WO2001023410A2 - Drug target isogenes: polymorphisms in the interleukin 13 gene - Google Patents

Drug target isogenes: polymorphisms in the interleukin 13 gene Download PDF

Info

Publication number
WO2001023410A2
WO2001023410A2 PCT/US2000/026556 US0026556W WO0123410A2 WO 2001023410 A2 WO2001023410 A2 WO 2001023410A2 US 0026556 W US0026556 W US 0026556W WO 0123410 A2 WO0123410 A2 WO 0123410A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
ill
gene
haplotype
polymoφhic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/026556
Other languages
English (en)
French (fr)
Other versions
WO2001023410A3 (en
Inventor
Anne Chew
R. Rex Denton
Krishnan Nandabalan
Joel Claiborne Stephens
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cogenics Inc
Original Assignee
Genaissance Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genaissance Pharmaceuticals Inc filed Critical Genaissance Pharmaceuticals Inc
Publication of WO2001023410A2 publication Critical patent/WO2001023410A2/en
Anticipated expiration legal-status Critical
Publication of WO2001023410A3 publication Critical patent/WO2001023410A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • a first nucleotide sequence which is a polymorphic variant of a reference sequence for interleukin 13 (IL13) gene or a fragment thereof, wherein the reference sequence comprises SEQ ID NO:l, and the polymorphic variant comprises at least one polymorphism selected from the group consisting of thymine at PS1, guanine at PS2, guanine at PS3, thymine at PS4, cytosine at PS5, adenine at PS6, thymine at PS7, adenine at PS8, thymine at PS9, thymine at PS10, adenine at PS11, thymine at PS12, thymine at PS13 and adenine at PS14; and
  • the isolated polynucleotide of claim 1 which is a DNA molecule and comprises both the first and second nucleotide sequences and further comprises expression regulatory elements operably linked to the first nucleotide sequence.
  • the recombinant organism of claim 4 which is a nonhuman transgenic animal.
  • the first nucleotide sequence is a polymorphic variant of a fragment of the IL13 gene, the fragment comprising one or more polymorphisms selected from the group consisting of thymine at PS1, guanine at PS2, guanine at PS3, thymine at PS4, cytosine at PS5, adenine at PS6, thymine at PS7, adenine at PS8, thymine at PS9, thymine at PS10, adenine at PS11, thymine at PS12, thymine at PS13 and adenine at PS14.
  • An isolated polynucleotide comprising a nucleotide sequence which is a polymorphic variant of a reference sequence for the IL13 cDNA or a fragment thereof, wherein the reference sequence comprises SEQ ID NO:2 and the polymorphic variant comprises at least one polymorphism selected from the group consisting of adenine at a position corresponding to nucleotide 111 and adenine at a position corresponding to nucleotide 386.
  • IL13 interleukin 13
  • the recombinant organism of claim 8 which is a nonhuman transgenic animal.
  • An isolated polypeptide comprising an amino acid sequence which is a polymorphic variant of a reference sequence for the IL13 protein or a fragment thereof, wherein the reference sequence comprises SEQ ID NO: 3 and the polymorphic variant comprises glutamine at a position corresponding to amino acid position 129.
  • a method for screening for drugs targeting the isolated polypeptide of claim 10 which comprises
  • a composition comprising at least one genotyping oligonucleotide for detecting a polymo ⁇ hism in the interleukin 13 (IL13) gene at a polymo ⁇ hic site selected from PS1-PS14.
  • IL13 interleukin 13
  • composition of claim 13, wherein the genotyping oligonucleotide is an allele-specific oligonucleotide that specifically hybridizes to an allele of the IL13 gene at a region containing the polymo ⁇ hic site.
  • composition of claim 14, wherein the allele-specific oligonucleotide comprises a nucleotide sequence selected from the group consisting of of SEQ ID NOS:4-31, the complements of SEQ ID NOS: 4-31, and SEQ ID NOS:32-87.
  • composition of claim 13, wherein the genotyping oligonucleotide is a primer-extension oligonucleotide.
  • a method for genotyping the interleukin 13 (IL13) gene of an individual comprising determining for the two copies of the IL13 gene present in the individual the identity of the nucleotide pair at one or more polymo ⁇ hic sites (PS) selected from PS 1 -PS 14.
  • PS polymo ⁇ hic sites
  • a method for haplotyping the interleukin 13 (IL13) gene of an individual which comprises determining, for one copy of the IL13 gene present in the individual, the identity of the nucleotide at one or more polymo ⁇ hic sites (PS) selected from PS 1 -PS 14.
  • PS polymo ⁇ hic sites
  • a method for predicting a haplotype pair for the interleukin 13 (IL13) gene of an individual comprising:
  • a method for identifying an association between a trait and at least one genotype or haplotype of the interleukin 13 gene which comprises comparing the frequency of the genotype or haplotype in a population exhibiting the trait with the frequency of the genotype or haplotype in a reference population, wherein the genotype or haplotype comprises a nucleotide pair or nucleotide located at one or more polymo ⁇ hic sites selected from PS 1 -PS 14, wherein a higher frequency of the genotype or haplotype in the trait population than in the reference population indicates the trait is associated with the genotype or haplotype.
  • the haplotype is selected from haplotype numbers 1-21 shown in Table 4.
  • a computer system for storing and analyzing polymo ⁇ hism data for the interleukin 13 gene comprising:
  • polymo ⁇ hism data comprises the genotypes and haplotype pairs shown in Table 3 and the haplotypes shown in Table 4.
  • This invention relates to variation in genes that encode pharmaceutically important proteins.
  • this invention provides genetic variants of the human Interleukin 13 (IL13) gene and methods for identifying which variant(s) of this gene is/are possessed by an individual.
  • IL13 human Interleukin 13
  • a target protein currently used to screen drugs typically is expressed by a gene cloned from an individual who was arbitrarily selected.
  • the nucleotide sequence of a particular gene may vary tremendously among individuals.
  • Subtle alteration(s) in the primary nucleotide sequence of a gene encoding a target protein may be manifested as significant variation in expression of or in the structure and/or function of the protein. Such alterations may explain the relatively high degree of uncertainty inherent in treatment of individuals with drugs whose design is based upon a single representative example of the target.
  • haplotype The organization of single nucleotide variations (polymo ⁇ hisms) in the primary sequence of a gene into one of the limited number of combinations that exist as units of inheritance is termed a haplotype. Each haplotype therefore contains significantly more information than individual
  • Haplotypes provide an accurate measurement of the genomic variation in the two chromosomes of an individual.
  • haplotype will provide a superior genetic marker for the phenotype (Clark AG et al. 1998 supra; Ulbrecht M et al. 2000, supra; Ruano G & Stephens JC Gen EngNews 19 (21), December 1999).
  • IL13 Interleukin 13
  • IL13 is a pro-inflammatory cytokine expressed by activated human T lymphocytes (Minty et al., Nature 362:248-250, 1993; McKenzie et al., Proc. Natl. Acad. Sci. USA 90:3735-3739, 1993).
  • IL-13 shares some biological activities with IL4 and these two T-cell cytokines may also share a common signaling pathway through the IL-4 receptor (Punnonen et al., Proc. Natl. Acad. Sci. 90:3730-3734, 1993).
  • IL-13 was found to be necessary and sufficient for the expression of allergic asthma in mice (Wills-Ka ⁇ et al., Science 282:2258-2261, 1998; Grunig et al., Science 282:2261-2263, 1998) and targeted pulmonary expression of IL-13 in transgenic mice produced responses similar to those observed in asthma (Zhu et al., J. Clin. Invest. 103:779-788, 1999).
  • IL-13 expression is elevated in the airways of both allergic and nonallergic asthma patients (Walker et al., Am. Rev. Respir. Dis. 146:109, 1992; Humbert et al, J.
  • IL13 has also been implicated in the pathogenesis of diseases characterized by fibrosis.
  • IL13 stimulates collagen production in both NF and KF cells by the expression of genes for procollagen 1 alpha 1.
  • NF normal
  • KF keloid
  • MMP-3 matrix metalloproteinase-3
  • TIMP-1 tissue inhibitor of metalloproteinase
  • Kanai et al. (Br. J. Cancer 2000 May;82(10):1717-23) studied the role of IL13 in colon cancer and found that IL13 inhibited colon cancer cell-cell adhesion by down-regulating the expression of E-cadherin and carcinoembryonic antigen (CEA) molecules.
  • CEA carcinoembryonic antigen
  • mutated IL13-based cytotoxins directed specifically towards glioma-associated sites, are known to be the most active anti- glioma agents (Debinski W and Gibo DM Mol Med 2000 May;6(5):440-9).
  • a mutagenized IL13 known as hIL13.E13K (glutamic acid at position 13 changed to lysine), was fused to Pseudomonas exotoxin A. This mutagenized IL13 was less active and less toxic on normal cells than gliomas and therefore served as an antitumor agent (Debinski et al., Nat. Biotechnol 1998 may;16(5):449-53).
  • the Interleukin 13 gene is located on chromosome 5q31 and contains 4 exons that encode a 131 amino acid protein.
  • Reference sequences for the IL13 gene (SEQ ID NO: 1), coding sequence, and protein are shown in Figures 1, 2 and 3, respectively.
  • polymo ⁇ hic sites correspond to the following nucleotide positions in Figure 1 : 1100 (PS1), 1408 (PS2), 1477 (PS3), 1842 (PS4), 2080 (PS5), 2233 (PS6), 2385 (PS7), 3248 (PS8), 3280 (PS9), 3807 (PS10), 4014 (PS11), 4033 (PS12), 4044 (PS13) and 4165 (PS14).
  • PS1 polymo ⁇ hic sites
  • 3 polymo ⁇ hisms at these sites are cytosine or thymine at PS1, adenine or guanine at PS2, adenine or guanine at PS3, cytosine or thymine at PS4, thymine or cytosine at PS5, cytosine or adenine at PS6, cytosine or thymine at PS7, guanine or adenine at PS8, cytosine or thymine at PS9, cytosine or thymine at PS10, guanine or adenine at PS11, cytosine or thymine at PS12, cytosine or thymine at PS13 and guanine or adenine at PS14.
  • the inventors have determined the identity of the alternative nucleotides present at these sites in a human reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: African descent, Asian, Caucasian and Hispanic/Latino. It is believed that IL13-encoding polynucleotides containing one or more of the novel polymo ⁇ hic sites reported herein will be useful in studying the expression and biological function of IL 13, as well as in developing drugs targeting this protein. In addition, information on the combinations of polymo ⁇ hisms in the IL13 gene may have diagnostic and forensic applications.
  • the invention provides an isolated polynucleotide comprising a nucleotide sequence which is a polymo ⁇ hic variant of a reference sequence for the IL13 gene or a fragment thereof.
  • the reference sequence comprises SEQ ID NO: 1 and the polymo ⁇ hic variant comprises at least one polymo ⁇ hism selected from the group consisting of thymine at PS1, guanine at PS2, guanine at PS3, thymine at PS4, cytosine at PS5, adenine at PS6, thymine at PS7, adenine at PS8, thymine at PS9, thymine at PS10, adenine at PS11, thymine at PS12, thymine at PS13 and adenine at PS 14.
  • a particularly preferred polymo ⁇ hic variant is a naturally-occurring isoform (also referred to herein as an "isogene") of the IL13 gene.
  • An IL13 isogene of the invention comprises cytosine or thymine at PS1, adenine or guanine at PS2, adenine or guanine at PS3, cytosine or thymine at PS4, thymine or cytosine at PS5, cytosine or adenine at PS6, cytosine or thymine at PS7, guanine or adenine at PS8, cytosine or thymine at PS9, cytosine or thymine at PS 10, guanine or adenine at PS11, cytosine or thymine at PS12, cytosine or thymine at PS13 and guanine or adenine at PS14.
  • the invention also provides a collection of IL13 isogenes, referred to herein as an IL13 genome anthology.
  • An IL13 isogene may be defined by the combination and order of these polymo ⁇ hisms in the isogene, which is referred to herein as an IL 13 haplotype.
  • the invention also provides data on the number of different IL13 haplotypes found in the above four population groups. This haplotype data is useful in methods for deriving an IL13 haplotype from an individual's genotype for the IL13 gene and for determining an association between an IL13 haplotype and a particular trait.
  • the invention provides a polynucleotide comprising a polymo ⁇ hic variant of a reference sequence for an IL13 cDNA or a fragment thereof.
  • the reference sequence comprises SEQ ID NO:2 (Fig. 2) and the polymo ⁇ hic cDNA comprises at least one polymo ⁇ hism selected from the group consisting of adenine at a position corresponding to nucleotide 111 and adenine at a position corresponding to nucleotide 386.
  • Polynucleotides complementary to these IL13 genomic and cDNA variants are also provided by the invention.
  • the invention provides a recombinant expression vector comprising one of the polymo ⁇ hic genomic variants operably linked to expression regulatory elements as well as a recombinant host cell transformed or transfected with the expression vector.
  • the recombinant vector and host cell may be used to express ILl 3 for protein structure analysis and drug binding studies.
  • the invention provides a polypeptide comprising a polymo ⁇ hic variant of a reference amino acid sequence for the ILl 3 protein.
  • the reference amino acid sequence comprises SEQ ID NO:3 (Fig. 3) and the polymo ⁇ hic variant comprises glutamine at a position corresponding to amino acid position 129.
  • a polymo ⁇ hic variant of ILl 3 is useful in studying the effect of the variation on the biological activity of ILl 3 as well as studying the binding affinity of candidate drugs targeting ILl 3 for the treatment of cancers, inflammatory and immune disorders.
  • the present invention also provides antibodies that recognize and bind to the above polymo ⁇ hic ILl 3 protein variant. Such antibodies can be utilized in a variety of diagnostic and prognostic formats and therapeutic methods.
  • the invention provides methods, compositions, and kits for haplotyping and/or genotyping the ILl 3 gene in an individual.
  • the methods involve identifying the nucleotide or nucleotide pair present at one or more polymo ⁇ hic sites selected from PS 1 -PS 14 in one or both copies of the ILl 3 gene from the individual.
  • the compositions contain oligonucleotide probes and primers designed to specifically hybridize to one or more target regions containing, or that are adjacent to, a polymo ⁇ hic site.
  • the methods and compositions for establishing the genotype or haplotype of an individual at the novel polymo ⁇ hic sites described herein are useful for studying the effect of the polymo ⁇ hisms in the etiology of diseases affected by the expression and function of the ILl 3 protein, studying the efficacy of drugs targeting ILl 3, predicting individual susceptibility to diseases affected by the expression and function of the ILl 3 protein and predicting individual responsiveness to drugs targeting ILl 3.
  • the invention provides a method for identifying an association between a genotype or haplotype and a trait.
  • the trait is susceptibility to a disease, severity of a disease, the staging of a disease or response to a drug.
  • the present invention also provides transgenic animals comprising one of the ILl 3 genomic polymo ⁇ hic variants described herein and methods for producing such animals.
  • the transgenic animals are useful for studying expression of the ILl 3 isogenes in vivo, for in vivo screening and testing of drugs targeted against ILl 3 protein, and for testing the efficacy of therapeutic agents and compounds for cancers, inflammatory and immune disorders in a biological system.
  • the present invention also provides a computer system for storing and displaying polymo ⁇ hism data determined for the ILl 3 gene.
  • the computer system comprises a computer processing unit; a display; and a database containing the polymo ⁇ hism data.
  • the polymo ⁇ hism data comprises a computer processing unit; a display; and a database containing the polymo ⁇ hism data.
  • the computer system is capable of producing a display showing ILl 3 haplotypes organized according to their evolutionary relationships.
  • Figure 1 illustrates a reference sequence for the IL13 gene (contiguous lines; SEQ ID NO:l), with the start and stop positions of each region of coding sequence indicated below the sequence by the numbers within the brackets and the polymo ⁇ hic sites and polymo ⁇ hisms identified by Applicants in a reference population indicated by the variant nucleotide positioned below the polymo ⁇ hic site in the sequence.
  • Figure 2 illustrates a reference sequence for the ILl 3 coding sequence (contiguous lines; SEQ ID NO:2) with the polymo ⁇ hic sites and polymo ⁇ hisms identified by Applicants in a reference population indicated by the variant nucleotide positioned below the polymo ⁇ hic site in the sequence.
  • Figure 3 illustrates a reference sequence for the ILl 3 protein (contiguous lines; SEQ ID NO:3), with the variant amino acids caused by the polymo ⁇ hisms of Fig. 2 positioned below the polymo ⁇ hic site in the sequence.
  • the present invention is based on the discovery of novel variants of the ILl 3 gene.
  • the inventors herein discovered 14 novel polymo ⁇ hic sites by characterizing the ILl 3 gene found in genomic DNAs isolated from an Index Repository IA that contains immortalized cell lines from one chimpanzee and 93 human individuals and Index Repository IB that contains 70 individuals. These two repositories contain 10 individuals in common.
  • the human individuals in Index Repository IA included a reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: Caucasian (22 individuals), African descent (20 individuals) Asian (20 individuals) Hispanic/Latino (17 individuals). To the extent possible, the members of this reference population were organized into population subgroups by the self-identified ethnogeographic origin of their four grandparents as shown in Table 1 below.
  • the Index Repository contains three unrelated indigenous American Indians (one from each of North, Central and South America), one three-generation Caucasian family (from the CEPH Utah cohort) and one two-generation African-American family.
  • Index Repository IB contains a reference population of 70 human individuals comprised of 4 three-generation families (from the CEPH Utah cohort) as well as unrelated African-American, Asian and Caucasian individuals. A total of 38 individuals in this reference population are unrelated.
  • the inventors herein also determined the haplotypes found on each chromosome for most human members of this repository.
  • the ILl 3 genotypes and haplotypes found in the repository include those shown in Tables 3 and 4, respectively.
  • the polymo ⁇ hism and haplotype data disclosed herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the ILl 3 genetic variation and a trait such as level of drug response or susceptibility to disease.
  • Candidate Gene - A gene which is hypothesized to be responsible for a disease, condition, or the response to a treatment, or to be correlated with one of these.
  • Genotype An unphased 5 ' to 3 ' sequence of nucleotide pair(s) found at one or more polymo ⁇ hic sites in a locus on a pair of homologous chromosomes in an individual.
  • genotype includes a full-genotype and/or a sub-genotype as described below.
  • Full-genotype The unphased 5 ' to 3 ' sequence of nucleotide pairs found at all known polymo ⁇ hic sites in a locus on a pair of homologous chromosomes in a single individual.
  • Sub-genotype The unphased 5' to 3' sequence of nucleotides seen at a subset of the known polymo ⁇ hic sites in a locus on a pair of homologous chromosomes in a single individual.
  • Genotyping A process for determining a genotype of an individual.
  • Haplotype A 5 ' to 3 ' sequence of nucleotides found at one or more polymo ⁇ hic sites in a locus on a single chromosome from a single individual.
  • haplotype includes a full- haplotype and or a sub-haplotype as described below.
  • Full-haplotype The 5' to 3' sequence of nucleotides found at all known polymo ⁇ hic sites in a locus on a single chromosome from a single individual.
  • Sub-haplotype The 5 ' to 3 ' sequence of nucleotides seen at a subset of the known polymo ⁇ hic sites in a locus on a single chromosome from a single individual.
  • Haplotype pair The two haplotypes found for a locus in a single individual.
  • Haplotyping A process for determining one or more haplotypes in an individual and includes use of family pedigrees, molecular techniques and/or statistical inference.
  • Haplotype data Information concerning one or more of the following for a specific gene: a listing of the haplotype pairs in each individual in a population; a listing of the different haplotypes in a population; frequency of each haplotype in that or other populations, and any known associations between one or more haplotypes and a trait.
  • Isoform - A particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/or structure.
  • Isogene - One of the isoforms of a gene found in a population.
  • An isogene contains all of the polymo ⁇ hisms present in the particular isoform of the gene.
  • Isolated - As applied to a biological molecule such as RNA, DNA, oligonucleotide, or protein, isolated means the molecule is substantially free of other biological molecules such as nucleic acids, proteins, lipids, carbohydrates, or other material such as cellular debris and growth media. Generally, the term “isolated” is not intended to refer to a complete absence of such material or to absence of water, buffers, or salts, unless they are present in amounts that substantially interfere with the methods of the present invention.
  • Locus - A location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature.
  • Naturally-occurring A term used to designate that the object it is applied to, e.g., naturally- occurring polynucleotide or polypeptide, can be isolated from a source in nature and which has not been intentionally modified by man.
  • Nucleotide pair The nucleotides found at a polymo ⁇ hic site on the two copies of a chromosome from an individual.
  • phased As applied to a sequence of nucleotide pairs for two or more polymo ⁇ hic sites in a locus, phased means the combination of nucleotides present at those polymo ⁇ hic sites on a single copy of the locus is known.
  • Polymorphic site (PS) - A position within a locus at which at least two alternative sequences are found in a population, the most frequent of which has a frequency of no more than 99%.
  • Polymorphism The sequence variation observed in an individual at a polymo ⁇ hic site.
  • Polymo ⁇ hisms include nucleotide substitutions, insertions, deletions and microsatellites and may, but need not, result in detectable differences in gene expression or protein function.
  • Polymorphism data Information concerning one or more of the following for a specific gene: location of polymo ⁇ hic sites; sequence variation at those sites; frequency of polymo ⁇ hisms in one or more populations; the different genotypes and/or haplotypes determined for the gene; frequency of one or more of these genotypes and/or haplotypes in one or more populations; any known association(s) between a trait and a genotype or a haplotype for the gene.
  • Polymorphism Database A collection of polymo ⁇ hism data arranged in a systematic or methodical way and capable of being individually accessed by electronic or other means.
  • Polynucleotide - A nucleic acid molecule comprised of single-stranded RNA or DNA or comprised of complementary, double-stranded DNA.
  • Population Group A group of individuals sharing a common ethnogeographic origin.
  • Reference Population A group of subjects or individuals who are predicted to be representative of the genetic variation found in the general population. Typically, the reference population represents the genetic variation in the population at a certainty level of at least 85%, preferably at least 90%, more preferably at least 95% and even more preferably at least 99%.
  • Single Nucleotide Polymorphism SNP - Typically, the specific pair of nucleotides observed at a single polymo ⁇ hic site. In rare cases, three or four nucleotides may be found.
  • Subject A human individual whose genotypes or haplotypes or response to treatment or disease state are to be determined.
  • Treatment A stimulus administered internally or externally to a subject.
  • Unphased As applied to a sequence of nucleotide pairs for two or more polymo ⁇ hic sites in a locus, unphased means the combination of nucleotides present at those polymo ⁇ hic sites on a single copy of the locus is not known.
  • the inventors herein have discovered 14 novel polymo ⁇ hic sites in the ILl 3 gene.
  • the polymo ⁇ hic sites identified by the inventors are referred to as PS 1-14 to designate the order in which they are located in the gene (see Table 2 below).
  • the invention provides an isolated polynucleotide comprising a polymo ⁇ hic variant of the ILl 3 gene or a fragment of the gene which contains at least one of the novel polymo ⁇ hic sites described herein.
  • the nucleotide sequence of a variant ILl 3 gene is identical to the reference genomic sequence for those portions of the gene examined, as described in the Examples below, except that it comprises a different nucleotide at one or more of the novel polymo ⁇ hic sites PS 1 -PS 14.
  • nucleotide sequence of a variant fragment of the ILl 3 gene is identical to the corresponding portion of the reference sequence except for having a different nucleotide at one or more of the novel polymo ⁇ hic sites described herein.
  • the invention specifically does not include polynucleotides comprising a nucleotide sequence identical to the reference sequence (or other reported ILl 3 sequences) or to portions of the reference sequence (or other reported ILl 3 sequences), except for genotyping oligonucleotides as described below.
  • polymo ⁇ hism in a variant gene or fragment is identified by aligning its sequence against SEQ ID NO: 1.
  • the polymo ⁇ hism is selected from the group consisting of thymine at PS1, guanine at PS2, guanine at PS3, thymine at PS4, cytosine at PS5, adenine at PS6, thymine at PS7, adenine at PS8, thymine at PS9, thymine at PS 10, adenine at PS11, thymine at PS 12, thymine at PS 13 and adenine at PS 14.
  • the polymo ⁇ hic variant comprises a naturally- occurring isogene of the ILl 3 gene which is defined by any one of haplotypes 1-21 shown in Table 4 below.
  • Polymo ⁇ hic variants of the invention may be prepared by isolating a clone containing the ILl 3 gene from a human genomic library.
  • the clone may be sequenced to determine the identity of the nucleotides at the polymo ⁇ hic sites described herein. Any particular variant claimed herein could be prepared from this clone by performing in vitro mutagenesis using procedures well-known in the art.
  • ILl 3 isogenes may be isolated using any method that allows separation of the two "copies" of the ILl 3 gene present in an individual, which, as readily understood by the skilled artisan, may be the same allele or different alleles. Separation methods include targeted in vivo cloning (TIVC) in yeast as described in WO 98/01573, U.S. Patent No. 5,866,404, and U.S. Patent No. 5,972,614. Another method, which is described in U.S. Patent No. 5,972,614, uses an allele specific oligonucleotide in combination with primer extension and exonuclease degradation to generate hemizygous DNA targets. Yet other methods are single molecule dilution (SMD) as described in Ruano et al., Proc. Natl. Acad.
  • SMD single molecule dilution
  • the invention also provides ILl 3 genome anthologies, which are collections of ILl 3 isogenes found in a given population.
  • the population may be any group of at least two individuals, including but not limited to a reference population, a population group, a family population, a clinical population, and a same sex population.
  • An IL13 genome anthology may comprise individual IL13 isogenes stored in separate containers such as microtest tubes, separate wells of a microtitre plate and the like. Alternatively, two or more groups of the ILl 3 isogenes in the anthology may be stored in separate containers.
  • a preferred ILl 3 genome anthology of the invention comprises a set of isogenes defined by the haplotypes shown in Table 4 below.
  • An isolated polynucleotide containing a polymo ⁇ hic variant nucleotide sequence of the invention may be operably linked to one or more expression regulatory elements in a recombinant expression vector capable of being propagated and expressing the encoded ILl 3 protein in a prokaryotic or a eukaryotic host cell.
  • expression regulatory elements which may be used include, but are not limited to, the lac system, operator and promoter regions of phage lambda, yeast promoters, and promoters derived from vaccinia virus, adenovirus, retroviruses, or SV40.
  • regulatory elements include, but are not limited to, appropriate leader sequences, termination codons, polyadenylation signals, and other sequences required for the appropriate transcription and subsequent translation of the nucleic acid sequence in a given host cell.
  • the expression vector contains any additional elements necessary for its transfer to and subsequent replication in the host cell. Examples of such elements include, but are not limited to, origins of replication and selectable markers.
  • Such expression vectors are commercially available or are readily constructed using methods known to those in the art (e.g., F. Ausubel et al., 1987, in "Current Protocols in Molecular Biology", John Wiley and Sons, New York, New York).
  • Host cells which may be used to express the variant ILl 3 sequences of the invention include, but are not limited to, eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells as known in the art.
  • the recombinant expression vector may be introduced into the host cell using any method known to those in the art including, but not limited to, microinjection, electroporation, particle bombardment, transduction, and transfection using DEAE- dextran, lipofection, or calcium phosphate (see e.g., Sambrook et al. (1989) in "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor Press, Plainview, New York).
  • eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells are used.
  • Non-limiting examples of such vectors include vaccinia virus vectors, adenovirus vectors,
  • eukaryotic cell lines include COS cells, CHO cells, HeLa cells, NIH 3T3 cells, and embryonic stem cells (Thomson, J. A. et al., 1998 Science 282: 1145-1147).
  • Particularly preferred host cells are mammalian cells.
  • polymo ⁇ hic variants of the ILl 3 gene will produce ILl 3 mRNAs varying from each other at any polymo ⁇ hic site retained in the spliced and processed mRNA molecules.
  • mRNAs can be used for the preparation of an ILl 3 cDNA comprising a nucleotide sequence which is a polymo ⁇ hic variant of the ILl 3 reference coding sequence shown in Figure 2.
  • the invention also provides IL13 mRNAs and corresponding cDNAs which comprise a nucleotide sequence that is identical to SEQ ID NO:2 (Fig.
  • polymo ⁇ hisms selected from the group consisting of adenine at a position corresponding to nucleotide 111 and adenine at a position corresponding to nucleotide 386. Fragments of these variant mRNAs and cDNAs are included in the scope of the invention, provided they contain the novel polymo ⁇ hisms described herein.
  • the invention specifically excludes polynucleotides identical to previously identified and characterized ILl 3 cDNAs and fragments thereof.
  • Polynucleotides comprising a variant RNA or DNA sequence may be isolated from a biological sample using well-known molecular biological procedures or may be chemically synthesized.
  • Genomic and cDNA fragments of the invention comprise at least one novel polymo ⁇ hic site identified herein and have a length of at least 10 nucleotides and may range up to the full length of the gene.
  • a fragment according to the present invention is between 100 and 3000 nucleotides in length, and more preferably between 200 and 2000 nucleotides in length, and most preferably between 500 and 1000 nucleotides in length.
  • nucleic acid molecules containing the ILl 3 gene may be complementary double stranded molecules and thus reference to a particular site on the sense strand refers as well to the corresponding site on the complementary antisense strand.
  • reference may be made to the same polymo ⁇ hic site on either strand and an oligonucleotide may be designed to hybridize specifically to either strand at a target region containing the polymo ⁇ hic site.
  • the invention also includes single-stranded polynucleotides which are complementary to the sense strand of the IL13 genomic variants described herein.
  • Polynucleotides comprising a polymo ⁇ hic gene variant or fragment may be useful for therapeutic pu ⁇ oses.
  • an expression vector encoding the isoform may be administered to the patient.
  • the patient may be one who lacks the ILl 3 isogene encoding that isoform or may already have at least one copy of that isogene.
  • ILl 3 isogene may be turned off by transforming a targeted organ, tissue or
  • oligonucleotides directed against the regulatory regions (e.g., promoter, introns, enhancers, 3' untranslated region) of the isogene may block transcription. Oligonucleotides targeting the transcription initiation site, e.g., between positions -10 and +10 from the start site are preferred. Similarly, inhibition of transcription can be achieved using oligonucleotides that base-pair with region(s) of the isogene DNA to form triplex DNA (see e.g., Gee et al. in Huber, B.E. and B.I.
  • Antisense oligonucleotides may also be designed to block translation of ILl 3 mRNA transcribed from a particular isogene. It is also contemplated that ribozymes may be designed that can catalyze the specific cleavage of IL 13 mRNA transcribed from a particular isogene.
  • the oligonucleotides may be delivered to a target cell or tissue by expression from a vector introduced into the cell or tissue in vivo or ex vivo.
  • the oligonucleotides may be formulated as a pharmaceutical composition for administration to the patient.
  • Oligoribonucleotides and/or oligodeoxynucleotides intended for use as antisense oligonucleotides may be modified to increase stability and half-life.
  • Possible modifications include, but are not limited to phosphorothioate or 2' O-methyl linkages, and the inclusion of nontraditional bases such as inosine and queosine, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytosine, guanine, thymine, and uracil which are not as easily recognized by endogenous nucleases.
  • the invention also provides an isolated polypeptide comprising a polymo ⁇ hic variant of the reference ILl 3 amino acid sequence shown in Figure 3.
  • the location of a variant amino acid in an ILl 3 polypeptide or fragment of the invention is identified by aligning its sequence against SEQ ID NO:3 (Fig. 3).
  • An IL13 protein variant of the invention comprises an amino acid sequence identical to SEQ ID NO: 3 except for having glutamine at a position conesponding to amino acid position 129.
  • the invention specifically excludes amino acid sequences identical to those previously identified for IL13, including SEQ ID NO:3, and previously described fragments thereof.
  • IL13 protein variants included within the invention comprise all amino acid sequences based on SEQ ID NO: 3 and having glutamine at a position conesponding to amino acid position 129.
  • the invention also includes ILl 3 peptide variants, which are any fragments of an ILl 3 protein variant that contains glutamine at a position conesponding to amino acid position 129.
  • An ILl 3 peptide variant is at least 6 amino acids in length and is preferably any number between 6 and 30 amino acids long, more preferably between 10 and 25, and most preferably between 15 and 20 amino acids long.
  • Such ILl 3 peptide variants may be useful as antigens to generate antibodies specific for one of the above ILl 3 isoforms.
  • the ILl 3 peptide variants may be useful in drug screening assays.
  • an IL13 variant protein or peptide of the invention may be prepared by chemical synthesis or by expressing one of the variant ILl 3 genomic and cDNA sequences as described above.
  • the ILl 3 protein variant may be isolated from a biological sample of an individual
  • IL 13 having an ILl 3 isogene which encodes the variant protein where the sample contains two different IL13 isoforms (i.e., the individual has different IL13 isogenes), a particular IL13 isoform of the invention can be isolated by immunoaffinity chromatography using an antibody which specifically binds to that particular IL13 isoform but does not bind to the other IL13 isoform.
  • the expressed or isolated ILl 3 protein may be detected by methods known in the art, including Coomassie blue staining, silver staining, and Western blot analysis using antibodies specific for the isoform of the ILl 3 protein as discussed further below.
  • ILl 3 variant proteins can be purified by standard protein purification procedures known in the art, including differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelectric focusing, gel electrophoresis, affinity and immunoaff ⁇ nity chromatography and the like. (Ausubel et. al., 1987, In Cunent Protocols in Molecular Biology John Wiley and Sons, New York, New York). In the case of immunoaffinity chromatography, antibodies specific for a particular polymo ⁇ hic variant may be used.
  • a polymo ⁇ hic variant ILl 3 gene of the invention may also be fused in frame with a heterologous sequence to encode a chimeric ILl 3 protein.
  • the non-IL13 portion of the chimeric protein may be recognized by a commercially available antibody.
  • the chimeric protein may also be engineered to contain a cleavage site located between the ILl 3 and non-IL13 portions so that the ILl 3 protein may be cleaved and purified away from the non-IL13 portion.
  • An additional embodiment of the invention relates to using a novel ILl 3 protein isoform in any of a variety of drug screening assays.
  • Such screening assays may be performed to identify agents that bind specifically to all known ILl 3 protein isoforms or to only a subset of one or more of these isoforms.
  • the agents may be from chemical compound libraries, peptide libraries and the like.
  • the ILl 3 protein or peptide variant may be free in solution or affixed to a solid support.
  • high throughput screening of compounds for binding to an ILl 3 variant may be accomplished using the method described in PCT application WO84/03565, in which large numbers of test compounds are synthesized on a solid substrate, such as plastic pins or some other surface, contacted with the ILl 3 protein(s) of interest and then washed. Bound ILl 3 protein(s) are then detected using methods well-known in the art.
  • a novel ILl 3 protein isoform may be used in assays to measure the binding affinities of one or more candidate drugs targeting the ILl 3 protein.
  • the invention provides antibodies specific for and immunoreactive with one or more of the novel ILl 3 variant proteins described herein.
  • the antibodies may be either monoclonal or polyclonal in origin.
  • the ILl 3 protein or peptide variant used to generate the antibodies may be from natural or recombinant sources or produced by chemical synthesis using synthesis techniques known in the art. If the ILl 3 protein variant is of insufficient size to be antigenic, it may be conjugated, complexed, or otherwise covalently linked to a carrier molecule to enhance the antigenicity of the peptide.
  • carrier molecules include, but are not limited to, albumins
  • an antibody specifically immunoreactive with one of the novel ILl 3 protein isoforms described herein is administered to an individual to neutralize activity of the ILl 3 isoform expressed by that individual.
  • the antibody may be formulated as a pharmaceutical composition which includes a pharmaceutically acceptable carrier.
  • Antibodies specific for and immunoreactive with one of the novel ILl 3 protein isoform described herein may be used to immunoprecipitate the ILl 3 protein variant from solution as well as react with ILl 3 protein isoforms on Western or immunoblots of polyacrylamide gels on membrane supports or substrates.
  • the antibodies will detect ILl 3 protein isoforms in paraffin or frozen tissue sections, or in cells which have been fixed or unfixed and prepared on slides, coverslips, or the like, for use in immunocytochemical, immunohistochemical, and immunofmorescence techniques.
  • an antibody specifically immunoreactive with one of the novel ILl 3 protein variants described herein is used in immunoassays to detect this variant in biological samples.
  • an antibody of the present invention is contacted with a biological sample and the formation of a complex between the ILl 3 protein variant and the antibody is detected.
  • suitable immunoassays include radioimmunoassay, Western blot assay, immunofluorescent assay, enzyme linked immunoassay (ELISA), chemiluminescent assay, immunohistochemical assay, immunocytochemical assay, and the like (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Christopher P. Price and David J. Neoman, Stockton Press, New York, New York; Cunent Protocols in Molecular Biology, 1987, Eds. Ausubel et al., John Wiley and Sons, New York, New York). Standard techniques known in the art for ELISA are described in Methods in Immunodiagnosis, 2nd Ed., Eds. Rose and Bigazzi, John Wiley and Sons, New York 1980; and
  • Such assays may be direct, indirect, competitive, or noncompetitive as described in the art (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Christopher P. Price and David J. Neoman, Stockton Pres, NY, NY; and Oellirich, M., 1984, J. Clin. Chem. Clin. Biochem., 22:895-904). Proteins may be isolated from test specimens and biological samples by conventional methods, as described in Cunent Protocols in Molecular Biology, supra.
  • Exemplary antibody molecules for use in the detection and therapy methods of the present invention are intact immunoglobulin molecules, substantially intact immunoglobulin molecules, or those portions of immunoglobulin molecules that contain the antigen binding site.
  • Polyclonal or monoclonal antibodies may be produced by methods conventionally known in the art (e.g., Kohler and Milstein, 1975, Nature, 256:495-497; Campbell Monoclonal Antibody Technology, the Production and Characterization of Rodent and Human Hybridomas, 1985, In: Laboratory Techniques in
  • the antibodies or antigen binding fragments thereof may also be produced by genetic engineering.
  • the technology for expression of both heavy and light chain genes in E. coli is the subject of PCT patent applications, publication number WO 901443, WO 901443 and WO 9014424 and in Huse et al., 1989, Science, 246:1275-1281.
  • the antibodies may also be humanized (e.g., Queen, C. et al. 1989 Proc. Natl. Acad. Sci. 86;10029).
  • Effect(s) of the polymo ⁇ hisms identified herein on expression of ILl 3 may be investigated by preparing recombinant cells and/or organisms, preferably recombinant animals, containing a polymo ⁇ hic variant of the ILl 3 gene.
  • expression includes but is not limited to one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into ILl 3 protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
  • the desired ILl 3 isogene may be introduced into the cell in a vector such that the isogene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location.
  • the ILl 3 isogene is introduced into a cell in such a way that it recombines with the endogenous ILl 3 gene present in the cell. Such recombination requires the occunence of a double recombination event, thereby resulting in the desired ILl 3 gene polymo ⁇ hism.
  • Vectors for the introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector or vector construct may be used in the invention. Methods such as electroporation, particle bombardment, calcium phosphate co-precipitation and viral transduction for introducing DNA into cells are known in the art; therefore, the choice of method may lie with the competence and preference of the skilled practitioner.
  • Examples of cells into which the ILl 3 isogene may be introduced include, but are not limited to, continuous culture cells, such as COS, NIH 3T3, and primary or culture cells of the relevant tissue type, i.e., they express the ILl 3 isogene. Such recombinant cells can be used to compare the biological activities of the different protein variants.
  • Recombinant organisms i.e., transgenic animals, expressing a variant ILl 3 gene are prepared using standard procedures known in the art.
  • a construct comprising the variant gene is introduced into a nonhuman animal or an ancestor of the animal at an embryonic stage, i.e., the one- cell stage, or generally not later than about the eight-cell stage.
  • Transgenic animals carrying the constructs of the invention can be made by several methods known to those having skill in the art.
  • One method involves transfecting into the embryo a retrovirus constructed to contain one or more insulator elements, a gene or genes of interest, and other components known to those skilled in the art to provide a complete shuttle vector harboring the insulated gene(s) as a transgene, see e.g., U.S. Patent No. 5,610,053.
  • Another method involves directly injecting a transgene into the embryo.
  • a third method involves the use of embryonic stem cells. Examples of animals into which the ILl 3
  • 16 isogenes may be introduced include, but are not limited to, mice, rats, other rodents, and nonhuman primates (see “The Introduction of Foreign Genes into Mice” and the cited references therein, In: Recombinant DNA, Eds. J.D. Watson, M. Gilman, J. Witkowski, and M. Zoller; W.H. Freeman and Company, New York, pages 254-272).
  • Transgenic animals stably expressing a human ILl 3 isogene and producing human ILl 3 protein can be used as biological models for studying diseases related to abnormal ILl 3 expression and/or activity, and for screening and assaying various candidate drugs, compounds, and treatment regimens to reduce the symptoms or effects of these diseases.
  • An additional embodiment of the invention relates to pharmaceutical compositions for treating disorders affected by expression or function of a novel ILl 3 isogene described herein.
  • the pharmaceutical composition may comprise any of the following active ingredients: a polynucleotide comprising one of these novel ILl 3 isogenes; an antisense oligonucleotide directed against one of the novel ILl 3 isogenes, a polynucleotide encoding such an antisense oligonucleotide, or another compound which inhibits expression of a novel ILl 3 isogene described herein.
  • the composition contains the active ingredient in a therapeutically effective amount.
  • composition also comprises a pharmaceutically acceptable carrier, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water.
  • a pharmaceutically acceptable carrier examples of which include, but are not limited to, saline, buffered saline, dextrose, and water.
  • Those skilled in the art may employ a formulation most suitable for the active ingredient, whether it is a polynucleotide, oligonucleotide, protein, peptide or small molecule antagonist.
  • the pharmaceutical composition may be administered alone or in combination with at least one other agent, such as a stabilizing compound.
  • Administration of the pharmaceutical composition may be by any number of routes including, but not limited to oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, intradermal, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA).
  • the dose can be estimated initially either in cell culture assays or in animal models.
  • the animal model may also be used to determine the appropriate concentration range and route of administration.
  • Such information can then be used to determine useful doses and routes for administration in humans.
  • the exact dosage will be determined by the practitioner, in light of factors relating to the patient requiring treatment, including but not limited to severity of the disease state, general health, age, weight and gender of the patient, diet, time and frequency of administration, other drugs being taken by the patient, and tolerance/response to the treatment.
  • the invention also provides compositions and methods for detecting the novel ILl 3 polymo ⁇ hisms identified herein.
  • compositions comprise at least one ILl 3 genotyping oligonucleotide.
  • an ILl 3 genotyping oligonucleotide is a probe or primer capable of hybridizing to a target region that is located close to, or that contains, one of the novel polymo ⁇ hic sites described herein.
  • the term "oligonucleotide” refers to a polynucleotide molecule having less than about 100 nucleotides.
  • a prefened oligonucleotide of the invention is 10 to 35 nucleotides long. More preferably, the oligonucleotide is between 15 and 30, and most preferably, between 20 and 25 nucleotides in length.
  • oligonucleotide may be comprised of any phosphorylation state of ribonucleotides, deoxyribonucleotides, and acyclic nucleotide derivatives, and other functionally equivalent derivatives.
  • oligonucleotides may have a phosphate-free backbone, which may be comprised of linkages such as carboxymethyl, acetamidate, carbamate, polyamide (peptide nucleic acid (PNA)) and the like (Varma, R. in Molecular Biology and Biotechnology, A Comprehensive Desk Reference, Ed. R. Meyers, VCH Publishers, Inc. (1995), pages 617-620).
  • Oligonucleotides of the invention may be prepared by chemical synthesis using any suitable methodology known in the art, or may be derived from a biological sample, for example, by restriction digestion.
  • the oligonucleotides may be labeled, according to any technique known in the art, including use of radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like.
  • Genotyping oligonucleotides of the invention must be capable of specifically hybridizing to a target region of an IL13 polynucleotide, i.e., an IL13 isogene.
  • specific hybridization means the oligonucleotide forms an anti-parallel double-stranded structure with the target region under certain hybridizing conditions, while failing to form such a structure when incubated with a non-target region or a non-IL13 polynucleotide under the same hybridizing conditions.
  • the oligonucleotide specifically hybridizes to the target region under conventional high stringency conditions.
  • a nucleic acid molecule such as an oligonucleotide or polynucleotide is said to be a "perfect” or “complete” complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the conesponding position of the other molecule.
  • a nucleic acid molecule is "substantially complementary" to another molecule if it hybridizes to that molecule with sufficient stability to remain in a duplex form under conventional low-stringency conditions.
  • Conventional hybridization conditions are described, for example, by Sambrook J. et al., in Molecular Cloning, A Laboratory Manual, 2 nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) and by Haymes, B.D. et al. in Nucleic Acid Hybridization, A Practical Approach,
  • an oligonucleotide primer may have a non-complementary fragment at its 5 ' end, with the remainder of the primer being complementary to the target region.
  • non-complementary nucleotides may be interspersed into the oligonucleotide probe or primer as long as the resulting probe or primer is still capable of specifically hybridizing to the target region.
  • Prefened genotyping oligonucleotides of the invention are allele-specific oligonucleotides.
  • ASO allele-specific oligonucleotide
  • allele-specificity will depend upon a variety of readily optimized stringency conditions, including salt and formamide concentrations, as well as temperatures for both the hybridization and washing steps.
  • Allele-specific oligonucleotide probes which usually provide good discrimination between different alleles are those in which a central position of the oligonucleotide probe aligns with the polymo ⁇ hic site in the target region (e.g., approximately the 7 th or 8 th position in a 15 mer, the 8 th or 9 th position in a 16mer, the 10 th or 11 th position in a 20 mer).
  • a prefened ASO probe for detecting IL13 gene polymo ⁇ hisms comprises a nucleotide sequence, listed 5' to 3', selected from the group consisting of:
  • AGGAAAACGAGGGAA (SEQ ID NO: 4) and its complement, AGGAAAA GAGGGAA (SEQ ID NO: 5) and its complement, ACAAAACAAAAAAAC (SEQ ID NO: 6) and its complement, ACAAAACGAAAAAAC (SEQ ID NO: :7) and its complement, CCTGGAAATCTGAAC (SEQ ID NO: :8) and its complement, CCTGGAAGTCTGAAC (SEQ ID NO: :9) and its complement, TGCCTGCCGCTGGAA (SEQ ID NO: :10 and its complement, TGCCTGCTGCTGGAA (SEQ ID NO: :11 and its complement, CCCAGCCTATGCATC (SEQ ID NO: :12 and its complement, CCCAGCCCATGCATC (SEQ ID NO:13 and its complement, AGCTGGTCAACATCA (SEQ ID NO: :14 and its complement, AGCTGGTAAACATCA (SEQ ID NO:15 and its complement, ACCAAGGCCCGGCCC
  • CTACTCACGTGCTGA SEQ ID NO 28
  • CTACTCATGTGCTGA SEQ ID NO 29
  • GAGGGACAGTTCAAC (SEQ ID NO 31) and its complement .
  • An allele-specific oligonucleotide primer of the invention has a 3' terminal nucleotide, or preferably a 3 ' penultimate nucleotide, that is complementary to only one nucleotide of a particular SNP, thereby acting as a primer for polymerase-mediated extension only if the allele containing that nucleotide is present. Allele-specific oligonucleotide primers hybridizing to either the coding or noncoding strand are contemplated by the invention.
  • a prefened ASO primer for detecting ILl 3 gene polymo ⁇ hisms comprises a nucleotide sequence, listed 5 ' to 3', selected from the group consisting of:
  • genotyping oligonucleotides of the invention hybridize to a target region located one to several nucleotides downstream of one of the novel polymo ⁇ hic sites identified herein. Such oligonucleotides are useful in polymerase-mediated primer extension methods for detecting one of the novel polymo ⁇ hisms described herein and therefore such genotyping oligonucleotides are refened to
  • primer-extension oligonucleotides the 3 '-terminus of a primer-extension oligonucleotide is a deoxynucleotide complementary to the nucleotide located immediately adjacent to the polymo ⁇ hic site.
  • a particularly prefened oligonucleotide primer for detecting ILl 3 gene polymo ⁇ hisms by primer extension terminates in a nucleotide sequence, listed 5' to 3', selected from the group consisting of:
  • TCTAGGAAAA (SEQ ID NO: :88); CTCTTCCCTC SEQ ID NO: :89) ; AAAACAAAAC (SEQ ID NO: :90) ; GGTGTTTTTT SEQ ID NO: :91); AGACCTGGAA (SEQ ID NO: :92) ; AAAGTTCAGA SEQ ID NO: :93) ; CCTTGCCTGC (SEQ ID NO: :94) ; TAATTCCAGC SEQ ID NO: :95); CCACCCAGCC (SEQ ID NO: :96), GCGGATGCAT SEQ ID NO: :97) ; AGGAGCTGGT (SEQ ID NO: :98); GGGTGATGTT SEQ ID NO: :99) ; TGGACCAAGG (SEQ ID NO:100) GCTGGGCCGG SEQ ID NO:101); ACCTGGCCTG (SEQ ID NO: :102) CCCTGGCAGC SEQ ID NO: :103) ;
  • a composition contains two or more differently labeled genotyping oligonucleotides for simultaneously probing the identity of nucleotides at two or more polymo ⁇ hic sites. It is also contemplated that primer compositions may contain two or more sets of allele-specific primer pairs to allow simultaneous targeting and amplification of two or more regions containing a polymo ⁇ hic site.
  • ILl 3 genotyping oligonucleotides of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e.g., WO 98/20020 and WO 98/20019).
  • Such immobilized genotyping oligonucleotides may be used in a variety of polymo ⁇ hism detection assays, including but not limited to probe hybridization and polymerase extension assays.
  • Immobilized ILl 3 genotyping oligonucleotides of the invention may comprise an ordered anay of oligonucleotides designed to rapidly screen a DNA sample for polymo ⁇ hisms in multiple genes at the same time.
  • the invention provides a kit comprising at least two genotyping oligonucleotides packaged in separate containers.
  • the kit may also contain other components such as hybridization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container.
  • the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for primer extension mediated by the polymerase, such as PCR.
  • the 21 and may optionally also include the nucleotide pair or nucleotide present at one or more additional polymo ⁇ hic sites in the ILl 3 gene.
  • the additional polymo ⁇ hic sites may be cunently known polymo ⁇ hic sites or sites that are subsequently discovered.
  • One embodiment of the genotyping method involves isolating from the individual a nucleic acid mixture comprising the two copies of the ILl 3 gene, or a fragment thereof, that are present in the individual, and determining the identity of the nucleotide pair at one or more of the polymo ⁇ hic sites selected from PS 1 -PS 14 in the two copies to assign an ILl 3 genotype to the individual.
  • the two "copies" of a gene in an individual may be the same allele or may be different alleles.
  • the genotyping method comprises determining the identity of the nucleotide pair at each of PS1-14.
  • the nucleic acid mixture is isolated from a biological sample taken from the individual, such as a blood sample or tissue sample.
  • tissue samples include whole blood, semen saliva, tears, urine, fecal material, sweat, buccal, skin and hair.
  • the nucleic acid mixture may be comprised of genomic DNA, mRNA, or cDNA and, in the latter two cases, the biological sample must be obtained from an organ in which the ILl 3 gene is expressed.
  • mRNA or cDNA preparations would not be used to detect polymo ⁇ hisms located in introns or in 5' and 3' nontranscribed regions. If an ILl 3 gene fragment is isolated, it must contain the polymo ⁇ hic site(s) to be genotyped.
  • One embodiment of the haplotyping method comprises isolating from the individual a nucleic acid molecule containing only one of the two copies of the ILl 3 gene, or a fragment thereof, that is present in the individual and determining in that copy the identity of the nucleotide at one or more of the polymo ⁇ hic sites PS 1 -PS 14 in that copy to assign an ILl 3 haplotype to the individual.
  • the nucleic acid may be isolated using any method capable of separating the two copies of the ILl 3 gene or fragment such as one of the methods described above for preparing ILl 3 isogenes, with targeted in vivo cloning being the prefened approach.
  • any individual clone will only provide haplotype information on one of the two ILl 3 gene copies present in an individual. If haplotype information is desired for the individual's other copy, additional ILl 3 clones will need to be examined. Typically, at least five clones should be examined to have more than a 90% probability of haplotyping both copies of the ILl 3 gene in an individual. In a particularly prefened embodiment, the nucleotide at each of PS 1-14 is identified.
  • an ILl 3 haplotype pair is determined for an individual by identifying the phased sequence of nucleotides at one or more of the polymo ⁇ hic sites selected from PS 1 -PS 14 in each copy of the ILl 3 gene that is present in the individual.
  • the haplotyping method comprises identifying the phased sequence of nucleotides at each of PS1-14 in each copy of the IL13 gene.
  • the identifying step is preferably performed with each copy of the gene being placed in separate containers. However, it is also envisioned that if the two copies are labeled with different tags, or are
  • first and second copies of the gene are labeled with different first and second fluorescent dyes, respectively, and an allele-specific oligonucleotide labeled with yet a third different fluorescent dye is used to assay the polymo ⁇ hic site(s), then detecting a combination of the first and third dyes would identify the polymo ⁇ hism in the first gene copy while detecting a combination of the second and third dyes would identify the polymo ⁇ hism in the second gene copy.
  • the identity of a nucleotide (or nucleotide pair) at a polymo ⁇ hic site(s) may be determined by amplifying a target region(s) containing the polymo ⁇ hic site(s) directly from one or both copies of the ILl 3 gene, or fragment thereof, and the sequence of the amplified region(s) determined by conventional methods. It will be readily appreciated by the skilled artisan that only one nucleotide will be detected at a polymo ⁇ hic site in individuals who are homozygous at that site, while two different nucleotides will be detected if the individual is heterozygous for that site.
  • the polymo ⁇ hism may be identified directly, known as positive-type identification, or by inference, refened to as negative-type identification.
  • a site may be positively determined to be either guanine or cytosine for an individual homozygous at that site, or both guanine and cytosine, if the individual is heterozygous at that site.
  • the site may be negatively determined to be not guanine (and thus cytosine/cytosine) or not cytosine (and thus guanine/guanine).
  • the identity of the allele(s) present at any of the novel polymo ⁇ hic sites described herein may be indirectly determined by genotyping a polymo ⁇ hic site not disclosed herein that is in linkage disequilibrium with the polymo ⁇ hic site that is of interest. Two sites are said to be in linkage disequilibrium if the presence of a particular variant at one site enhances the predictability of another variant at the second site (Stevens, JC 1999, Mol. Diag. 4: 309-17). Polymo ⁇ hic sites in linkage disequilibrium with the presently disclosed polymo ⁇ hic sites may be located in regions of the gene or in other genomic regions not examined herein.
  • Genotyping of a polymo ⁇ hic site in linkage disequilibrium with the novel polymo ⁇ hic sites described herein may be performed by, but is not limited to, any of the above-mentioned methods for detecting the identity of the allele at a polymo ⁇ hic site.
  • the target region(s) may be amplified using any oligonucleotide-directed amplification method, including but not limited to polymerase chain reaction (PCR) (U.S. Patent No. 4,965,188), ligase chain reaction (LCR) (Barany et al., Proc. Natl. Acad. Sci.
  • Oligonucleotide ligation assay OLA
  • Oligonucleotides useful as primers or probes in such methods should specifically hybridize to a region of the nucleic acid that contains or is adjacent to the polymo ⁇ hic site.
  • the oligonucleotides are between 10 and 35 nucleotides in length and preferably, between 15 and 30 nucleotides in length. Most preferably, the oligonucleotides are 20 to 25 nucleotides long. The exact
  • nucleic acid amplification procedures may be used to amplify the target region including transcription-based amplification systems (U.S. Patent No. 5,130,238; EP 329,822; U.S. Patent No. 5,169,766, WO89/06700) and isothermal methods (Walker et al., Proc. Natl. Acad. Sci. USA 89:392-396, 1992).
  • a polymo ⁇ hism in the target region may also be assayed before or after amplification using one of several hybridization-based methods known in the art.
  • allele-specific oligonucleotides are utilized in performing such methods.
  • the allele-specific oligonucleotides may be used as differently labeled probe pairs, with one member of the pair showing a perfect match to one variant of a target sequence and the other member showing a perfect match to a different variant.
  • more than one polymo ⁇ hic site may be detected at once using a set of allele- specific oligonucleotides or oligonucleotide pairs.
  • the members of the set have melting temperatures within 5°C, and more preferably within 2°C, of each other when hybridizing to each of the polymo ⁇ hic sites being detected.
  • Hybridization of an allele-specific oligonucleotide to a target polynucleotide may be performed with both entities in solution, or such hybridization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support. Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidin-biotin, salt bridges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Allele-specific oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis.
  • Solid-supports suitable for use in detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads.
  • the solid support may be treated, coated or derivatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid.
  • the genotype or haplotype for the ILl 3 gene of an individual may also be determined by hybridization of a nucleic sample containing one or both copies of the gene to nucleic acid arrays and subarrays such as described in WO 95/11995.
  • the arrays would contain a battery of allele-specific oligonucleotides representing each of the polymo ⁇ hic sites to be included in the genotype or haplotype.
  • polymo ⁇ hisms may also be determined using a mismatch detection technique, including but not limited to the RNase protection method using riboprobes (Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230:1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet. 25:229-253, 1991).
  • riboprobes Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230:1242, 1985
  • proteins which recognize nucleotide mismatches such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet. 25:229-253, 1991).
  • a polymerase-mediated primer extension method may also be used to identify the polymo ⁇ hism(s).
  • Several such methods have been described in the patent and scientific literature and include the "Genetic Bit Analysis” method (W092/15712) and the ligase/polymerase mediated genetic bit analysis (U.S. Patent 5,679,524. Related methods are disclosed in W091/02087, WO90/09455, W095/17676, U.S. Patent Nos. 5,302,509, and 5,945,283. Extended primers containing a polymo ⁇ hism may be detected by mass spectrometry as described in U.S. Patent No. 5,605,798.
  • Another primer extension method is allele-specific PCR (Ruano et al., Nucl. Acids Res. 17:8392,
  • the haplotyping prediction method comprises identifying an ILl 3 genotype for the individual at two or more polymo ⁇ hic sites selected from PS 1 -PS 14, enumerating all possible haplotype pairs which are consistent with the genotype, accessing data containing ILl 3 haplotype pairs identified in a reference population, and assigning a haplotype pair to the individual that is consistent with the data.
  • the reference haplotype pairs include the ILl 3 haplotype pairs shown in Table 3.
  • the reference population should be composed of randomly-selected individuals representing the major ethnogeographic groups of the world.
  • a prefened reference population allows the detection of any haplotype whose frequency is at least 10% with about 99% certainty and comprises about 20 unrelated individuals from each of the four population groups named above.
  • a particularly prefened reference population includes a 3-generation family representing one or more of the four population groups to serve as controls for checking quality of haplotyping procedures.
  • the haplotype frequency data for each ethnogeographic group is examined to determine whether it is consistent with Hardy- Weinberg equilibrium.
  • Hardy- Weinberg equilibrium Hardy- Weinberg
  • a statistically significant difference between the observed and expected haplotype frequencies could be due to one or more factors including significant inbreeding in the population group, strong selective pressure on the gene, sampling bias, and or enors in the genotyping process. If large deviations from Hardy- Weinberg equilibrium are observed in an ethnogeographic group, the number of individuals in that group can be increased to see if the deviation is due to a sampling bias. If a larger sample size does not reduce the difference between observed and expected haplotype pair frequencies, then one may wish to consider haplotyping the individual using a direct haplotyping method such as, for example, CLASPER System TM technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long- range PCR (Michalotos-Beloin et al, Nucleic Acids Res. 24:4841-4843, 1996).
  • CLASPER System TM technology U.S. Patent No. 5,866,404
  • SMD or allele-specific long- range PCR
  • the assigning step involves performing the following analysis. First, each of the possible haplotype pairs is compared to the haplotype pairs in the reference population. Generally, only one of the haplotype pairs in the reference population matches a possible haplotype pair and that pair is assigned to the individual. Occasionally, only one haplotype represented in the reference haplotype pairs is consistent with a possible haplotype pair for an individual, and in such cases the individual is assigned a haplotype pair containing this known haplotype and a new haplotype derived by subtracting the known haplotype from the possible haplotype pair.
  • the individual is preferably haplotyped using a direct molecular haplotyping method such as, for example, CLASPER System TM technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al., Nucleic Acids Res. 24:4841-4843, 1996).
  • a direct molecular haplotyping method such as, for example, CLASPER System TM technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al., Nucleic Acids Res. 24:4841-4843, 1996).
  • the invention also provides a method for determining the frequency of an ILl 3 genotype or ILl 3 haplotype in a population.
  • the method comprises determining the genotype or the haplotype pair for the ILl 3 gene that is present in each member of the population, wherein the genotype or haplotype comprises the nucleotide pair or nucleotide detected at one or more of the polymo ⁇ hic sites PS 1 -PS 14 in the ILl 3 gene; and calculating the frequency any particular genotype or haplotype is found in the population.
  • the population may be a reference population, a family population, a same sex population, a population group, a trait population (e.g., a group of individuals exhibiting a trait of interest such as a medical condition or response to a therapeutic treatment).
  • frequency data for ILl 3 genotypes and/or haplotypes found in a reference population are used in a method for identifying an association between a trait and an ILl genotype or an ILl 3 haplotype.
  • the trait may be any detectable phenotype, including but not
  • the method involves obtaining data on the frequency of the genotype(s) or haplotype(s) of interest in a reference population as well as in a population exhibiting the trait.
  • Frequency data for one or both of the reference and trait populations may be obtained by genotyping or haplotyping each individual in the populations using one of the methods described above.
  • the haplotypes for the trait population may be determined directly or, alternatively, by the predictive genotype to haplotype approach described above.
  • the frequency data for the reference and or trait populations is obtained by accessing previously determined frequency data, which may be in written or electronic form.
  • the frequency data may be present in a database that is accessible by a computer.
  • the frequencies of the genotype(s) or haplotype(s) of interest in the reference and trait populations are compared.
  • the frequencies of all genotypes and/or haplotypes observed in the populations are compared. If a particular genotype or haplotype for the ILl 3 gene is more frequent in the trait population than in the reference population at a statistically significant amount, then the trait is predicted to be associated with that ILl 3 genotype or haplotype.
  • the ILl 3 genotype or haplotype being compared in the trait and reference populations is selected from the full-genotypes and full-haplotypes shown in Tables 3 and 4, respectively, or from sub-genotypes and sub-haplotypes derived from these genotypes and haplotypes.
  • the trait of interest is a clinical response exhibited by a patient to some therapeutic treatment, for example, response to a drug targeting ILl 3 or response to a therapeutic treatment for a medical condition.
  • medical condition includes but is not limited to any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment is desirable, and includes previously and newly identified diseases and other disorders.
  • clinical response means any or all of the following: a quantitative measure of the response, no response, and adverse response (i.e., side effects).
  • clinical population In order to deduce a conelation between clinical response to a treatment and an ILl 3 genotype or haplotype, it is necessary to obtain data on the clinical responses exhibited by a population of individuals who received the treatment, hereinafter the "clinical population".
  • This clinical data may be obtained by analyzing the results of a clinical trial that has already been run and/or the clinical data may be obtained by designing and carrying out one or more new clinical trials.
  • the term "clinical trial” means any research study designed to collect clinical data on responses to a particular treatment, and includes but is not limited to phase I, phase II and phase HI clinical trials. Standard methods are used to define the patient population and to enroll subjects.
  • the therapeutic treatment of interest is administered to each individual in the trial population and each individual's response to the treatment is measured using one or more predetermined criteria. It is contemplated that in many cases, the trial population will exhibit a range of responses and that the investigator will choose the number of responder groups (e.g., low, medium, high) made up by the various responses.
  • the IL13 gene for each individual in the trial population is genotyped and/or haplotyped, which may be done before or after administering the treatment.
  • conelations between individual response and ILl 3 genotype or haplotype content are created. Conelations may be produced in several ways. In one method, individuals are grouped by their ILl 3 genotype or haplotype (or haplotype pair) (also refened to as a polymo ⁇ hism group), and then the averages and standard deviations of clinical responses exhibited by the members of each polymo ⁇ hism group are calculated.
  • the conelation is found using a genetic algorithm approach as described in PCT Application entitled “Methods for Obtaining and Using Haplotype Data", filed June 26, 2000.
  • Conelations may also be analyzed using analysis of variation (ANOVA) techniques to determine how much of the variation in the clinical data is explained by different subsets of the ANOVA
  • the identification of an association between a clinical response and a genotype or haplotype (or haplotype pair) for the ILl 3 gene may be the basis for designing a diagnostic method to determine those individuals who will or will not respond to the treatment, or alternatively, will respond at a lower level and thus may require more treatment, i.e., a greater dose of a drug.
  • the diagnostic method may take one of several forms: for example, a direct DNA test (i.e., genotyping or haplotyping one or more of the polymo ⁇ hic sites in the ILl 3 gene), a serological test, or a physical exam measurement.
  • this diagnostic method uses the predictive haplotyping method described above.
  • any or all analytical and mathematical operations involved in practicing the methods of the present invention may be implemented by a computer.
  • the computer may execute a program that generates views (or screens) displayed on a display device and with which the user can interact to view and analyze large amounts of information relating to the ILl 3 gene and its genomic variation, including chromosome location, gene structure, and gene family, gene expression data, polymo ⁇ hism data, genetic sequence data, and clinical data population data (e.g., data on ethnogeographic origin, clinical responses, genotypes, and haplotypes for one or more populations).
  • the IL13 polymo ⁇ hism data described herein may be stored as part of a relational database (e.g., an instance of an Oracle database or a set of ASCII flat files).
  • polymo ⁇ hism data may be stored on the computer's hard drive or may, for example, be stored on a CD ROM or on one or more other storage devices accessible by the computer.
  • the data may be stored on one or more databases in communication with the computer via a network.
  • Example IA This example illustrates examination of various regions of the ILl 3 gene for polymo ⁇ hic sites using DNA from Index Repository 1 A.
  • Amplification profile 94°C - 2 min. 1 cycle
  • PCR products were purified by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at http://www.genome.wi.mit.edu/sequencing/protocols/pure/SPRI_pcr.html. Briefly, five ⁇ l of carboxyl coated magnetic beads (10 mg/ml) and 60 ⁇ l of HYB BUFFER
  • the purified PCR products were sequenced in both directions using the primer sets described previously or those listed, in the 5 ' to 3 ' direction, below.
  • Example IB This example illustrates examination of the ILl 3 gene for polymo ⁇ hic sites in several regions spanning about 2100 base pairs upstream of the ATG start site to about 115 base pairs downstream of the termination codon.
  • Fragment 1 (Promoter region) Forward primer
  • Fragment 2 (Promoter region) Forward primer: 560-581 GGGATAAGGGGCGTTGACTCAC (SEQ ID NO: 150)
  • Reverse primer complement of 1248-1223 CCATCCTTCTGGGAAACTCTTAACTG (SEQ ID NO: 151) PCR Product 689 nt Fragment 3 (Promoter region)
  • Reverse primer complement of 1667-1644 TGACCACAGTCTACCAGCTATGGG (SEQ ID NO: 153) PCR Product 592 nt
  • Fragment 4 (Promoter region) Forward primer:
  • Reverse primer complement of 2058-2035 GCGTCTTGTGGCAGCTTTTATAGG (SEQ ID NO: 155) PCR Product 698 nt
  • Reverse primer complement of 3906-3883 AGGTAGGAGTTAGGAGCCCTTGAG (SEQ ID NO: 161) PCR Product 781 nt
  • PCR products were purified by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at http://www.genome.wi.mit.edu/sequencing/protocols/pure/SPRI_pcr.html. Briefly, carboxyl coated magnetic beads (10 mg/ml) were washed three times with wash buffer (0.5 M EDTA, pH 8.0). Ten ⁇ l of washed beads and 50 ⁇ l of HYB BUFFER (2.5M NaCl/20% PEG 8000) were added to each PCR reaction mixture (50 ⁇ l). The reaction mixture was mixed well and incubated at room temperature (RT) for 10 min.
  • wash buffer 0.5 M EDTA, pH 8.0
  • HYB BUFFER 2.5M NaCl/20% PEG 8000
  • the microtitre plate was placed on a magnet for 2 min and the beads washed twice with 150 ⁇ l of 70% EtOH. The beads were air dried for 2 min and resuspend in 20 ⁇ l of elution buffer (10 mM trisacetate, pH 7.8) and incubated at RT for 5 min. The beads were magnetically separated and the supernatant removed for testing and sequencing.
  • the purified PCR products were sequenced in both directions using the above PCR primer sets except where indicated below, with nucleotide positions of the primers referring to Fig. 1.
  • Reverse primer complement of 620-597 AACTACCTTGGTCTGTGCAACTCC (SEQ ID NO: 165)
  • Reverse primer complement of 1667-1644 TGACCACAGTCTACCAGCTATGGG (SEQ ID NO: 167)
  • Fragment 5 Forward primer 1683-1707 AAGACTATCTGCTCAGCACTTCTGG (SEQ ID NO: 170)
  • Reverse primer complement of 2241-2219 TGATGTTGACCAGCTCCTCAATG (SEQ ID NO: 171)
  • Reverse primer complement of 2442-2423 CATCCACAGTGCTGAGCCCCCCAGCCCAGC (SEQID NO: 173)
  • Reverse primer complement of 3805-3784 TATTCAGCCAGCTTCCCTTCAG (SEQ ID NO: 177)
  • Reverse primer complement of 4293-4274 CCCCTCCCTAACCCTCCTTC (SEQ ID NO: 179)
  • Example 2 This example illustrates analysis of the ILl 3 polymo ⁇ hisms identified in the Index Repositories IA and IB for human genotypes and haplotypes.
  • Genotype PO Lymor;phic Sites
  • haplotype pairs shown in Table 3 were estimated from the unphased genotypes using an extension of Clark's algorithm (Clark, A.G. (1990) Mol Bio Evol 1, 111-122), as described in U.S. Provisional Patent Application filed April 19, 2000 and entitled "A Method and System for Determining Haplotypes from a Collection of Polymo ⁇ hisms".
  • haplotypes are assigned directly from individuals who are homozygous at all sites or heterozygous at no more than one of the variable sites. This list of haplotypes is then used to deconvolute the unphased genotypes in the remaining (multiply heterozygous) individuals.
  • Haplotype Polymorph ic : Sites

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2000/026556 1999-09-28 2000-09-27 Drug target isogenes: polymorphisms in the interleukin 13 gene Ceased WO2001023410A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15648999P 1999-09-28 1999-09-28
US60/156,489 1999-09-28

Publications (2)

Publication Number Publication Date
WO2001023410A2 true WO2001023410A2 (en) 2001-04-05
WO2001023410A3 WO2001023410A3 (en) 2003-03-13

Family

ID=22559792

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/026556 Ceased WO2001023410A2 (en) 1999-09-28 2000-09-27 Drug target isogenes: polymorphisms in the interleukin 13 gene

Country Status (2)

Country Link
AU (1) AU2000278349A1 (https=)
WO (1) WO2001023410A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003016346A1 (fr) * 2001-08-17 2003-02-27 Hitachi Chemical Co., Ltd. Ligands
EP1405921A1 (en) * 2002-10-04 2004-04-07 Roche Diagnostics GmbH Detection of susceptibility to autoimmune diseases, especially type 1 diabetes
US7205106B1 (en) 2001-07-20 2007-04-17 Roche Molecular Systems, Inc. Association of polymorphisms in IL4-related genes with autoimmune disease
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US8323646B2 (en) 2008-08-20 2012-12-04 Centocor Ortho Biotech Inc. Engineered anti-IL-13 antibodies, compositions, methods and uses

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IE61148B1 (en) * 1988-03-10 1994-10-05 Ici Plc Method of detecting nucleotide sequences

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7205106B1 (en) 2001-07-20 2007-04-17 Roche Molecular Systems, Inc. Association of polymorphisms in IL4-related genes with autoimmune disease
WO2003016346A1 (fr) * 2001-08-17 2003-02-27 Hitachi Chemical Co., Ltd. Ligands
JPWO2003016346A1 (ja) * 2001-08-17 2004-12-02 日立化成工業株式会社 リガンド
EP1405921A1 (en) * 2002-10-04 2004-04-07 Roche Diagnostics GmbH Detection of susceptibility to autoimmune diseases, especially type 1 diabetes
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US8323646B2 (en) 2008-08-20 2012-12-04 Centocor Ortho Biotech Inc. Engineered anti-IL-13 antibodies, compositions, methods and uses
US8399630B2 (en) 2008-08-20 2013-03-19 Centocor Ortho Biotech Inc. Engineered anti-IL-13 antibodies, compositions, methods and uses

Also Published As

Publication number Publication date
AU2000278349A1 (en) 2001-04-30
WO2001023410A3 (en) 2003-03-13
AU2000278349A8 (https=) 2001-06-28

Similar Documents

Publication Publication Date Title
WO2001023410A2 (en) Drug target isogenes: polymorphisms in the interleukin 13 gene
WO2001007662A1 (en) Drug target isogenes: polymorphisms in the prostaglandin-endoperoxide synthase 2 gene
WO2001004270A1 (en) Drug target isogenes: polymorphisms in the interleukin 4 receptor alpha gene
WO2001005832A1 (en) Drug target isogenes: polymorphisms in the dopamine receptor d2 gene
WO2002012497A2 (en) Haplotypes of the nfkbib gene
WO2001027312A2 (en) Drug target isogenes: polymorphisms in the m1 muscarinic acetylcholine receptor gene
WO2001010884A1 (en) Drug target isogenes: polymorphisms in the 5-hydroxytryptamine receptor 1a gene
EP1208194A2 (en) Drug target isogenes: polymorphisms in the immunoglobulin e receptor i alpha subunit gene
WO2001029176A2 (en) Drug target isogenes: polymorphisms in the cholinergic receptor, muscarinic 3 gene
WO2001090127A2 (en) Haplotypes of the hoxd3 gene
WO2001079232A2 (en) Haplotypes of the mpl gene
WO2001014588A1 (en) Drug target isogenes: polymorphisms in the immunoglobulin e receptor beta chain gene
WO2002062820A2 (en) Haplotypes of the cyp27b1 gene
WO2002022888A1 (en) Haplotypes of the scya8 gene
WO2002032928A2 (en) Haplotypes of the hrh1 gene
WO2002050098A2 (en) Haplotypes of the prlr gene
WO2001027313A2 (en) Drug target isogenes: polymorphisms in the cholinergic receptor, muscarinic 2 gene
WO2002063045A1 (en) Drug target isogenes: polymorphisms in the angiotensin receptor 2 gene
WO2001027311A2 (en) Drug target isogenes: polymorphisms in the 5-hydroxytryptamine (serotonin) receptor 1d gene
WO2001018232A2 (en) Drug target isogenes: polymorphisms in the uncoupling protein 3 (mitochondrial, proton carrier) gene
WO2002012499A2 (en) Haplotypes of the ntf3 gene
WO2002026766A2 (en) Haplotypes of the sstr4 gene
WO2001087908A2 (en) Haplotypes of the ccr3 gene
WO2001090128A2 (en) Haplotypes of the gpr3 gene
WO2001087907A2 (en) Haplotypes of the osm gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: JP