WO2001018213A1 - Adn polymerases chimeriques thermoresistantes - Google Patents

Adn polymerases chimeriques thermoresistantes Download PDF

Info

Publication number
WO2001018213A1
WO2001018213A1 PCT/GB2000/003478 GB0003478W WO0118213A1 WO 2001018213 A1 WO2001018213 A1 WO 2001018213A1 GB 0003478 W GB0003478 W GB 0003478W WO 0118213 A1 WO0118213 A1 WO 0118213A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna polymerase
chimeric
polymerase
dna
domain
Prior art date
Application number
PCT/GB2000/003478
Other languages
English (en)
Inventor
Tom Kristensen
Original Assignee
Dzieglewska, Hanna
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dzieglewska, Hanna filed Critical Dzieglewska, Hanna
Priority to AU70275/00A priority Critical patent/AU7027500A/en
Publication of WO2001018213A1 publication Critical patent/WO2001018213A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • This invention relates to novel chimeric DNA polymerase molecules and their use in molecular biology techniques such as those involving primer extension or chain extension, for example second strand DNA synthesis, the polymerase chain reaction (PCR) and DNA sequencing.
  • primer extension or chain extension for example second strand DNA synthesis, the polymerase chain reaction (PCR) and DNA sequencing.
  • PCR polymerase chain reaction
  • DNA polymerases are essential cellular enzymes that are involved in replication of cellular DNA, repair of DNA damage, genetic recombination etc.
  • An organism will in general contain several types of DNA polymerases .
  • the eubacterium Escherichia coli possesses three different DNA polymerases : DNA polymerase I that participates in DNA replication and repair, DNA polymerase II where the main cellular function is still unknown, and DNA polymerase III, which is the main DNA polymerase involved in the replication of the E. coli genome .
  • DNA polymerases from other species can be divided into four families : families A, B and C which show homology with the E. coli DNA polymerases I, II and III, respectively and Family X which show no homology with any of the E. coli DNA polymerases.
  • prokaryotic and eukaryotic DNA polymerases share the same fundamental type of synthetic activity. That is, that under suitable conditions with respect to pH, temperature, nucleoside triphosphate concentrations etc . they will synthesize a DNA strand which is complementary to a template strand, starting from a double stranded region in the DNA template.
  • DNA polymerases useful in a variety of molecular biology and gene technology procedures . This is especially the case for family A polymerases .
  • polymerases from this family which are used as gene technology tools are the DNA polymerase I enzyme from E. coli (and the Klenow fragment thereof, see below) , the DNA polymerase I enzyme from Thermus aqua icus (Taq) , Thermus thermophilus (Tth) , Bacillus caldotenax (Bca) , Bacillus stearothermophilus (Bst) and Thermotoga mari tima (Tma) .
  • E. coli DNA polymerase I The detailed structure of E. coli DNA polymerase I is known. Three domains are formed by folding of the polypeptide chain: an N-terminal domain with 5 '-3' exonuclease activity (5'->3' exo domain), a central domain with S' ⁇ ' exonuclease activity (3 '-5 1 exo domain) , and a C-terminal domain with polymerase activity (polymerase domain) .
  • the same three domain structure is found for other family A DNA polymerases.
  • the central 3' -5' exo domain lacks the 3' -5' exonuclease (proofreading) activity associated with this domain in the E. coli polymerase I enzyme.
  • DNA polymerases to synthesise a DNA strand which is complementary to a template strand, starting from a double stranded region in the DNA template, is a property also sometimes referred to as chain extension or primer extension.
  • Chain extension or primer extension is the mainstay of many current molecular biology protocols.
  • the DNA polymerase enzymes which catalyse chain extension are important tools in many molecular biology techniques. Due to the ability to catalyse chain extension DNA polymerase enzymes can be used as tools in techniques which involve synthesis of DNA fragments, and also for example techniques such as the polymerase chain reaction (PCR) amplification of DNA fragments and DNA sequencing.
  • PCR polymerase chain reaction
  • thermostable family A polymerases include Taq, Tth, Bst, Bca, Cau and Tma.
  • novel DNA polymerases which exhibit proof-reading (3 ' -5 ' exonuclease) properties, can be produced by generating chimeric DNA polymerases comprising a 3 '-5' exonuclease domain from one DNA polymerase enzyme and a DNA polymerase domain from a different DNA polymerase enzyme .
  • Such novel chimeric DNA polymerases are produced by inserting one or more domains which exhibit catalytic activity, for example DNA polymerase activity, 5' -3' exonuclease activity or 3 '-5' exonuclease activity, from one DNA polymerase into the molecular framework of another, different, DNA polymerase.
  • thermostability a novel chimeric DNA polymerase which combines the property of thermostability, with the property of a 3' -5' exonuclease (proofreading) activity.
  • the described DNA polymerases consist of an N-terminal region derived from the 5 '--3' exonuclease domain of a Thermus species DNA polymerase and a C-terminal region derived from the 3' -5' exonuclease and polymerase domains of Tma DNA polymerase. It is preferred in the chimeric polymerases of EP-A-892058 to inactivate the exonuclease activities by mutation.
  • chimeric DNA polymerases such as those disclosed herein which comprise a 3 ' —5 ' exonuclease domain from one DNA polymerase enzyme and a DNA polymerase domain from a different DNA polymerase enzyme, have not been produced.
  • the chimeric DNA polymerases of the present invention which comprise a 3 '-5' exonuclease domain from one DNA polymerase enzyme and a DNA polymerase domain from a different DNA polymerase enzyme can exhibit the ability to bind DNA together with DNA polymerase activity and 3' -5' exonuclease activity.
  • the 5' -3' exonuclease domain can be separated from the other domains by treatment with proteolytic enzymes, indicating that the junction between the 5 '-3' exonuclease domain and the 3 '-5' exonuclease domain is open and easily accessible (see for instance Klenow H. & Henningsen, I. Proc Natl Acad Sci USA 65: 168-175, 1970) .
  • Studies on the crystal structure of Taq DNA polymerase Karl et al .
  • the present invention therefore provides a chimeric DNA polymerase comprising a 3 ! -5' exonuclease domain from one DNA polymerase enzyme and a DNA polymerase domain from a heterologous DNA polymerase enzyme .
  • the DNA polymerase enzymes for use as sources for the different domains in the present invention may be any DNA polymerase enzymes, whether native or modified e.g. by mutagenesis. As mentioned above many DNA polymerase enzymes are known in the art and described in the literature and any of these may be used to provide the domain (s) which make up the chimeric DNA polymerases of the invention.
  • domain refers to a part of a DNA polymerase polypeptide that folds into a separate distinct unit.
  • the polypeptide chain can traverse forwards and backwards within the domain, whereas neighbouring domains are usually connected by one or at most two polypeptide chain segments.
  • domain as used herein can be regarded as a separate folding unit, i.e. that the presence or absence of a given domain will not significantly affect the folding and structure of the other domains in the protein.
  • domains in accordance with the present invention include the 3' -5' exo domain, the 5'->3' exo domain and the polymerase domains of family A DNA polymerases .
  • domain Also included within the term "domain” are separate folding units within a domain, also termed sub-domains. Examples of such structures in accordance with the present invention are the finger, thumb and palm subdomains in the polymerase domain of family A DNA polymerases.
  • domain (s) making up the chimeric DNA polymerases of the present invention may be native (ie. as they occur in nature) or they may be modified.
  • modified as used herein in relation to DNA polymerase domains includes all forms of amino acid sequence modification, and thus includes single or multiple amino acid substitution (s) , addition or deletion, be this of single amino acids or longer amino acid sequences e.g. truncations, insertions, etc. Also included are sequences where the amino acids have been chemically modified, including by glycosylation, or other chemical substitution of amino acid residues.
  • domain (s) making up the chimeric DNA polymerases of the invention may be wholly or partly synthetic, i.e. may wholly or partly comprise amino acids which have been generated chemically.
  • the chimeric DNA polymerases of the invention may be produced by the insertion of one or more domains from a DNA polymerase enzyme into a heterologous DNA polymerase enzyme.
  • insertion refers to the positioning of a domain (s) from one DNA polymerase enzyme into a different DNA polymerase enzyme.
  • insert can take the form of a replacement or a substitution of a domain from one DNA polymerase with a functionally equivalent or homologous domain (e.g. a corresponding domain) from a different DNA polymerase enzyme.
  • a preferred chimeric DNA polymerase of the invention is produced by the replacement of the 3'-*5' exonuclease domain (and optionally the 5' -3' exonuclease domain) of one DNA polymerase enzyme with functionally equivalent domain (s) (i.e. a 3'-5' exonuclease domain and optionally a 5'-*3' exonuclease domain) from a heterologous DNA polymerase enzyme.
  • functionally equivalent domain i.e. a 3'-5' exonuclease domain and optionally a 5'-*3' exonuclease domain
  • a preferred chimeric DNA polymerase of the invention is produced by the replacement of the DNA polymerase domain (and optionally the 5'-3' exonuclease domain) of one DNA polymerase enzyme with functionally equivalent domain (s) from a heterologous DNA polymerase enzyme .
  • the 3' -5' exonuclease domain and the 5 ' —3 ' exonuclease domain of the DNA polymerase enzyme are replaced with a 3' -5' exonuclease domain from a heterologous DNA polymerase enzyme.
  • insert also includes the replacement or substitution of more than one domain from a DNA polymerase with a domain from a different DNA polymerase enzyme. However, also included is the possibility of adding an extra new domain into an existing DNA polymerase enzyme.
  • a chimeric polymerase according to the invention may also be prepared by "joining" together selected domains from two or more polymerase enzymes.
  • each of the three primary domains (5' -3' exo, 3 '-5' exo and polymerase) may be derived from a different polymerase enzyme .
  • the insertion of a domain (s) or joining of domains according to the present invention is carried out so that the inserted domain (s) /joined domains and the domain (s) comprising the heterologous DNA polymerase enzyme are operatively joined.
  • operatively joined as used herein in the context of protein domains, means that the domains are joined in such a way that they function together in the same way as in a naturally occurring DNA polymerase enzyme.
  • heterologous DNA polymerase enzyme refers to a DNA polymerase enzyme encoded by a different nucleic acid sequence.
  • a “heterologous DNA polymerase enzyme” according to the present invention includes DNA polymerase enzymes of the same, or different species of organism, providing the DNA polymerase enzymes are encoded by different nucleic acid sequences.
  • the invention requires that a native DNA polymerase enzyme be modified to introduce a new catalytic domain (s) which is not naturally present in that enzyme - this catalytic domain (s) may be native (ie. naturally occurring) or modified or synthetic, and it may be derived from any other DNA polymerase enzyme .
  • the chimeric DNA polymerase further comprises a 5'->3' exonuclease domain.
  • a 5' -3' exonuclease domain can be derived from the same DNA polymerase enzyme as the 3' -5' exonuclease domain is derived from, or can be derived from the same DNA polymerase enzyme as the DNA polymerase domain is derived from.
  • a 5 '-3' exonuclease domain can be derived from a completely different DNA polymerase enzyme.
  • thermostable DNA polymerase is selected from the group comprising Taq, Tth, Bca, Bst, Cau, Tma, Pfu, Vent and Deep Vent DNA polymerases.
  • the chimeric DNA polymerase of the present invention is a thermostable DNA polymerase .
  • thermoostable DNA polymerase refers to a DNA polymerase which can be heated to temperatures of at least 50°C, preferably temperatures in the range of approximately 50°C-70°C (even more preferably up to 95°C) for an extended period of time, such as for example 30 minutes, without extensive loss of catalytic activity.
  • "without extensive loss of catalytic activity” means that at least 40%, more preferably 50%-70%, even more preferably at least 75, 80, 85, 90 or 95% of the original activity is retained, measured under suitable conditions regarding temperature, pH, ionic strength etc., as compared with the original activity of the polymerase enzyme before exposure to heat.
  • Suitable conditions may be any condition known in the art to be appropriate for, or conducive to the polymerase reaction.
  • Exemplary conditions include the presence of a polymerase buffer which has a pH of 9.0 at 25°C and comprises 50 mM KC1 and 5 mM MgCl 2 and measurement of polymerase activity at a temperature of 70°C.
  • Such catalytic activity may be any catalytic activity associated with a DNA polymerase. Examples of catalytic activity which may be associated with a DNA polymerase include, for example, the DNA polymerase activity, 3'-5' exonuclease activity and 5 ' —3 ' exonuclease activity.
  • a polymerase enzyme according to the invention may thus be "thermostable” with regard to a selected catalytic activity and this means that the enzyme is stable to heat (e.g. up to a temperature of 50°C, 60°C or 70°C or more) and has an elevated temperature reaction optimum.
  • thermostable DNA polymerase can withstand heating to higher temperatures, for example 92°C to 95°C.
  • Such polymerases would thus be useful in techniques such as PCR.
  • PCR (and variants thereof) is a technique which is well known and described in the art and allows in vi tro amplification of a DNA sequence limited by two synthetic oligonucleotides, or primers (described in more detail below) .
  • samples need to be heated to high temperatures (approximately 92-95°C) .
  • high temperatures approximately 92-95°C
  • family A DNA polymerases which can withstand heating to approximately 95°C and consequently are usable in PCR, are Taq DNA polymerase and Tth DNA polymerase.
  • family B DNA polymerases from the thermophilic Archae bacteria are used, for instance Pfu DNA polymerase from Pyrococcus furiosus , Vent polymerase from Thermococcus li toralis and Deep Vent polymerase from Pyrococcus species GB-D.
  • DNA polymerases from Taq and Tth are thermostable and can withstand heating to approximately 95°C, these enzymes (as mentioned above) , do not exhibit a 3' -5' exonuclease (proofreading) activity. This lack of proofreading activity means that difficulties arise when such polymerases are used to amplify long DNA fragments.
  • Taq and Tth DNA polymerases cannot remove misincorporated nucleotides and subsequent elongation of a growing chain with a 3 ' nucleotide that is not complementary to the corresponding nucleotide in the template strand is a slow and inefficient process.
  • kilobases is commonly regarded as an upper size limit for fragments that can be amplified with Taq and Tth DNA polymerase .
  • the family B polymerases mentioned above have a 3 '-5' exonuclease (proofreading) activity.
  • proofreading 3 '-5' exonuclease activity
  • problems still arise with the amplification of long DNA fragments.
  • the 3'-5' exonuclease activities of these enzymes are so strong that the unannealed DNA primers used in the PCR method are degraded during the PCR process .
  • Another reason is the low processivity of these family B polymerase enzymes.
  • the current solution to overcome the problems associated with the DNA polymerases known in the art is to use combinations of DNA polymerases when trying to amplify long DNA fragments (Barnes, W.M. (1994) PNAS USA 91: 2216-2220). For example, Taq polymerase in combination with small amounts of a proofreading polymerase such as Pfu is sometimes used.
  • thermostability of chimeric DNA polymerases of the invention may be improved (i.e. the temperature to which the polymerase may be heated without a loss in catalytic activity is increased) by further modification of the polymerases.
  • modification may take any form, including genetic manipulation of the chimeric enzyme involving techniques well known and documented in the art such as for example single or multiple nucleotide or amino acid substitution, addition, mutation or deletion.
  • thermostability of the chimeric DNA polymerases of the invention could be improved, for example, the addition of stabilising compounds such as trehalose and trimethylamine-N-oxide (Carninci, P., et al . , PNAS USA, 1998, Vol. 95: 520-524 and Baskakov, I. and Bolen, D. , J. Biol Chem, 1998, Vol 273: 4831-4834) to the reaction mix, or the introduction of random C-terminal tails in the enzymes (Matsuura, T., et al . , Nature Biotech. 1999, Vol 17: 58-61) .
  • stabilising compounds such as trehalose and trimethylamine-N-oxide (Carninci, P., et al . , PNAS USA, 1998, Vol. 95: 520-524 and Baskakov, I. and Bolen, D. , J. Biol Chem, 1998, Vol 273: 4831-4834)
  • At least one of the inserted domain or domains from the heterologous DNA polymerase is derived from a family A DNA polymerase ' .
  • the family A DNA polymerase is selected from the group comprising E. coli polymerase I, Taq, Tth, Bca, Bst, Cau, Tma and T7 bacteriophage DNA polymerases.
  • the part of the chimeric DNA polymerase which exhibits the DNA polymerase activity is derived from Taq DNA polymerase.
  • the part of the chimeric DNA polymerase which exhibits the 3'-5' exonuclease activity is derived from Cau DNA polymerase.
  • the chimeric DNA polymerase comprises a domain exhibiting DNA polymerase activity derived from Taq DNA polymerase and a domain exhibiting 3' -5' exonuclease activity derived from Cau DNA polymerase. More preferably, the chimeric DNA polymerases of the invention have the amino acid sequence shown in either SEQ ID NO: 2 or 4.
  • the part of the chimeric DNA polymerase which exhibits the 3' -5' exonuclease activity is derived from Tma DNA polymerase, and hence an additional preferred chimeric DNA polymerase comprises a domain exhibiting DNA polymerase activity derived from Taq DNA polymerase and a domain exhibiting 3' -5' exonuclease activity derived from Tma DNA polymerase .
  • the chimeric DNA polymerases of the invention may be prepared using techniques which are standard or conventional in the art. Generally these will be based on genetic engineering techniques, but protein manipulation techniques or proteolytic digestion to release a selected domain and chemical coupling is also possible, using known techniques.
  • one of the methods which may be used to prepare the DNA polymerases of the invention is through genetic engineering techniques.
  • a genetic construct is prepared, using standard recombinant DNA techniques, encoding a desired chimeric DNA polymerase and comprising appropriate nucleotide sequences (nucleotide fragments) encoding the various domains, etc. so as to express the desired chimeric polypeptide as a complete "finished" molecule.
  • the appropriate nucleotide sequences may be ligated together, or inserted into one another etc.
  • Such a genetic construct or gene designed to encode the desired polypeptide may then be inserted into an expression vector construct.
  • expression vectors include appropriate control sequences such as for example translational (e.g. start and stop codons, ribosomal binding sites) and transcriptional control elements (e.g. promoter- operator regions, termination stop sequences) linked in matching reading frame with the nucleic acid molecule encoding the desired polypeptide of the invention.
  • transcriptional control elements e.g. promoter- operator regions, termination stop sequences
  • further components of such vectors include for example replication origins, selectable markers, secretion signalling and processing sequences.
  • Such expression vectors may include plasmids, cosmids and viruses (including both bacteriophage and eukaryotic viruses) according to techniques well known and documented in the art, and may be expressed in a variety of different expression systems, also well known and documented in the art, including bacterial (e.g. E. coli) , Baculovirus, yeast or mammalian expression systems.
  • bacterial e.g. E. coli
  • Baculovirus e.g. E. coli
  • yeast e.g. bacterial
  • mammalian expression systems e.g. E. coli
  • One preferred vector for use in an E. coli expression system in accordance with the present invention is the plasmid pTrc99A (Pharmacia Biotech, Uppsala, Sweden) which provides an inducible tac promoter and suitable transcription termination signals, as well as ori sequences for autonomous replication and an ampicillin resistance gene for selection.
  • Such host cells may for example include prokaryotic cells such as E.coli, eukaryotic cells such as yeasts or the baculovirus insect cell system, transformed mammalian cells, germ line or somatic cells, or genetically engineered cell lines. Suitable techniques by which such vectors may be introduced into such cells are well known and documented in the literature .
  • the chimeric DNA polymerase according to the invention can be produced by culturing the host cells under conditions which allow the expression of the chimeric polypeptide by the host cell.
  • transcription and expression of the coding sequence may be initiated by adding a suitable inducer to the culture medium.
  • An example of such an inducer which may be used in the present invention is IPTG.
  • Some vector constructs will contain control sequences that direct the produced protein to the periplasmic space or out into the growth medium, in which case isolation will entail removal of the host cells and recovery of the polymerase from the medium. With other vector constructs the produced protein will remain in the host cell, in which case it must be recovered, for example by lysis of the host cells and purification of the proteins by methods well known and documented in the art . Such recombinantly produced proteins may also be produced by the host cell in an insoluble form and end up in so-called inclusion bodies.
  • the protein can be recovered from the inclusion bodies using methods well known and documented in the art, for example by isolating the inclusion bodies from lysed cells, solubilization of the protein in the inclusion body by using reagents such as urea or guanidinium thiocyanate, and removal of the reagent under conditions that allow refolding of the protein.
  • reagents such as urea or guanidinium thiocyanate
  • DNA fragments encoding the desired domains of the appropriate chimeric polypeptide may be produced and joined together, for example by ligation. While carrying out this procedure, one or more of the DNA fragments may already be joined to the intended vector construct. Alternatively, while carrying out this procedure, none of the DNA fragments may be joined to the intended vector construct, but joined to the intended vector construct in a subsequent step.
  • the domain encoding DNA fragments can be obtained by techniques which are well known and documented in the art. For example by restriction enzyme cutting, if necessary after the introduction of suitable restriction sites or other sequences that are not present in the starting sequences. Such restriction sites or other sequences can be introduced by for example site directed mutagenesis or PCR amplification (optionally using tailed primers) . Alternatively the domain encoding DNA fragments may be prepared by PCR amplification from a template DNA molecule using appropriate primers. Such PCR amplification can also be used to introduce any required restriction sites or other sequences into the DNA fragments .
  • the DNA fragments may be purified using techniques which are well known and documented in the art, for example by subjecting the DNA fragment to electrophoresis in a gel medium (for example an agarose gel) , isolating the part of the gel containing said DNA fragment and purification of the fragment from the gel medium by methods known in the art (for example using the Geneclean kit produced by BIO 101, Inc., 1070 Joshua Way, Vista, CA 92083, USA or the kits produced by Qiagen, Qiagen GmbH, Max-Volmer-Strasse 4, 40724 Hilden, Germany) .
  • a gel medium for example an agarose gel
  • the fragments are joined together for example by incubation with a suitable DNA ligase, such as for instance T4 DNA ligase, under conditions and for a period of time that allows joining together of the fragments.
  • a suitable DNA ligase such as for instance T4 DNA ligase
  • Ligation to the linearised vector can be performed in the same or a separate ligation reaction.
  • the DNA fragments encoding the domains of the desired chimeric polypeptide are joined in such a way that the domains of the chimeric polypeptide expressed by said construct are operatively joined, that is joined in such a way that they function together in the same way as in a native polypeptide molecule.
  • domains are often linked by flexible loops or unstructured regions in the polypeptide chain. Therefore, one possibility is that the ends of the DNA fragments encoding the domains of the desired chimeric DNA polymerase encode amino acids that are found in such linking regions in the native polymerases. This should facilitate the correct orientation of the polypeptide domains relative to each other and increase the likelihood that the joined domains will be able to function in a concerted way.
  • the 3 -dimensional structure is known from X-ray crystallography. Careful examination of the 3- dimensional model enables suitable choices of start and end amino acid residues for the portion of the polypeptide chain that will be used in the chimeric enzyme to be made. For other family A polymerases the 3 -dimensional structure has not yet been experimentally determined. For these, carefully adjusted alignment of sequences might be helpful to identify suitable ends to be used for the DNA fragments. Sequence alignments can be made using techniques well known and documented in the art, for example with the help of computer programs like the Clustal series (Thompson et al .
  • Such computer programs can also take into account the secondary structure of sequences, where such structures are known. These alignments can then for example be used to make a 3 -dimensional model of polymerases for which no experimental structure is available, by using protein modelling techniques known in the art, or be used to identify residues that correspond to suitably placed residues in the polypeptides for which an experimental structure is known.
  • a further aspect of the present invention provides nucleic acid molecules comprising a nucleotide sequence which encodes a chimeric DNA polymerase of the invention.
  • nucleic acid molecules comprise the sequence as defined in SEQ ID NO. 1 or 3 , or a fragment thereof encoding a functionally active product, or a sequence which is degenerate, substantially homologous with or which hybridises with the sequence as defined in SEQ ID NO. 1 or 3 or with the sequence complementary thereto, or a fragment thereof encoding a functionally active product.
  • “Functionally active product” as used herein refers to any chimeric product encoded by said sequence which exhibits DNA polymerase activity.
  • substantially homologous as used herein includes those sequences having a sequence homology of approximately 60% or more, e.g. 70%, 75%, 80% or 85% or more and also functionally equivalent allelic variants and related sequences modified by single or multiple base substitution, addition and/or deletion.
  • functionally equivalent in this sense is meant nucleotide sequences which encode catalytically active polypeptides, ie. having DNA polymerase activity.
  • sequences according to the present invention having 60%, 70%, 75%, 80%, 85% homology etc. may be determined using the ALIGN program with default parameters (for instance available on Internet at the GENESTREAM network server, IGH, adjoin, France) .
  • sequences which hybridise under conditions of high stringency are included within the scope of the invention, as are sequences which, but for the degeneracy of the code, would hybridise under high stringency conditions.
  • a further aspect of the present invention provides an expression vector capable of expressing a chimeric DNA polymerase of the invention.
  • the expression vector comprises a nucleic acid molecule of the invention. Possible types and structures of such expression vectors according to the invention are described above.
  • a yet further aspect of the present invention provides a host cell expressing a chimeric DNA polymerase of the invention.
  • Examples of possible host cells which may be used to express the chimeric DNA polymerase of the invention are described above.
  • a yet further aspect of the present invention provides a method of producing a chimeric DNA polymerase of the invention, comprising the steps of (i) growing a host cell containing a nucleic acid molecule encoding a chimeric DNA polymerase of the invention under conditions suitable for the expression of the chimeric DNA polymerase; and (ii) isolating the chimeric DNA polymerase from the host cell or from the growth medium.
  • a further aspect of the present invention provides the use of the chimeric DNA polymerases of the invention in molecular biology and gene technology techniques.
  • the chimeric DNA polymerases of the present invention are particularly useful in those molecular biology techniques involving chain or primer extension and requiring a thermostable enzyme.
  • Such techniques include for example second strand DNA synthesis, PCR amplification, DNA sequencing, nucleic acid based assays, etc.
  • the proof-reading (3 '-5' exonuclease) activity of the chimeric DNA polymerases of the present invention makes the polymerases particularly useful in techniques where the fit between the primer and the template DNA is not exact.
  • the use of a proof-reading chimeric enzyme of the invention with some degree of thermostability would be an advantage in second strand cDNA synthesis using a consensus primer, as in cases where sequence information for the cDNA is not available and the primer is made taking sequence information from homologous enzymes from other species into consideration.
  • chimeric DNA polymerases of the invention will be useful in DNA sequencing with consensus primers .
  • polymerases have problems extending primers that do not anneal properly at the 3' end.
  • a polymerase without proof-reading capability would not be able to deal with this problem, whereas a proof-reading enzme (such as that of the present invention) could remove any mismatches at the 3 ' end and replace them with properly matched nucleotides.
  • kits for use in molecular biology and gene technology techniques comprising a chimeric DNA polymerase of the invention.
  • kits comprises at least a chimeric DNA polymerase of the invention together with one or more primers which hybridise to strands of target DNA in order to provide a substrate for the chain extension reaction which may be catalysed by the chimeric DNA polymerase.
  • Figure 1 shows the activity of CauTaq DNA polymerase version 2 at various temperatures. The enzyme reaction was performed at the given temperatures for 5 minutes. Polymerase activity is given as per cent of the activity at the optimal temperature, 55°C. For comparison, the results from corresponding experiments with Cau DNA polymerase and Taq DNA polymerase are shown.
  • Figure 2 shows time courses for inactivation of CauTaq DNA polymerase version 2 at various temperatures.
  • the enzyme was preincubated at the stated temperatures for various periods of time before polymerase activity was measured.
  • Polymerase activity, relative to the activity before preincubation, is given as a function of preincubation time.
  • Figure 3 demonstrates thermostable exonuclease activity in versions 1 and 2 of CauTaq DNA polymerase.
  • the data shown is output from an ALF Express DNA sequencer and show the size (in bases) of Cy5 -labelled fragments .
  • Samples labeled Match contained the Match primer and samples labeled Mismatch the Mismatch primer.
  • Samples labeled Alul were treated with Alul before electrophoretic analysis. The results demonstrate that the CauTaq polymerases are able to edit mismatched nucleotides and extend the edited primer.
  • the data for Taq polymerase demonstrate that this enzyme is unable to edit the mismatch as well as to extend the Mismatch primer.
  • Example 1 Construction of an expression vector coding for CauTag polymerase version 1
  • the primers were based on the published sequence of Taq DNA polymerase (Lawyer et al . (1989) J. Biol. Chem. 264, 6427-6437) and were designed to introduce a EcoRI site in the 5' end of the gene and a Bglll site in the 3' end.
  • Thermus aquaticus strain YT-1 obtained from American Type Culture Collection (ATCC) , was grown in Castenholz medium, after which genomic DNA was isolated using the method of Chen and Ku (1993) Nucl . Acids Res. 21, 2260.
  • a PCR reaction mixture was set up containing approximately 0.05 ⁇ g genomic Tag-DNA, 20 pmoles each of the primers above. 0.2 mM each of dATP, dCTP, dGTP and dTTP, 1.5 mM MgCl2, 2 U Taq DNA polymerase (Boehringer- Mannheim) , and 2.5 ⁇ l 10 x PCR buffer (Boehringer- Mannheim) .
  • the polymerase gene was amplified using 35 PCR cycles, each consisting of 94°C (30 seconds) , 45°C (30 seconds), and 72°C (1 minute).
  • the resulting 2.6 kb DNA fragment was digested with the restriction endonucleases EcoRI and Bglll , gel purified and ligated into the expression plasmid pTrc99A (Pharmacia, Sweden) that previously had been digested with Ec ⁇ RI and BamHl, using a 20 ⁇ l ligation mixture with T4 DNA ligase (Promega) according to the recommendations of the producer.
  • the ligation mix was introduced into E. coli strain INV ⁇ F 1 made competent according to the procedure of Inoue et al . (1990) Gene 96, 23-28. Bacteria containing the correct construct were identified by isolation of the plasmid, restriction enzyme mapping and DNA sequencing.
  • the plasmid in the following designated pTaq, contains an open reading frame coding for native Taq, except that the N-terminal sequence is MEFGML rather than MRGML in the native sequence, due to the choice of cloning procedure.
  • a restriction site was introduced in the part of the sequence that codes for the part of the polypeptide chain that links the 3 '-5' exo and the polymerase domain together, based on molecular modelling with the known 3D structure of the Klenow fragment as a template.
  • Site- directed mutagenesis was performed using a U.S.E. Mutagenesis Kit (Pharmacia Biotech, Sweden) according to the instructions of the manufacturer, except that the concentration of the mutagenic primer was 25 times higher than recommended, and that the pTaq template was denatured with alkali rather than heat.
  • the mutagenesis primer was GCCTCTCCACCTCG,CGATAAAGCCAAAGGA SEQ ID NO.
  • 5 ' -exo3 corresponds to part of the sequence of the cloned Cau DNA polymerase, described in Tvermyr et al . Genetic analysis: Biomolecular Engineering 14: 75-83 (1998).
  • pCauPol polymerase clone
  • 5'-exo3 in addition contains an EcoRI site.
  • 3 ' -exo3 is complementary to an area in the Cau DNA polymerase clone assumed to code for C-terminal part of the Cau 3'-5' exo domain .
  • primers were used to amplify DNA coding for the 3 ' -5 ' exo domain by using cloned Cau DNA polymerase as a template in a PCR reaction performed as described above, except that the annealing temperature was 55°C and that 30 cycles were used.
  • the PCR product was analysed in a 1% agarose gel. The part of the gel containing the 0.6 kb product was cut out and DNA purified using a Quiaquick kit (Qiagen) .
  • the PCR product obtained above was treated with the restriction endonuclease EcoRI and purified using a Qiaquick kit as above.
  • the purified, BcoRI-cut fragment was ligated into the large DNA fragment from pTaqMut that had been cut with EcoRI and Nrul to release the fragment coding for the two exonuclease domains and gel purified as described above.
  • plasmid DNA was prepared from colonies by boiling as described above. Restriction fragment analysis showed that 10 of these plasmids gave the anticipated pattern. One of these was chosen and its sequence verified by DNA sequencing.
  • this plasmid coding for the 3 '-5' exo domain from Cau DNA polymerase linked to the polymerase domain from Tag DNA polymerase is called pCauTaql (SEQ ID NO. 1) .
  • the encoded amino acid sequence is shown in SEQ ID NO. 2.
  • 3*-exo3b CGATAAAGCCAAAGGAGCCTCTCTTCAGCCTCTAACTGAC (SEQ ID NO. 10)
  • the first 23 5' nucleotides in this sequence are complementary to sequence in the Tag gene, while the rest is complementary to sequence from the Cau clone.
  • Amplification of DNA using cloned Cau DNA polymerase gene as a template and primer 5'-exo3 (see above) and 3 ' -exo3b as primers should give a fragment coding for the 3 '-5' exo domain from Cau DNA polymerase and in addition the 8 missing amino acid residues from the Taq polymerase domain.
  • pCauTaql and pCauTaq2 were separately transformed into the E. coli host strain INV F.
  • Bacteria containing pCauTaql or 2 , or the vector pTrc99A without an insert, were grown in 0.11 1 LB broth containing 100 ⁇ g/ml ampicillin by adding 0.5 ml of an overnight culture to 1 1 of the medium. The culture was grown to OD 600 approximately 0.6, and expression of the plasmid-encoded polypeptides was induced by the addition of IPTG to a final concentration of 125 ⁇ g/ml.
  • the cells were harvested by centrifugation and washed with 10 ml of buffer A (50 mM Tris-HCl pH 7.9, 50 mM dextrose, 1 mM EDTA) .
  • the cells from each culture were again recovered by centrifugation and suspended in 3 ml pre-lysis buffer (buffer A + 4 mg/ml lysozyme) .
  • buffer A + 4 mg/ml lysozyme Buffer A + 4 mg/ml lysozyme
  • lysis buffer 10 mM Tris-HCl pH 7.9, 50 mM KC1, 1 mM EDTA, 1 mM PMSF, 0.5% Tween 20, 0.5% Nonidet P40
  • cleared lysates prepared from mock transfected E. coli cultures showed that endogenous activity from E. coli DNA polymerases could not be detected, the cleared lysates containing the chimeric constructs were considered suitable for detection and initial characterization of polymerase activity in the constructs .
  • 10 ⁇ l of 10 X polymerase buffer 500mM KC1, lOOmM Tris-HCl (pH 9.0 at 25°C) , 50 mM MgCl 2 , 1% Triton ® X-100
  • 10 X polymerase buffer 500mM KC1, lOOmM Tris-HCl (pH 9.0 at 25°C) , 50 mM MgCl 2 , 1% Triton ® X-100
  • the optimal temperatures for the polymerase activities was determined using a DNA polymerase assay as described above, but incubating at various temperatures between 25 and 85°C. Also, the amount of 3 H-dTMP was increased to 0.5 ⁇ l (0.5 ⁇ Ci) and the incubation time reduced to 5 minutes .
  • the data from this experiment are given in Figure 1.
  • the Figure includes the temperature profiles of the polymerase activity of the ancestral enzymes, Tag polymerase and Cau polymerase. The results shown in Figure 1 indicate that CauTaq DNA polymerase has optimal polymerase activity at 55°C, while Cau polymerase and Taq polymerase have optimal activity at 65 and 75°C, respectively.
  • CauTaq DNA polymerase version 2 was diluted in reaction mixtures corresponding to the ones used for the DNA polymerase assay above, but without added activated DNA as a template. After incubation at various temperatures for various time intervals, the reaction tubes were transferred to a heating block at 55°C, which is the optimal temperature of the polymerase activity of the enzyme. 10 ⁇ g of activated DNA was added, and remaining polymerase activity was determined as described above. For comparison, Taq polymerase and Cau polymerase were treated in the same way at various temperatures and time intervals, before remaining polymerase activity was quantified at 70°C as above.
  • Example 5 Demonstration of 3' -5' exonuclease activity in the chimeric constructs, and characterization of the activity
  • the Match primer is complementary to part of the M13mpl8 template.
  • the Mismatch primer is identical to the Match primer except for the nucleotide in the 3', end, where the T in the Match primer is exchanged with an A in the Mismatch primer.
  • the position in M13mpl8 to which the primers anneal was chosen in such a way that the 3 ' ends of the primers overlap with a recognition site for the restriction endonuclease Alul in the template sequence. Further Alul sites are found 63 and 88 nt downstream of the 5' end of the primers.
  • Primer elongation followed by cutting of the double-stranded product with Alul would then give a 18 nt (nucleotides) long Cy5-labelled product, which could be detected and quantified using the DNA sequencer.
  • Any extension of the Mismatch primer would give a double-stranded product that would not be cut by Alul in this position, due to the mismatch introduced by the primer. Cutting in the other Alul sites would instead give a 63 nt long Cy5-labelled product .
  • any DNA polymerase would be able to extend it and in this way remove the 20 nt Cy5-labelled oligonucleotide from the reaction mix.
  • this assay depends on both the exonuclease activity and the polymerase activity of the DNA polymerases . Because of this it is not suited for quantitative assessments of any of these activities separately. Detection of 3' -5' exonuclease activity
  • the DNA polymerases were diluted until only about 20-50% of the Mismatch primer was edited and extended under standard conditions. The diluted enzymes were then analysed in a standard exonuclease assay as above, except that the incubation temperature was varied.
  • the amount of 18 nucleotides long product formed by Alul digestion of extension products relative to a fixed amount of Cy5-labelled oligonucleotide added to the reactions before loading on the polyacrylamide gel. In this way it is possible to compensate for any differences between the efficiency of the detectors associated with separate lanes in the gel .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne une ADN polymérase chimérique comprenant un domaine exonucléase 3'-5' d'une ADN polymérase et un domaine ADN polymérase d'une enzyme ADN polymérase hétérologue, ainsi que des molécules d'acide nucléique codant pour lesdites ADN polymérases chimériques. L'invention concerne également des vecteurs d'expression et des cellules hôtes pouvant exprimer de telles ADN polymérases chimériques, ainsi que l'utilisation de ces dernières dans de nombreuses techniques de biologie moléculaire.
PCT/GB2000/003478 1999-09-09 2000-09-08 Adn polymerases chimeriques thermoresistantes WO2001018213A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70275/00A AU7027500A (en) 1999-09-09 2000-09-08 Chimeric thermostable dna polymerases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9921318.3A GB9921318D0 (en) 1999-09-09 1999-09-09 Chimeric molecules
GB9921318.3 1999-09-09

Publications (1)

Publication Number Publication Date
WO2001018213A1 true WO2001018213A1 (fr) 2001-03-15

Family

ID=10860634

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/003478 WO2001018213A1 (fr) 1999-09-09 2000-09-08 Adn polymerases chimeriques thermoresistantes

Country Status (3)

Country Link
AU (1) AU7027500A (fr)
GB (1) GB9921318D0 (fr)
WO (1) WO2001018213A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001061015A2 (fr) * 2000-02-17 2001-08-23 Qiagen Gmbh Nouvelles acide nucleique polymerases chimeriques thermostables
WO2006010887A1 (fr) * 2004-07-26 2006-02-02 Bioline Limited Adn polymerase chimere
WO2010062776A3 (fr) * 2008-11-03 2010-08-19 Kapabiosystems Adn polymérases chimériques
US7960157B2 (en) 2002-12-20 2011-06-14 Agilent Technologies, Inc. DNA polymerase blends and uses thereof
US8124391B2 (en) 2000-10-05 2012-02-28 Qiagen Gmbh Thermostable polymerases from Thermococcus pacificus
CN105452451A (zh) * 2013-12-06 2016-03-30 生物辐射实验室股份有限公司 融合聚合酶
WO2016033315A3 (fr) * 2014-08-27 2016-06-02 New England Biolabs, Inc. Formation de synthon
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992006200A1 (fr) * 1990-09-28 1992-04-16 F. Hoffmann-La-Roche Ag Mutations d'adn-polymerases thermostables en 5' a 3' exonuclease
WO1994026766A1 (fr) * 1993-02-19 1994-11-24 Barnes Wayne M Adn polymerases presentant une extension d'amorce de thermostabilite, de longueur et d'efficacite accrues
EP0823479A2 (fr) * 1996-08-06 1998-02-11 F. Hoffmann-La Roche Ag Polymérase d'ADN thermostable modifiée
WO1999047649A2 (fr) * 1998-03-13 1999-09-23 Roche Diagnostics Gmbh Chimeres de polymerases
GB2344591A (en) * 1998-08-24 2000-06-14 Bioline Limited A chimaeric DNA polymerase

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992006200A1 (fr) * 1990-09-28 1992-04-16 F. Hoffmann-La-Roche Ag Mutations d'adn-polymerases thermostables en 5' a 3' exonuclease
WO1994026766A1 (fr) * 1993-02-19 1994-11-24 Barnes Wayne M Adn polymerases presentant une extension d'amorce de thermostabilite, de longueur et d'efficacite accrues
EP0823479A2 (fr) * 1996-08-06 1998-02-11 F. Hoffmann-La Roche Ag Polymérase d'ADN thermostable modifiée
WO1999047649A2 (fr) * 1998-03-13 1999-09-23 Roche Diagnostics Gmbh Chimeres de polymerases
GB2344591A (en) * 1998-08-24 2000-06-14 Bioline Limited A chimaeric DNA polymerase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TVERMYR MARIANNE ET AL: "Cloning, sequence analysis and expression in E. coli of the DNA polymerase I gene from Chloroflexus aurantiacus, a green nonsulfur eubacterium.", GENETIC ANALYSIS BIOMOLECULAR ENGINEERING, vol. 14, no. 3, January 1998 (1998-01-01), pages 75 - 83, XP002153289 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8637288B2 (en) 2000-02-17 2014-01-28 Qiagen, Gmbh Thermostable chimeric nucleic acid polymerases and uses thereof
WO2001061015A3 (fr) * 2000-02-17 2002-04-25 Dirk Loeffert Nouvelles acide nucleique polymerases chimeriques thermostables
WO2001061015A2 (fr) * 2000-02-17 2001-08-23 Qiagen Gmbh Nouvelles acide nucleique polymerases chimeriques thermostables
US8124391B2 (en) 2000-10-05 2012-02-28 Qiagen Gmbh Thermostable polymerases from Thermococcus pacificus
US7960157B2 (en) 2002-12-20 2011-06-14 Agilent Technologies, Inc. DNA polymerase blends and uses thereof
WO2006010887A1 (fr) * 2004-07-26 2006-02-02 Bioline Limited Adn polymerase chimere
US9388396B2 (en) 2008-11-03 2016-07-12 Kapa Biosystems, Inc. Chimeric DNA polymerases
WO2010062776A3 (fr) * 2008-11-03 2010-08-19 Kapabiosystems Adn polymérases chimériques
US9023633B2 (en) 2008-11-03 2015-05-05 Kapa Biosystems Chimeric DNA polymerases
US9840697B2 (en) 2013-12-06 2017-12-12 Bio-Rad Laboratories, Inc. Fusion polymerases
CN105452451A (zh) * 2013-12-06 2016-03-30 生物辐射实验室股份有限公司 融合聚合酶
CN105452451B (zh) * 2013-12-06 2020-06-05 生物辐射实验室股份有限公司 融合聚合酶
US10351831B2 (en) 2013-12-06 2019-07-16 Bio-Rad Laboratories, Inc. Fusion polymerases
EP2986719A4 (fr) * 2013-12-06 2016-10-26 Bio Rad Laboratories Polymérases de fusion
JP2017525376A (ja) * 2014-08-27 2017-09-07 ニユー・イングランド・バイオレイブス・インコーポレイテツド シントン形成
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same
EP3450558A3 (fr) * 2014-08-27 2019-05-15 New England Biolabs, Inc. Formation de synthon
US9447445B2 (en) 2014-08-27 2016-09-20 New England Biolabs, Inc. Synthon formation
WO2016033315A3 (fr) * 2014-08-27 2016-06-02 New England Biolabs, Inc. Formation de synthon
EP3778891A1 (fr) * 2014-08-27 2021-02-17 New England Biolabs, Inc. Formation de synthon

Also Published As

Publication number Publication date
GB9921318D0 (en) 1999-11-10
AU7027500A (en) 2001-04-10

Similar Documents

Publication Publication Date Title
Lawyer et al. High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5'to 3'exonuclease activity.
US10035993B2 (en) DNA polymerases and related methods
US5674738A (en) DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05
Lundberg et al. High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus
RU2235773C2 (ru) Модифицированная термостабильная днк-полимераза, способ её получения и применение
US9040276B2 (en) DNA binding protein-polymerase chimeras
US7943358B2 (en) Polymerase enhancing factor (PEF) extracts, PEF protein complexes, isolated PEF protein, and methods for purifying and identifying
US5405774A (en) DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17
US5814506A (en) Over-expression and purification of a truncated thermostable DNA polymerase by protein fusion
JP6579152B2 (ja) 改変された耐熱性ｄｎａポリメラーゼ
JP2001511018A (ja) 多型核酸フラグメントを分析または型分類するためのポリメラーゼおよびその使用
EP0799319B1 (fr) Adn-polymerase purifiee de thermococcus barossii
WO2002004022A9 (fr) Polymerases haute fidelite et leur utilisation
WO2001018213A1 (fr) Adn polymerases chimeriques thermoresistantes
WO2007076461A1 (fr) Adn polymerase thermostable provenant de thermus scotoductus
US20160024548A1 (en) Dna polymerases and related methods
WO2007117331A2 (fr) Nouvelle adn polymerase provenant d'un thermoanaerobacter tengcongenesis
WO2007076464A2 (fr) Adn polymerase thermostable provenant de thermus filiformis
JP5515373B2 (ja) 改良された耐熱性ｄｎａポリメラーゼ
Kim et al. Cloning, expression, and characterization of thermostable DNA polymerase from Thermoanaerobacter yonseiensis
WO2007143436A2 (fr) Nouvelle adn polymérase issue de spirochaeta thermophila
Susanti et al. Cloning, homological analysis, and expression of DNA Pol I from Geobacillus thermoleovorans
Lawyer et al. High-level expression, purification, and enzymatic characterization
Tvermyr et al. Cloning, sequence analysis and expression in E. coli of the DNA polymerase I gene from Chloroflexus aurantiacus, a green: nonsulfur eubacterium
Chalov et al. Thermostable DNA-polymerase from the thermophilic archaeon microorganism Archaeoglobus fulgidus VC16 and its features

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ CZ DE DE DK DK DM DZ EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP