CA2485218A1 - Method for creating polynucleotide molecules - Google Patents
Method for creating polynucleotide molecules Download PDFInfo
- Publication number
- CA2485218A1 CA2485218A1 CA002485218A CA2485218A CA2485218A1 CA 2485218 A1 CA2485218 A1 CA 2485218A1 CA 002485218 A CA002485218 A CA 002485218A CA 2485218 A CA2485218 A CA 2485218A CA 2485218 A1 CA2485218 A1 CA 2485218A1
- Authority
- CA
- Canada
- Prior art keywords
- polynucleotide molecules
- stranded polynucleotide
- double
- dna
- strand breaks
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
Abstract
The invention relates to methods for creating polynucleotide molecules with modified characteristics, said methods running through a cycle comprising the following steps:(a) provision of a double-stranded polynucleotide molecule or a population of double-stranded polynucleotide molecules, the individual polynucleotides of said population having at least one homologous sequence part and at least one heterologous sequence part,(b) creation of single-strand breaks in the double-stranded polynucleotide molecules, (c) nucleolytic degradation in the 5'.fwdarw. 3' direction starting from the single-strand breaks with simultaneous new synthesis in the 5' .fwdarw. 3' direction and shifting of the single-strand breaks in the direction of the 3' end, (d) production of single-stranded polynucleotide molecules, (e) production of partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided in step (d), (f) template-directed nucleic acid synthesis starting from the partially double-stranded polynucleotide molecules produced in step (e), whereby steps (b) and (c) can be carried out in succession or simultaneously.
Description
METHOD FOR CREATING POLYNUCLEOTIDE MOLECULES
The present invention relates to a method for generating polynucleotide molecules wit altered properties.
Biomolecules, and in particular biopolymers such as polynucleotides, polypeptides, polysaccharides, etc.wnot only.
form the basis of biological life as we know it, but are also increasingly used in a whole variety of industrial applications.
The search for new functional biomolecules, their isolation and preparation and their industrial application are the subject matter of modern biotechnology. In addition to finding by chance previously unknown biomolecules with desired properties in nature (cf. screening for natural substances), there have recently appeared methods which mimic in a laboratory the principles of natural evolution.
In addition to the methods for generating point mutations (in the form of exchange, deletion and insertion of bases), recombination of sequence sections is a very successful strategy in nature for the combination of point mutations, but also of domains within a polymer, of subunits of a heteromultimer, or of gene variants within a gene cluster or of genes within a genome. Homologous recombination, i.e. the combination of corresponding sequence sections from different variants while retaining orientation and reading frame, is particularly important.
Experimentally, recombination can be realized in different ways:
firstly, in vitro by using individual enzyme functions or defined mixtures or sequences of enzymatic processing steps, secondly, in vivo by using cellular recombination and/or repair processes.
Previously, mainly PCR-based methods have been used in industrial in vitro methods. First to be mentioned here is DNA shuffling, also referred to as secual PCR (WO 95/22625; Stemmer, Nature 370 (1994), 389). In this case, random gene fragments whose sequences overlap are generated and subsequently reconstructed by PCR
without addition of primers to give products of the original length. Thus, in each PCR cycle it is possible for fragments of different origins, by priming each other, to combine randomly and homologously to a product molecule. DNA shuffling makes it _.
1a possible in principle to limit the frequency of recombination events by adjusting the fragment length. However, this method is experimentally complicated, since first the reaction conditions for generating the nucleic acid fragments have to be established.
Another method for preparing recombinant DNA in vitro has been reported by Shao et al., Nucl. Acids Res. 26 (1998), 681). This method used primers with ranc~~mized sequences, which enable polymerization to start at random sites within a polynucleotide.
Thus, similar to DNA shuffling, short polynucleotide fragments are produced which can recombine with one another by priming each other. Controlling the recombination frequency is hardly possible using this method. Moreover, the non-specific primers cause a comparatively high inherent error rate which can become a problem for sensitive sequence sections and/or long genes. As an alternative to these methods, the staggered extension process (WO 98/42728; Zhao et al., Nat. Biotechnol. (1998), 258) uses a modified PCR protocol in order to provoke strand exchange during PCR amplification. By using very short phases at the polymerization temperature between the melting and annealing phases, incomplete products can hybridize with new templates and be extended further. The recombination frequency can be adjusted by presetting the polymerization time and the number of cycles. A <
technical limitation here is the accurate setting of very short phases at a particular temperature. As an alternative to these PCR-based methods, a method has been described which generates from a population of polynucieotide sequences with mutations heteroduplexes which are then subjected to random repair in vivo by introducing them into cells or in vitro by incubating them with a cell extract, resulting in a certain proportion of recombinant molecule variants, depending on the relative frequency of the variants in the starting population (WO 99129902). This method is characterized by the use of cellular repair systems which specifically recognize unpaired bases and randomly repair either of the two strands in a double strand. This method if limited on the one hand by the limited efficiency in introducing polynucleotides into cells and by the missing controllability of the repair processes. A decisive disadvantage is furthermore the fact that in each repair step only two starting molecules can be recombined with one another.
It is an object of the present invention to provide a method for preparing polynucleotides with altered properties, which avoids the above-described disadvantages of the known methods and which allows efficient recombination of genotypes of polynucleotide molecules, thereby generating altered phenotypes.
We have found that this object is achieved by providing the embodiments described in the claims.
.:i Thus the present invention relates to a method for generating polynucleotide molecules with altered properties, which comprises going through at least one cycle comprising the following steps:
(a) providing a double-stranded polynucleotide molecule or a population of double-stranded polynucleotide molecules, with the individual polynucleotides of said population having at least one homologous sequence section and at least one heterologous sequence section, (b) generating single strand :;peaks in said double-stranded polynucleotide molecules (c) 5'-+3' nucleolytic degradation starting from said single strand breaks, with simultaneous 5'-+3' de-novo synthesis and shifting of said single strand breaks in the direction of the 3' end, (d) preparing single-stranded polynucleotide molecules (e) preparing partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), (f) template-directed nucleic acid synthesis starting from the partially double-stranded polynucleotide molecules prepared in step (e), it being possible to carry out the steps (b) and (c) successively or simultaneously.
The method of the invention is therefore distinguished by a combination of advantages, which cannot be achieved with any of the methods previously described. Further benefits of said method are its low experimental complexity and the small amount of time needed and also the possibility of automation.
The method of the invention is distinguished by the fact that simultaneous nucleolytic degradation and nucleic acid synthesis, i.e. "nick translation", avoids both excessive nucleic acid fragmentation and degradation of recombinable nucleic acids. In principle, the entire amount of DNA used is available for subsequent recombination of said nucleic acids in vitro.
The present invention relates to a method for generating polynucleotide molecules wit altered properties.
Biomolecules, and in particular biopolymers such as polynucleotides, polypeptides, polysaccharides, etc.wnot only.
form the basis of biological life as we know it, but are also increasingly used in a whole variety of industrial applications.
The search for new functional biomolecules, their isolation and preparation and their industrial application are the subject matter of modern biotechnology. In addition to finding by chance previously unknown biomolecules with desired properties in nature (cf. screening for natural substances), there have recently appeared methods which mimic in a laboratory the principles of natural evolution.
In addition to the methods for generating point mutations (in the form of exchange, deletion and insertion of bases), recombination of sequence sections is a very successful strategy in nature for the combination of point mutations, but also of domains within a polymer, of subunits of a heteromultimer, or of gene variants within a gene cluster or of genes within a genome. Homologous recombination, i.e. the combination of corresponding sequence sections from different variants while retaining orientation and reading frame, is particularly important.
Experimentally, recombination can be realized in different ways:
firstly, in vitro by using individual enzyme functions or defined mixtures or sequences of enzymatic processing steps, secondly, in vivo by using cellular recombination and/or repair processes.
Previously, mainly PCR-based methods have been used in industrial in vitro methods. First to be mentioned here is DNA shuffling, also referred to as secual PCR (WO 95/22625; Stemmer, Nature 370 (1994), 389). In this case, random gene fragments whose sequences overlap are generated and subsequently reconstructed by PCR
without addition of primers to give products of the original length. Thus, in each PCR cycle it is possible for fragments of different origins, by priming each other, to combine randomly and homologously to a product molecule. DNA shuffling makes it _.
1a possible in principle to limit the frequency of recombination events by adjusting the fragment length. However, this method is experimentally complicated, since first the reaction conditions for generating the nucleic acid fragments have to be established.
Another method for preparing recombinant DNA in vitro has been reported by Shao et al., Nucl. Acids Res. 26 (1998), 681). This method used primers with ranc~~mized sequences, which enable polymerization to start at random sites within a polynucleotide.
Thus, similar to DNA shuffling, short polynucleotide fragments are produced which can recombine with one another by priming each other. Controlling the recombination frequency is hardly possible using this method. Moreover, the non-specific primers cause a comparatively high inherent error rate which can become a problem for sensitive sequence sections and/or long genes. As an alternative to these methods, the staggered extension process (WO 98/42728; Zhao et al., Nat. Biotechnol. (1998), 258) uses a modified PCR protocol in order to provoke strand exchange during PCR amplification. By using very short phases at the polymerization temperature between the melting and annealing phases, incomplete products can hybridize with new templates and be extended further. The recombination frequency can be adjusted by presetting the polymerization time and the number of cycles. A <
technical limitation here is the accurate setting of very short phases at a particular temperature. As an alternative to these PCR-based methods, a method has been described which generates from a population of polynucieotide sequences with mutations heteroduplexes which are then subjected to random repair in vivo by introducing them into cells or in vitro by incubating them with a cell extract, resulting in a certain proportion of recombinant molecule variants, depending on the relative frequency of the variants in the starting population (WO 99129902). This method is characterized by the use of cellular repair systems which specifically recognize unpaired bases and randomly repair either of the two strands in a double strand. This method if limited on the one hand by the limited efficiency in introducing polynucleotides into cells and by the missing controllability of the repair processes. A decisive disadvantage is furthermore the fact that in each repair step only two starting molecules can be recombined with one another.
It is an object of the present invention to provide a method for preparing polynucleotides with altered properties, which avoids the above-described disadvantages of the known methods and which allows efficient recombination of genotypes of polynucleotide molecules, thereby generating altered phenotypes.
We have found that this object is achieved by providing the embodiments described in the claims.
.:i Thus the present invention relates to a method for generating polynucleotide molecules with altered properties, which comprises going through at least one cycle comprising the following steps:
(a) providing a double-stranded polynucleotide molecule or a population of double-stranded polynucleotide molecules, with the individual polynucleotides of said population having at least one homologous sequence section and at least one heterologous sequence section, (b) generating single strand :;peaks in said double-stranded polynucleotide molecules (c) 5'-+3' nucleolytic degradation starting from said single strand breaks, with simultaneous 5'-+3' de-novo synthesis and shifting of said single strand breaks in the direction of the 3' end, (d) preparing single-stranded polynucleotide molecules (e) preparing partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), (f) template-directed nucleic acid synthesis starting from the partially double-stranded polynucleotide molecules prepared in step (e), it being possible to carry out the steps (b) and (c) successively or simultaneously.
The method of the invention is therefore distinguished by a combination of advantages, which cannot be achieved with any of the methods previously described. Further benefits of said method are its low experimental complexity and the small amount of time needed and also the possibility of automation.
The method of the invention is distinguished by the fact that simultaneous nucleolytic degradation and nucleic acid synthesis, i.e. "nick translation", avoids both excessive nucleic acid fragmentation and degradation of recombinable nucleic acids. In principle, the entire amount of DNA used is available for subsequent recombination of said nucleic acids in vitro.
This makes it possible to increase recombination efficiency compared with the previously described .-lethods for recombining nucleic acids in vitro.
A preferred embodiment comprises going through more than one cycle comprising the abovementioned steps (a) to id), i.e, at least two, preferably at least 5, particularly preferably at least 10, and very particularly preferably at least 20, cycles.
Cyclic application of the method of the invention thus makes it possible to prepare from a starting distribution of related polynucleotide sequences polynucleotides with sequence regions which have been newly combined several times. Said cyclic application in particular allows a plurality of different heterologous sequence sections can be combined with one another.
Furthermore, it is possible to control precisely the recombination frequency per polynucleotide strand via the number of cycles. Cyclic application makes it also possible to control in this way the average interval between recombination events from one cycle to the next.
In a further preferred embodiment, a selection step is carried out after one, several or all cycles of the method of the invention. Said selection step may be related to either the genotype or the phenotype or to both the genotype and the phenotype of the polynucleotide.
In this connection, the genotype of a polynucleotide is the sequence of different monomers in said polynucleotide. The phenotype is the sum of the functions and properties of a polynucleotide molecule and of the transcription or translation products encoded by a polynucleotide.
The selection step may be carried out, for example, as amplification-coupled (natural) selection, selection by physical separation or selection by screening (Koltermann and Kettling, Biophys. Chem. 66 (1999), 159; Kettling et al., Current Topics in Microbiol. and Immunol. 243 (1999), 173; Koltermann, Dissertation, TU Berlin (1998), Zhao et al., in Manual of Ind.
Microbiol. and Biotechnol. Chapter 49, pp. 597604, ASM Press, Washington, DC, 1999; Reetz, Angew. Chem. 113 (2001) 113, 292-320. Step (a) of the method of the invention provides a double-stranded polynucleotide molecule or a population of double-stranded polynucleotides.
The population of double-stranded polynucleotide molecules which is provided according to step (a) of the method of the invention may be any population of double-stranded polynucleotide molecules which comprises at least two types of polynucleotide molecules, which comprise at least one homologous sequence section and at least one heterologous sequence section. In this connection, the term "population of single-stranded polynucleotide molecules"
refers to an amount of polynucleotide molecules, with intermolecular interactions in the form of specific base pairings between said molecules being prevented or being nonexistent. The term "polynucleotides" (nucleic acids, oligonucleotides) here comprises both DNA and RNA, polynucleotides are linear, oriented (5'--~3') heteropolymers which may be in single-stranded or double-stranded form. In a double strand, two single strands bind to one another via interactions in the form of specific base pairing. In principle, the polynucleotides may also be DNA or RNA
with modified monomers. In general, the method can also be applied to similarly constructed artificial polymers and also to DNA-RNA hybrid double strands.
The term "homologous sections" refers to sections which are identical or complementary in two or more polynucleotide molecules, i.e, which contain the same information in corresponding positions. The term "heterologous sections" refers to sections which are not identical or not complementary in two or more polynucleotide molecules, i.e. which contain differing information in the corresponding positions. Information of a polynucleotide molecule (genotype) here refers to the sequence of different monomers in a polynucleotide molecule. A heterologous sequence region is at least one nucleotide in length, but may also be substantially longer. A heteroiogous sequence region may in particular be two nucleotides, or three nucleotides, for example of a codon, and preferably more than 5 nucleotides, particularly preferably more than 10 nucleotides, in length. In principle, the length of a heterologous region has no upper limit. Preferably, however, a heterologous region should be no longer'than 10 000 nucleotides, particularly preferably no longer than S 000 nucleotides, in particular no longer than 2 000 nucleotides, and very particularly preferably no longer than 1 000 nucleotides. Relatively long sequence sections of this kind may be, for example, the hypervariable regions of a sequence encoding an antibody, domains of a protein, genes in a gene cluster or regions of a genome. The heterologous regions are preferably sequence regions in which the polynucleotide molecules differ from one another in individual bases. However, heterologous regions may also be based on a deletion, duplication, insertion, inversion or addition being present or having occurred in a polynucleotide molecule.
The double-stranded polynucleotide molecules provided according to step (a) of the method of the invention have, according to the invention, at least one homologous and at least one heterologous sequence region. Preferably, ~=owever, they have a multiplicity of homologous and heterologous sections. In principle, there is no upper limit for the number of homologous and heterologous sections.
The heterologous sections in said double-stranded polynucleotide molecules are in each case interrupted by homologous sections. In this connection, the homologous sections are preferentially at least 5, preferably at least 10, and particularly preferably at least 20, nucleotides in length. However, like the heterologous sections, the homologous sections.may be substantially longer, and in principle there is no upper limit of their length:
Preferentially, they should be no longer than 50 000 nucleotides, preferably no longer than 20 000 nucleotides, particularly preferably no longer than 10 OOO nucleotides, and very particularly preferably no longer than 1 000 nucleotides.
Double-stranded polynucleotide molecules can be provided according to step (a) of the method of the invention by methods known to the skilled worker. These include, for example, physical, chemical, biochemical and biological methods. These include both synthetic and preparative methods, such as, for example, chemical synthesis of oligonucleotides, synthesis of nucleic acids by polymerase chain reaction (PCR), preparation of plasmids, cosmids, phages, BACs (bacterial artificial chromosomes), YACs (yeast artificial chromosomes) or chromosomal DNA.
In a particularly preferred embodiment of the method of the invention, a population of double-stranded polynucleotides with homologous and heterologous sections is provided by using related polynucleotide sequences from the distribution of mutants of a quasispecies. The term "related" here relates to polynucleotides, among which there are both hornologous and heterologous sections.
Quasispecies refers to a dynamic population of molecule variants (mutants) related to one another, which is produced by error-prone replication. It was possible to show that, according to the quasispecies principle, the subject of selection is not ..
the wild type (center of mass of the quasispecies) but the entire distribution. tnlith altered selection conditions, such a distribution of mutants already contains advantageous variants . PF 53571 CA 02485218 2004-11-04 according to their fitness value, which therefore need not be produced first by subsequent, random mutations. In the case of successive shifting of the selection parameters, evolutive ' generation then resembles an implicitly directed drift of said quasispecies along ridges of the value landscape. WO 92/18645 describes the preparation of quasispecies and the application of this principle for evolutive biotechnology.
The generation of a quasispecies if based on error-prone replication of the molecular variants. V~hen using polynucleotides, replication is preferably carried out with the aid of replication enzymes, i.e. polymerases, which enable template-controlled synthesis of a polynucleotide molecule. The introduction of errors, i.e. variation in molecular information, can be achieved by the inherently error-prone copying process alone or else by specifically increasing polymerase inaccuracy (e.g. specifically imbalanced addition of monomers, addition of base analogs, error-prone PCR, polymerases with very high error rates), by post-synthesis chemical modification of polynucleotides, by complete synthesis of polynucleotides with at least partial use of monomer mixtures and/or nucleotide analogs, and by a combination of said methods. Preference is given to using distributions of mutants of a qaasispecies, the phenotypical properties of a desired molecular function of the individual mutants of said quasispecies having already been improved compared to the wild type. The term "phenotype of a polynucleotide molecule" refers to the sum of functions and properties of a polynucleotide molecule and of the transcription or translation product encoded by a polynucleotide.
In addition, it is possible to use sequences of different origin, inter alia polynucleotide sequences of a gene family from different species, polynucleotide sequences which have been replicated at a particularly high error rate in vivo (e.g. by viruses, by mutator bacteria, by bacteria under W irradiation) or in vitro (e. g. by means of Qi3-repiicase react~~.on, error-prone PCR), polynucleotide sequences into which, after synthesis, mutations have been introduced by means of chemical agents or which have been chemically synthesized in such a way that they have homologous and heterologous sections, or polynucleotide sequences which have been generated by a combination of abovementioned methods. In principle, the polynucleotides used in the method of the invention may be any polynucleotides, in particular DNA or RNA molecules.
The single strand break required in step (b) of the method of the invention can, in principle, be generated by any method which leads to cleavage of a phosphodiester bond between 2 nucleotides in a polynucleotide strand of the double-stranded polynucleotide molecule. Said methods may be physical or chemical methods (e. g.
ultrasound treatment, partial ester hydrolysis).
Enzymic methods are particularly suitable for step (b).
Examples of enzymes suitable for this are nucleases.
In a preferred embodiment of the method of the invention, single strand breaks are introduced by sequence-specific nicking enzymes.
Examples of said nicking enzymes are V.BchI from Bacillus _ chitinosporus, N.BstNBI from Bacillus stearothermophilus, N.BstSEI from Bacillus stearothermophilus, N.CviPII from Chlorella strain NC64A, N.CviQXI from Chlorella strain NC64A, 20 V.EcoDem from E.coli, V.HpaII from Haemophilus parainfluenzae, V.Neal from Nocardia aerocolonigenes and V.XorII from Xanthomonas oryzae.
In a further preferred embodiment it is possible to introduce 25 single strand breaks into said double-stranded polynucleotide molecules by non-sequence-specific nicking enzymes. In this connection, it is possible to use, for example, calf pancreas DNase I with Mg2+ as cofactor (Kunitz, J. Genetic Physiology 33 (1950), 349; Kunitz, J. Genetic Physiology 33 (1950), 363, and Melgac and Goldthwaite, J. Liolog. Chem. 243 (1968), 4409).
The reaction conditions in step (c) are chosen depending on the enzymes used.
In a preferred embodiment, step (c) is carried out under conditions which cause an increased error rate of de-novo synthesis.
Said error rate of de-novo synthesis may be chosen depending an the desired variants to be generated. Typical error rates are from 0.1 x 10-3 to 10 x 10-3, i.e. 0.01 to 1~ error (exchange of 1 to 10 bases in a DNA section of 10 000 bases).
It is particularly useful to carry out step (c) with an error .
rate of from 1 x 10-3 to 5 x 10-3, i.e. 0.1 to 0.5~ error, i.e. 1 to 5 bases are exchanged in a DNA section of 1 000 bases.
The error rate of DNA polymerise I is 9 x 10-6 (Kunkel et al.
(1984) J. Biol. Chem. 259:1539-1545). Consequently, when using DNA polymerise I, an increase in the error rate means an error rate of more than 9 x 10-6.
In principle, the error rate of de-novo synthesis can be increased, for example, by using mutated DNA polymerise or by choosing the proper reaction conditions in step (c).
In a preferred embodiment, the error rate of de-novo synthesis is increased by using polymerises with reduced or no proofreading activity.
In a preferred embodiment of the method of the invention, the error rate of de-novo synthesis is increased by different nucleotide concentrations as starting material. In this connection, the concentration of individual or several nucleotides can be varied relatively to the other nucleotides.
Preference is given to a substoichiometric amount of one nucleotide, in particular of dATP, compared to the other nucleotides. Examples of suitable concentrations are 200 ~.M each of dGTP, dCTP and dTTP and from 20 to 50 ~M ATP.
Preference is given to substoichiometric amounts of two nucleotides, in particular o' dATP and dGTP, compared to the other nucleotides. Examples of suitable concentrations are 200 ~,M
each of dCTP and dTTP and 40 ~M each of dATP and dGTP.
In a further embodiment of the method of the invention, the error rate of de-novo synthesis is increased by the addition of nucleotide analogs. Nucleotide analogs which may be mentioned are deoxyinosine triphosphate, ?-deazadeoxyguanosine triphosphate and deoxynucleoside a-thiotriphosphate. Particular preference is given to using deoxyinosine triphosphate.
In a further embodiment of the method of the invention the error rate of de-novo synthesis is increased by varying the salt concentration. An example suitable for this is an increase in the concentration of Mg2+ ions to concentrations above 1.5 mM. Also suitable is the addition of Mn2+ ions, for example in a concentration range from 0.2 to 1 mM, in particular 0.2 to 0.5 mM.
In a further embodiment of the method of the invention, the error rate of de-novo synthesis is increased by adding additives. A
suitable additive is any substance which increases the error rate; examples which may be mentioned are dimethyl sulfoxide, polyethylene glycol and glycerol. Particular preference is given to adding said additives at the following concentrations: DMSO at from 2 to 100, PEG at from 5 to 150, glycerol at from > 0 to 300, 5 preferably 5 to 20~.
In a further embodiment, the error rate of de-novo synthesis is increased by changing the reaction temperature, in particular by an increase in temperature.
All of the measures mentioned for increasing the error rate may also be carried out in combination with one another, for example excess of a nucleotide at increased Mn2+ ion concentration.
In a preferred embodiment, s~eps (b) and (c) are carried out simultaneously.
Preparation of single-stranded polynucleotide molecules, according to step (d) of the method of the invention, may be carried out using methods known to the skilled worker. These include, for example, physical, chemical, biochemical and biological methods. Examples which may be listed here are melting of polynucleotide double strands by means of heating to temperatures above the annealing temperature (Newton, in: PCR, Spektrum Akademischer Verlag (1994); Lazurkin, Biopolymers 9 (1970), 1253-1306), denaturing polynucleotide double strands by means of adding denaturing reagents (e. g. urea or detergents), addition of enzymes which convert double-stranded polynucleotides to single-stranded polynucleotides, for example by exonucleolytic degradation of double-stranded DNA to single-stranded DNA.
Preparation of partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), according to step (e) of the method of the invention, may be carried out using methods known to the skilled worker and is preferably achieved by hybridizing the homologous sections of the complementary single-stranded polynucleotide molecules.
Hybridization to give double-stranded polynucleotides is carried out using methods known to the skilled worker and may, in particular, be achieved, for example, by combining the single strands and setting reaction conditions, which promote annealing of complementary polynucleotides, such as, for example, by lowering the temperature and/or reducing the salt concentration.
Starting from the partially double-stranded polynucleotide molecules prepared in step (e), a template-directed nucleic acid synthesis is carried out in step (f) of the method of the invention.
The term "template-directed nucleic acid synthesis" here refers to the synthesis of a polynucleotide by extending an existing single strand on the basis of the information of a corresponding template strand.
The skilled worker is familiar with carrying out a template-directed polymerization of this kind, which is described, for example, in Sambrook (Molecular Cloning, Cold Spring Harbor Laboratory Press (1989)).
Any enzyme which has template-controlled polynucleotide polymerization activity and which is capable of synthesizing polynucleotide strands may be used for the polymerase reaction. A
multiplicity of polymerases from a large variety of organisms and 20 with different functions have already been isolated and described. There is a distinction with respect to the type of template and of synthesized polynucleotide between DNA-dependent DNA polymerases, RNA-dependent DNA polymerases (reverse transcriptases), DNA-dependent RNA polymerases and RNA-dependent 25 RNA polymerases (replicases). With respect to temperature stability, there is a distinction between non-thermostable (37°C) and thermostable polymerases (75 to 95°C). Furthermore, polymerases differ with respect to the presence of 5'-3'- and 3'-5'-exonucleolytic activity. The most important polymerases are DNA-dependent DNA polymerases.
In particular, it is possible to use DNA polymerases having a temperature optimum of around 37°C. These include, for example, the E. coli DNA polymerase I, T7 DNA polymerase of bacteriophage T7 and T4 DNA polymerase of bacteriophage T4, each of which is commercially sold by a multiplicity of manufacturers, for example USB, Rbche Molecular Biochemicals, Stratagene, NEB or Quantum Biotechnologies. E. coli DNA polymerase I (holoenzyme) has a 5'-3' polymerase activity, a 3'-5' proofreading exonuclease activity and a 5'-3' exonuclease activity. The enzyme is used for in vitro DNA labeling by means of the nick translation method (Rigby et al. (J. Mol. Biol. 113 (1977)), 237-251). In contrast to the holoenzyme, the Klenow fragment of E. coli DNA polymerase I, like T7 DNA polymerase and T4 DNA polymerase, has no 5' exonuclease activity. Therefore, these enzymes are used for "fill-in reactions" or for the synthesis of long strands (Young et al. (Biochemistry 31 (1992), $675-8690), Lehman (Methods Enzymol. 29 (1974), 46-53)). Finally, the 3'-5'-exo(-) variant of the Klenow fragment of E. coli DNA polymerise I also lacks the 3' exonuclease activity. This enzyme is often used for DNA
sequencing according to Singer (Singer (Proc. Natl. Acid. Sci.
USA 74 (1977), 5463-5467)). In addition to these enzymes, there exists a multiplicity of further 37°C DNA polymerises with different properties, which may be used in the method of the invention.
The most common, thermostable DNA polymerise which has a temperature optimum of 75°C and is sufficiently stable at 95°C
is Taq DNA polymerise from Therrlus aquaticus, which is commercially available. Taq DNA polymerise is a highly processive 5'-3' DNA
polymerise which has no 3'-5' exonuclease activity. It is often used for standard PCRs, for sequencing reactions and for mutagenic PCRs (Cadwell and 3oyce (PCR Methods Appl. 3 (1994), 136-140, Agrogoni and Kaminski (Methods Mol. Biol. 23 (1993), 109-114)). Tth DNA polymerise from Thermus thermophilus HB8 and Tfl DNA polymerise from Thermus flavus have similar properties.
Tth DNA polymerise, however, additionally has an intrinsic reverse-transcriptase (RT) activity in the presence of manganese ions (Cusi et a1. (Biotechniques 17 (1994), 1034-1036)). Again, quite a number of the thermostable DNA polymerises with 3' but no 5' exonuclease activity are sold commercially: Pwo DNA polymerise from Pyrococcus woesei, Tli, Vent and DeepVent DNA polymerises from Thermococcus litoralix, Pfx and Pfu DNA polymerises from Pyrococcus furiosus, Tub DNA polymerise from Thermus ubiquitous, Tma and UlTma DNA polymerise from Thermotoga maritima (Newton and Graham, in: PCR, Spektrum Akad. Verlag Heidelberg (1994), 1)).
Polymerises lacking 3' proofreading exonuclease activity are used in order to amplify PCR products as with as few errors as possible. Finally, DNA polymerises lacking both 5' and 3' exonucleolytic activities are available in the form of the Stoffel fragment of Taq DNA polymerise, the Vent-(exo-) DNA
polymerise and Tsp DNA polymerise. The most common enzymes among the RNA-dependant DNA polymerises (reverse transcriptases) include AMV reverse transcriptase fro_n avian myeloblastosis virus, M-MuLV reverse transcriptase from Moloney murine leukemia virus and HIV reverse transcriptase from human immunodeficiency virus, which are also sold by various suppliers such as, for example, NEB, Life Technologies, Quantum Biotechnologies. Like HIV reverse transcriptase, ~~2V reverse transcriptase has an associated RNase H activity which is markedly reduced in M-MuLV
reverse transcriptase. Both M-MuLV and AMV reverse transcriptase lack 3'-5' exonuclease activity.
a PF 53571 CA 02485218 2004-11-04 The most common enzymes among the DNA-dependent RNA polymerises include E. coli RNA polymerise, SP6 RNA polymerise from Salmonella thyphimurium LT2 infected with bacteriophase SP6, T3 RNA polymerise from bacteriophage T3 and T7 RNA polymerise from bacteriophage T7.
In a preferred embodiment of the method of the invention the template strands in step (f) of the method are DNA molecules and a DNA-dependent DNA polymerise is used for template-directed single strand synthesis.
In a particularly preferred embodiment, a non-thermostable DNA
polymerise, particularly preferably one with 5' and 3' exonucleolytic activity, such as, for example, E. coli polymerise I, is used here.
As an alternative, it is also possible to use a non-thermostable DNA polymerise which has a 3'-+5' exonucleolytic activity but no 5'-+3' exonucleolytic activity, such as, for example, the Klenow fragment of E. coli DNA polymerise I, T7 DNA polymerise from bacteriophage T7 or T4 DNA polymerise from bacteriophage T4.
It is furthermore also possible to use a non-thermostable DNA
polymerise which has neither 5'-+3' nor 3'--~5' exonucleolytic activity, such as, for example, the 3'-5'-exo(-) variant of the Klenow fragment of E. coli DNA polymerise I.
Another, particularly preferred embodiment uses a thermostable polymerise (e. g. Taq polymerise, Pwo polymerise) which may again have 5' and 3' exonucleolytic activities or else 5' exonucleolytic activity but no 3' exonucleolytic activity, such as, for example, Taq DNA polymerise from Thermus aquaticus, Tth DNA polymerise from Thermus thermophilis HB8 or Tfl DNA
polymerise from Thermus flavus.
Alternatively, the thermostable DNA polymerise may have 3'-+5' but no 5'--t3' exonucleolytic activity, such as, for example, the Pwo DNA polymerise from Pyrococcus woesei, the VentR DNA polymerise, the DeepVentR DNA polymerise or the Tli DNA polymerise from Thermococcus litoralis, the Pfu DNA polymerise or the Pfx DNA
polymerise from Pyrococcus furiosus or Tma DNA polymerise or UlTma DNA polymerise from Thermotoga maritima.
It is further possible to use a thermostable polymerise which has neither 3'-5' nor 5'-3' exonucleolytic activity, such as, for example, the Stoffel fragment of Taq DNA polymerise from Thermus aquaticus, the Tsp DNA polymerise or the exo(-) variant of VentR
DNA polymerase or DeepVentR DNA polymerase from Thermococcus litoralis.
If a thermostable polymerase is used, the polymerase reaction preferably immediately follows step (e), without intermediate purification or further sample treatment.
In another preferred embodiment of the method of the invention, the template strands on which template-directed single strand synthesis is carried out in step (f) of the method of the invention are RNA molecules, In this case, the template-directed single strand synthesis uses an RNA-dependent DNA polymerase, preferably AMV reverse transcriptase from avian myeloblastosis virus, HIV reverse transcriptase from human immunodeficiency 25 virus, or M-MuLV reverse transcriptase from Moloney murine leukemia virus. Preference is further given to using a thermostable reverse transcriptase, very particularly Tth DNA
polymerase from Thermus thermophilus, which has intrinsic reverse transcriptase activity.
Example 1 Unless stated otherwise, the experiments were carried out according to Current Protocols in Molecular Biology.
I. Providing the starting material 4 lipase variants were used as starting material:
LipA H86W encoded by pBP2035, LipA S87T encoded by pBP2008, LipA F142W encoded by pBP2006, LipA L167A encoded by pBP2007.
1. Plasmid preparation of the following plasmids:
Plasmid Vector Vector Insert Insert size Enzyme size variant pBP2006 pBSIIKS 2961 56-20 1142 by F142W
by pBP2007 pBSIIKS 2961 98-10 1142 by L167A
by pBP2008 pBSIIKS 2961 124-9 1142 by S87T
by pBP2035 pBSIIKS 2961 198-1-3 1142 by H86W
by 2. Cleaving the plasmids with restriction endonucleases HindIII
and SacI
3. Isolating the inserts b~~ gel extraction using the GFX Kit (Pharmacia) 4. Resuspending the DNA fragments in H20 5. Adjusting the DNA concentrations to 250 ng/~l II. Generation of single strand breaks and de-novo synthesis 1. 4 separate reaction mixtures for r_ick translation of inserts 56-20, 98-10, 124-9, 198-1-3, using the nick translation kit 5 (Roche, Cat. No. 976776) Component Volume DNA solution with insert -250 ng/~,l 16 ~,~.1 dATP 0.4 mM 2,5 ~l 10 dCTP 0.4 mM 2,5 ~l dGTP 0 . 4 mM 2 , 5 ~,1 dTTP 0 . 4 mM 2 , 5 ~,l 10 x buffer 5 ~tl H20 14 ~l Enzyme mix 1 ) 5 ~.1 15 Total 50 ~,1 1) Enzyme mix:
DNA polymerase I and DNAseI in 50 $ glycerol (v!v) 2. Incubating the mixtures at 15~C, 90 min 3. Stopping the reaction by adding 5 ~1 of 0.5 M EDTA, pH 8.8 4. Precipitating, washing, drying and resuspending the mixtures in 20 ~l of H20 III.PCR without primers Reaction mixture for PCR using the GC rich PCR system (Roche, Cat. No. 2140306) Component Volume Mixture of 6 ~tl of each mixture from 24 ~1 2.4 dNTP 10 mM 1 ~l GC rich resolution solution 5 M 10 ~,1 GC rich reaction buffer 10 ~tl PCR grade H20 4 ~1 GC rich enzyme mix ) 1 ~l Total 50 ~,l Thermostatic Taq-DNA polymerase and Tgo DNA polymerase x6 PCR conditions:
Temperature Time Cycles 95C 5 min 55C 60 s 45 72C 60 s 95C 30 s 72C 10 min 4C x min IV. PCR with primers Reaction mixture for PCR using the GC rich PCR system (Roche, Cat. No. 2140306):
Component Volume PCR product from step 3 5 ~.l dNTP 10 mM 1 ~.1 Primer MAT16 * 6 , 2 5 ).~M 2 ~1 Primer MAT19* 6, 25 ~,M 2 ~,1 GC rich resolution solution 10 ~1 GC rich reaction buffer 10 ~l PCR grade H20 19 ~1 GC rich enzyme mix 1 ~1 Total ~ ( 5 0 ~,1 ~
* Primer MAT16 = 5'-GATCGACGTAAGCTTTAACGATGGAGAT-3' * Primer MAT19 = 5'-CATCGGGCGAGCTCCCAGCCCGCCGCG-3' PCR conditions:
Temperature Time Cycles 95C 5 min 52C 30 s 25 72C 60 s g5C 30 s 72C 10 min 4C x min ~0 V. Cloning and analyzing the fragments 1. 20 ~l of the PCR product from step 4 are cut with HindIII and Sa cI
2. Precipitating, washing, drying and resuspending the mixture in 20 ~.1 of H20 3. Purifying the cut fragments using the GFX kit (Pharmacia) 4. Ligating the cut fragments with vector pBSIIKS (Stratagene), which has been cut beforehand with HindIII and Sacl 5. Transforming the ligation mixtures into Escherichia coli XL1-Blue 6. Sequence analysis of 29 clones with inserts SEQUENCE LISTING
<110> BASF AG
<120> Method for generating polynucleotide molecules <130> PF5357I/MSt <140> PCT/EP03/05308 <141> 2003-05-21 <160> 4 <170> PatentIn version 3.1 <210> 1 <211> 1142 <212> DNA
<213> pBluescriptIIKS+
<220>
<221> misc_feature <223> Lipases in pBluescriptIIKS+
<400> 1 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggctggagccagggcggcetgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960 53 ~ 7 1 CA 02485218 2004-11-04 ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc 1I42 <210> 2 <211> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature <222> (1)..-(1142) <223>
<220>
<221> misc_feature <222> (1). (1142) <223>
<400> 2 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggc.cgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacacccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 P,.k' 53571 CA 02485218 2004-11-04 tgatcaatcg cgcctcgggg cagaacgacg ggctcgtctc gcgctgcagc tcgctgttcg 960 ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc I142 <210> 3 <211> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc_feature <222> (1)..(1142) <223>
<220>
<221> misc_feature <222> (1)..(1142) <223>
<220>
<221> misc_feature <222> (1). (1142) <223>
<220>
<221> misc_feature <222> (1)..(1142) <223>
<400> 3 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 BF 53571 _ CA 02485218 2004-11-04 atcgcggctc cgagttcgcc gacttcgtgc aggacgtgct gaagaccgat ccgaccgggc 540 tctcgtcgac ggtgatcgcc gccttcgtca acgtgttcgg cacgctcgtc agcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacggccaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960 ggcaggtgatcagcaccagctaccactggaaccatctcgacgagatcaaccagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc 1142 <210> 4 <2-I1> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature <222> (1)..(I142) <223>
<400> 4 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgcctgggtcaacgtgttcggcacgctcgtcagcagctcgc 600 P~' 53571 . CA 02485218 2004-11-04 acaacaccgaccaggacgcgctcgcggcgc tgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcc tgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagc acctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtga ccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtcca cgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacg ggctcgtctcgcgctgcagctcgctgttcg 960 ggcaggtgatcagcaccagctaccactgga accatctcgacgagatcaaccagctgctcg 1020 gcgtgcgcggcgccaacgcggaagatccgg tcgcggtgatccgcacgcacgtgaaccggc 1080 tcaagctgcagggcgtgtgatggcgcaggc cgatcgtccggcgcgcggcgggctgggagc 1140 tc 1142
A preferred embodiment comprises going through more than one cycle comprising the abovementioned steps (a) to id), i.e, at least two, preferably at least 5, particularly preferably at least 10, and very particularly preferably at least 20, cycles.
Cyclic application of the method of the invention thus makes it possible to prepare from a starting distribution of related polynucleotide sequences polynucleotides with sequence regions which have been newly combined several times. Said cyclic application in particular allows a plurality of different heterologous sequence sections can be combined with one another.
Furthermore, it is possible to control precisely the recombination frequency per polynucleotide strand via the number of cycles. Cyclic application makes it also possible to control in this way the average interval between recombination events from one cycle to the next.
In a further preferred embodiment, a selection step is carried out after one, several or all cycles of the method of the invention. Said selection step may be related to either the genotype or the phenotype or to both the genotype and the phenotype of the polynucleotide.
In this connection, the genotype of a polynucleotide is the sequence of different monomers in said polynucleotide. The phenotype is the sum of the functions and properties of a polynucleotide molecule and of the transcription or translation products encoded by a polynucleotide.
The selection step may be carried out, for example, as amplification-coupled (natural) selection, selection by physical separation or selection by screening (Koltermann and Kettling, Biophys. Chem. 66 (1999), 159; Kettling et al., Current Topics in Microbiol. and Immunol. 243 (1999), 173; Koltermann, Dissertation, TU Berlin (1998), Zhao et al., in Manual of Ind.
Microbiol. and Biotechnol. Chapter 49, pp. 597604, ASM Press, Washington, DC, 1999; Reetz, Angew. Chem. 113 (2001) 113, 292-320. Step (a) of the method of the invention provides a double-stranded polynucleotide molecule or a population of double-stranded polynucleotides.
The population of double-stranded polynucleotide molecules which is provided according to step (a) of the method of the invention may be any population of double-stranded polynucleotide molecules which comprises at least two types of polynucleotide molecules, which comprise at least one homologous sequence section and at least one heterologous sequence section. In this connection, the term "population of single-stranded polynucleotide molecules"
refers to an amount of polynucleotide molecules, with intermolecular interactions in the form of specific base pairings between said molecules being prevented or being nonexistent. The term "polynucleotides" (nucleic acids, oligonucleotides) here comprises both DNA and RNA, polynucleotides are linear, oriented (5'--~3') heteropolymers which may be in single-stranded or double-stranded form. In a double strand, two single strands bind to one another via interactions in the form of specific base pairing. In principle, the polynucleotides may also be DNA or RNA
with modified monomers. In general, the method can also be applied to similarly constructed artificial polymers and also to DNA-RNA hybrid double strands.
The term "homologous sections" refers to sections which are identical or complementary in two or more polynucleotide molecules, i.e, which contain the same information in corresponding positions. The term "heterologous sections" refers to sections which are not identical or not complementary in two or more polynucleotide molecules, i.e. which contain differing information in the corresponding positions. Information of a polynucleotide molecule (genotype) here refers to the sequence of different monomers in a polynucleotide molecule. A heterologous sequence region is at least one nucleotide in length, but may also be substantially longer. A heteroiogous sequence region may in particular be two nucleotides, or three nucleotides, for example of a codon, and preferably more than 5 nucleotides, particularly preferably more than 10 nucleotides, in length. In principle, the length of a heterologous region has no upper limit. Preferably, however, a heterologous region should be no longer'than 10 000 nucleotides, particularly preferably no longer than S 000 nucleotides, in particular no longer than 2 000 nucleotides, and very particularly preferably no longer than 1 000 nucleotides. Relatively long sequence sections of this kind may be, for example, the hypervariable regions of a sequence encoding an antibody, domains of a protein, genes in a gene cluster or regions of a genome. The heterologous regions are preferably sequence regions in which the polynucleotide molecules differ from one another in individual bases. However, heterologous regions may also be based on a deletion, duplication, insertion, inversion or addition being present or having occurred in a polynucleotide molecule.
The double-stranded polynucleotide molecules provided according to step (a) of the method of the invention have, according to the invention, at least one homologous and at least one heterologous sequence region. Preferably, ~=owever, they have a multiplicity of homologous and heterologous sections. In principle, there is no upper limit for the number of homologous and heterologous sections.
The heterologous sections in said double-stranded polynucleotide molecules are in each case interrupted by homologous sections. In this connection, the homologous sections are preferentially at least 5, preferably at least 10, and particularly preferably at least 20, nucleotides in length. However, like the heterologous sections, the homologous sections.may be substantially longer, and in principle there is no upper limit of their length:
Preferentially, they should be no longer than 50 000 nucleotides, preferably no longer than 20 000 nucleotides, particularly preferably no longer than 10 OOO nucleotides, and very particularly preferably no longer than 1 000 nucleotides.
Double-stranded polynucleotide molecules can be provided according to step (a) of the method of the invention by methods known to the skilled worker. These include, for example, physical, chemical, biochemical and biological methods. These include both synthetic and preparative methods, such as, for example, chemical synthesis of oligonucleotides, synthesis of nucleic acids by polymerase chain reaction (PCR), preparation of plasmids, cosmids, phages, BACs (bacterial artificial chromosomes), YACs (yeast artificial chromosomes) or chromosomal DNA.
In a particularly preferred embodiment of the method of the invention, a population of double-stranded polynucleotides with homologous and heterologous sections is provided by using related polynucleotide sequences from the distribution of mutants of a quasispecies. The term "related" here relates to polynucleotides, among which there are both hornologous and heterologous sections.
Quasispecies refers to a dynamic population of molecule variants (mutants) related to one another, which is produced by error-prone replication. It was possible to show that, according to the quasispecies principle, the subject of selection is not ..
the wild type (center of mass of the quasispecies) but the entire distribution. tnlith altered selection conditions, such a distribution of mutants already contains advantageous variants . PF 53571 CA 02485218 2004-11-04 according to their fitness value, which therefore need not be produced first by subsequent, random mutations. In the case of successive shifting of the selection parameters, evolutive ' generation then resembles an implicitly directed drift of said quasispecies along ridges of the value landscape. WO 92/18645 describes the preparation of quasispecies and the application of this principle for evolutive biotechnology.
The generation of a quasispecies if based on error-prone replication of the molecular variants. V~hen using polynucleotides, replication is preferably carried out with the aid of replication enzymes, i.e. polymerases, which enable template-controlled synthesis of a polynucleotide molecule. The introduction of errors, i.e. variation in molecular information, can be achieved by the inherently error-prone copying process alone or else by specifically increasing polymerase inaccuracy (e.g. specifically imbalanced addition of monomers, addition of base analogs, error-prone PCR, polymerases with very high error rates), by post-synthesis chemical modification of polynucleotides, by complete synthesis of polynucleotides with at least partial use of monomer mixtures and/or nucleotide analogs, and by a combination of said methods. Preference is given to using distributions of mutants of a qaasispecies, the phenotypical properties of a desired molecular function of the individual mutants of said quasispecies having already been improved compared to the wild type. The term "phenotype of a polynucleotide molecule" refers to the sum of functions and properties of a polynucleotide molecule and of the transcription or translation product encoded by a polynucleotide.
In addition, it is possible to use sequences of different origin, inter alia polynucleotide sequences of a gene family from different species, polynucleotide sequences which have been replicated at a particularly high error rate in vivo (e.g. by viruses, by mutator bacteria, by bacteria under W irradiation) or in vitro (e. g. by means of Qi3-repiicase react~~.on, error-prone PCR), polynucleotide sequences into which, after synthesis, mutations have been introduced by means of chemical agents or which have been chemically synthesized in such a way that they have homologous and heterologous sections, or polynucleotide sequences which have been generated by a combination of abovementioned methods. In principle, the polynucleotides used in the method of the invention may be any polynucleotides, in particular DNA or RNA molecules.
The single strand break required in step (b) of the method of the invention can, in principle, be generated by any method which leads to cleavage of a phosphodiester bond between 2 nucleotides in a polynucleotide strand of the double-stranded polynucleotide molecule. Said methods may be physical or chemical methods (e. g.
ultrasound treatment, partial ester hydrolysis).
Enzymic methods are particularly suitable for step (b).
Examples of enzymes suitable for this are nucleases.
In a preferred embodiment of the method of the invention, single strand breaks are introduced by sequence-specific nicking enzymes.
Examples of said nicking enzymes are V.BchI from Bacillus _ chitinosporus, N.BstNBI from Bacillus stearothermophilus, N.BstSEI from Bacillus stearothermophilus, N.CviPII from Chlorella strain NC64A, N.CviQXI from Chlorella strain NC64A, 20 V.EcoDem from E.coli, V.HpaII from Haemophilus parainfluenzae, V.Neal from Nocardia aerocolonigenes and V.XorII from Xanthomonas oryzae.
In a further preferred embodiment it is possible to introduce 25 single strand breaks into said double-stranded polynucleotide molecules by non-sequence-specific nicking enzymes. In this connection, it is possible to use, for example, calf pancreas DNase I with Mg2+ as cofactor (Kunitz, J. Genetic Physiology 33 (1950), 349; Kunitz, J. Genetic Physiology 33 (1950), 363, and Melgac and Goldthwaite, J. Liolog. Chem. 243 (1968), 4409).
The reaction conditions in step (c) are chosen depending on the enzymes used.
In a preferred embodiment, step (c) is carried out under conditions which cause an increased error rate of de-novo synthesis.
Said error rate of de-novo synthesis may be chosen depending an the desired variants to be generated. Typical error rates are from 0.1 x 10-3 to 10 x 10-3, i.e. 0.01 to 1~ error (exchange of 1 to 10 bases in a DNA section of 10 000 bases).
It is particularly useful to carry out step (c) with an error .
rate of from 1 x 10-3 to 5 x 10-3, i.e. 0.1 to 0.5~ error, i.e. 1 to 5 bases are exchanged in a DNA section of 1 000 bases.
The error rate of DNA polymerise I is 9 x 10-6 (Kunkel et al.
(1984) J. Biol. Chem. 259:1539-1545). Consequently, when using DNA polymerise I, an increase in the error rate means an error rate of more than 9 x 10-6.
In principle, the error rate of de-novo synthesis can be increased, for example, by using mutated DNA polymerise or by choosing the proper reaction conditions in step (c).
In a preferred embodiment, the error rate of de-novo synthesis is increased by using polymerises with reduced or no proofreading activity.
In a preferred embodiment of the method of the invention, the error rate of de-novo synthesis is increased by different nucleotide concentrations as starting material. In this connection, the concentration of individual or several nucleotides can be varied relatively to the other nucleotides.
Preference is given to a substoichiometric amount of one nucleotide, in particular of dATP, compared to the other nucleotides. Examples of suitable concentrations are 200 ~.M each of dGTP, dCTP and dTTP and from 20 to 50 ~M ATP.
Preference is given to substoichiometric amounts of two nucleotides, in particular o' dATP and dGTP, compared to the other nucleotides. Examples of suitable concentrations are 200 ~,M
each of dCTP and dTTP and 40 ~M each of dATP and dGTP.
In a further embodiment of the method of the invention, the error rate of de-novo synthesis is increased by the addition of nucleotide analogs. Nucleotide analogs which may be mentioned are deoxyinosine triphosphate, ?-deazadeoxyguanosine triphosphate and deoxynucleoside a-thiotriphosphate. Particular preference is given to using deoxyinosine triphosphate.
In a further embodiment of the method of the invention the error rate of de-novo synthesis is increased by varying the salt concentration. An example suitable for this is an increase in the concentration of Mg2+ ions to concentrations above 1.5 mM. Also suitable is the addition of Mn2+ ions, for example in a concentration range from 0.2 to 1 mM, in particular 0.2 to 0.5 mM.
In a further embodiment of the method of the invention, the error rate of de-novo synthesis is increased by adding additives. A
suitable additive is any substance which increases the error rate; examples which may be mentioned are dimethyl sulfoxide, polyethylene glycol and glycerol. Particular preference is given to adding said additives at the following concentrations: DMSO at from 2 to 100, PEG at from 5 to 150, glycerol at from > 0 to 300, 5 preferably 5 to 20~.
In a further embodiment, the error rate of de-novo synthesis is increased by changing the reaction temperature, in particular by an increase in temperature.
All of the measures mentioned for increasing the error rate may also be carried out in combination with one another, for example excess of a nucleotide at increased Mn2+ ion concentration.
In a preferred embodiment, s~eps (b) and (c) are carried out simultaneously.
Preparation of single-stranded polynucleotide molecules, according to step (d) of the method of the invention, may be carried out using methods known to the skilled worker. These include, for example, physical, chemical, biochemical and biological methods. Examples which may be listed here are melting of polynucleotide double strands by means of heating to temperatures above the annealing temperature (Newton, in: PCR, Spektrum Akademischer Verlag (1994); Lazurkin, Biopolymers 9 (1970), 1253-1306), denaturing polynucleotide double strands by means of adding denaturing reagents (e. g. urea or detergents), addition of enzymes which convert double-stranded polynucleotides to single-stranded polynucleotides, for example by exonucleolytic degradation of double-stranded DNA to single-stranded DNA.
Preparation of partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), according to step (e) of the method of the invention, may be carried out using methods known to the skilled worker and is preferably achieved by hybridizing the homologous sections of the complementary single-stranded polynucleotide molecules.
Hybridization to give double-stranded polynucleotides is carried out using methods known to the skilled worker and may, in particular, be achieved, for example, by combining the single strands and setting reaction conditions, which promote annealing of complementary polynucleotides, such as, for example, by lowering the temperature and/or reducing the salt concentration.
Starting from the partially double-stranded polynucleotide molecules prepared in step (e), a template-directed nucleic acid synthesis is carried out in step (f) of the method of the invention.
The term "template-directed nucleic acid synthesis" here refers to the synthesis of a polynucleotide by extending an existing single strand on the basis of the information of a corresponding template strand.
The skilled worker is familiar with carrying out a template-directed polymerization of this kind, which is described, for example, in Sambrook (Molecular Cloning, Cold Spring Harbor Laboratory Press (1989)).
Any enzyme which has template-controlled polynucleotide polymerization activity and which is capable of synthesizing polynucleotide strands may be used for the polymerase reaction. A
multiplicity of polymerases from a large variety of organisms and 20 with different functions have already been isolated and described. There is a distinction with respect to the type of template and of synthesized polynucleotide between DNA-dependent DNA polymerases, RNA-dependent DNA polymerases (reverse transcriptases), DNA-dependent RNA polymerases and RNA-dependent 25 RNA polymerases (replicases). With respect to temperature stability, there is a distinction between non-thermostable (37°C) and thermostable polymerases (75 to 95°C). Furthermore, polymerases differ with respect to the presence of 5'-3'- and 3'-5'-exonucleolytic activity. The most important polymerases are DNA-dependent DNA polymerases.
In particular, it is possible to use DNA polymerases having a temperature optimum of around 37°C. These include, for example, the E. coli DNA polymerase I, T7 DNA polymerase of bacteriophage T7 and T4 DNA polymerase of bacteriophage T4, each of which is commercially sold by a multiplicity of manufacturers, for example USB, Rbche Molecular Biochemicals, Stratagene, NEB or Quantum Biotechnologies. E. coli DNA polymerase I (holoenzyme) has a 5'-3' polymerase activity, a 3'-5' proofreading exonuclease activity and a 5'-3' exonuclease activity. The enzyme is used for in vitro DNA labeling by means of the nick translation method (Rigby et al. (J. Mol. Biol. 113 (1977)), 237-251). In contrast to the holoenzyme, the Klenow fragment of E. coli DNA polymerase I, like T7 DNA polymerase and T4 DNA polymerase, has no 5' exonuclease activity. Therefore, these enzymes are used for "fill-in reactions" or for the synthesis of long strands (Young et al. (Biochemistry 31 (1992), $675-8690), Lehman (Methods Enzymol. 29 (1974), 46-53)). Finally, the 3'-5'-exo(-) variant of the Klenow fragment of E. coli DNA polymerise I also lacks the 3' exonuclease activity. This enzyme is often used for DNA
sequencing according to Singer (Singer (Proc. Natl. Acid. Sci.
USA 74 (1977), 5463-5467)). In addition to these enzymes, there exists a multiplicity of further 37°C DNA polymerises with different properties, which may be used in the method of the invention.
The most common, thermostable DNA polymerise which has a temperature optimum of 75°C and is sufficiently stable at 95°C
is Taq DNA polymerise from Therrlus aquaticus, which is commercially available. Taq DNA polymerise is a highly processive 5'-3' DNA
polymerise which has no 3'-5' exonuclease activity. It is often used for standard PCRs, for sequencing reactions and for mutagenic PCRs (Cadwell and 3oyce (PCR Methods Appl. 3 (1994), 136-140, Agrogoni and Kaminski (Methods Mol. Biol. 23 (1993), 109-114)). Tth DNA polymerise from Thermus thermophilus HB8 and Tfl DNA polymerise from Thermus flavus have similar properties.
Tth DNA polymerise, however, additionally has an intrinsic reverse-transcriptase (RT) activity in the presence of manganese ions (Cusi et a1. (Biotechniques 17 (1994), 1034-1036)). Again, quite a number of the thermostable DNA polymerises with 3' but no 5' exonuclease activity are sold commercially: Pwo DNA polymerise from Pyrococcus woesei, Tli, Vent and DeepVent DNA polymerises from Thermococcus litoralix, Pfx and Pfu DNA polymerises from Pyrococcus furiosus, Tub DNA polymerise from Thermus ubiquitous, Tma and UlTma DNA polymerise from Thermotoga maritima (Newton and Graham, in: PCR, Spektrum Akad. Verlag Heidelberg (1994), 1)).
Polymerises lacking 3' proofreading exonuclease activity are used in order to amplify PCR products as with as few errors as possible. Finally, DNA polymerises lacking both 5' and 3' exonucleolytic activities are available in the form of the Stoffel fragment of Taq DNA polymerise, the Vent-(exo-) DNA
polymerise and Tsp DNA polymerise. The most common enzymes among the RNA-dependant DNA polymerises (reverse transcriptases) include AMV reverse transcriptase fro_n avian myeloblastosis virus, M-MuLV reverse transcriptase from Moloney murine leukemia virus and HIV reverse transcriptase from human immunodeficiency virus, which are also sold by various suppliers such as, for example, NEB, Life Technologies, Quantum Biotechnologies. Like HIV reverse transcriptase, ~~2V reverse transcriptase has an associated RNase H activity which is markedly reduced in M-MuLV
reverse transcriptase. Both M-MuLV and AMV reverse transcriptase lack 3'-5' exonuclease activity.
a PF 53571 CA 02485218 2004-11-04 The most common enzymes among the DNA-dependent RNA polymerises include E. coli RNA polymerise, SP6 RNA polymerise from Salmonella thyphimurium LT2 infected with bacteriophase SP6, T3 RNA polymerise from bacteriophage T3 and T7 RNA polymerise from bacteriophage T7.
In a preferred embodiment of the method of the invention the template strands in step (f) of the method are DNA molecules and a DNA-dependent DNA polymerise is used for template-directed single strand synthesis.
In a particularly preferred embodiment, a non-thermostable DNA
polymerise, particularly preferably one with 5' and 3' exonucleolytic activity, such as, for example, E. coli polymerise I, is used here.
As an alternative, it is also possible to use a non-thermostable DNA polymerise which has a 3'-+5' exonucleolytic activity but no 5'-+3' exonucleolytic activity, such as, for example, the Klenow fragment of E. coli DNA polymerise I, T7 DNA polymerise from bacteriophage T7 or T4 DNA polymerise from bacteriophage T4.
It is furthermore also possible to use a non-thermostable DNA
polymerise which has neither 5'-+3' nor 3'--~5' exonucleolytic activity, such as, for example, the 3'-5'-exo(-) variant of the Klenow fragment of E. coli DNA polymerise I.
Another, particularly preferred embodiment uses a thermostable polymerise (e. g. Taq polymerise, Pwo polymerise) which may again have 5' and 3' exonucleolytic activities or else 5' exonucleolytic activity but no 3' exonucleolytic activity, such as, for example, Taq DNA polymerise from Thermus aquaticus, Tth DNA polymerise from Thermus thermophilis HB8 or Tfl DNA
polymerise from Thermus flavus.
Alternatively, the thermostable DNA polymerise may have 3'-+5' but no 5'--t3' exonucleolytic activity, such as, for example, the Pwo DNA polymerise from Pyrococcus woesei, the VentR DNA polymerise, the DeepVentR DNA polymerise or the Tli DNA polymerise from Thermococcus litoralis, the Pfu DNA polymerise or the Pfx DNA
polymerise from Pyrococcus furiosus or Tma DNA polymerise or UlTma DNA polymerise from Thermotoga maritima.
It is further possible to use a thermostable polymerise which has neither 3'-5' nor 5'-3' exonucleolytic activity, such as, for example, the Stoffel fragment of Taq DNA polymerise from Thermus aquaticus, the Tsp DNA polymerise or the exo(-) variant of VentR
DNA polymerase or DeepVentR DNA polymerase from Thermococcus litoralis.
If a thermostable polymerase is used, the polymerase reaction preferably immediately follows step (e), without intermediate purification or further sample treatment.
In another preferred embodiment of the method of the invention, the template strands on which template-directed single strand synthesis is carried out in step (f) of the method of the invention are RNA molecules, In this case, the template-directed single strand synthesis uses an RNA-dependent DNA polymerase, preferably AMV reverse transcriptase from avian myeloblastosis virus, HIV reverse transcriptase from human immunodeficiency 25 virus, or M-MuLV reverse transcriptase from Moloney murine leukemia virus. Preference is further given to using a thermostable reverse transcriptase, very particularly Tth DNA
polymerase from Thermus thermophilus, which has intrinsic reverse transcriptase activity.
Example 1 Unless stated otherwise, the experiments were carried out according to Current Protocols in Molecular Biology.
I. Providing the starting material 4 lipase variants were used as starting material:
LipA H86W encoded by pBP2035, LipA S87T encoded by pBP2008, LipA F142W encoded by pBP2006, LipA L167A encoded by pBP2007.
1. Plasmid preparation of the following plasmids:
Plasmid Vector Vector Insert Insert size Enzyme size variant pBP2006 pBSIIKS 2961 56-20 1142 by F142W
by pBP2007 pBSIIKS 2961 98-10 1142 by L167A
by pBP2008 pBSIIKS 2961 124-9 1142 by S87T
by pBP2035 pBSIIKS 2961 198-1-3 1142 by H86W
by 2. Cleaving the plasmids with restriction endonucleases HindIII
and SacI
3. Isolating the inserts b~~ gel extraction using the GFX Kit (Pharmacia) 4. Resuspending the DNA fragments in H20 5. Adjusting the DNA concentrations to 250 ng/~l II. Generation of single strand breaks and de-novo synthesis 1. 4 separate reaction mixtures for r_ick translation of inserts 56-20, 98-10, 124-9, 198-1-3, using the nick translation kit 5 (Roche, Cat. No. 976776) Component Volume DNA solution with insert -250 ng/~,l 16 ~,~.1 dATP 0.4 mM 2,5 ~l 10 dCTP 0.4 mM 2,5 ~l dGTP 0 . 4 mM 2 , 5 ~,1 dTTP 0 . 4 mM 2 , 5 ~,l 10 x buffer 5 ~tl H20 14 ~l Enzyme mix 1 ) 5 ~.1 15 Total 50 ~,1 1) Enzyme mix:
DNA polymerase I and DNAseI in 50 $ glycerol (v!v) 2. Incubating the mixtures at 15~C, 90 min 3. Stopping the reaction by adding 5 ~1 of 0.5 M EDTA, pH 8.8 4. Precipitating, washing, drying and resuspending the mixtures in 20 ~l of H20 III.PCR without primers Reaction mixture for PCR using the GC rich PCR system (Roche, Cat. No. 2140306) Component Volume Mixture of 6 ~tl of each mixture from 24 ~1 2.4 dNTP 10 mM 1 ~l GC rich resolution solution 5 M 10 ~,1 GC rich reaction buffer 10 ~tl PCR grade H20 4 ~1 GC rich enzyme mix ) 1 ~l Total 50 ~,l Thermostatic Taq-DNA polymerase and Tgo DNA polymerase x6 PCR conditions:
Temperature Time Cycles 95C 5 min 55C 60 s 45 72C 60 s 95C 30 s 72C 10 min 4C x min IV. PCR with primers Reaction mixture for PCR using the GC rich PCR system (Roche, Cat. No. 2140306):
Component Volume PCR product from step 3 5 ~.l dNTP 10 mM 1 ~.1 Primer MAT16 * 6 , 2 5 ).~M 2 ~1 Primer MAT19* 6, 25 ~,M 2 ~,1 GC rich resolution solution 10 ~1 GC rich reaction buffer 10 ~l PCR grade H20 19 ~1 GC rich enzyme mix 1 ~1 Total ~ ( 5 0 ~,1 ~
* Primer MAT16 = 5'-GATCGACGTAAGCTTTAACGATGGAGAT-3' * Primer MAT19 = 5'-CATCGGGCGAGCTCCCAGCCCGCCGCG-3' PCR conditions:
Temperature Time Cycles 95C 5 min 52C 30 s 25 72C 60 s g5C 30 s 72C 10 min 4C x min ~0 V. Cloning and analyzing the fragments 1. 20 ~l of the PCR product from step 4 are cut with HindIII and Sa cI
2. Precipitating, washing, drying and resuspending the mixture in 20 ~.1 of H20 3. Purifying the cut fragments using the GFX kit (Pharmacia) 4. Ligating the cut fragments with vector pBSIIKS (Stratagene), which has been cut beforehand with HindIII and Sacl 5. Transforming the ligation mixtures into Escherichia coli XL1-Blue 6. Sequence analysis of 29 clones with inserts SEQUENCE LISTING
<110> BASF AG
<120> Method for generating polynucleotide molecules <130> PF5357I/MSt <140> PCT/EP03/05308 <141> 2003-05-21 <160> 4 <170> PatentIn version 3.1 <210> 1 <211> 1142 <212> DNA
<213> pBluescriptIIKS+
<220>
<221> misc_feature <223> Lipases in pBluescriptIIKS+
<400> 1 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggctggagccagggcggcetgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960 53 ~ 7 1 CA 02485218 2004-11-04 ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc 1I42 <210> 2 <211> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature <222> (1)..-(1142) <223>
<220>
<221> misc_feature <222> (1). (1142) <223>
<400> 2 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggc.cgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacacccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 P,.k' 53571 CA 02485218 2004-11-04 tgatcaatcg cgcctcgggg cagaacgacg ggctcgtctc gcgctgcagc tcgctgttcg 960 ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc I142 <210> 3 <211> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc_feature <222> (1)..(1142) <223>
<220>
<221> misc_feature <222> (1)..(1142) <223>
<220>
<221> misc_feature <222> (1). (1142) <223>
<220>
<221> misc_feature <222> (1)..(1142) <223>
<400> 3 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 BF 53571 _ CA 02485218 2004-11-04 atcgcggctc cgagttcgcc gacttcgtgc aggacgtgct gaagaccgat ccgaccgggc 540 tctcgtcgac ggtgatcgcc gccttcgtca acgtgttcgg cacgctcgtc agcagctcgc 600 acaacaccgaccaggacgcgctcgcggcgctgcgcacggccaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960 ggcaggtgatcagcaccagctaccactggaaccatctcgacgagatcaaccagctgctcg 1020 gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080 tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140 tc 1142 <210> 4 <2-I1> 1142 <212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature <222> (1)..(I142) <223>
<400> 4 aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60 cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120 cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180 tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240 agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300 gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360 cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420 gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480 atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540 tctcgtcgacggtgatcgccgcctgggtcaacgtgttcggcacgctcgtcagcagctcgc 600 P~' 53571 . CA 02485218 2004-11-04 acaacaccgaccaggacgcgctcgcggcgc tgcgcacgctcaccaccgcgcagaccgcca 660 cctacaaccggaacttcccgagcgcgggcc tgggcgcgcccggttcgtgccagacgggcg 720 ccgcgaccgaaaccgtcggcggcagccagc acctgctctattcgtggggcggcaccgcga 780 tccagcccacctccaccgtgctcggcgtga ccggcgcgaccgacaccagcaccggcacgc 840 tcgacgtcgcgaacgtgaccgacccgtcca cgctcgcgctgctcgccaccggcgcggtga 900 tgatcaatcgcgcctcggggcagaacgacg ggctcgtctcgcgctgcagctcgctgttcg 960 ggcaggtgatcagcaccagctaccactgga accatctcgacgagatcaaccagctgctcg 1020 gcgtgcgcggcgccaacgcggaagatccgg tcgcggtgatccgcacgcacgtgaaccggc 1080 tcaagctgcagggcgtgtgatggcgcaggc cgatcgtccggcgcgcggcgggctgggagc 1140 tc 1142
Claims (11)
1. A method for generating polynucleotide molecules with altered properties, which comprises going through at least one cycle comprising the following steps:
(a) providing a double-stranded polynucleotide molecule or a population of double-stranded polynucleotide molecules, with the individual polynucleotides of said population having at least one homologous sequence section and at least one heterologous sequence section, (b) generating single strand breaks in said double-stranded polynucleotide molecules (c) 5'.fwdarw.3' nucleolytic degradation starting from said single strand breaks, with simultaneous 5'.fwdarw.3' de-novo synthesis and shifting of said single strand breaks in the direction of the 3' end, (d) preparing single-stranded polynucleotide molecules (e) preparing partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), (f) template-directed nucleic acid synthesis starting from the partially double-stranded polynucleotide molecules prepared in step (e), it being possible to carry out the steps (b) and (c) successively or simultaneously.
(a) providing a double-stranded polynucleotide molecule or a population of double-stranded polynucleotide molecules, with the individual polynucleotides of said population having at least one homologous sequence section and at least one heterologous sequence section, (b) generating single strand breaks in said double-stranded polynucleotide molecules (c) 5'.fwdarw.3' nucleolytic degradation starting from said single strand breaks, with simultaneous 5'.fwdarw.3' de-novo synthesis and shifting of said single strand breaks in the direction of the 3' end, (d) preparing single-stranded polynucleotide molecules (e) preparing partially double-stranded polynucleotide molecules of the single-stranded polynucleotide molecules provided by step (d), (f) template-directed nucleic acid synthesis starting from the partially double-stranded polynucleotide molecules prepared in step (e), it being possible to carry out the steps (b) and (c) successively or simultaneously.
2. A method as claimed in claim 1, wherein more than one cycle comprising the steps (a) to (f) is gone through.
3. A method as claimed in claim 2, wherein a selection step is carried out after one, several or all cycles, said selection step relating either to the genotype or the phenotype or to both the genotype and the phenotype of the polynucleotide.
4. A method as claimed in any of claims 1 to 3, wherein sequence-specific nicking enzymes introduce said single strand breaks in step (b).
5. A method as claimed in any of claims 1 to 3, wherein non-sequence-specific nicking enzymes introduce said single strand breaks in step (b).
6. A method as claimed in any of claims 1 to 5, wherein DNA
polymerase I is used in step (c).
polymerase I is used in step (c).
7. A method as claimed in any of claims 1 to 6, wherein the error rate of said de-novo synthesis is increased in step (c) by choosing suitable reaction conditions.
8. A method as claimed in any of claims 1 to 6, wherein the error rate of said de-novo synthesis is increased via an excess of one or more nucleoside triphosphates.
9. A method as claimed in any of claims 1 to 6, wherein the error rate of said de-novo synthesis is increased by using one or more nucleotide analogs.
10. A method as claimed in any of claims 1 to 6, wherein the error rate of said de-novo synthesis is increased by varying the salt concentration.
11. A method as claimed in any of claims 1 to 6, wherein the error rate of said de-novo synthesis is increased via polymerases having a reduced or no proof reading activity.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10223057A DE10223057A1 (en) | 2002-05-24 | 2002-05-24 | Process for the production of polynucleotide molecules |
| DE10223057.9 | 2002-05-24 | ||
| PCT/EP2003/005308 WO2003100058A2 (en) | 2002-05-24 | 2003-05-21 | Method for creating polynucleotide molecules |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2485218A1 true CA2485218A1 (en) | 2003-12-04 |
Family
ID=29432268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002485218A Abandoned CA2485218A1 (en) | 2002-05-24 | 2003-05-21 | Method for creating polynucleotide molecules |
Country Status (9)
| Country | Link |
|---|---|
| EP (1) | EP1511842A2 (en) |
| JP (1) | JP2005529596A (en) |
| KR (1) | KR20050004207A (en) |
| CN (1) | CN1656221A (en) |
| AU (1) | AU2003240683A1 (en) |
| CA (1) | CA2485218A1 (en) |
| DE (1) | DE10223057A1 (en) |
| MX (1) | MXPA04011554A (en) |
| WO (1) | WO2003100058A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10927394B2 (en) | 2017-01-19 | 2021-02-23 | Oxford Nanopore Technologies Limited | Methods and reagents for synthesising polynucleotide molecules |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2574197B (en) * | 2018-05-23 | 2022-01-05 | Oxford Nanopore Tech Ltd | Double stranded polynucleotide synthesis method and system. |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2422749A1 (en) * | 2000-09-21 | 2002-03-28 | Merck & Co., Inc. | Method for generating recombinant polynucleotides |
| WO2002079468A2 (en) * | 2001-02-02 | 2002-10-10 | Large Scale Biology Corporation | A method of increasing complementarity in a heteroduplex polynucleotide |
-
2002
- 2002-05-24 DE DE10223057A patent/DE10223057A1/en not_active Withdrawn
-
2003
- 2003-05-21 CN CNA038119277A patent/CN1656221A/en active Pending
- 2003-05-21 JP JP2004508297A patent/JP2005529596A/en not_active Withdrawn
- 2003-05-21 EP EP03730082A patent/EP1511842A2/en not_active Withdrawn
- 2003-05-21 AU AU2003240683A patent/AU2003240683A1/en not_active Abandoned
- 2003-05-21 MX MXPA04011554A patent/MXPA04011554A/en not_active Application Discontinuation
- 2003-05-21 CA CA002485218A patent/CA2485218A1/en not_active Abandoned
- 2003-05-21 KR KR10-2004-7018944A patent/KR20050004207A/en not_active Application Discontinuation
- 2003-05-21 WO PCT/EP2003/005308 patent/WO2003100058A2/en not_active Application Discontinuation
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10927394B2 (en) | 2017-01-19 | 2021-02-23 | Oxford Nanopore Technologies Limited | Methods and reagents for synthesising polynucleotide molecules |
| US11884950B2 (en) | 2017-01-19 | 2024-01-30 | Oxford Nanopore Technologies Plc | Methods and reagents for synthesising polynucleotide molecules |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20050004207A (en) | 2005-01-12 |
| WO2003100058A2 (en) | 2003-12-04 |
| WO2003100058A3 (en) | 2004-09-02 |
| MXPA04011554A (en) | 2005-03-07 |
| JP2005529596A (en) | 2005-10-06 |
| EP1511842A2 (en) | 2005-03-09 |
| CN1656221A (en) | 2005-08-17 |
| DE10223057A1 (en) | 2003-12-11 |
| AU2003240683A1 (en) | 2003-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU783823B2 (en) | Method for the production of biopolymers with modified properties | |
| EP2396430B1 (en) | Template-independent ligation of single-stranded dna | |
| CN104114702B (en) | Template switch is used for the purposes of DNA synthesis | |
| Nikoomanzar et al. | Engineering polymerases for applications in synthetic biology | |
| EP1817413B1 (en) | Oligonucleotide ladder assembly and system for generating molecular diversity | |
| EP2050819A1 (en) | Method for amplification of nucleotide sequence | |
| AU2002321251B2 (en) | Method for the production of nucleic acids consisting of stochastically combined parts of source nucleic acids | |
| EP1929012A2 (en) | Method for in vitro recombination | |
| Wang et al. | Mutant library construction in directed molecular evolution: casting a wider net | |
| AU2002321251A1 (en) | Method for the production of nucleic acids consisting of stochastically combined parts of source nucleic acids | |
| JPWO2002036822A1 (en) | Nucleic acid base sequencing method | |
| US6641998B2 (en) | Methods and kits to enrich for desired nucleic acid sequences | |
| CA2485218A1 (en) | Method for creating polynucleotide molecules | |
| Shiba et al. | Guide oligonucleotide-dependent DNA linkage that facilitates controllable polymerization of microgene blocks | |
| Adamthwaite | Novel Approach to Synthesizing Sticky Ended DNA | |
| Tian-Wen et al. | Mutant library construction in directed molecular evolution | |
| CA2486900A1 (en) | A method for obtaining circular mutated and/or chimaeric polynucleotides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued |