WO2001027313A2 - Drug target isogenes: polymorphisms in the cholinergic receptor, muscarinic 2 gene - Google Patents

Abstract

Polynucleotides comprising 1 novel single nucleotide polymorphism in the human cholinergic receptor, muscarinic 2 (CHRM2) gene are described. Compositions and methods for detecting this polymorphism are also disclosed. In addition, various genotypes and haplotypes for the CHRM2 gene that exist in the population are described.

Description

POLYMORPHISMS IN THE CHOLINERGIC RECEPTOR, MUSCARINIC 2 GENE

RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Serial No. 60/159, 314 filed

October 14, 1999.

FIELD OF THE INVENTION

This invention relates to variation in genes that encode pharmaceutically important proteins. In particular, this invention provides genetic variants of the human cholinergic receptor, muscarinic 2 (CHRM2) gene and methods for identifying which variant(s) of this gene is/are possessed by an individual.

BACKGROUND OF THE INVENTION Current methods for identifying pharmaceuticals to treat disease often start by identifying, cloning, and expressing an important target protein related to the disease. A determination of whether an agonist or antagonist is needed to produce an effect that may benefit a patient with the disease is then made. Then, vast numbers of compounds are screened against the target protein to find new potential drugs. The desired outcome of this process is a drug that is specific for the target, thereby reducing the incidence of the undesired side effects usually caused by a compound's activity at non-intended targets.

What this approach fails to consider, however, is that natural variability exists in any and every population with respect to a particular protein. A target protein currently used to screen drugs typically is expressed by a gene cloned from an individual who was arbitrarily selected. However, the nucleotide sequence of a particular gene may vary tremendously among individuals. Subtle alteration(s) in the primary nucleotide sequence of a gene encoding a target protein may be manifested as significant variation in expression of or in the structure and/or function of the protein. Such alterations may explain the relatively high degree of uncertainty inherent in treatment of individuals with drugs whose design is based upon a single representative example of the target. For example, it is well-established that some classes of drugs frequently have lower efficacy in some individuals than others, which means such individuals and their physicians must weigh the possible benefit of a larger dosage against a greater risk of side effects. In addition, variable information on the biological function or effects of a particular protein may be due to different scientists unknowingly studying different isoforms of the gene encoding the protein. Thus, information on the type and frequency of genomic variation that exists for pharmaceutically important proteins would be useful. The organization of single nucleotide variations (polymorphisms) in the primary sequence of a gene into one of the limited number of combinations that exist as units of inheritance is termed a haplotype. Each haplotype therefore contains significantly more information than individual . the two chromosomes of an individual and can be used to identify and distinguish between isoforms of genes coding for drug targets.

It is well-established that many diseases are associated with specific variations in gene sequences. However while there are examples in which individual polymorphisms act as genetic markers for a particular phenotype, in other cases an individual polymorphism may be found in a variety of genomic backgrounds and therefore shows no definitive coupling between the polymorphism and the causative site for the phenotype (Clark AG et al. 1998 Am J Hum Genet 63:595-612; Ulbrecht M et al. 2000 Am JRespir Crit Care Med 161: 469-74). In addition, the marker may be predictive in some populations, but not in other populations (Clark AG et al. 1998 supra). In these instances, a haplotype will provide a superior genetic marker for the phenotype (Clark AG et al. 1998 supra; Ulbrecht M et al. 2000, supra; Ruaήo G & Stephens JC Gen EngNews 19 (21), December 1999). Analysis of the association between each observed haplotype and a particular phenotype permits ranking of each haplotype by its statistical power of prediction for the phenotype. Haplotypes found to be strongly associated with the phenotype can then have that positive association confirmed by alternative methods to minimize false positives. For a gene suspected to be associated with a particular phenotype, if no observed haplotypes for that gene show association with the phenotype of interest, then it may be inferred that variation in the gene has little, if any, involvement with that phenotype (Ruano & Stephens 1999, supra). Thus, information on the observed haplotypes and their frequency of occurrence in various population groups will be useful in a variety of research and clinical applications. One possible drug target for the treatment of Alzheimer's disease, Parkinson's disease, Chagas' disease and disorders involving smooth muscle activity is the cholinergic receptor, muscarinic 2 (CHRM2) gene or its encoded product. CHRM2 is one subtype of a heterogeneous family of five genetically distinct muscarinic acetylcholine receptors (mAChR) that play important roles in higher brain functions such as learning and memory (Levy, A.I., Proc. Natl. Acad. Sci. 93:13541-13546,

1996). Evidence has indicated that impaired cholinergic neurotransmission at mAChRs contributes to the dementia symptoms observed in Alzheimer's disease (Rodriguez-Puertas et al. 1997, Synapse, 26:341-50). CHRM2, also known as muscarinic 2 cholinergic receptor and Hm2, is an integral membrane protein that mediates various cellular responses, including inhibition of adenylate cyclase, breakdown of phosphoinositides and modulation of potassium channels through the action of G proteins. Desensitization of CHRM2 by autoantibodies may also play a role in the pathogenesis of cardioneuromyopathy in chronic Chagas' disease. Chagas' disease is associated with pathological changes of the cardiovascular, digestive, and autonomic nervous system, culminating in autonomic denervation and congestive heart failure (Leiros et al., J. Biol. Chem. 272: 12989-12993, 1997). CHRM2 has also been implicated in smooth muscle activity. CHRM2 is expressed in human corpus cavernosum smooth muscle cells, whose relaxation and contraction are essential for penile erection and detumescence. Smooth muscle activity is controlled locally by cholinergic, adrenergic and , . , et al. (Life Sci 1994;55(8):621-7) suggest that CHRM2 plays a role in smooth muscle contraction. In addition, CHRM2 has been found to be involved in smooth muscle activity of the human prostate (Obara et al. Urol Res 2000 Jun;28(3): 196-200). The cholinergic receptor, muscarinic 2 gene is located on chromosome 7q31-q35 and contains 1 exon that encodes a 466 amino acid protein. Reference sequences for the CHRM2 gene (GenBank Accession No: Ml 6404.1; SEQ ID NO:l), coding sequence, and protein are shown in Figures 1, 2 and 3, respectively.

Because of the potential for polymorphisms in the CHRM2 gene to affect the expression and function of the encoded protein, it would be useful to determine whether polymorphisms exist in the CHRM2 gene, as well as how such polymorphisms are combined in different copies of the gene. Such information would be useful for studying the biological function of CHRM2 as well as in identifying drugs targeting this protein for the treatment of disorders related to its abnormal expression or function.

SUMMARY OF THE INVENTION

Accordingly, the inventors herein have discovered 1 novel polymorphic site in the CHRM2 gene. This polymorphic site (PS) corresponds to the following nucleotide position in the indicated GenBank Accession Number: 1185 (PSl) in Ml 6404.1. The polymoφhism at this site is adenine or thymine at PS1. In addition, the inventors have determined the identity of the alternative nucleotide present at this site in a human reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: African descent, Asian, Caucasian and Hispanic/Latino. It is believed that CHRM2-encoding polynucleotides containing one or more of the novel polymorphic sites reported herein will be useful in studying the expression and biological function of CHRM2, as well as in developing drugs targeting this protein. In addition, information on the combinations of polymorphisms in the CHRM2 gene may have diagnostic and forensic applications. Thus, in one embodiment, the invention provides an isolated polynucleotide comprising a nucleotide sequence which is a polymorphic variant of a reference sequence for the CHRM2 gene or a fragment thereof. The reference sequence comprises SEQ ID NO: 1 and the polymorphic variant comprises thymine at PS 1. A particularly preferred polymorphic variant is a naturally-occurring isoform (also referred to herein as an "isogene") of the CHRM2 gene. A CHRM2 isogene of the invention comprises adenine or thymine at PS 1. The invention also provides a collection of CHRM2 isogenes, referred to herein as a CHRM2 genome anthology.

A CHRM2 isogene may be defined by the combination and order of these polymorphisms in the isogene, which is referred to herein as a CHRM2 haplotype. Thus, the invention also provides data on the number of different CHRM2 haplotypes found in the above four population groups. This haplotype data is useful in methods for deriving a CHRM2 haplotype from an individual's genotype for the CHRM2 gene and for determining an association between a CHRM2 haplotype and a particular ra .

In another embodiment, the invention provides a polynucleotide comprising a polymoφhic variant of a reference sequence for a CHRM2 cDNA or a fragment thereof. The reference sequence comprises SEQ ID NO:2 (Fig. 2) and the polymoφhic cDNA comprises thymine at a position corresponding to nucleotide 991.

Polynucleotides complementary to these CHRM2 genomic and cDNA variants are also provided by the invention.

In other embodiments, the invention provides a recombinant expression vector comprising one of the polymoφhic genomic variants operably linked to expression regulatory elements as well as a recombinant host cell transformed or transfected with the expression vector. The recombinant vector and host cell may be used to express CHRM2 for protein structure analysis and drug binding studies. In yet another embodiment, the invention provides a polypeptide comprising a polymoφhic variant of a reference amino acid sequence for the CHRM2 protein. The reference amino acid sequence comprises SEQ ID NO:3 (Fig. 3) and the polymoφhic variant comprises serine at a position corresponding to amino acid position 331. A polymoφhic variant of CHRM2 is useful in studying the effect of the variation on the biological activity of CHRM2 as well as on the binding affinity of candidate drugs targeting CHRM2 for the treatment of Alzheimer's disease, Parkinson's disease, Chagas' disease and disorders involving smooth muscle activity.

The present invention also provides antibodies that recognize and bind to the above polymoφhic CHRM2 protein variant. Such antibodies can be utilized in a variety of diagnostic and prognostic formats and therapeutic methods.

In other embodiments, the invention provides methods, compositions, and kits for haplotyping and or genotyping the CHRM2 gene in an individual. The methods involve identifying the nucleotide or nucleotide pair present at PS 1 in one or both copies of the CHRM2 gene from the individual. The compositions contain ohgonucleotide probes and primers designed to specifically hybridize to one or more target regions containing, or that are adjacent to, a polymoφhic site. The methods and compositions for establishing the genotype or haplotype of an individual at the novel polymoφhic sites described herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the CHRM2 genetic variation and a trait such as level of drug response or susceptibility to disease.

In yet another embodiment, the invention provides a method for identifying an association between a genotype or haplotype and a trait. In preferred embodiments, the trait is susceptibility to a disease, severity of a disease, the staging of a disease or response to a drug. Such methods have applicability in developing diagnostic tests and therapeutic treatments for Alzheimer's disease, Parkinson's disease, Chagas' disease and disorders involving smooth muscle activity.

The present invention also provides nonhuman transgenic animals comprising one of the . transgenic animals are useful for studying expression of the CHRM2 isogenes in vivo, for in vivo screening and testing of drugs targeted against CHRM2 protein, and for testing the efficacy of therapeutic agents and compounds for Alzheimer's disease, Parkinson's disease, Chagas' disease and disorders involving smooth muscle activity in a biological system.

The present invention also provides a computer system for storing and displaying polymoφhism data determined for the CHRM2 gene. The computer system comprises a computer processing unit; a display; and a database containing the polymoφhism data. The polymoφhism data includes the polymoφhisms, the genotypes and the haplotypes identified for the CHRM2 gene in a reference population. In a preferred embodiment, the computer system is capable of producing a display showing CHRM2 haplotypes organized according to their evolutionary relationships.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 illustrates a reference sequence for the CHRM2 gene (Genbank Version Number M16404.1; contiguous lines; SEQ ID NO:l), with the start and stop positions of each region of coding sequence indicated below the sequence by the numbers within the brackets and the polymoφhic sites and polymoφhism identified by Applicants in a reference population indicated by the variant nucleotide positioned below the polymoφhic site in the sequence.

Figure 2 illustrates a reference sequence for the CHRM2 coding sequence (contiguous lines; SEQ ID NO:2), with the polymoφhic site and polymoφhism identified by Applicants in a reference population indicated by the variant nucleotide positioned below the polymoφhic site in the sequence.

Figure 3 illustrates a reference sequence for the CHRM2 protein (contiguous lines; SEQ ID NO:3), with the variant amino acid caused by the polymoφhism of Fig. 2 positioned below the polymoφhic site in the sequence.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is based on the discovery of novel variants of the CHRM2 gene. As described in more detail below, the inventors herein discovered 1 novel polymoφhic site by characterizing the CHRM2 gene found in genomic DNAs isolated from an Index Repository that contains immortalized cell lines from one chimpanzee and 93 human individuals. The human individuals included a reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: Caucasian (22 individuals), African descent (20 individuals) Asian (20 individuals) Hispanic/Latino (17 individuals). To the extent possible, the members of this reference population were organized into population subgroups by the self-identified ethnogeographic origin of their four grandparents as shown in Table 1 below.

In addition, the Index Repository contains three unrelated indigenous American Indians (one from each of North, Central and South America), one three-generation Caucasian family (from the CEPH Utah cohort) and one two-generation African- American family.

Using the CHRM2 genotypes identified in the Index Repository and the methodology described in the Examples below, the inventors herein also determined the haplotypes found on each chromosome for most human members of this repository. The CHRM2 genotypes and haplotypes found in the repository include those shown in Tables 3 and 4, respectively. The polymoφhism and haplotype data disclosed herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the CHRM2 genetic variation and a trait such as level of drug response or susceptibility to disease.

In the context of this disclosure, the following terms shall be defined as follows unless otherwise indicated:

Allele - A particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence.

Candidate Gene - A gene which is hypothesized to be responsible for a disease, condition, or the response to a treatment, or to be correlated with one of these. Gene - A segment of DNA that contains all the information for the regulated biosynthesis of an expression.

Genotype - An unphased 5 ' to 3 ' sequence of nucleotide pair(s) found at one or more polymoφhic sites in a locus on a pair of homologous chromosomes in an individual. As used herein, genotype includes a full-genotype and/or a sub-genotype as described below.

Full-genotype - The unphased 5' to 3' sequence of nucleotide pairs found at all known polymoφhic sites in a locus on a pair of homologous chromosomes in a single individual.

Sub-genotype - The unphased 5 ' to 3 ' sequence of nucleotides seen at a subset of the known polymoφhic sites in a locus on a pair of homologous chromosomes in a single individual. Genotyping - A process for determining a genotype of an individual.

Haplotype - A 5 ' to 3 ' sequence of nucleotides found at one or more polymoφhic sites in a locus on a single chromosome from a single individual. As used herein, haplotype includes a full- haplotype and/or a sub-haplotype as described below.

Full-haplotype - The 5' to 3' sequence of nucleotides found at all known polymoφhic sites in a locus on a single chromosome from a single individual.

Sub-haplotype - The 5' to 3' sequence of nucleotides seen at a subset of the known polymoφhic sites in a locus on a single chromosome from a single individual.

Haplotype pair - The two haplotypes found for a locus in a single individual.

Haplotyping - A process for determining one or more haplotypes in an individual and includes use of family pedigrees, molecular techniques and/or statistical inference.

Haplotype data - Information concerning one or more of the following for a specific gene: a listing of the haplotype pairs in each individual in a population; a listing of the different haplotypes in a population; frequency of each haplotype in that or other populations, and any known associations between one or more haplotypes and a trait. Isoform - A particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/or structure.

Isogene - One of the isoforms of a gene found in a population. An isogene contains all of the polymoφhisms present in the particular isoform of the gene.

Isolated - As applied to a biological molecule such as RNA, DNA, ohgonucleotide, or protein, isolated means the molecule is substantially free of other biological molecules such as nucleic acids, proteins, lipids, carbohydrates, or other material such as cellular debris and growth media. Generally, the term "isolated" is not intended to refer to a complete absence of such material or to absence of water, buffers, or salts, unless they are present in amounts that substantially interfere with the methods of the present invention. Locus - A location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature.

Naturally-occurring - A term used to designate that the object it is applied to, e.g., naturally- intentionally modified by man.

Nucleotide pair - The nucleotides found at a polymoφhic site on the two copies of a chromosome from an individual. Phased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, phased means the combination of nucleotides present at those polymoφhic sites on a single copy of the locus is known.

Polymorphic site (PS) - A position within a locus at which at least two alternative sequences are found in a population, the most frequent of which has a frequency of no more than 99%. Polymorphic variant - A gene, mRNA, cDNA, polypeptide or peptide whose nucleotide or amino acid sequence varies from a reference sequence due to the presence of a polymoφhism in the gene.

Polymorphism - The sequence variation observed in an individual at a polymoφhic site. Polymoφhisms include nucleotide substitutions, insertions, deletions and microsatellites and may, but need not, result in detectable differences in gene expression or protein function.

Polymorphism data - Information concerning one or more of the following for a specific gene: location of polymoφhic sites; sequence variation at those sites; frequency of polymoφhisms in one or more populations; the different genotypes and/or haplotypes determined for the gene; frequency of one or more of these genotypes and/or haplotypes in one or more populations; any known association(s) between a trait and a genotype or a haplotype for the gene.

Polymorphism Database - A collection of polymoφhism data arranged in a systematic or methodical way and capable of being individually accessed by electronic or other means.

Polynucleotide - A nucleic acid molecule comprised of single-stranded RNA or DNA or comprised of complementary, double-stranded DNA. Population Group - A group of individuals sharing a common ethnogeographic origin.

Reference Population - A group of subjects or individuals who are predicted to be representative of the genetic variation found in the general population. Typically, the reference population represents the genetic variation in the population at a certainty level of at least 85%, preferably at least 90%, more preferably at least 95% and even more preferably at least 99%. Single Nucleotide Polymorphism (SNP) - Typically, the specific pair of nucleotides observed at a single polymoφhic site. In rare cases, three or four nucleotides may be found.

Subject - A human individual whose genotypes or haplotypes or response to treatment or disease state are to be determined.

Treatment - A stimulus administered internally or externally to a subject. Unphased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, unphased means the combination of nucleotides present at those polymoφhic sites on a single copy of the locus is not known. polymoφhic site identified by the inventors is referred to as PS1.

Thus, in one embodiment, the invention provides an isolated polynucleotide comprising a polymoφhic variant of the CHRM2 gene or a fragment of the gene which contains the novel polymoφhic site described herein. The nucleotide sequence of a variant CHRM2 gene is identical to the reference genomic sequence for those portions of the gene examined, as described in the Examples below, except that it comprises a different nucleotide at the novel polymoφhic site PS 1. Similarly, the nucleotide sequence of a variant fragment of the CHRM2 gene is identical to the corresponding portion of the reference sequence except for having a different nucleotide at the novel polymoφhic site described herein. Thus, the invention specifically does not include polynucleotides comprising a nucleotide sequence identical to the reference sequence (or other reported CHRM2 sequences) or to portions of the reference sequence (or other reported CHRM2 sequences), except for genotyping oligonucleotides as described below.

The location of a polymoφhism in a variant gene or fragment is identified by aligning its sequence against SEQ ID NO: 1. The polymoφhism comprises thymine at PS 1. In a preferred embodiment, the polymoφhic variant comprises a naturally-occurring isogene of the CHRM2 gene which is defined by any one of haplotypes 1-2 shown in Table 4 below.

Polymoφhic variants of the invention may be prepared by isolating a clone containing the CHRM2 gene from a human genomic library. The clone may be sequenced to determine the identity of the nucleotides at the polymoφhic sites described herein. Any particular variant claimed herein could be prepared from this clone by performing in vitro mutagenesis using procedures well-known in the art. CHRM2 isogenes may be isolated using any method that allows separation of the two "copies" of the CHRM2 gene present in an individual, which, as readily understood by the skilled artisan, may be the same allele or different alleles. Separation methods include targeted in vivo cloning (TIVC) in yeast as described in WO 98/01573, U.S. Patent No. 5,866,404, and U.S. Patent No. 5,972,614. Another method, which is described in U.S. Patent No. 5,972,614, uses an allele specific ohgonucleotide in combination with primer extension and exonuclease degradation to generate hemizygous DNA targets. Yet other methods are single molecule dilution (SMD) as described in Ruano et al., Proc. Natl. Acad. Sci. 87:6296-6300, 1990; and allele specific PCR (Ruano et al., 17 Nucleic Acids. Res. 8392, 1989; Ruano et al., 19 Nucleic Acids Res. 6877-6882, 1991; Michalatos- Beloin et al, 24 Nucleic Acids Res. 4841-4843, 1996).

The invention also provides CHRM2 genome anthologies, which are collections of CHRM2 isogenes found in a given population. The population may be any group of at least two individuals, including but not limited to a reference population, a population group, a family population, a clinical population, and a same sex population. A CHRM2 genome anthology may comprise individual

CHRM2 isogenes stored in separate containers such as microtest tubes, separate wells of a microtitre plate and the like. Alternatively, two or more groups of the CHRM2 isogenes in the anthology may be . stored in any convenient and stable form, including but not limited to in buffered solutions, as DNA precipitates, freeze-dried preparations and the like. A preferred CHRM2 genome anthology of the invention comprises a set of isogenes defined by the haplotypes shown in Table 4 below. An isolated polynucleotide containing a polymoφhic variant nucleotide sequence of the invention may be operably linked to one or more expression regulatory elements in a recombinant expression vector capable of being propagated and expressing the encoded CHRM2 protein in a prokaryotic or a eukaryotic host cell. Examples of expression regulatory elements which may be used include, but are not limited to, the lac system, operator and promoter regions of phage lambda, yeast promoters, and promoters derived from vaccinia virus, adenovirus, retroviruses, or SV40. Other regulatory elements include, but are not limited to, appropriate leader sequences, termination codons, polyadenylation signals, and other sequences required for the appropriate transcription and subsequent translation of the nucleic acid sequence in a given host cell. Of course, the correct combinations of expression regulatory elements will depend on the host system used. In addition, it is understood that the expression vector contains any additional elements necessary for its transfer to and subsequent replication in the host cell. Examples of such elements include, but are not limited to, origins of replication and selectable markers. Such expression vectors are commercially available or are readily constructed using methods known to those in the art (e.g., F. Ausubel et al, 1987, in "Current Protocols in Molecular Biology", John Wiley and Sons, New York, New York). Host cells which may be used to express the variant CHRM2 sequences of the invention include, but are not limited to, eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells as known in the art. The recombinant expression vector may be introduced into the host cell using any method known to those in the art including, but not limited to, microinjection, electroporation, particle bombardment, transduction, and transfection using DEAE-dextran, lipofection, or calcium phosphate (see e.g., Sambrook et al. (1989) in "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor Press, Plainview, New York). In a preferred aspect, eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells, are used. Non-limiting examples of such vectors include vaccinia virus vectors, adenovirus vectors, heφes virus vectors, and baculovirus transfer vectors. Preferred eukaryotic cell lines include COS cells, CHO cells, HeLa cells, NIH/3T3 cells, and embryonic stem cells (Thomson, J. A. et al., 1998 Science 282: 1145-1147). Particularly preferred host cells are mammalian cells.

As will be readily recognized by the skilled artisan, expression of polymoφhic variants of the CHRM2 gene will produce CHRM2 mRNAs varying from each other at any polymoφhic site retained in the spliced and processed mRNA molecules. These mRNAs can be used for the preparation of a CHRM2 cDNA comprising a nucleotide sequence which is a polymoφhic variant of the CHRM2 reference coding sequence shown in Figure 2. Thus, the invention also provides CHRM2 mRNAs and corresponding cDNAs which comprise a nucleotide sequence that is identical to SEQ ID NO:2 (Fig. 2), corresponding to nucleotide 991. Fragments of these variant mRNAs and cDNAs are included in the scope of the invention, provided they contain the novel polymoφhism described herein. The invention specifically excludes polynucleotides identical to previously identified and characterized CHRM2 cDNAs and fragments thereof. Polynucleotides comprising a variant RNA or DNA sequence may be isolated from a biological sample using well-known molecular biological procedures or may be chemically synthesized.

Polymoφhic variants of fragments according to the invention comprise at least one novel polymoφhism identified herein and have a length of at least 10 nucleotides and may range up to the full length of the gene. Preferably, such fragments are between 100 and 3000 nucleotides in length, and more preferably between 200 and 2000 nucleotides in length, and most preferably between 500 and 1000 nucleotides in length.

In describing the polymoφhic sites identified herein, reference is made to the sense strand of the gene for convenience. However, as recognized by the skilled artisan, nucleic acid molecules containing the CHRM2 gene may be complementary double stranded molecules and thus reference to a particular site on the sense strand refers as well to the corresponding site on the complementary antisense strand. Thus, reference may be made to the same polymoφhic site on either strand and an ohgonucleotide may be designed to hybridize specifically to either strand at a target region containing the polymoφhic site. Thus, the invention also includes single-stranded polynucleotides which are complementary to the sense strand of the CHRM2 genomic variants described herein.

Polynucleotides comprising a polymoφhic gene variant or fragment may be useful for therapeutic puφoses. For example, where a patient could benefit from expression, or increased expression, of a particular CHRM2 protein isoform, an expression vector encoding the isoform may be administered to the patient. The patient may be one who lacks the CHRM2 isogene encoding that isoform or may already have at least one copy of that isogene.

In other situations, it may be desirable to decrease or block expression of a particular CHRM2 isogene. Expression of a CHRM2 isogene may be turned off by transforming a targeted organ, tissue or cell population with an expression vector that expresses high levels of untranslatable mRNA for the isogene. Alternatively, oligonucleotides directed against the regulatory regions (e.g., promoter, introns, enhancers, 3' untranslated region) of the isogene may block transcription. Oligonucleotides targeting the transcription initiation site, e.g., between positions -10 and +10 from the start site are preferred. Similarly, inhibition of transcription can be achieved using oligonucleotides that base-pair with region(s) of the isogene DNA to form triplex DNA (see e.g., Gee et al. in Huber, B.E. and B.I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co., Mt. Kisco, N.Y., 1994). Antisense oligonucleotides may also be designed to block translation of CHRM2 mRNA transcribed from a particular isogene. It is also contemplated that ribozymes may be designed that can catalyze the specific cleavage of CHRM2 mRNA transcribed from a particular isogene. o gonu introduced into the cell or tissue in vivo or ex vivo. Alternatively, the oligonucleotides may be formulated as a pharmaceutical composition for administration to the patient. Oligoribonucleotides and/or oligodeoxynucleotides intended for use as antisense oligonucleotides may be modified to increase stability and half-life. Possible modifications include, but are not limited to phosphorothioate or 2' O-methyl linkages, and the inclusion of nontraditional bases such as inosine and queosine, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytosine, guanine, thymine, and uracil which are not as easily recognized by endogenous nucleases.

The invention also provides an isolated polypeptide comprising a polymoφhic variant of the reference CHRM2 amino acid sequence shown in Figure 3. The location of a variant amino acid in a CHRM2 polypeptide or fragment of the invention is identified by aligning its sequence against SEQ ID NO:3 (Fig. 3). A CHRM2 protein variant of the invention comprises an amino acid sequence identical to SEQ ID NO: 3 except for having serine at a position corresponding to amino acid position 331. The invention specifically excludes amino acid sequences identical to those previously identified for CHRM2, including SEQ ID NO: 3, and previously described fragments thereof. CHRM2 protein variants included within the invention comprise all amino acid sequences based on SEQ ID NO: 3 and having serine at a position corresponding to amino acid position 331.

The invention also includes CHRM2 peptide variants, which are any fragments of a CHRM2 protein variant that contains serine at a position corresponding to amino acid position 331. A CHRM2 peptide variant is at least 6 amino acids in length and is preferably any number between 6 and 30 amino acids long, more preferably between 10 and 25, and most preferably between 15 and 20 amino acids long. Such CHRM2 peptide variants may be useful as antigens to generate antibodies specific for one of the above CHRM2 isoforms. In addition, the CHRM2 peptide variants may be useful in drug screening assays. A CHRM2 variant protein or peptide of the invention may be prepared by chemical synthesis or by expressing one of the variant CHRM2 genomic and cDNA sequences as described above. Alternatively, the CHRM2 protein variant may be isolated from a biological sample of an individual having a CHRM2 isogene which encodes the variant protein. Where the sample contains two different CHRM2 isoforms (i.e., the individual has different CHRM2 isogenes), a particular CHRM2 isoform of the invention can be isolated by immunoaffinity chromatography using an antibody which specifically binds to that particular CHRM2 isoform but does not bind to the other CHRM2 isoform.

The expressed or isolated CHRM2 protein may be detected by methods known in the art, including Coomassie blue staining, silver staining, and Western blot analysis using antibodies specific for the isoform of the CHRM2 protein as discussed further below. CHRM2 variant proteins can be purified by standard protein purification procedures known in the art, including differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelectric focusing, gel electrophoresis, affinity and immunoaffinity chromatography and the like. (Ausubel et. al., 1987, In immunoaffinity chromatography, antibodies specific for a particular polymoφhic variant may be used.

A polymoφhic variant CHRM2 gene of the invention may also be fused in frame with a heterologous sequence to encode a chimeric CHRM2 protein. The non-CHRM2 portion of the chimeric protein may be recognized by a commercially available antibody. In addition, the chimeric protein may also be engineered to contain a cleavage site located between the CHRM2 and non-CHRM2 portions so that the CHRM2 protein may be cleaved and purified away from the non-CHRM2 portion.

An additional embodiment of the invention relates to using a novel CHRM2 protein isoform in any of a variety of drug screening assays. Such screening assays may be performed to identify agents that bind specifically to all known CHRM2 protein isoforms or to only a subset of one or more of these isoforms. The agents may be from chemical compound libraries, peptide libraries and the like. The CHRM2 protein or peptide variant may be free in solution or affixed to a solid support. In one embodiment, high throughput screening of compounds for binding to a CHRM2 variant may be accomplished using the method described in PCT application WO 84/03565, in which large numbers of test compounds are synthesized on a solid substrate, such as plastic pins or some other surface, contacted with the CHRM2 protein(s) of interest and then washed. Bound CHRM2 protein(s) are then detected using methods well-known in the art.

In another embodiment, a novel CHRM2 protein isoform may be used in assays to measure the binding affinities of one or more candidate drugs targeting the CHRM2 protein. In another embodiment, the invention provides antibodies specific for and immunoreactive with one or more of the novel CHRM2 variant proteins described herein. The antibodies may be either monoclonal or polyclonal in origin. The CHRM2 protein or peptide variant used to generate the antibodies may be from natural or recombinant sources or produced by chemical synthesis using synthesis techniques known in the art. If the CHRM2 protein variant is of insufficient size to be antigenic, it may be conjugated, complexed, or otherwise covalently linked to a carrier molecule to enhance the antigenicity of the peptide. Examples of carrier molecules, include, but are not limited to, albumins (e.g., human, bovine, fish, ovine), and keyhole limpet hemocyanin (Basic and Clinical Immunology, 1991, Eds. D.P. Stites, and A.I. Terr, Appleton and Lange, Norwalk Connecticut, San Mateo, California). In one embodiment, an antibody specifically immunoreactive with one of the novel CHRM2 protein isoforms described herein is administered to an individual to neutralize activity of the CHRM2 isoform expressed by that individual. The antibody may be formulated as a pharmaceutical composition which includes a pharmaceutically acceptable carrier.

Antibodies specific for and immunoreactive with one of the novel CHRM2 protein isoform described herein may be used to immunoprecipitate the CHRM2 protein variant from solution as well as react with CHRM2 protein isoforms on Western or immunoblots of polyacrylamide gels on membrane supports or substrates. In another preferred embodiment, the antibodies will detect CHRM2 protein , on slides, coverslips, or the like, for use in immunocytochemical, immunohistochemical, and immunofluorescence techniques.

In another embodiment, an antibody specifically immunoreactive with one of the novel CHRM2 protein variants described herein is used in immunoassays to detect this variant in biological samples. In this method, an antibody of the present invention is contacted with a biological sample and the formation of a complex between the CHRM2 protein variant and the antibody is detected. As described, suitable immunoassays include radioimmunoassay, Western blot assay, immunofluorescent assay, enzyme linked immunoassay (ELISA), chemiluminescent assay, immunohistochemical assay, immunocytochemical assay, and the like (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Christopher P. Price and David J. Neoman, Stockton Press, New York, New York; Current Protocols in Molecular Biology, 1987, Eds. Ausubel et al., John Wiley and Sons, New York, New York). Standard techniques known in the art for ELISA are described in Methods in Immunodiagnosis, 2nd Ed., Eds. Rose and Bigazzi, John Wiley and Sons, New York 1980; and Campbell et al., 1984, Methods in Immunology, W.A. Benjamin, Inc.). Such assays may be direct, indirect, competitive, or noncompetitive as described in the art (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Christopher P. Price and David J. Neoman, Stockton Pres, NY, NY; and Oellirich, M., 1984, J. Clin. Chem. Clin. Biochem., 22:895-904). Proteins may be isolated from test specimens and biological samples by conventional methods, as described in Current Protocols in Molecular Biology, supra. Exemplary antibody molecules for use in the detection and therapy methods of the present invention are intact immunoglobulin molecules, substantially intact immunoglobulin molecules, or those portions of immunoglobulin molecules that contain the antigen binding site. Polyclonal or monoclonal antibodies may be produced by methods conventionally known in the art (e.g., Kohler and Milstein, 1975, Nature, 256:495-497; Campbell Monoclonal Antibody Technology, the Production and Characterization of Rodent and Human Hybridomas, 1985, In: Laboratory Techniques in Biochemistry and Molecular Biology, Eds. Burdon et al., Volume 13, Elsevier Science Publishers, Amsterdam). The antibodies or antigen binding fragments thereof may also be produced by genetic engineering. The technology for expression of both heavy and light chain genes in E. coli is the subject of PCT patent applications, publication number WO 901443, WO 901443 and WO 9014424 and in Huse et al., 1989, Science, 246: 1275-1281. The antibodies may also be humanized (e.g., Queen, C. et al. 1989 Proc. Natl. Acad. Sci. 86; 10029).

Effect(s) of the polymoφhisms identified herein on expression of CHRM2 may be investigated by preparing recombinant cells and/or nonhuman recombinant organisms, preferably recombinant animals, containing a polymoφhic variant of the CHRM2 gene. As used herein, "expression" includes but is not limited to one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into CHRM2 protein (including codon usage and tRNA availability); , expression and function.

To prepare a recombinant cell of the invention, the desired CHRM2 isogene may be introduced into the cell in a vector such that the isogene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. In a preferred embodiment, the

CHRM2 isogene is introduced into a cell in such a way that it recombines with the endogenous CHRM2 gene present in the cell. Such recombination requires the occurrence of a double recombination event, thereby resulting in the desired CHRM2 gene polymoφhism. Vectors for the introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector or vector construct may be used in the invention. Methods such as electroporation, particle bombardment, calcium phosphate co-precipitation and viral transduction for introducing DNA into cells are known in the art; therefore, the choice of method may lie with the competence and preference of the skilled practitioner. Examples of cells into which the CHRM2 isogene may be introduced include, but are not limited to, continuous culture cells, such as COS, NIH/3T3, and primary or culture cells of the relevant tissue type, i.e., they express the CHRM2 isogene. Such recombinant cells can be used to compare the biological activities of the different protein variants.

Recombinant nonhuman organisms, i.e., transgenic animals, expressing a variant CHRM2 gene are prepared using standard procedures known in the art. Preferably, a construct comprising the variant gene is introduced into a nonhuman animal or an ancestor of the animal at an embryonic stage, i.e., the one-cell stage, or generally not later than about the eight-cell stage. Transgenic animals carrying the constructs of the invention can be made by several methods known to those having skill in the art. One method involves transfecting into the embryo a retrovirus constructed to contain one or more insulator elements, a gene or genes of interest, and other components known to those skilled in the art to provide a complete shuttle vector harboring the insulated gene(s) as a transgene, see e.g., U.S. Patent No. 5,610,053. Another method involves directly injecting a transgene into the embryo. A third method involves the use of embryonic stem cells. Examples of animals into which the CHRM2 isogenes may be introduced include, but are not limited to, mice, rats, other rodents, and nonhuman primates (see "The Introduction of Foreign Genes into Mice" and the cited references therein, In: Recombinant DNA, Eds. J.D. Watson, M. Gilman, J. Witkowski, and M. Zoller; W.H. Freeman and Company, New York, pages 254-272). Transgenic animals stably expressing a human CHRM2 isogene and producing human CHRM2 protein can be used as biological models for studying diseases related to abnormal CHRM2 expression and/or activity, and for screening and assaying various candidate drugs, compounds, and treatment regimens to reduce the symptoms or effects of these diseases.

An additional embodiment of the invention relates to pharmaceutical compositions for treating disorders affected by expression or function of a novel CHRM2 isogene described herein. The pharmaceutical composition may comprise any of the following active ingredients: a polynucleotide comprising one of these novel CHRM2 isogenes; an antisense ohgonucleotide directed against one of the novel CHRM2 isogenes, a polynucleotide encoding such an antisense ohgonucleotide, or another compound which inhibits expression of a novel CHRM2 isogene described herein. Preferably, the composition contains the active ingredient in a therapeutically effective amount. By therapeutically effective amount is meant that one or more of the symptoms relating to disorders affected by expression or function of a novel CHRM2 isogene is reduced and/or eliminated. The composition also comprises a pharmaceutically acceptable carrier, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water. Those skilled in the art may employ a formulation most suitable for the active ingredient, whether it is a polynucleotide, ohgonucleotide, protein, peptide or small molecule antagonist. The pharmaceutical composition may be administered alone or in combination with at least one other agent, such as a stabilizing compound. Administration of the pharmaceutical composition may be by any number of routes including, but not limited to oral, intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, intraventricular, intradermal, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA).

For any composition, determination of the therapeutically effective dose of active ingredient and/or the appropriate route of administration is well within the capability of those skilled in the art. For example, the dose can be estimated initially either in cell culture assays or in animal models. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. The exact dosage will be determined by the practitioner, in light of factors relating to the patient requiring treatment, including but not limited to severity of the disease state, general health, age, weight and gender of the patient, diet, time and frequency of administration, other drugs being taken by the patient, and tolerance/response to the treatment. Information on the identity of genotypes and haplotypes for the CHRM2 gene of any particular individual as well as the frequency of such genotypes and haplotypes in any particular population of individuals is expected to be useful for a variety of basic research and clinical applications. Thus, the invention also provides compositions and methods for detecting the novel CHRM2 polymoφhisms identified herein. The compositions comprise at least one CHRM2 genotyping ohgonucleotide. In one embodiment, a CHRM2 genotyping ohgonucleotide is a probe or primer capable of hybridizing to a target region that is located close to, or that contains, one of the novel polymoφhic sites described herein. As used herein, the term "ohgonucleotide" refers to a polynucleotide molecule having less than about 100 nucleotides. A preferred ohgonucleotide of the invention is 10 to 35 nucleotides long. More preferably, the ohgonucleotide is between 15 and 30, and most preferably, between 20 and 25 nucleotides in length. The ohgonucleotide may be comprised of any phosphorylation state of ribonucleotides, deoxyribonucleotides, and acyclic nucleotide derivatives, and other functionally . , , may be comprised of linkages such as carboxymethyl, acetamidate, carbamate, polyamide (peptide nucleic acid (PNA)) and the like (Varma, R. in Molecular Biology and Biotechnology, A Comprehensive Desk Reference, Ed. R. Meyers, VCH Publishers, Inc. (1995), pages 617-620). Oligonucleotides of the invention may be prepared by chemical synthesis using any suitable methodology known in the art, or may be derived from a biological sample, for example, by restriction digestion. The oligonucleotides may be labeled, according to any technique known in the art, including use of radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like. Genotyping oligonucleotides of the invention must be capable of specifically hybridizing to a target region of a CHRM2 polynucleotide, i.e., a CHRM2 isogene. As used herein, specific hybridization means the ohgonucleotide forms an anti-parallel double-stranded structure with the target region under certain hybridizing conditions, while failing to form such a structure when incubated with a non-target region or a non-CHRM2 polynucleotide under the same hybridizing conditions. Preferably, the ohgonucleotide specifically hybridizes to the target region under conventional high stringency conditions. The skilled artisan can readily design and test ohgonucleotide probes and primers suitable for detecting polymoφhisms in the CHRM2 gene using the polymoφhism information provided herein in conjunction with the known sequence information for the CHRM2 gene and routine techniques. A nucleic acid molecule such as an ohgonucleotide or polynucleotide is said to be a "perfect" or

"complete" complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the corresponding position of the other molecule. A nucleic acid molecule is "substantially complementary" to another molecule if it hybridizes to that molecule with sufficient stability to remain in a duplex form under conventional low-stringency conditions. Conventional hybridization conditions are described, for example, by Sambrook J. et al., in Molecular Cloning, A Laboratory Manual, 2^nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) and by Haymes, B.D. et al. in Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). While perfectly complementary oligonucleotides are preferred for detecting polymoφhisms, departures from complete complementarity are contemplated where such departures do not prevent the molecule from specifically hybridizing to the target region. For example, an ohgonucleotide primer may have a non-complementary fragment at its 5 ' end, with the remainder of the primer being complementary to the target region. Alternatively, non-complementary nucleotides may be interspersed into the oligonucleotide probe or primer as long as the resulting probe or primer is still capable of specifically hybridizing to the target region. Preferred genotyping oligonucleotides of the invention are allele-specifϊc oligonucleotides. As used herein, the term allele-specific oligonucleotide (ASO) means an oligonucleotide that is able, under sufficiently stringent conditions, to hybridize specifically to one allele of a gene, or other locus, at a target reg on con a n ng a po ymoφ c s e w e no y z ng o e correspon ng reg on n anot er allele(s). As understood by the skilled artisan, allele-specificity will depend upon a variety of readily optimized stringency conditions, including salt and formamide concentrations, as well as temperatures for both the hybridization and washing steps. Examples of hybridization and washing conditions typically used for ASO probes are found in Kogan et al., "Genetic Prediction of Hemophilia A" in PCR Protocols, A Guide to Methods and Applications, Academic Press, 1990 and Ruano et al., 87 Proc. Natl. Acad. Sci. USA 6296-6300, 1990. Typically, an allele-specific oligonucleotide will be perfectly complementary to one allele while containing a single mismatch for another allele.

Allele-specifϊc oligonucleotide probes which usually provide good discrimination between different alleles are those in which a central position of the oligonucleotide probe aligns with the polymoφhic site in the target region (e.g., approximately the 7^th or 8^th position in a 15 mer, the 8^th or 9^th position in a 16mer, the 10^th or 11^th position in a 20 mer). A preferred ASO probe for detecting CHRM2 gene polymoφhisms comprises a nucleotide sequence, listed 5' to 3', selected from the group consisting of: Accession No.: M16404.1

CACCAAGACCCCAAA (SEQ ID NO: 4) and its complement, and CACCAAGTCCCCAAA (SEQ ID NO: 5) and its complement.

An allele-specific oligonucleotide primer of the invention has a 3 ' terminal nucleotide, or preferably a 3' penultimate nucleotide, that is complementary to only one nucleotide of a particular

SNP, thereby acting as a primer for polymerase-mediated extension only if the allele containing that nucleotide is present. Allele-specific oligonucleotide primers hybridizing to either the coding or noncoding strand are contemplated by the invention. A preferred ASO primer for detecting CHRM2 gene polymoφhisms comprises a nucleotide sequence, listed 5' to 3', selected from the group consisting of:

Accession No . : M16404 . 1 AATTGGCACCAAGAC (SEQ ID NO:6); TCACTTTTTGGGGTC (SEQ ID NO:7);

AATTGGCACCAAGTC (SEQ ID NO : 8 ) ; and TCACTTTTTGGGGAC (SEQ ID NO:9).

Other genotyping oligonucleotides of the invention hybridize to a target region located one to several nucleotides downstream of one of the novel polymoφhic sites identified herein. Such oligonucleotides are useful in polymerase-mediated primer extension methods for detecting one of the novel polymoφhisms described herein and therefore such genotyping oligonucleotides are referred to herein as "primer-extension oligonucleotides". In a preferred embodiment, the 3 '-terminus of a primer- extension oligonucleotide is a deoxynucleotide complementary to the nucleotide located immediately adjacent to the polymoφhic site. A particularly preferred oligonucleotide primer for detecting CHRM2 gene polymoφhisms by primer extension terminates in a nucleotide sequence, listed 5' to 3', selected from the group cons st ng o :

Accession No . : M16404 . 1

TGGCACCAAG (SEQ ID NO:10);and CTTTTTGGGG (SEQ ID NO:ll).

In some embodiments, a composition contains two or more differently labeled genotyping oligonucleotides for simultaneously probing the identity of nucleotides at two or more polymoφhic sites. It is also contemplated that primer compositions may contain two or more sets of allele-specific primer pairs to allow simultaneous targeting and amplification of two or more regions containing a polymoφhic site.

CHRM2 genotyping oligonucleotides of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e.g., WO 98/20020 and WO 98/20019). Such immobilized genotyping oligonucleotides may be used in a variety of polymoφhism detection assays, including but not limited to probe hybridization and polymerase extension assays. Immobilized CHRM2 genotyping oligonucleotides of the invention may comprise an ordered array of oligonucleotides designed to rapidly screen a DNA sample for polymoφhisms in multiple genes at the same time.

In another embodiment, the invention provides a kit comprising at least two genotyping oligonucleotides packaged in separate containers. The kit may also contain other components such as hybridization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container. Alternatively, where the oligonucleotides are to be used to amplify a target region, the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for primer extension mediated by the polymerase, such as PCR.

The above described oligonucleotide compositions and kits are useful in methods for genotyping and or haplotyping the CHRM2 gene in an individual. As used herein, the terms "CHRM2 genotype" and "CHRM2 haplotype" mean the genotype or haplotype contains the nucleotide pair or nucleotide, respectively, that is present at one or more of the novel polymoφhic sites described herein and may optionally also include the nucleotide pair or nucleotide present at one or more additional polymoφhic sites in the CHRM2 gene. The additional polymoφhic sites may be currently known polymoφhic sites or sites that are subsequently discovered.

One embodiment of the genotyping method involves isolating from the individual a nucleic acid mixture comprising the two copies of the CHRM2 gene, or a fragment thereof, that are present in the individual, and determining the identity of the nucleotide pair at PS1 in the two copies to assign a CHRM2 genotype to the individual. As will be readily understood by the skilled artisan, the two "copies" of a gene in an individual may be the same allele or may be different alleles. In a particularly preferred embodiment, the genotyping method comprises determining the identity of the nucleotide pair at PSl.

Typically, the nucleic acid mixture is isolated from a biological sample taken from the semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair. The nucleic acid mixture may be comprised of genomic DNA, mRNA, or cDNA and, in the latter two cases, the biological sample must be obtained from an organ in which the CHRM2 gene is expressed. Furthermore it will be understood by the skilled artisan that mRNA or cDNA preparations would not be used to detect polymoφhisms located in introns or in 5 ' and 3 ' nontranscribed regions. If a CHRM2 gene fragment is isolated, it must contain the polymoφhic site(s) to be genotyped.

One embodiment of the haplotyping method comprises isolating from the individual a nucleic acid molecule containing only one of the two copies of the CHRM2 gene, or a fragment thereof, that is present in the individual and determining in that copy the identity of the nucleotide at PSl in that copy to assign a CHRM2 haplotype to the individual. The nucleic acid may be isolated using any method capable of separating the two copies of the CHRM2 gene or fragment such as one of the methods described above for preparing CHRM2 isogenes, with targeted in vivo cloning being the preferred approach. As will be readily appreciated by those skilled in the art, any individual clone will only provide haplotype information on one of the two CHRM2 gene copies present in an individual. If haplotype information is desired for the individual's other copy, additional CHRM2 clones will need to be examined. Typically, at least five clones should be examined to have more than a 90% probability of haplotyping both copies of the CHRM2 gene in an individual. In a particularly preferred embodiment, the nucleotide at PS 1 is identified. In a preferred embodiment, a CHRM2 haplotype pair is determined for an individual by identifying the phased sequence of nucleotides at PSl in each copy of the CHRM2 gene that is present in the individual. In a particularly preferred embodiment, the haplotyping method comprises identifying the phased sequence of nucleotides at each of PSl in each copy of the CHRM2 gene. When haplotyping both copies of the gene, the identifying step is preferably performed with each copy of the gene being placed in separate containers. However, it is also envisioned that if the two copies are labeled with different tags, or are otherwise separately distinguishable or identifiable, it could be possible in some cases to perform the method in the same container. For example, if first and second copies of the gene are labeled with different first and second fluorescent dyes, respectively, and an allele-specific oligonucleotide labeled with yet a third different fluorescent dye is used to assay the polymoφhic site(s), then detecting a combination of the first and third dyes would identify the polymoφhism in the first gene copy while detecting a combination of the second and third dyes would identify the polymoφhism in the second gene copy.

In both the genotyping and haplotyping methods, the identity of a nucleotide (or nucleotide pair) at a polymoφhic site(s) may be determined by amplifying a target region(s) containing the polymoφhic site(s) directly from one or both copies of the CHRM2 gene, or fragment thereof, and the sequence of the amplified region(s) determined by conventional methods. It will be readily appreciated by the skilled artisan that only one nucleotide will be detected at a polymoφhic site in individuals who , heterozygous for that site. The polymoφhism may be identified directly, known as positive-type identification, or by inference, referred to as negative-type identification. For example, where a SNP is known to be guanine and cytosine in a reference population, a site may be positively determined to be either guanine or cytosine for an individual homozygous at that site, or both guanine and cytosine, if the individual is heterozygous at that site. Alternatively, the site may be negatively determined to be not guanine (and thus cytosine/cytosine) or not cytosine (and thus guanine/guanine).

In addition, the identity of the allele(s) present at any of the novel polymoφhic sites described herein may be indirectly determined by genotyping a polymoφhic site not disclosed herein that is in linkage disequilibrium with the polymoφhic site that is of interest. Two sites are said to be in linkage disequilibrium if the presence of a particular variant at one site enhances the predictability of another variant at the second site (Stevens, JC 1999, Mol. Diag. 4: 309-17). Polymoφhic sites in linkage disequilibrium with the presently disclosed polymoφhic sites may be located in regions of the gene or in other genomic regions not examined herein. Genotyping of a polymoφhic site in linkage disequilibrium with the novel polymoφhic sites described herein may be performed by, but is not limited to, any of the above-mentioned methods for detecting the identity of the allele at a polymoφhic site.

The target region(s) may be amplified using any oligonucleotide-directed amplification method, including but not limited to polymerase chain reaction (PCR) (U.S. Patent No. 4,965,188), ligase chain reaction (LCR) (Barany et al., Proc. Natl. Acad. Sci. USA 88:189-193, 1991; WO90/01069), and oligonucleotide ligation assay (OLA) (Landegren et al., Science 241:1077-1080, 1988). Oligonucleotides useful as primers or probes in such methods should specifically hybridize to a region of the nucleic acid that contains or is adjacent to the polymoφhic site. Typically, the oligonucleotides are between 10 and 35 nucleotides in length and preferably, between 15 and 30 nucleotides in length. Most preferably, the oligonucleotides are 20 to 25 nucleotides long. The exact length of the oligonucleotide will depend on many factors that are routinely considered and practiced by the skilled artisan.

Other known nucleic acid amplification procedures may be used to amplify the target region including transcription-based amplification systems (U.S. Patent No. 5,130,238; EP 329,822; U.S. Patent No. 5,169,766, WO89/06700) and isothermal methods (Walker et al, Proc. Natl. Acad. Sci. USA 89:392-396, 1992).

A polymoφhism in the target region may also be assayed before or after amplification using one of several hybridization-based methods known in the art. Typically, allele-specific oligonucleotides are utilized in performing such methods. The allele-specific oligonucleotides may be used as differently labeled probe pairs, with one member of the pair showing a perfect match to one variant of a target sequence and the other member showing a perfect match to a different variant. In some embodiments, more than one polymoφhic site may be detected at once using a set of allele- spec ic o gonuc eot es or o gonuc eot e pa rs. re era y, t e mem ers o t e set ave me t ng temperatures within 5°C, and more preferably within 2°C, of each other when hybridizing to each of the polymoφhic sites being detected.

Hybridization of an allele-specific oligonucleotide to a target polynucleotide may be performed with both entities in solution, or such hybridization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support. Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidin-biotin, salt bridges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Allele-specific oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis. Solid-supports suitable for use in detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads. The solid support may be treated, coated or derivatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid. The genotype or haplotype for the CHRM2 gene of an individual may also be determined by hybridization of a nucleic acid sample containing one or both copies of the gene to nucleic acid arrays and subarrays such as described in WO 95/11995. The arrays would contain a battery of allele-specifϊc oligonucleotides representing each of the polymoφhic sites to be included in the genotype or haplotype. The identity of polymoφhisms may also be determined using a mismatch detection technique, including but not limited to the RNase protection method using riboprobes (Winter et al, Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230: 1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet. 25:229-253, 1991). Alternatively, variant alleles can be identified by single strand conformation polymoφhism (SSCP) analysis (Orita et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or denaturing gradient gel electrophoresis (DGGE) (Wartell et al., Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236, 1989).

A polymerase-mediated primer extension method may also be used to identify the polymoφhism(s). Several such methods have been described in the patent and scientific literature and include the "Genetic Bit Analysis" method (W092/15712) and the ligase/polymerase mediated genetic bit analysis (U.S. Patent 5,679,524. Related methods are disclosed in W091/02087, WO90/09455, W095/17676, U.S. Patent Nos. 5,302,509, and 5,945,283. Extended primers containing a polymoφhism may be detected by mass spectrometry as described in U.S. Patent No. 5,605,798. Another primer extension method is allele-specific PCR (Ruano et al., Nucl. Acids Res. 17:8392, 1989; Ruano et al., Nucl. Acids Res. 19, 6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest.

95: 1635-1641, 1995). In addition, multiple polymoφhic sites may be investigated by simultaneously amplifying multiple regions of the nucleic acid using sets of allele-specific primers as described in . .

In another aspect of the invention, an individual's CHRM2 haplotype pair is predicted from its CHRM2 genotype using information on haplotype pairs known to exist in a reference population. In its broadest embodiment, the haplotyping prediction method comprises identifying a CHRM2 genotype for the individual at PSl, enumerating all possible haplotype pairs which are consistent with the genotype, accessing data containing CHRM2 haplotype pairs identified in a reference population, and assigning a haplotype pair to the individual that is consistent with the data. In one embodiment, the reference haplotype pairs include the CHRM2 haplotype pairs shown in Table 3.

Generally, the reference population should be composed of randomly-selected individuals representing the major ethnogeographic groups of the world. A preferred reference population for use in the methods of the present invention comprises an approximately equal number of individuals from Caucasian, African American, Asian and Hispanic-Latino population groups with the minimum number of each group being chosen based on how rare a haplotype one wants to be guaranteed to see. For example, if one wants to have a q% chance of not missing a haplotype that exists in the population at a p% frequency of occurring in the reference population, the number of individuals (n) who must be sampled is given by 2n=log(l-q)/log(l-p) where p and q are expressed as fractions. A preferred reference population allows the detection of any haplotype whose frequency is at least 10% with about 99% certainty and comprises about 20 unrelated individuals from each of the four population groups named above. A particularly preferred reference population includes a 3-generation family representing one or more of the four population groups to serve as controls for checking quality of haplotyping procedures.

In a preferred embodiment, the haplotype frequency data for each ethnogeographic group is examined to determine whether it is consistent with Hardy- Weinberg equilibrium. Hardy- Weinberg equilibrium (D.L. Hartl et al., Principles of Population Genomics, Sinauer Associates (Sunderland, MA), 3^rd Ed., 1997) postulates that the frequency of finding the haplotype pair H_x I H., is equal to p_H__w (H_λ IH₂ ) = 2p(H_λ )p(H₂ ) if H ≠ H₂ and p_H__w (H lH₂ ) = p(H_λ )p(H₂ ) if H, = H₂ . A statistically significant difference between the observed and expected haplotype frequencies could be due to one or more factors including significant inbreeding in the population group, strong selective pressure on the gene, sampling bias, and/or errors in the genotyping process. If large deviations from Hardy- Weinberg equilibrium are observed in an ethnogeographic group, the number of individuals in that group can be increased to see if the deviation is due to a sampling bias. If a larger sample size does not reduce the difference between observed and expected haplotype pair frequencies, then one may wish to consider haplotyping the individual using a direct haplotyping method such as, for example, CLASPER System^™ technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al., Nucleic Acids Res. 24:4841-4843, 1996).

In one embodiment of this method for predicting a CHRM2 haplotype pair, the assigning step involves performing the following analysis. First, each of the possible haplotype pairs is compared to . , reference population matches a possible haplotype pair and that pair is assigned to the individual. Occasionally, only one haplotype represented in the reference haplotype pairs is consistent with a possible haplotype pair for an individual, and in such cases the individual is assigned a haplotype pair containing this known haplotype and a new haplotype derived by subtracting the known haplotype from the possible haplotype pair. In rare cases, either no haplotypes in the reference population are consistent with the possible haplotype pairs, or alternatively, multiple reference haplotype pairs are consistent with the possible haplotype pairs. In such cases, the individual is preferably haplotyped using a direct molecular haplotyping method such as, for example, CLASPER System technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al., Nucleic Acids Res. 24:4841-4843, 1996). A preferred process for predicting CHRM2 haplotype pairs from CHRM2 genotypes is described in copending U.S. Provisional Application Serial No. 60/198,340.

The invention also provides a method for determining the frequency of a CHRM2 genotype or CHRM2 haplotype in a population. The method comprises determining the genotype or the haplotype pair for the CHRM2 gene that is present in each member of the population, wherein the genotype or haplotype comprises the nucleotide pair or nucleotide detected at PSl in the CHRM2 gene; and calculating the frequency any particular genotype or haplotype is found in the population. The population may be a reference population, a family population, a same sex population, a population group, a trait population (e.g., a group of individuals exhibiting a trait of interest such as a medical condition or response to a therapeutic treatment).

In another aspect of the invention, frequency data for CHRM2 genotypes and/or haplotypes found in a reference population are used in a method for identifying an association between a trait and a CHRM2 genotype or a CHRM2 haplotype. The trait may be any detectable phenotype, including but not limited to susceptibility to a disease or response to a treatment. The method involves obtaining data on the frequency of the genotype(s) or haplotype(s) of interest in a reference population as well as in a population exhibiting the trait. Frequency data for one or both of the reference and trait populations may be obtained by genotyping or haplotyping each individual in the populations using one of the methods described above. The haplotypes for the trait population may be determined directly or, alternatively, by the predictive genotype to haplotype approach described above. In another embodiment, the frequency data for the reference and/or trait populations is obtained by accessing previously determined frequency data, which may be in written or electronic form. For example, the frequency data may be present in a database that is accessible by a computer. Once the frequency data is obtained, the frequencies of the genotype(s) or haplotype(s) of interest in the reference and trait populations are compared. In a preferred embodiment, the frequencies of all genotypes and/or haplotypes observed in the populations are compared. If a particular genotype or haplotype for the CHRM2 gene is more frequent in the trait population than in the reference population at a statistically significant amount, then the trait is predicted to be associated with that CHRM2 genotype or haplotype. , selected from the full-genotypes and full-haplotypes shown in Tables 3 and 4, respectively, or from sub- genotypes and sub-haplotypes derived from these genotypes and haplotypes.

In a preferred embodiment of the method, the trait of interest is a clinical response exhibited by a patient to some therapeutic treatment, for example, response to a drug targeting CHRM2 or response to a therapeutic treatment for a medical condition. As used herein, "medical condition" includes but is not limited to any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment is desirable, and includes previously and newly identified diseases and other disorders. As used herein the term "clinical response" means any or all of the following: a quantitative measure of the response, no response, and adverse response (i.e., side effects).

In order to deduce a correlation between clinical response to a treatment and a CHRM2 genotype or haplotype, it is necessary to obtain data on the clinical responses exhibited by a population of individuals who received the treatment, hereinafter the "clinical population". This clinical data may be obtained by analyzing the results of a clinical trial that has already been run and/or the clinical data may be obtained by designing and carrying out one or more new clinical trials. As used herein, the term "clinical trial" means any research study designed to collect clinical data on responses to a particular treatment, and includes but is not limited to phase I, phase II and phase III clinical trials. Standard methods are used to define the patient population and to enroll subjects.

It is preferred that the individuals included in the clinical population have been graded for the existence of the medical condition of interest. This is important in cases where the symptom(s) being presented by the patients can be caused by more than one underlying condition, and where treatment of the underlying conditions are not the same. An example of this would be where patients experience breathing difficulties that are due to either asthma or respiratory infections. If both sets were treated with an asthma medication, there would be a spurious group of apparent non-responders that did not actually have asthma. These people would affect the ability to detect any correlation between haplotype and treatment outcome. This grading of potential patients could employ a standard physical exam or one or more lab tests. Alternatively, grading of patients could use haplotyping for situations where there is a strong correlation between haplotype pair and disease susceptibility or severity.

The therapeutic treatment of interest is administered to each individual in the trial population and each individual's response to the treatment is measured using one or more predetermined criteria. It is contemplated that in many cases, the trial population will exhibit a range of responses and that the investigator will choose the number of responder groups (e.g., low, medium, high) made up by the various responses. In addition, the CHRM2 gene for each individual in the trial population is genotyped and/or haplotyped, which may be done before or after administering the treatment. After both the clinical and polymoφhism data have been obtained, correlations between individual response and CHRM2 genotype or haplotype content are created. Correlations may be produced in several ways. In one method, individuals are grouped by their CHRM2 genotype or standard deviations of clinical responses exhibited by the members of each polymoφhism group are calculated.

These results are then analyzed to determine if any observed variation in clinical response between polymoφhism groups is statistically significant. Statistical analysis methods which may be used are described in L.D. Fisher and G. vanBelle, "Biostatistics: A Methodology for the Health Sciences", Wiley-Interscience (New York) 1993. This analysis may also include a regression calculation of which polymoφhic sites in the CHRM2 gene give the most significant contribution to the differences in phenotype. One regression model useful in the invention is described in PCT Application Serial No. PCT/USOO/17540, entitled "Methods for Obtaining and Using Haplotype Data".

A second method for finding correlations between CHRM2 haplotype content and clinical responses uses predictive models based on error-minimizing optimization algorithms. One of many possible optimization algorithms is a genetic algorithm (R. Judson, "Genetic Algorithms and Their Uses in Chemistry" in Reviews in Computational Chemistry, Vol. 10, pp. 1-73, K. B. Lipkowitz and D. B. Boyd, eds. (VCH Publishers, New York, 1997). Simulated annealing (Press et al., "Numerical Recipes in C: The Art of Scientific Computing", Cambridge University Press (Cambridge) 1992, Ch. 10), neural networks (E. Rich and K. Knight, "Artificial Intelligence", 2^nd Edition (McGraw-Hill, New York, 1991, Ch. 18), standard gradient descent methods (Press et al., supra Ch. 10), or other global or local optimization approaches (see discussion in Judson, supra) could also be used. Preferably, the correlation is found using a genetic algorithm approach as described in PCT Application Serial No. PCT/USOO/17540.

Correlations may also be analyzed using analysis of variation (ANOVA) techniques to determine how much of the variation in the clinical data is explained by different subsets of the polymoφhic sites in the CHRM2 gene. As described in PCT Application Serial No. PCT/USOO/17540, ANOVA is used to test hypotheses about whether a response variable is caused by or correlated with one or more traits or variables that can be measured (Fisher and vanBelle, supra, Ch. 10).

From the analyses described above, a mathematical model may be readily constructed by the skilled artisan that predicts clinical response as a function of CHRM2 genotype or haplotype content. Preferably, the model is validated in one or more follow-up clinical trials designed to test the model. The identification of an association between a clinical response and a genotype or haplotype (or haplotype pair) for the CHRM2 gene may be the basis for designing a diagnostic method to determine those individuals who will or will not respond to the treatment, or alternatively, will respond at a lower level and thus may require more treatment, i.e., a greater dose of a drug. The diagnostic method may take one of several forms: for example, a direct DNA test (i.e., genotyping or haplotyping one or more of the polymoφhic sites in the CHRM2 gene), a serological test, or a physical exam measurement. The only requirement is that there be a good correlation between the diagnostic test results and the underlying CHRM2 genotype or haplotype that is in turn correlated with the clinical response. In a , .

Any or all analytical and mathematical operations involved in practicing the methods of the present invention may be implemented by a computer. In addition, the computer may execute a program that generates views (or screens) displayed on a display device and with which the user can interact to view and analyze large amounts of information relating to the CHRM2 gene and its genomic variation, including chromosome location, gene structure, and gene family, gene expression data, polymoφhism data, genetic sequence data, and clinical data population data (e.g., data on ethnogeographic origin, clinical responses, genotypes, and haplotypes for one or more populations). The CHRM2 polymoφhism data described herein may be stored as part of a relational database (e.g., an instance of an Oracle database or a set of ASCII flat files). These polymoφhism data may be stored on the computer's hard drive or may, for example, be stored on a CD ROM or on one or more other storage devices accessible by the computer. For example, the data may be stored on one or more databases in communication with the computer via a network.

Preferred embodiments of the invention are described in the following examples. Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spirit of the invention being indicated by the claims which follow the examples.

EXAMPLES

The Examples herein are meant to exemplify the various aspects of carrying out the invention and are not intended to limit the scope of the invention in any way. The Examples do not include detailed descriptions for conventional methods employed, such as in the performance of genomic DNA isolation, PCR and sequencing procedures. Such methods are well-known to those skilled in the art and are described in numerous publications, for example, Sambrook, Fritsch, and Maniatis, "Molecular Cloning: A Laboratory Manual", 2^nd Edition, Cold Spring Harbor Laboratory Press, USA, (1989).

EXAMPLE 1 This example illustrates examination of various regions of the CHRM2 gene for polymoφhic sites.

Amplification of Target Regions

The following target regions of the CHRM2 gene were amplified using the PCR primer pairs listed below, with the sequences presented in the 5 ' to 3 ' direction and nucleotide positions shown for each region corresponding to the indicated GenBank Accession No. . Fragment 1 Forward primer CAGGGGAAGGGAGATTTGGG (SEQ ID NO: 12) 36-55 Reverse primer CCAGTAACCAATCACAGTGTAGAGGG (SEQ ID NO: 13)

Complement of 461-436 PCR Product 426 nt

Fragment 2 Forward primer

298-320 TGGTGACCATTATCGGGAACATC (SEQ ID NO: 14)

Reverse primer

Complement of 789-766 CTGGCAAATAGAAGGCTGCAATAG (SEQ ID NO: 15)

PCR Product 492 nt

Fragment 3

Forward primer

679-700 GGCAGTTCATTGTAGGGGTGAG (SEQ ID NO: 16)

Reverse primer Complement of 1197- 1177 CACTTTTTGGGGTCTTGGTGC (SEQ ID NO: 17)

PCR Product 519 nt

Fragment 4 Forward primer 1051-1072 CCACCTCAGTCAGTGCTGTTGC (SEQ ID NO: 18)

Reverse primer Complement of 1523-1503 GCAAAGTGCATAGCAGGCAGG (SEQ ID NO: 19) PCR Product 473 nt Fragment 5

Forward primer

1335-1355 CGGGAAAAGAAAGTCACCAGG (SEQ ID NO:20)

Reverse primer

Complement of 1752-1730 AGGCGTGATAAGTGTGTCACTGC (SEQ ID NO:21) PCR Product 418 nt

These primer pairs were used in PCR reactions containing genomic DNA isolated from immortalized cell lines for each member of the Index Repository. The PCR reactions were carried out under the following conditions:

Reaction volume = 20 μl

10 x Advantage 2 Polymerase reaction buffer (Clontech) = 2 μl

100 ng of human genomic DNA = l μl

10 mM dNTP = 0.4 μl

Advantage 2 Polymerase enzyme mix (Clontech) = 0.2 μl

Forward Primer (10 μM) = 0.4 μl

Reverse Primer (10 μM) = 0.4 μl

Water =15.6μl

Amplification profile: 94°C - 2 min. 1 cycle - . 70°C - 45 sec. 10 cycles 72°C - 1 min.

94°C - 30 sec. 64°C - 45 sec. 35 cycles 72°C - 1 min.

Sequencing of PCR Products

The PCR products were purified by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at http://www.genome.wi.mit.edu/sequencing/protocols/pure/SPRI_pcr.html.

Briefly, five μl of carboxyl coated magnetic beads (10 mg/ml) and 60 μl of HYB BUFFER (2.5M NaCl/20% PEG 8000) were added to each PCR reaction mixture (20 μl). The reaction mixture was mixed well and incubated at room temperature (RT) for 10 min. The microtitre plate was placed on a magnet for 2 min and the beads washed twice with 150 μl of 70% EtOH. The beads were air dried for 2 min and the DNA was eluted in 25 μl of distilled water and incubated at RT for 5 min. The beads were magnetically separated and the supernatant removed for testing and sequencing. The purified PCR products were sequenced in both directions using the primer sets described previously.

Analysis of Sequences for Polvmoφhic Sites

Sequences were analyzed for the presence of polymoφhisms using the Polyphred program (Nickerson et al., Nucleic Acids Res. 14:2745-2751, 1997). The presence of a polymoφhism was confirmed on both strands. The polymoφhisms and their locations in the CHRM2 gene are listed in Table 2 below.

EXAMPLE 2

This example illustrates analysis of the CHRM2 polymoφhisms identified in the Index Repository for human genotypes and haplotypes.

The different genotypes containing these polymoφhisms that were observed in the reference population are shown in Table 3 below, with the haplotype pair indicating the combination of haplotypes determined for the individual using the haplotype derivation protocol described below. In

Table 3, homozygous positions are indicated by one nucleotide and heterozygous positions are indicated by two nucleotides. Missing nucleotides in any given genotype in Table 3 were inferred based on linkage disequilibrium and/or Mendelian inheritance.

The haplotype pairs shown in Table 3 were estimated from the unphased genotypes using an extension of Clark's algorithm (Clark, A.G. (1990) Mol Bio Evol 7, 111-122), as described in U.S. Provisional Application Serial No. 60/198,340 entitled "A Method and System for Determining Haplotypes from a Collection of Polymoφhisms". In this method, haplotypes are assigned directly from individuals who are homozygous at all sites or heterozygous at no more than one of the variable sites. In our analysis, the list of haplotypes is augmented with haplotypes obtained from a three- generation Caucasian family and a two-generation African- American family. This hst of haplotypes is then used to deconvolute the unphased genotypes in the remaining (multiply heterozygous) individuals.

By following this protocol, it was determined that the Index Repository examined herein and, by extension, the general population contains the 2 human CHRM2 haplotypes shown in Table 4 below.

In view of the above, it will be seen that the several advantages of the invention are achieved and other advantageous results attained. As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be inteφreted as illustrative and not in a limiting sense.

All references cited in this specification, including patents and patent applications, are hereby incoφorated in their entirety by reference. The discussion of references herein is intended merely to summarize the assertions made by their authors and no admission is made that any reference constitutes prior art. Applicants reserve the right to challenge the accuracy and pertinency of the cited references.

Claims

W at s C a me s:

1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(a) a first nucleotide sequence which is a polymoφhic variant of a reference sequence for cholinergic receptor, muscarinic 2 (CHRM2) gene or a fragment thereof, wherein the reference sequence comprises SEQ ID NO: land the polymoφhic variant comprises thymine at PSl; and

(b) a second nucleotide sequence which is complementary to the first nucleotide sequence.

2. The isolated polynucleotide of claim 1 which comprises a CHRM2 isogene.

3. The isolated polynucleotide of claim 1 which is a DNA molecule and comprises both the first and second nucleotide sequences and further comprises expression regulatory elements operably linked to the first nucleotide sequence.

4. A recombinant nonhuman organism transformed or transfected with the isolated polynucleotide of claim 1 , wherein the organism expresses a CHRM2 protein encoded by the first nucleotide sequence.

5. The recombinant organism of claim 4 which is a nonhuman transgenic animal.

6. The isolated polynucleotide of claim 1 , wherein the first nucleotide sequence is a polymoφhic variant of a fragment of the CHRM2 gene, the fragment comprising one polymoφhism consisting ofthymine at PSl.

7. An isolated polynucleotide comprising a nucleotide sequence which is a polymoφhic variant of a reference sequence for the CHRM2 cDNA or a fragment thereof, wherein the reference sequence comprises SEQ ID NO: 2 and the polymoφhic variant comprises thymine at a position corresponding to nucleotide 991.

8. A recombinant nonhuman organism transformed or transfected with the isolated polynucleotide of claim 7, wherein the organism expresses a cholinergic receptor, muscarinic 2 (CHRM2) protein encoded by the polymoφhic variant sequence.

9. The recombinant organism of claim 8 which is a nonhuman transgenic animal.

10. An isolated polypeptide comprising an amino acid sequence which is a polymoφhic variant of a reference sequence for the CHRM2 protein or a fragment thereof, wherein the reference sequence comprises SEQ ID NO: 3 and the polymoφhic variant comprises serine at a position corresponding to amino acid position 331.

11. An isolated antibody specific for and immunoreactive with the isolated polypeptide of claim 10.

12. A method for screening for drugs targeting the isolated polypeptide of claim 10 which comprises contacting the CHRM2 polymoφhic variant with a candidate agent and assaying for binding activity.

13. A composition comprising at least one genotyping oligonucleotide for detecting a polymoφhism in the cholinergic receptor, muscarinic 2 (CHRM2) gene at a polymoφhic site selected from PS 1.

14. The composition of claim 13, wherein the genotyping oligonucleotide is an allele-specific oligonucleotide that specifically hybridizes to an allele of the CHRM2 gene at a region containing e po ymoφ c s e.

15. The composition of claim 14, wherein the allele-specific oligonucleotide comprises a nucleotide sequence selected from the group consisting of of SEQ ID NOS:4-5, the complements of SEQ ID NOS: 4-5, and SEQ ID NOS:6-9.

16. The composition of claim 13, wherein the genotyping oligonucleotide is a primer-extension oligonucleotide.

17. A method for genotyping the cholinergic receptor, muscarinic 2 (CHRM2) gene of an individual, comprising determining for the two copies of the CHRM2 gene present in the individual the identity of the nucleotide pair at one or more polymoφhic sites (PS) selected from PSl.

18. The method of claim 17, wherein the determining step comprises:

(a) isolating from the individual a nucleic acid mixture comprising both copies of the CHRM2 gene, or a fragment thereof, that are present in the individual;

(b) amplifying from the nucleic acid mixture a target region containing at least one of the polymoφhic sites;

(c) hybridizing a primer extension oligonucleotide to one allele of the amplified target region;

(d) performing a nucleic acid template-dependent, primer extension reaction on the hybridized genotyping oligonucleotide in the presence of at least two different terminators of the reaction, wherein said terminators are complementary to the alternative nucleotides present at the polymoφhic site; and

(e) detecting the presence and identity of the terminator in the extended genotyping oligonucleotide.

19. A method for haplotyping the cholinergic receptor, muscarinic 2 (CHRM2) gene of an individual which comprises determining, for one copy of the CHRM2 gene present in the individual, the identity of the nucleotide at one or more polymoφhic sites (PS) selected from PSl.

20. The method of claim 19, wherein the determining step comprises

(a) isolating from the individual a nucleic acid molecule containing only one of the two copies of the CHRM2 gene, or a fragment thereof, that is present in the individual;

(b) amplifying from the nucleic acid molecule a target region containing at least one of the polymoφhic sites;

(c) hybridizing a primer extension oligonucleotide to one allele of the amplified target region;

(d) performing a nucleic acid template-dependent, primer extension reaction on the hybridized genotyping oligonucleotide in the presence of at least two different terminators of the reaction, wherein said terminators are complementary to the alternative nucleotides present at the polymoφhic site; and

(e) detecting the presence and identity of the terminator in the extended genotyping oligonucleotide.

21. A method for predicting a haplotype pair for the cholinergic receptor, muscarinic 2 (CHRM2) gene (a) identifying an CHRM2 genotype for the individual at PS 1 ;

(b) enumerating all possible haplotype pairs which are consistent with the genotype; (c) accessing data containing the CHRM2 haplotype pairs determined in a reference population; and (d) assigning a haplotype pair to the individual that is consistent with the data.

22. A method for identifying an association between a trait and at least one genotype or haplotype of the cholinergic receptor, muscarinic 2 gene which comprises comparing the frequency of the genotype or haplotype in a population exhibiting the trait with the frequency of the genotype or haplotype in a reference population, wherein the genotype or haplotype comprises a nucleotide pair or nucleotide located at one or more polymoφhic sites selected from PSl, wherein a higher frequency of the genotype or haplotype in the trait population than in the reference population indicates the trait is associated with the genotype or haplotype.

23 The method of claim 22, wherein the haplotype is selected from haplotype numbers 1 -2 shown in Table 4.

24. The method of claim 23, wherein the trait is a clinical response to a drug targeting CHRM2 .

25. A computer system for storing and analyzing polymoφhism data for the cholinergic receptor, muscarinic 2 gene, comprising:

(a) a central processing unit (CPU); (b) a communication interface;

(c) a display device;

(d) an input device; and

(e) a database containing the polymoφhism data; wherein the polymoφhism data comprises the genotypes and haplotype pairs shown in Table 3 and the haplotypes shown in Table 4.

26. A genome anthology for the cholinergic receptor, muscarinic 2 (CHRM2) gene which comprises CHRM2 isogenes defined by haplotypes 1-2 shown in Table 4.