyb ⁇ d length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementanty f : SSPE (lxSSPE is 0.15M NaCl, lOmM NaH 2 P0 4) and 1.25mM EDTA, pH 7.4) can be substituted for SSC (lxSSC is 0.15M NaCl and 15mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete.
- this hybridization step can be optimized using any suitable method of optimization that is established in the art of hybridization and or PCR. These include, but are not limited to, techniques that increase the efficiency of annealing or hybridization from complex mixtures of polynucleotides (e.g., PERT; Nucleic Acids Research, 1995, vol 23, 2339-2340) or hybridization in different formats (e.g., using immobilized template or in microtiter well formats; Analytical Biochemistry, 1995, vol 227, 201-209).
- PERT Nucleic Acids Research, 1995, vol 23, 2339-2340
- Oligonucleotides can hybridize to the template such that the entire length of the oligonucleotide is hybridized to the template.
- oligonucleotides can hybridize to the template such that portions remain unhybridized, e.g., at least one terminus remains unhybridized, e.g., one terminus forms a "flap.”
- the term "flaps" is used herein to describe the unhybridized portion of an oligonucleotide otherwise hybridized to a template.
- the method typically includes the further step of removing or cleaving flaps from the oligonucleotide prior to the ligation step.
- the method typically includes the further step of removing or trimming loops from the template or oligonucleotide prior to the ligation step.
- flaps or loops used herein to refer to a process of removing just the flaps or loops and leaving the hybridized portion of the oligonucleotide intact, can be inco ⁇ orated into the method of the present invention. In embodiments where one or more oligonucleotides form both flaps and loops, these structures can both be trimmed prior to the ligation step.
- Flaps and loops can be trimmed enzymatically, e.g., utilizing polymerases with single-stranded exonuclease activity or other single-stranded endonucleases or exonucleases (e.g., mung bean nuclease, S 1 nuclease), or chemically.
- the step of trimming flaps and/or loops can be performed prior to or concurrently with the additional steps of polymerization and ligation.
- flaps can be removed using RNA or DNA digesting enzymes, including nucleic acid polymerases having proofreading ability. Flaps can also be removed using enzymes including, but not limited to, RNase HI, Exo HI, Exo VII or the flap endonuclease activity of Taq DNA polymerase. Methods of using these enzymes are well known in the art. Enzymes can be selected on their abilities to perform at various temperatures, for example, they can be cryophilic in that they are active at low temperatures (less than about 30° C), mesophilic in that they are functional at moderate temperatures (between about 30° C and 60° C), or thermophilic in that they are active at high temperatures (greater than about 60° C).
- unhybridized termini of the template can be protected from degradation by including within the population of oligonucleotides of interest nucleic acid sequence specific for the termini of the template.
- These fragments termed “clamps,” or equivalently, “anchors,” can be from about 6 to about 500 or more nucleotides in length. In a particular embodiment, the clamps can be from about 12 to about 50 nucleotides in length.
- These clamps can be designed to have low stringency sufficient to protect the termini from degradation but such that oligonucleotides of interest that bind the termini can displace the clamps.
- the termini of the template can be protected by having one or more thioester or phosphorothioate bonds instead of a phosphodiester bond, thus rendering the termini refractory to trimming enzymes.
- the template comprises, for example, PNA, which is unaffected by nucleic acid polymerizing or degrading enzymes. Oligonucleotides can hybridize to the template such that no region of the template remains unhybridized, e.g., there is no intervening single-stranded template sequence between the hybridized oligonucleotides, e.g, there are no gaps between the hybridized oligonucleotides.
- oligonucleotides can hybridize to the template or templates such that regions of the template remain unhybridized, e.g., there is intervening single-stranded template sequence between the hybridized oligonucleotides e.g., there are gaps between the hybridized oligonucleotides.
- adjacently hybridized is used herein to describe the relative positions of two oligonucleotides hybridized to the same template at positions such that only single- stranded template sequence is contained between the two oligonucleotides.
- immediately adjacently hybridized is used herein to describe adjacently hybridized oligonucleotides which abut each other, e.g., no intervening single- stranded template is contained between the two oligonucleotides.
- the method includes the further step of filling in the gaps between hybridized oligonucleotides, e.g., rendering the unhybridized regions of the template double- stranded, such that the step of ligating the hybridized oligonucleotides results in a chimeric polynucleotide about target length.
- Trimming of flaps and gap filling can be performed in any order, including both sequentially and concu ⁇ ently. Moreover, ligation can also be performed concurrently with trimming of flaps and gap filling.
- the three process steps in combination are referred to as the TPL step.
- the TPL step can include trimming flaps, polymerization to fill in gaps between adjacently hybridized oligonucleotides, and ligation to chemically join immediately adjacently hybridized oligonucleotides.
- the TPL step of the invention follows the contacting and hybridization of the population of oligonucleotides to the single-stranded template.
- the present invention is also related, at least in part, to the discovery of modifications of single-stranded templates used to assemble oligonucleotides prior to recombination.
- the present invention optimizes the TPL step.
- modifications to the single-stranded template lead to an increase in the degree of chimeragenesis in the products by limiting polymerization during the TPL step to filling in only short gaps between adjacently hybridized oligonucleotides. Since filling in gaps between oligonucleotides results in the synthesis of sequences complementary to the template, the overall degree of chimeragenesis of the eventual product is typically lowered when long gaps are filled in.
- this improvement also increases the overall proportion of chimeric products formed by limiting the formation of non-chimeric products.
- polymerization can lead to the formation of a non-chimeragenic product, e.g., the synthesis of a strand entirely complementary to the template.
- a non- chimeragenic product can be produced by a single oligonucleotide hybridizing to the template and then being extended for the length of the template during the polymerization step.
- limiting the polymerization step to short gaps can increase the overall degree of chimeragenesis of the product polynucleotide.
- Modifications to the single-stranded template include both physical and chemical modifications.
- the method of the present invention limits the polymerization step to filling in only short gaps (e.g., gaps that span less than about 5%, 10%,15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%, 90%, and 95% of the template sequence) and, thus, further minimizes the extensive polymerization that leads to non-chimeragenic product polynucleotides or polynucleotide products with a low degree of chimeragenesis.
- the further step of filling in gaps between hybridized oligonucleotides can be conducted before removal of the unhybridized sequences and thereby protect the 3' terminus of the template.
- gaps between adjacently hybridized oligonucleotides can be filled using a suitable nucleic acid polymerizing enzyme.
- Suitable polymerases are readily available. Gaps can be filled in using prokaryotic, eukaryotic or viral polymerases.
- the polymerases can be selected on their abilities to perform at various temperatures, for example, they can be cryophilic in that they are active at low temperatures (less than about 30° C), mesophilic in that they are functional at moderate temperatures (between about 30° C and 60° C), or thermophilic in that they are active at high temperatures (greater than about 60° C).
- the polymerases can optionally have proofreading ability.
- Suitable polymerizing enzymes include but are not limited to T4 DNA polymerase, Taq DNA polymerase, Pfu DNA polymerase, Pol I, Klenow and Klenow ⁇ s*TM*TM* (New England BioLabs, Beverly, Ma.).
- Control of enzymatic polymerization can be achieved, for example, by affecting the polymerase, e.g., by altering reaction conditions using a polymerase with altered processivity, or by affecting the template which is used by the polymerase during polymerization.
- the single-stranded template can be modified such that polymerization during the TPL step of the invention is affected.
- the modification can be either chemical or physical.
- the template can include the nucleotide, uracil, which can be glycosylated by a uracil glycosylase, "UNG,” thus forming an abasic residue within the polynucleotide template.
- uracil can be glycosylated by a uracil glycosylase, "UNG,” thus forming an abasic residue within the polynucleotide template.
- UNG uracil glycosylase
- the extent of polymerization can be modulated by affecting the average distance a polymerase can cover before encountering a modified residue.
- Other chemical modifications to template polynucleotides which lead to stalled polymerases are known to those of ordinary skill in the art.
- the template can be modified by annealing pre-selected oligonucleotides to the template.
- an oligonucleotide complementary to a template terminus can be hybridized to the template, thus preventing oligonucleotides in the arbitrarily fragmented population of oligonucleotides generated from parent polynucleotides from hybridizing to the terminus of the template.
- the pre-selected oligonucleotide cannot be extended by polymerases, e.g., it can contain a 3' dideoxy or 3' phosphate containing nucleotide.
- the polymerase utilized for filling in gaps is prevented from synthesizing a complementary and non- chimeragenic copy of the template.
- the pre-selected oligonucleotide can be selectively removed and replaced by a second pre-selected oligonucleotide which can be extended by polymerases, or a second pre-selected oligonucleotide which can be extended by polymerases can be immediately adjacently hybridized to the first pre- selected oligonucleotide.
- the first pre-selected oligonucleotide can be synthesized to contain the nucleotide, uracil, instead of thymidine.
- the second, extendable oligonucleotide does not contain uracil but instead contains thymidine, conditions can be established such that after UNG treatment the second oligonucleotide will be substantially favored over the first oligonucleotide for annealing to the template.
- a cleavage site for a restriction endonuclease can be contained at the 3' end of the template.
- This short portion can be removed while other oligonucleotides remain hybridized by adjusting the stringency of the hybridization.
- the second pre-selected oligonucleotide is specifically annealed to the 3' end of the template. In either case, a subsequent round of polymerization to extend the second pre-selected oligonucleotide and ligation generates the full length chimeric polynucleotide.
- Gaps between adjacently hybridized oligonucleotides can be of any length.
- gaps between adjacently hybridized oligonucleotides can be from about 1,000 to about 100,000 template nucleotides.
- the gaps between adjacently hybridized oligonucleotides can be from about 500 to about 10,000 template nucleotides; less than 1,000 template nucleotides; less than 250 template nucleotides; less than 50 template nucleotides; or even less than 25 template nucleotides.
- gaps are filled in in vivo, wherein complexes comprising oligonucleotides hybridized to a template are inserted or transformed into a suitable host cell.
- the gaps whether filled in in vitro or in vivo, can be filled with or without the introduction of "errors" in comparison to the template.
- the invention is directed to a method of generating a chimeric polynucleotide having at least one characteristic altered in comparison to a reference polynucleotide including the steps of generating a population of oligonucleotides, comprising randomly fragmenting at least one polynucleotide; contacting at least one single-stranded polynucleotide template with the population of oligonucleotides under conditions wherein at least two oligonucleotides hybridize to the template; removing flaps of hybridized oligonucleotides; filling in gaps between hybridized oligonucleotides; ligating adjacently hybridized oligonucleotides to form at least one chimeric polynucleotide, hybridized to a • template; selectively amplifying the chimeric polynucleotides and selecting or screening at least one chimeric polynucleotide having the specified characteristic altered in comparison to the reference polynucleotide.
- a chimeric polynucleotide is produced in a single iteration of the steps of the method. That is, after oligonucleotides hybridize to the single-stranded template, and any flaps or loops are trimmed and any gaps remaining are filled in, and the hybridized oligonucleotides are ligated, a chimeric polynucleotide is formed which is usually about the length of the template. Individual process steps are generally not repeated, nor are the chimeric polynucleotide products formed in stepwise extensions.
- the necessary steps of the process can, however, be repeated after the chimeric polynucleotide is formed, for example, the chimeric polynucleotide can be utilized as a library of oligonucleotide fragments or as a template in a subsequent reiteration of the process.
- the methods of the invention are generally considered to constitute a non-reiterative process.
- the chimeric polynucleotide product formed is generally about the length of the template on which it is assembled.
- a chimeric strand may not form on any given template, about one polynucleotide product is produced per single-stranded template upon which a chimeric strand is synthesized, and the number of polynucleotide products produced and the number of such templates are in a ratio of about 1.
- the chimeric polynucleotides are selectively amplified with respect to the template.
- At least one chimeric polynucleotide is generated, wherein one or more characteristics of the chimeric molecule is altered in comparison to at least one reference molecule.
- parent polynucleotides used to generate the population of oligonucleotides contain sequence differences which account for differences in characteristics associated with the parent polynucleotides, e.g., different parent polynucleotides can have slight differences in the nucleotide sequences of their coding regions wherein such differences result in the expression of an altered protein with altered functions.
- polymo ⁇ hisms sequence differences
- polymo ⁇ hisms sequence differences
- oligonucleotides containing specific polymo ⁇ hisms derived from specific parents are generated. The random set of oligonucleotides that hybridizes to any given template determines the precise set of polymo ⁇ hisms contained to the chimeric product.
- a comparison of a chimeric product to any one of the parents or to a product of a polynucleotide functionally related to the parents allows for the evaluation of the chimeric polynucleotide product with respect to a given function.
- the molecule used for such a comparison is referred to herein as a "reference" polynucleotide.
- the nucleic acid which forms the parent polynucleotides, or that which is utilized as a template or in a population of oligonucleotides can be isolated from any suitable source of polynucleotides or it can be synthetically manufactured. For example, it can be isolated from an organism, such as a eubacterial, archeal, eukaryotic or viral organism. These organisms can be amplified, enriched or isolated and grown in culture, or can be used directly from environmental sources.
- Environmental sources include soil samples, water samples from fresh water sources or salt water sources, polluted sites, waste treatment sites and sources comprising extreme condition sources such as permafrost sources, high altitude sources, high pressure sources and geothermal sources such as volcanic sources, hot springs and hydrothermal vent sources.
- Sources of nucleic acid also include tissue or bodily fluid samples from an organism, wherein nucleic acid can be isolated from said sample.
- the nucleic acid of a tissue or bodily fluid sample can comprise nucleic acid of said organism or of flora, such as fungal, bacterial, viral or parasitic organisms present in said sample.
- the sample can further be fresh, fossile or archival.
- nucleic acid for such oligonucleotides is polynucleotide encoding a desulfiirization enzyme.
- isolated nucleic acids can comprise a variety of forms of nucleic acids including both genomic DNA and cDNA.
- RNA or more particularly mRNA can be isolated from a nucleic acid containing sample and converted into DNA, e.g, cDNA, according to standard methods.
- the library can be prepared from a sample of interest that expresses a desired phenotype. Alternatively, the library can be produced from a sample that is not otherwise preselected for phenotype.
- the library is subjected to subtractive hybridization against a suitable sample of nucleic acid, using techniques well known in the art.
- a suitable sample of nucleic acid includes nucleic acid from a reference strain of bacteria, for example, one that does not express the phenotype of interest.
- Sequences that are common between the library and the sample are removed from the library. In this way, sequences present in multiple copies and sequences that are common between the two populations are removed, effectively enriching for low abundance sequences.
- Particular methods for producing libraries of oligonucleotides with minimal complementarity are described in the application entitled “Generating Single-Stranded Oligonucleotide Libraries With Minimal Complementarity And Uses Therefore” by Joseph J. Arensdorf and Wayne M. Coco with Attorney Docket No. 1405.2016-001 filed of even date herewith, the entire teachings of which are hereby inco ⁇ orated by reference.
- a region of the template is hybridized to complementary sequences by providing oligonucleotides complimentary to any oligonucleotide or oligonucleotides that are complementary to that region of the template. In this manner, the sequence complementary to a region of the template can be specifically retained in the chimeric molecule.
- defined oligonucleotides can be added in greater quantities to the random population of oligonucleotides in order to preferentially hybridize the defined oligonucleotides to the template. In one embodiment these oligonucleotides hybridize at particular regions or positions in order to introduce desired mutations or in order to protect sequences on the template from changes that might be introduced by the random oligonucleotides.
- the present invention allows oligonucleotides of interest to be inco ⁇ orated into a larger molecule to form one or more chimeric polynucleotides, hybridized to a given template.
- polynucleotides that are not otherwise easily manipulated due for example, to their large size
- random mutagenesis using PCR is most effective on smaller DNA fragments, such as 1 kilobase or less in length.
- a large polynucleotide can be cleaved into fragments of about 1 kilobase and randomly mutagenized using PCR, and then made single-stranded, fragments can be hybridized to a transient template and ligated as described herein.
- the transient template can be derived from the original polynucleotide, or can be an altered form thereof as described herein, for example, the template itself can be mutagenized or can have added or deleted regions or domains as compared to the starting polynucleotide.
- a set of specific oligonucleotides inco ⁇ orating known allelic variations can be synthesized and used as the population of oligonucleotides in the RACHITTTM method.
- polymo ⁇ hisms which are located in positions close to each other on the nucleotide sequence of the parent polynucleotide can be sampled separately based on available sequence and allele information.
- the particular combination of polymo ⁇ hisms contained in the chimeric polynucleotide resulting from this method is determined by the specific set of oligonucleotides which hybridizes to the template during the RACHITTTM method.
- the set of polymo ⁇ hisms contained in each chimeric polynucleotide is a random set which can vary from chimera to chimera, thus allowing production of a library containing many different chimera.
- in vivo techniques can include methods for trimming of unhybridized termini, gap filling, ligation, or combinations thereof, wherein the oligonucleotides hybridized to the template are transformed into a suitable host cell.
- suitable host cells include bacteria and eukaryotic cells, such as yeast, mammalian cell culture, insect cell culture, plant or in multicellular organisms.
- Suitable bacterial host cells include, for example, bacteria that express desulfiirization biocatalysts, and non-desulfurization biocatalyst expressing bacteria, such as E. coli, Bacillus and non-desulfurizing pseudomonads.
- Suitable host cells for in vivo trimming of unhybridized termini, gap filling or ligation, or for cloning, selecting, screening, expressing the chimeras of the present invention include bacteria that express native or altered desulfiirization biocatalyst such as Sphingomonas microorganisms such as Sphingomonas strain AD 109, Rhodococcus microorganisms such as Rhodococcus strain IGTS8, Corynebacterium such as Corynebacterium strain SY1, Rhodococcus erythropolis D-l and ATCC #55309 and #55310, Arthrobacter described by Lee et al, Appl Environ. Microbiol.
- Sphingomonas microorganisms such as Sphingomonas strain AD 109
- Rhodococcus microorganisms such as Rhodococcus strain IGTS8, Corynebacterium such as Corynebacterium strain SY1, Rhodococcus
- Suitable host bacteria also include for example, E. coli, e.g., K12 and its derivatives and Bacillius. Suitable host selection and/or screening can also be performed in vitro.
- hybridized oligonucleotides are ligated.
- the hybridized oligonucleotides to be ligated are adjacently hybridized on the template.
- the hybridized oligonucleotides are ligated using a suitable ligase enzymes.
- oligonucleotides are ligated using one or more ligases.
- Suitable ligases include both thermostable and non thermostable ligases and include T4 DNA ligase, DNA ligase I or Taq ligase and Tth ligase. Hybridized oligonucleotides can also be ligated using chemical means.
- the methods of the invention produce a single contiguous polynucleotide of about the same length as the template.
- the chimeric polynucleotides can be described as being formed in about a 1 :1 ratio with the transient templates of the invention.
- a plurality of chimeric polynucleotides can be formed on a plurality of transient templates.
- the method of the present invention further comprises repeating the method using at least a chimeric polynucleotide or fragment thereof formed in an earlier process as the hybridization template or source of hybridizing oligonucleotides.
- the chimeric polynucleotides are selectively amplified with respect to the template.
- the transient template is not directly inco ⁇ orated into the resulting chimeric molecules.
- Specific amplification of the chimeric polynucleotide product can be followed by one or more rounds of selection or screening and subsequent amplification.
- the chimeric polynucleotide can be selected or screened based on alterations of specific properties, e.g., nucleotide structure, nucleotide function, altered enzymatic activities of proteins encoded by the chimeric polynucleotide, altered structural functions of proteins encoded by the chimeric polynucleotide, altered regulatory functions of proteins encoded by the chimeric polynucleotide, etc., or a combination thereof.
- Subsequent selection and amplification of the chimeric polynucleotide allows for the in vitro or in vivo directed evolution of biological molecules such as nucleic acid or polypeptides. This method for directed evolution can aid in the improvement of such molecules for use, for example, in medical therapies, as reagents in molecular biology, and in industry.
- a template can be synthesized such that after ligation to form the chimeric polynucleotides, the chimeric polynucleotide is selectively amplified over the template.
- the template is synthesized to contain at least one uracil.
- the template is rendered non-amplifiable or non- replicatable by treating the template with Uracil DNA Glycosylase (UDG).
- UDG Uracil DNA Glycosylase
- the template-chimera heteroduplex can be introduced into a suitable host cell, wherein the template is selectively destroyed.
- a suitable host can be a bacterial strain carrying the wild type dut gene. Methods of transfecting suitable hosts, such as bacteria, are well known in the art.
- the chimeric polynucleotide and template can be inserted into a suitable vector to facilitate the process.
- the template or templates can be synthesized such that they can be separated by differential mobility, density, or charge; or immobilization on a matrix or solid phase.
- the template is synthesized such that it contains an affinity moiety, such that it can be separated by selective binding or removal, such as affinity chromatography.
- the affinity moiety comprises, for example, biotin or digoxygenin, which can be affinity separated along with the molecule to which it is attached, using avidin or anti-digoxygenin antibodies, respectively.
- one or more of the oligonucleotides of interest or fragments thereof can be synthesized to contain an affinity moiety such that the resulting chimera contains the moiety.
- the chimeric polynucleotide can then be isolated as described above.
- the transient template used in the RACHITTTM method is formed from RNA.
- the initial chimeric product produced by this embodiment is a RNA/DNA hybrid in which the DNA strand is the chimeric strand.
- the RNA strand can be selectively removed by ribonucleases such as RNase H, and the chimeric strand can then be selectively amplified.
- the chimeric DNA strand can be selectively amplified by PCR when PCR utilizes DNA-dependent DNA polymerases which do not recognize an RNA strand.
- the transient template used in the RACHITTTM method can also contain sequences in addition to target sequences.
- the product of the RACHITTTM method can be a heteroduplex wherein the template strand is larger than the chimeric strand.
- the template is selectively removed by methods known in the art (e.g., electrophoresis, gel filtration, affinity chromatography, ion-exchange chromatography, subfractive hybridization), and the chimeric strand is then selectively amplified.
- the transient template is a circular molecule and can contain sequences derived from phage genomes in addition to RACHITTTM target sequences.
- the transient template contains sequences designed specifically to make the template larger than the resultant chimeric strand. Such a template can contain more than one copy of the target sequence, which can be separated by additional sequences.
- the template can comprise PNA, which cannot be amplified using polymerases, allowing selective amplification of the chimeric polynucleotides.
- selection of chimeric polynucleotides with improved properties with respect to a particular trait is performed after cloning the library of chimeric products into a suitable vector.
- restriction sites for cloning into suitable vectors can be contained at the 3' and 5' ends of the template. In this embodiment, the chimeric products can retain those restriction sites and, therefore, can be directly cloned into the same sites in a suitable vector.
- One advantage for including a restriction site at the 5' end of the template is that only molecules made double-stranded during the TPL step of the RACHITTTM method can be cleaved at the restriction site.
- the restriction site at the 5' end of the template is made double- stranded only in the case where at least one oligonucleotide from the library of oligonucleotides hybridizes to the template.
- Treatment with the endonuclease that specifically cleaves DNA at the 5' site yields a 5' clonable end.
- the RACHITTTM method provides a method for generating chimeric polynucleotides by means of in vitro directed evolution. Different sequences from related parent polynucleotides can be inco ⁇ orated into the chimeric product. As such, the products formed represent a sample of the differences in the sequences of different parent polynucleotides.
- the RACHITTTM method results in a library of chimeric products, each chimera containing a different set of sample sequences derived from parent polynucleotides.
- a significant contaminant in this library can be a molecule which represents a clone of a parent sequence, i.e., a molecule which contains sequence from only one parent or reference molecule, typically the template used in the RACHITTTM method. Reducing the occurrence of these parental clones improves the diversity of the library of chimeric products obtained as a result of the RACHITTTM method, and, thus, allows for a greater and more efficient sampling of combined parent sequences.
- a common pathway which leads to the appearance of parental clones in the final library of chimeric products involves a template which is extended during a polymerization step, but which does not contain parent-derived sequences annealed to it.
- the RACHITTTM method can be modified to include, either before or during the hybridization step, pre-selected oligonucleotides which hybridize to either end of the template. These oligonucleotides can specifically optimize the RACHITTTM method depending on the precise sequence and other physical properties of the pre-selected oligonucleotides.
- Figure 16 A illustrates particular instances of such oligonucleotides.
- a given gene of interest 510 i.e., a "target sequence" for the RACHITTTM method
- a target sequence for the RACHITTTM method
- PFTIO 520 and RTl 530 contain sequences which can hybridize to the end of the target sequence, but also contain sequences on their 5' ends which are engineered and not part of the target sequence.
- the non-target sequences of PFTIO and RTl are contained in FT8 540 and RT4 550, respectively.
- FTl IP 560 is identical to PFT10 except that FTl IP contains three nucleotides 570 which do not hybridize to FT8 (thus, annealing FT8 to a PCR fragment amplified with FTl IP as a primer, results in FT8 annealing to the 5' end of the FTl IP- containing molecule, but a 3' flap that is not hybridized, and that corresponds to the three nucleotide mismatch, is generated).
- FTl IP also contains a 3' phosphate and a phosphorothioate linkage between the ultimate and penultimate nucleotides.
- RT2 580 is identical to a sequence complementary to the 5' end of RTl, except for the analogous three nucleotide mismatch 590 internal to RT2.
- RT3 600 which contains uracil residues instead of thymine residues, is complementary to the 3' end of RTl and, if hybridized to RTl -containing sequences with RT2, produces a double-stranded region covering the entirety of RTl with a nick between RT3 and RT2 and a three nucleotide bubble created by the mismatch in RT2.
- Figure 16B presents two possible outcomes of the RACHITTTM method using such a PCR-generated template.
- One outcome 610 is the result of the RACHITTTM method in the case where no oligonucleotides from the fragmented population of oligonucleotides hybridizes to the template.
- the other 620 is the result of at least one oligonucleotide from the fragmented population of oligonucleotides hybridizing to the template.
- the RACHITTTM method is altered such that FTl IP 560 and RT2 580 are annealed to the ends of the template either prior to or during the addition of the library of oligonucleotides 630.
- FTl IP is not extended due to the 3' phosphate moiety.
- RT3 is added under conditions such that it can hybridize to a single-stranded DNA sequence complementary to itself, and the 3' phosphate is then removed from FTl IP 640. Subsequent gap fill in results in a double-stranded molecule, one strand of which is the original template 650 and 660.
- RT3 is prevented from annealing to the single-stranded template, and, thus, the resultant double stranded molecule does not contain uracil residues 660.
- the non-template strand contains uracil residues due to the fact that RT3 was permitted to anneal to the template when added 650.
- the present invention is particularly useful for evolving industrially or medically useful molecules or biochemical pathways, wherein the chimeric polynucleotide is itself a useful molecule (e.g. , promoter, aptamer, catalyst, enhancer or other regulatory element) or wherein the chimeric polynucleotide encodes a useful gene product.
- the chimeric polynucleotides can be or encode, for example, molecules that are more active under desired conditions or have altered or enhanced specificity, mutagenicity or fidelity.
- desired conditions include conditions to which the reference molecule, oligonucleotides or template, or polypeptide encoded therein are not typically exposed or extreme conditions. Such extreme conditions include high or low temperature, extreme high or low pH, extreme salt concentration or ionic strength or extreme solvent conditions such as organic solvent conditions.
- the template is selected or designed to encode a molecule that is to be evolved.
- bioactive molecules include bioactive molecules.
- bioactive agent includes peptides, proteins, polysaccharides and other sugars, lipids, nucleic acid sequences, such as genes, and antisense molecules.
- Nucleic acid encoding enzymes that produce, modify or degrade polysaccharides, other sugars and lipids can be used as the template, oligonucleotides or reference polynucleotide.
- bioactive molecules include but are not limited to: insulin, erythropoietin, interferons, colony stimulating factors such as granulocyte colony stimulating factor, growth hormones such as human growth hormone, LHRH analogs, LHRH antagonists, tissue plasminogen activator, somatostatin analog, r Factor VIE, r Factor DC, calcitonin, dornase alpha, polysaccharides, AG337, bone inducing protein, bone mo ⁇ hogenic protein, brain derived growth factor, gastrin 17 immunogen, interleukins such as IL-2, PEF superoxide, permeability increasing protein-21, platelet derived growth factor, stem cell factor, thyrotropin alfa and somatomedin C.
- colony stimulating factors such as granulocyte colony stimulating factor
- growth hormones such as human growth hormone, LHRH analogs, LHRH antagonists, tissue plasminogen activator, somatostatin analog, r Factor VIE,
- One of skill in the art would readily be able to select or design a template to encode the molecule of interest to be evolved according to the method of the present invention.
- Methods for measuring activity of hormones, interleukins, growth factors and angiogenesis inhibitors and the like under desired conditions are well known in the art.
- One of ordinary skill in the art can readily determine the activity of the hormone, interleukin, growth factor or angiogenesis inhibitor encoded by the chimeric polynucleotide produced by the present invention and select those having the desired characteristics.
- Examples of such medically useful molecules to be evolved according to the present invention also include enzymes that synthesize drugs, antibiotics, vitamins or cofactors.
- Other examples include vectors and genes for gene therapy.
- molecules that have desired therapeutic effect can be altered to alter, e.g., increase or decrease, toxicity, antigenicity or other side effects.
- Methods for determining activity under desired conditions include standard methods well known in the art.
- One of ordinary skill in the art can readily determine the activity of an enzyme encoded by a chimeric polynucleotide and select those having the desired characteristics.
- Enzymes include but are not limited to fermenting enzymes, proteases, lipases, oxidoreductases such as alcohol dehydrogenase, polymerases, hydrolases and luciferase.
- Examples of industrially useful molecules include enzymes that synthesize polyketides, transform small molecules, hydrolyze substrates, replace steps in organic synthesis reactions or degrade pollutants such as aromatic hydrocarbons (e.g., benzene, xylene, toluene and naphthalene), polychlorinated biphenyls and residual herbicides and pesticides.
- Catabolic pathways can be evolved using the present invention such that enzyme pathways are produced that degrade manmade pollutants that otherwise are not, or are only slowly catabolized by wild type organisms.
- Polynucleotides encoding said molecules or fragments thereof can be used in the present invention as either the template, the oligonucleotides, the reference molecule, or combinations thereof.
- a particularly useful metabolic pathway for the directed evolution process of the present invention includes enzymatic pathways that catalyze one or more steps in the desulfiirization of thiophenes, such as benzothiophenes or dibenzothiophenes, as described in United States Patent Applications, Serial Numbers 09/030,995 and 08/851,089 and United States Patent No. 5,952,208, the teachings of which are inco ⁇ orated herein by reference in their entirety.
- Polynucleotides encoding the molecules or fragments thereof can be used in the present invention as either the template, the oligonucleotides, the reference molecule, or combinations thereof.
- said nucleic acid source includes SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and homologs, variants, analogs and fragments thereof.
- the nucleic acid source further includes nucleic acids encoding polypeptide sequences SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, variants, analogs and fragments thereof.
- DBTO 2 monooxygenase genes such as dszA genes can be evolved according to the method of the present invention to possess a higher rate of enzyme activity, altered substrate range (such as, substituted or unsubstituted dibenzothiophene, benzothiophene, thiophene, alkyl sulfides, aryl sulfides, cyclic sulfides or other sulfur or non-sulfur containing molecules) or altered K ⁇ .
- altered substrate range such as, substituted or unsubstituted dibenzothiophene, benzothiophene, thiophene, alkyl sulfides, aryl sulfides, cyclic sulfides or other sulfur or non-sulfur containing molecules
- the method of the present invention is performed on a dibenzothiophene monooxygenase gene, wherein the dibenzothiophene monooxygenase gene is used as a nucleic acid source of at least one template, oligonucleotide, reference molecule or combination thereof, wherein a chimeric polynucleotide is isolated that encodes a polynucleotide that converts DBT to the compound DBTO, such that the second reaction present in native dibenzothiophene monooxygenase, converting DBTO to DBTO 2 , does not occur.
- a dszC gene is evolved by the method of the present invention such that it catalyzes the production of chiral sulfoxides in greater enantiomeric excess than that provided by the reference dszC gene.
- the method of the present invention can be used to increase, for example, the rate of an enzyme activity and the extent of the activity, e.g., the affinity of the enzyme for its substrate.
- the first enzyme in the metabolism of sulfur heterocycles by Rhodococcus, dibenzothiophene-monooxygenase (DBT-MO) is the bottleneck for both the rate and extent of sulfur oxidation in the biodesulfiirization (BDS) process.
- the method of the present invention was used to generate large, complex chimeric libraries containing multiple mosaicisms, high resolution recombination between closely spaced parental differences and no detectable non- chimeric parental clones.
- a single round of the present method using only two parental dszC genes, produced chimeric genes encoding polypeptide having a rate of reaction on high-sulfur diesel increased two-fold, and a two fold increase in the amount of sulfur oxidized from a deeply biotreated diesel.
- the low number of null phenotypes observed in the chimeric library allowed isolates with significant improvements to be identified after screening relatively few clones.
- Application of a low stringency selection further identified improvements in affinity beyond that of the best parent.
- the high rate inherent to the other parent was captured in many of these same high affinity mutants. This significant advance in biodesulfiirization has important implications in diverse fields requiring the directed evolution of proteins.
- a chimeric polynucleotide is generated wherein one or more characteristics of said molecule is altered in comparison to at least one reference polynucleotide.
- the alteration of the chimeric polynucleotide can comprise nucleotide change, and/or amino acid changes in the encoded polypeptide, in comparison to said reference polynucleotide, polypeptide or fragment thereof.
- the reference polynucleotide, polypeptide or fragment thereof can be the template or fragment, or can be a molecule related to said template used for comparison.
- a reference molecule can be used for comparison to chimeric polynucleotides generated.
- the reference molecule can be a family member of the gene or gene product of interest, such as a homologous gene, or fragment thereof. In particular embodiments, two, three or four molecules can be utilized.
- One of skill in the art can readily choose a reference molecule based on the templates and oligonucleotides of interest used to generate the chimeric polynucleotides.
- the characteristics to be altered according to the present invention include, but are not limited to, structural motif, stability, half-life, enzyme activity, enzyme specificity, binding affinity, binding specificity, toxicity, antigenicity, interaction with an organism and interaction with components of an organism of said polynucleotide or said encoded polypeptide.
- a functional characteristic can be altered according to the present invention such that the activity of said functional characteristic is enhanced at a higher or lower temperature compared to a reference molecule.
- said functional activities can be enhanced in various physical or chemical environments as described above. Methods for measuring and selecting or screening these characteristics are well known in the art.
- Structural motifs for proteins include, for example, alpha helices, beta sheets, solvent exposed loops, leucine zippers, ⁇ , ⁇ -barrel scaffolds and the like.
- Structural motifs for nucleic acids include, for example, quadraplex, aDNA, bDNA, zDNA, triple helices, stem loop, hai ⁇ in, protein binding sites and the like. Examples of regions are provided above. Methods for determining these motifs are well known in the art, for example, by nucleic acid or protein sequencing.
- alteration of said characteristic comprises an enhancement of said characteristic.
- alteration of said characteristic comprises a reduction in said characteristic.
- the chimera is cloned prior to selection or screening. Methods of cloning polynucleotides are well known in the art. In another embodiment, said contiguous chimera is selected or screened in vitro or in vivo prior to cloning.
- the present invention allows the generation of at least one chimeric polynucleotide based in part on hybridization with at least one template.
- Said chimeric polynucleotides are different from said templates. Based in the method of the present invention, the differences can include, for example, an additional region, wherein said region is not present in said template.
- the additional region can be derived from an existing source of polynucleotides, or altered form thereof or can be a completely random sequence. Said additional region or regions can be present at either terminus of said chimeric polynucleotide or can be present within said chimeric polynucleotide.
- the chimeric polynucleotide of the present invention can be longer than the template.
- the chimeric polynucleotide can comprise an altered version of a region that is present in said template. Said region can be the same length as the region in the hybridization template or can be longer or shorter than the region in the hybridization template.
- the chimeric polynucleotide can be the same size, longer or shorter than the template.
- kits containing the various components necessary for performing the RACHITTTM method can contain all the components necessary to conduct the RACHITTTM method or any portion of the components necessary to conduct the RACHITTTM method.
- kits can include components including enzymes for fragmenting oligonucleotides, for filling-in gaps, for trimming flaps, for proofreading, for inco ⁇ orating uracils in templates and for modifying templates.
- a kit can contain a single-stranded exonuclease, e.g. lambda exonuclease and a non-specific endonuclease, e.g., DNase I.
- kits can contain a single-stranded exonuclease, e.g. lambda exonuclease, dUTP and UNG.
- kits can also include additional components including any of the components previously listed and a polymerase, e.g., T4 DNA polymerase, Taq DNA polymerase or Pfu polymerase, an endonuclease e.g., Rnase HI, Taq DNA polymerase or Exonuclease VII, a ligase, e.g.
- kits can be provided with instructions teaching the purchaser methods for performing the RACHITTTM method generally and in conjunction with specific polynucleotides. Typically, components of the kits are contained in separate containers. Alternatively, components utilized in sequential reactions can be contained in separate containers.
- GFP green fluorescent protein gene
- the second mutation was created by cleaving the resultant Xbal mutant plasmid from the above reaction with Ncol, filling in the overhanging ends using the Klenow fragment of E. coli polymerase I and auto-ligating, creating another four base insertion that would alone render the gene inactive.
- dUTP was then inco ⁇ orated into the target using PCR (PCR Protocols, Academic Press, Inc) using standard methods known in the art.
- the template was then made single stranded by digestion of one strand using lambda exonuclease (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience). Briefly, lambda exonuclease will only digest strands having a 5' phosphate. Therefore, to generate single stranded DNA, the polynucleotide is amplified with one primer containing a 5' phosphate and the other primer not containing a 5' phosphate.
- Oligonucleotides for use in hybridizing the above-described GFP template to generate chimeric polynucleotides were chemically synthesized oligonucleotides from a commercial source. These fragments were synthesized with specific mutations with respect to the template. Since the full-length template above was rendered single stranded, the synthetic oligonucleotides were designed to anneal the single stranded template. Some internal oligonucleotides contained a 5 '-phosphate (PO 4 ) modification for efficient ligation with fragments hybridized upstream on the template.
- PO 4 5 '-phosphate
- Fragment 2 5'-PO 4 -GCATGCCTGCAGGTCGACTCTAG*AGGATCCCCGGGTACCGGTAG AAAAAATGAGTAAAGGAG (SEQ ID NO. 2) The location of the above deletion is marked by the *. Fragment 4:
- Fragment 3 was generated by PCR of the wild type GFP gene using upstream and downstream primers as follows.
- An upstream PCR primer that binds between the two mutations was designed to have a 5'-tail (bold type) of sequence unrelated to the template:
- Upstream primer for Fragment 3 5 -TTATATACTAGTATCGATGATCGAGGAGGATGATTAAATGAGTAAA
- Fragment 3 has the sequence (TTATATACTAGTATCGATGATCGAGGAGGATGATTAAATGAGTAAAGG AGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTG ATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGC AACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTA CCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATG CTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGT GCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATG ACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCT TGTTAATAGAATCGAGTTAAAAGGTATTGATACCCT TGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAG
- FIG. 1 A schematic diagram of the hybridization of fragments 1-4 to the template is shown in Figure 2.
- TT bottom panel, X marks the sites of mutation
- the hybridized fragments (bottom panel) are numbered 1 to 4. ⁇
- oligonucleotides were generated from the wild type GFP gene.
- the GFP gene was amplified by PCR, rendered single stranded by lambda exonuclease cleavage, randomly cleaved using DNasel (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience) and hybridized to the transient template as above.
- DNasel Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience
- the DNasel products ranging in size from 40 to over 200 bases were isolated from a 6 M urea-PAGE gel, eluted and purified using standard procedures (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience).
- the hybridized oligonucleotides were trimmed such that non-hybridized termini were removed.
- the trimming reaction for 5' flaps (or unhybridized termini) employed the flap endonuclease activity of Taq DNA polymerase, as described (Lyamichev, et al, Science 260: 778-783, 1993) or for both 5' and 3' termini, Exonuclease VII (Boehringer Mannheim) according to the manufacturer's recommendation.
- the trimming reaction using Taq polymerase was stopped by cooling on ice, while the exonuclease VII reaction was stopped by heating to 75°C for 15 minutes.
- Gap filling
- Gaps between hybridized oligonucleotides were then filled using T4 DNA polymerase (New England Biolabs), according to the manufacturer's recommendation, or 0.5 units RedTaq DNA polymerase (Sigma), while ramping the temperature from 45 to 60 degrees over 30 minutes.
- the gap filling reaction using Taq polymerase was stopped by cooling on ice.
- the T4 DNA polymerase gap filling reaction was stopped by heating to 75°C, for 15 min.
- Ligation of hybridized oligonucleotides was carried out using Taq DNA ligase (New England Biolabs) and/or T4 DNA ligase (New England Biolabs) according to the manufacturers' recommendations. All reactions at or below 30°C proceeded in New England Biolabs buffer II, supplemented with ImM ATP. All reactions above 30°C proceeded in New England Biolabs Taq ligase buffer. After ligation, 0.5 U uracil DNA glycosylase (UDG) (New England Biolabs) was added and the sample was incubated at 37°C for 30 minutes in IX UDG buffer. This treatment rendered the template unusable as a substrate in PCR. PCR was then used to amplify the newly synthesized chimera and its complementary natural base containing strand according to Table I. Table I
- chimeric products were observed using restriction endonuclease digestion and analysis of cleavage products by agarose gel electrophoresis and/or by cloning the products and observing the presence or absence of fluorescence in the co ⁇ esponding expressed polypeptide, the green fluorescent protein.
- Chimeric polynucleotide formation was assayed by restriction analysis across several experiments. Chimeric strands inco ⁇ orating at least two annealing oligonucleotides comprised approximately 40 to 60% of the total products formed, whereas no detectable background cleavage was observed when oligonucleotides were omitted from the reaction. Screening for restoration of the fluorescent phenotype revealed that approximately 14% of the resulting products had acquired both altered loci by inco ⁇ oration of at least three annealing oligonucleotides. Omission of oligonucleotides or inclusion of oligonucleotides from just one singly- mutated parental gene, produces no fluorescent colonies.
- the transient template was one strand of the DBT monooxygenase gene, dszC, from the soil microorganism, Rhodococcus erythropolis IGTS8.
- dUTP was inco ⁇ orated into the target using PCR (PCR Protocols, Academic Press, Inc), and the template was made single stranded by digestion of one strand using lambda exonuclease (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience).
- the wild type dszC gene from the free living microorganism, Nocardia sp. A3H1 was amplified by PCR, made single stranded as described above and randomly cleaved using DNasel (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience) and then hybridized to the transient template as described above. Before hybridization, the DNasel products ranging in size from 40 to 200 bases were isolated from a 6 M urea-PAGE gel and purified using standard procedures (Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press; or Current Protocols, Wiley Interscience). Before the above procedures, both template and hybridizing fragments were subjected to PCR amplification (as described above) using the following primers, which included 5' phosphorylations, where appropriate:
- Forward primer 1 5'- CCGTCGCCCTCGATCAGTG (SEQ ID NO: 20)
- Reverse primer 1 5'-GGGTGGTGTGGCTGGAAAC (SEQ ED NO: 21)
- oligonucleotide included a 5' phosphate as above.
- the 5' binding oligo was Forward primer 1, the second was:
- Exonuclease VII was used to trim 5' and 3' flaps and was used according to the manufacturer's recommendation. The Exonuclease VII reaction was stopped by heating to 75°C, 15min. In the second method, the 5' flap endonuclease activity of Taq DNA polymerase was used as described (Lyamichev). This reaction was stopped by cooling on ice. Where Taq DNA polymerase was used, Pfu DNA polymerase was included in the gap filling step, below in order to trim 3' flaps.
- Gap filling
- Gaps remaining on the template were filled using T4 DNA polymerase at 12°C to 37°C(New England Biolabs), according to the manufacturers recommendation, or 0.5 units RedE ⁇ r DNA polymerase (Sigma) and 1.25 units Pfu DNA polymerase (Stratagene), while ramping the temperature from 45 to 60 degrees over 30 minutes.
- the RedTaq DNA polymerase gap filling reaction using Taq polymerase was stopped by cooling on ice.
- the T4 DNA polymerase gap filling reaction was stopped by heating to 75°C, 15 min.
- Ligation was carried out using Taq DNA ligase (New England Biolabs) and/or T4 DNA ligase (New England Biolabs) according to the manufacturers' recommendations .
- UDG uracil DNA glycosylase
- chimeric products were observed using restriction endonuclease digestion and analysis of cleavage products by agarose gel electrophoresis and/or by cloning the products and observing the presence or absence of improvements in the corresponding expressed chimeric DBT monooxygenase.
- the dszC chimeric library is highly random:
- Clones from the chimeric dszC library were tested for the presence of chimeric sequences by restriction endonuclease cleavage using four sites along the gene (Bgll, Xmnl, Xmal/Smal and Bglll).
- the corresponding enzyme will either cleave or not cleave, depending upon which parental gene donated the sequence at that site. Every theoretically possible chimera analyzed by this test will have some permutation of cleavage or no cleavage at each of the four positions. There are thus 16 possible classes, each having a unique permutation of one or the other parental sequences present at each of the four sites. To date, 38 clones have been tested in this fashion.
- Table IU shows the parental contribution of each clone at each site.
- the clones are grouped by similar patterns of cleavage. Of the 16 possible classes, representatives have been observed for 14 classes. For comparison, for independent, random distribution at each site, a statistical analysis predicts 14 +/- 1, making the pattern observed statistically indistinguishable from random to well within one standard deviation. Remarkably, only eight of these 38 isolates were actually chosen at random. The others were chosen because of their growth on selection plates, after assessment of their ability to effect indole conversion or after confirmation of higher activity in a microtiter format assay.
- the DBT-MO catalyzes the conversion of indole to the colored product, indigo.
- colonies containing the less active (on Cx-DBT) dszC gene from A3H1 produce consistently and significantly more indigo than does the more active IGTS8 dszC gene.
- This discrepancy suggested specificity differences of the two parents for ratios of indole: Cx-DBT conversion. It was anticipated that the chimeric library should contain dszC clones with a wide range of indole oxidase activity.
- the biodesulfiirization pathway genes encode the proteins responsible for the release of sulfur from alkylated dibenzothiophenes in fossil fuels. Since the dszC product, the dibenzothiophene monooxygenase, DBT-MO, is rate limiting in one host strain, we used the overall conversion of the dibenzothiophenic sulfur in diesel fuel to sulfite as a measure of improvements in DBT-MO and therefore as a measure of the evolution of dszC.
- the assay consisted of shaking cells in aqueous growth medium with diesel fuel in an organic phase and then spectrophotometrically measuring the sulfite produced in a given amount of time.
- the chimeric dszC library clones were placed on solid medium containing diesel fuel (25 ppm final sulfur) as the sole sulfur source. While cells lacking dszC failed to grow on this medium, cells containing an intact dszC, including thousands of chimeric dszCs, were able to release the sulfur from the oil and grew normally.
- DNA sequence of dszC chimeras Several chimeric dszC genes from the above library were prepared, purified and subjected to DNA sequencing by standard methods. Templates chosen included both selected and unselected chimeric clones. With the first data inte ⁇ reted (one sequencing reaction of about 400 out of a total of 1248 nucleotides for each of 9 isolates), it was clear that the present invention generated a wide number of diverse chimeras. The number of A3H1 hybridizing fragments in the analyzed 400 bases ranged from 1 to 4 fragments, indicating that some chimeric genes may have eight or more sections from the A3H1 parent (see below).
- Figure 10 shows the completed DNA sequence of one evolved, chimeric dszC (SEQ ID. NO: 3). It is aligned with the Nocardia sp. A3H1 parental dszC above (SEQ ID NO: 23)and the IGTS8 dszC (SEQ ID NO: 24) below, all shown with the entire reading frame from the initial start codon to the final stop codon. The locations of three introduced mutations in the chimeric dszC, but not acquired from either parent, are indicated by triangles below the sequences. Where the two parental dszC genes differ, the chimeric dszC sequence is highlighted in black to show identity to A3H1, or by underlines at individual nucleotides for IGTS8.
- the hybridizing fragments are expected to extend to about the middle of each underlined region.
- This alignment makes immediately apparent several characteristics of the present method for chimeragenesis.
- the templates and hybridizing fragments were designed to allow either parent to donate sequences all the way to the ends of the gene. In this case, the hybridizing fragments contributed both ends. (In the above mentioned DNA sequences analyzed so far from the beginning of the gene, both parents have contributed.) It was also anticipated that insertions or deletions could be introduced on hybridizing fragments, and that is the case as seen for the introduction of a 3 nucleotide deletion in line one (dashed lines).
- the chimeric dszC library In a 10 day growth selection, the chimeric dszC library (in the presence of the other dsz genes, dszA, dszB and dszD, and in an appropriate Rhodococcus host strain), allowed growth and desulfiirization on a diluted, biotreated diesel fuel to about the same extent as one of the library parents, the A3H1 dszC.
- the library's other parent, dszC from IGTS8 while much more active on undiluted, unbiotreated distillates, has little activity on this substrate and does not allow significant growth of the same host strain.
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU10980/01A AU1098001A (en) | 1999-10-19 | 2000-10-19 | Method for directed evolution by random chimeragenesis on transient templates |
Applications Claiming Priority (14)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US16042099P | 1999-10-19 | 1999-10-19 | |
US60/160,420 | 1999-10-19 | ||
US51466000A | 2000-02-29 | 2000-02-29 | |
US09/514,660 | 2000-02-29 | ||
US21888300P | 2000-07-18 | 2000-07-18 | |
US21909000P | 2000-07-18 | 2000-07-18 | |
US21908700P | 2000-07-18 | 2000-07-18 | |
US61869600A | 2000-07-18 | 2000-07-18 | |
US61893500A | 2000-07-18 | 2000-07-18 | |
US60/219,090 | 2000-07-18 | ||
US09/618,696 | 2000-07-18 | ||
US60/218,883 | 2000-07-18 | ||
US09/618,935 | 2000-07-18 | ||
US60/219,087 | 2000-07-18 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2001029211A2 WO2001029211A2 (en) | 2001-04-26 |
WO2001029211A3 WO2001029211A3 (en) | 2002-01-24 |
WO2001029211A9 true WO2001029211A9 (en) | 2002-08-15 |
Family
ID=27569069
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/029046 WO2001029211A2 (en) | 1999-10-19 | 2000-10-19 | Method for directed evolution by random chimeragenesis on transient templates |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU1098001A (en) |
WO (1) | WO2001029211A2 (en) |
Families Citing this family (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6991922B2 (en) | 1998-08-12 | 2006-01-31 | Proteus S.A. | Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation |
US6951719B1 (en) | 1999-08-11 | 2005-10-04 | Proteus S.A. | Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained |
WO2001064864A2 (en) * | 2000-02-28 | 2001-09-07 | Maxygen, Inc. | Single-stranded nucleic acid template-mediated recombination and nucleic acid fragment isolation |
WO2002006469A2 (en) * | 2000-07-18 | 2002-01-24 | Enchira Biotechnology Corporation | Methods of ligation mediated chimeragenesis utilizing populations of scaffold and donor nucleic acids |
US20040152094A1 (en) * | 2001-05-10 | 2004-08-05 | Steffen Danielsen | Method for producing recombined polynucleotides |
DE60232523D1 (en) | 2001-07-26 | 2009-07-16 | Stratagene California | MULTI-JOBS Mutagenesis |
EP1281757A1 (en) * | 2001-07-31 | 2003-02-05 | Direvo Biotech AG | Method for the production of nucleic acids consisting of stochastically combined parts of source nucleic acids |
US20040005709A1 (en) * | 2001-10-24 | 2004-01-08 | Hoogenboom Henricus Renerus Jacobus Mattheus | Hybridization control of sequence variation |
DK2315145T3 (en) | 2002-03-01 | 2016-01-25 | Codexis Mayflower Holdings Llc | Methods, systems, and software for identifying the functional biomolecules |
US7620500B2 (en) | 2002-03-09 | 2009-11-17 | Maxygen, Inc. | Optimization of crossover points for directed evolution |
GB0500703D0 (en) * | 2005-01-14 | 2005-02-23 | Bioinvent Int Ab | Molecular biology method |
GB2528647A (en) * | 2014-07-10 | 2016-02-03 | Momentum Bioscience Ltd | Detecting viable microorganisms |
CN104297221B (en) * | 2014-09-28 | 2017-01-25 | 南京诺唯赞生物科技有限公司 | Active determination method for Lambda exonuclease |
EP3347466B1 (en) | 2015-09-08 | 2024-01-03 | Cold Spring Harbor Laboratory | Genetic copy number determination using high throughput multiplex sequencing of smashed nucleotides |
GB201612011D0 (en) | 2016-07-11 | 2016-08-24 | Glaxosmithkline Ip Dev Ltd | Novel processes for the production of oligonucleotides |
WO2023132885A1 (en) * | 2022-01-04 | 2023-07-13 | Modernatx, Inc. | Methods of purifying dna for gene synthesis |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4959312A (en) * | 1985-05-31 | 1990-09-25 | The University Of Tennessee Research Corporation | Full spectrum mutagenesis |
DE3936258C1 (en) * | 1989-10-31 | 1991-04-25 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften Ev, 3400 Goettingen, De | |
US6335160B1 (en) * | 1995-02-17 | 2002-01-01 | Maxygen, Inc. | Methods and compositions for polypeptide engineering |
US6153410A (en) * | 1997-03-25 | 2000-11-28 | California Institute Of Technology | Recombination of polynucleotide sequences using random or defined primers |
FR2782323B1 (en) * | 1998-08-12 | 2002-01-11 | Proteus | PROCESS FOR THE IN VITRO PRODUCTION OF RECOMBINANT POLYNUCLEOTIDE SEQUENCES, SEQUENCE BANKS AND SEQUENCES THUS OBTAINED |
-
2000
- 2000-10-19 WO PCT/US2000/029046 patent/WO2001029211A2/en active Application Filing
- 2000-10-19 AU AU10980/01A patent/AU1098001A/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
WO2001029211A2 (en) | 2001-04-26 |
AU1098001A (en) | 2001-04-30 |
WO2001029211A3 (en) | 2002-01-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1141275B1 (en) | Improved nucleic acid cloning | |
WO2001029211A9 (en) | Method for directed evolution by random chimeragenesis on transient templates | |
JP2003513652A (en) | Method of producing biopolymer having modified properties | |
EP1358322B1 (en) | A method of increasing complementarity in a heteroduplex polynucleotide | |
EP1929012A2 (en) | Method for in vitro recombination | |
EP0920496A1 (en) | Recombination of polynucleotide sequences using random or defined primers | |
CA2331926A1 (en) | Methods for generating highly diverse libraries | |
Wang et al. | Mutant library construction in directed molecular evolution: casting a wider net | |
AU2002314712A1 (en) | A method of increasing complementarity in a heteroduplex polynucleotide | |
WO2006053131A1 (en) | Ladder assembly and system for generating diversity | |
WO2002006469A2 (en) | Methods of ligation mediated chimeragenesis utilizing populations of scaffold and donor nucleic acids | |
AU2003267008B2 (en) | Method for the selective combinatorial randomization of polynucleotides | |
WO2004027056A2 (en) | Methods of use for thermostable rna ligases | |
WO2001029212A1 (en) | Methods for chimeragenesis of whole genomes or large polynucleotides | |
WO2008131580A1 (en) | Site-directed mutagenesis in circular methylated dna | |
WO2002004630A2 (en) | Methods for recombinatorial nucleic acid synthesis | |
JP2010500040A (en) | Reconstruction by fragment ligation | |
EP1670914A1 (en) | A process for sequence saturation mutagenesis (sesam) | |
EP1548113B1 (en) | A method for obtaining circular mutated and/or chimaeric polynucleotides | |
JP3880173B2 (en) | DNA synthase | |
Glover et al. | Recombination and mutagenesis of DNA in vitro | |
US20040132054A1 (en) | Method for the selective combinatorial randomization of polynucleotides | |
CA2485218A1 (en) | Method for creating polynucleotide molecules | |
Tian-Wen et al. | Mutant library construction in directed molecular evolution | |
MXPA98009854A (en) | Recombination of polynucleotide sequences using random or defined primers |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US US US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US US US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
COP | Corrected version of pamphlet |
Free format text: PAGES 1/31-31/31, DRAWINGS, REPLACED BY NEW PAGES 1/30-30/30; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |