WO2001011067A1 - Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof - Google Patents
Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof Download PDFInfo
- Publication number
- WO2001011067A1 WO2001011067A1 PCT/US2000/021410 US0021410W WO0111067A1 WO 2001011067 A1 WO2001011067 A1 WO 2001011067A1 US 0021410 W US0021410 W US 0021410W WO 0111067 A1 WO0111067 A1 WO 0111067A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- aav
- antigen
- cytokine
- precursors
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/29—Hepatitis virus
- A61K39/292—Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/19—Dendritic cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/24—Antigen-presenting cells [APC]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/35—Cytokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4203—Receptors for growth factors
- A61K40/4205—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4224—Molecules with a "CD" designation not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/46—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/59—Reproductive system, e.g. uterus, ovaries, cervix or testes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/02—Compounds of the arachidonic acid pathway, e.g. prostaglandins, leukotrienes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/22—Colony stimulating factors (G-CSF, GM-CSF)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/25—Tumour necrosing factors [TNF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- This present invention is directed to a method for preparing genetically altered dendritic cells (DC) using an adeno-associated virus (AAV) vector as the vehicle for introducing heterologous gene(s) into the DCs.
- AAV adeno-associated virus
- the present invention also is directed to the DCs produced by this method.
- the AAV vector is operably linked to at least one heterologous gene, which preferably encodes a cytokine or an antigen associated with a disease or combinations of one or more of each of these genes.
- the present invention also is directed to an immuno-stirnulatory treatment for a disease, particularly cancer, such as cervical cancer, breast cancer and muliple myeloma, or an infectious disease, such as Hepatitis B or C virus, AIDS, or warts, that involves the administration of the patient's antigen presenting DCs that have been genetically altered to contain at least one heterologous gene, such as a disease specific antigen, that is preferably stably integrated into the DCs' genome.
- a disease specific antigen that is preferably stably integrated into the DCs' genome.
- Any antigen that is a marker for a specific disease such as infectious diseases or a tumor specific marker, can be delivered to a DC via AAV vector delivery, according to the present invention.
- DCs express the gene encoding the antigen, process the antigen and present this antigen as an antigenic epitope for T-cell priming. But even a genetically altered DC that carries a heterolgous gene encoding a cytokine is useful for treating cancers or other diseases that would benefit from cytokine treatment because the expression of cytokines by the DCs stimulates the basal level of tumor cell recognition and enhanced the immune response. Additionally, these genetically altered DCs are useful to stimulate the patient's own T-cells in vivo and/or these genetically altered DCs are useful to stimulate T-cells in vitro, and then these primed T-cells are administered to the patient to stimulate the patient's immune system via adoptive immunotherapy.
- DCs although rare, are potent and the most effective antigen presenting cells (APC), which are able to initiate primary immune response to antigens by naive T cells.
- APC antigen presenting cells
- Several research groups (2,3) have developed tissue culture protocols for generating large numbers of DCs in vitro from peripheral blood in the presence of GM-CSF and IL-4.
- Recent studies (64, 100) have established the key role played by DCs in the immune system and provide a rationale for using DCs as natural adjuvants for human immunotherapy (4).
- the ability to culture DCs from peripheral blood allows DCs to be used to manipulate the immune response of autologous human T cells (4). This manipulation offers great promise as an imrnunotherapeutic adjunct to current cancer and infectious disease therapies.
- cytokines granulocyte macrophage-colony stimulating factor (GM-CSF) and interleukin-4 (IL-4), are needed for the generation of dendritic cells.
- GM-CSF granulocyte macrophage-colony stimulating factor
- IL-4 interleukin-4
- AAV helper dependent parvovirus adeno-associated virus
- AAV has been shown to be a versatile virus vector, being able to transduce a wide variety of cell types, including an effective gene delivery vector for both immortalized tissue culture cells, as well as primary hematopoietic cells. (45,49,67,81, 92-96).
- AAV is an efficient delivery vector that generates minimal intrinsic immunogenicity .
- Other viruses including retroviruses, adenoviruses. and pox viruses, have previously been shown to transduce DCs (9,11,24,29), but no one has been able to show the transduction of DCs with AAV. This may be so because AAV prefers transducing host cells that are actively dividing rather than quiescent cells, such as DCs that do not divide.
- AAV does not possess the drawbacks of these other viruses that includes their large size and that they carry extra genes into the transduced DCs. Thus, these larger viruses are not particularly useful for an immunotherapy treatment that focuses on obtaining an immune response to a particular antigen because these additional proteins elicit immune responses and do not allow the patient's immune system to focus on the immune response to the particular antigen.
- AAV is smaller in size and presents less complicated epitopes to the patient then retroviruses or adenoviruses. Additionally and very importantly, the retroviruses and retroviral vectors have been banned for use in gene therapy by the Food and Drug Administration. For all of these reasons, a more suitable choice of a vector for transducing DCs, such as an AAV vector, is needed.
- HPV infection Human papillomavirus (HPV) infection represents the most important risk factor for developing cervical cancer. Although there are over 20 oncogenic HPV genotypes, HPV- 16 and -18 are the most prevalent in cervical cancers regardless of geographic location. The E6 and E7 transforming oncoproteins of these two viruses are detected in the vast majority of HPV -positive cancer biopies and almost all HPV -containing cell lines and they play a crucial role in both transformation and maintenance of the malignant phenotype. Therefore, E6 and E7 are ideal candidates as potential tumor specific targets for cervical cancer immunotherapy.
- cervical cancer Because of the unique viral antigens/viral oncoproteins HPV (E6/E7), which are always present in cervical cancer ( > 90%) but are not usually present in normal tissues, cervical cancer is an ideal cancer for testing the promise of immunotherapy according to the present invention. Furthermore, cervical cancer is a very important cancer world-wide because it ranks just behind breast cancer in its prevalence in world statistics but, in fact, ranks higher than breast cancer in the developing world.
- HPV E6 and E7 specific CTLs in cervical cancer patients, suggesting that such CTL precursors may be present at low levels.
- HPV naturally infected targets e.g. , keratinocytes
- MHC major histocompatibility complex
- presentation of viral antigens by these non-professional APCs may in part explain the capacity of HPV to evade the host immune system. Consistent with this hypothesis, hyporesponsiveness or tolerance have been previously reported following presentation of "non-self" antigens by keratinocytes.
- breast cancer Another type of cancer that can benefit from the immuno-stimulatory treatment of the present invention is breast cancer because specific antigens have been identified that are associated with breast carcinomas.
- Breast cancer vies with lung cancer as one of the most prevalent cancers.
- ConA Concanavalin A
- tetanus toxoid tetanus toxoid
- allogeneic T cells when compared to controls in a mixed lymphocyte reaction. Further, the degree of defectiveness was dependent upon the stage of breast cancer.
- stage 4 patients the most invasive, the defect in proliferation was as much as 85% .
- the defect was specifically localized to the DCs and not the T cells, by combining various cell populations.
- DCs were generated from peripheral blood monocytes from these stage 4 breast cancer patients, no defect was found in their ability to stimulate T cell response.
- the present invention avoids this by generating DCs from peripheral blood.
- the methods, AAV vectors and genetically altered DCs of the present invention are useful to treat breast cancer by utilizing identified breast cancer associated antigens.
- a number of breast cancer antigens have been identified, but many are expressed only in a limited number of breast cancers. It is important to select a breast cancer antigen for use in the present invention, that is expressed in a large number of breast tumors.
- BA46 also called Lactadherin
- Lactadherin is a membrane-associated glycoprotein which is almost universally expressed in breast carcinomas. This protein is a part of milk and has been referred to as "milk fat globule membrane. " (103) But this protein is also expressed in most breast cancer cells, being found expressed in 7 of 7 of such cell lines (104). Furthermore, the protein/antigen is expressed on the cell surface (105-107). Antibodies against this protein also are available (108-110). The antigen has been cloned and its size of 46 kDa, translating to a size of about 1 kilobase of DNA, can easily fit inside an AAV vector.
- Her-2/neu is an important oncogene involved in breast cancer. ErbB2 or Her-2/neu was originally isolated as a defective retroviral viral oncogene in the chicken erythroblastosis virus (111). A normal cellular homologue (proto-oncogene) to the viral oncogene was soon discovered (112).
- Her-2/neu protein is over expressed in 40-50% of breast cancer tissues compared to adjacent normal tissue (113,114). The over expression of this protein appears to be linked with the preferential amplification of this gene in these breast cancers (115, 116). This has been recognized by others and, thus, Her-2/neu (erbB2) has been thought to be a potential target for immunotherapy as early as 1990 (117).
- CD24 is a cell surface protein and appears to be a ligand for P-selectin and this interaction is important for leukocyte-endothelium interaction (118-120). It is a small protein of only 27 amino-acids and undergoes extensive post translational modification, being highly glycosylated and bound to the membrane via a phosphatidylinositol anchor (120). CD24 appears to be expressed on several cancers, including small cell carcinoma, neuroblastoma, rhabdomyosarcoma and renal cell carcinoma.
- CD24 appears to be highly expressed in ductal breast cancers, being over expressed in 31 of 31 such tissues by immunohistochemistry (123), but a disadvantage is that CD24 also is expressed on some B cells during early stages of B cell development (124).
- Her-2/neu has been used as an antigenic target by a number of studies for breast and pancreatic cancer (125-129). Three studies have used Her-2/neu derived oligopeptides transfected into DCs to elicit an immunoresponse and these treatments have generated some success. (126, 127, 129). Another technique has been the use of a fibroblast cell line which overexpressed Her-2/neu as the immunogen that was partially successful. (127)
- the present invention shows for the first time that AAV transduces and chromosomally integrate into cells of the dendritic lineage.
- the present method utilizes AAV to transduce DCs with heterologous genes that are integrated into the genome of the DCs.
- the present method provides improvements in DC production and function resulting in a superior cytotoxic CD8+ T cell response and CD4+ helper T cell proliferation in vitro and in vivo.
- the DCs produced by the present invention are useful in studying DC function and their role in the immune system as APCs. Additionally, these genetically altered DCs are useful as an effective immuno-therapeutic regime for cancers and infectious diseases that involves the manipulation of these APCs. Immunizations with DCs transduced with tumor antigens or antigens associated with infectious diseases, or T-cells stimuated with these DCs provide effective methods of inducing antitumor or anti-infectious disease immunity in a patient.
- the present invention also provides a more effective technique for treating DCs with proteins, such as antigens and/or cytokines, by transducing the genes encoding these proteins into the DCs via AAV delivery.
- proteins such as antigens and/or cytokines
- the integration of these genes into the genome of the DCs, with subsequent expression of these genes, provides an improvement over the incubation of DCs with these proteins.
- Delivery of the entire gene has other advantages relevant to the induced immune response.
- Many DC-pulsing protocols use antigen-derived oligopeptides, which represent a very limited number of epitopes compared to the entire protein.
- the present method provides for the continuous production of the antigen and/or cytokine and overcomes any immune deficits resulting from the continual recycling of class I and II molecules and loss of sensitizing epitopes. Further, the method of the present invention introduces more epitopes than by the above methods of oligopeptide introduction or pulsing of DCs. Additionally, it is expected that AAV delivery of an antigen results in higher class I antigen epitope presentation. Further, the present method provides epitopes that are generated and presented endogenously, which is intended to be more representative than epitopes of proteins that are produced in bacteria and delivered to the DCs by way of incubation or pulsing.
- the present invention is the first reported successful DC transduction by AAV with the stable integration of the transduced gene into the DCs genome.
- the present invention utilizes AAV to transduce at least one heterologous gene into DCs.
- the resulting AAV transduced DCs, produced according to the present invention display many of the markers characteristic of mature DCs, supporting the usefulness of the present invention as outlined recently.
- the present invention discloses that AAV transduces and stably integrates into the genome cells of the dendritic lineage, and thus represents a step forward in providing an excellent APC for studying DC function and its role in the immune system.
- the present invention also provides a genetically altered DC for use in immuno-therapy containing genes encoding a specific antigen associated with a disease and/or a cytokine or combinations of one or more of each, that provides improvements in DC production and function resulting in a superior cytotoxic CD8 + T cell response and CD4+ helper T cell proliferation.
- the present invention is based upon the successful transduction of DCs by an AAV vector containing a heterologous gene to obtain genetically altered DCs expressing the heterologous gene in the DCs.
- a method for preparing genetically altered DCs comprises: (a) obtaining DC precursors from a human subject; and (b) transducing the DC precursors with at least one AAV vector comprising at least one heterologous gene to obtain genetically altered DCs expressing said heterolgous gene.
- the present invention is directed to an adeno-associated virus (AAV) vector comprising at least a portion of the AAV genome and at least one heterologous gene selected from the group consisting of a gene encoding an antigen, a gene encoding a cytokine and combinations of one or more genes thereof.
- AAV adeno-associated virus
- the genetically altered DCs produced by the methods of the present invention also are provided. These altered DCs are able to express one or more of the heterologous gene that have been transduced into the DCs.
- an AAV vector comprises at least a portion of the AAV genome and at least one heterologous gene selected from the group consisting of a gene encoding an antigen, a gene encoding a cytokine and combinations of one or more genes thereof, and also provided is a DC containing this vector.
- the present invention is directed to a method for stimulating the immune system of a patient afflicted with a disease comprising administering to the patient genetically altered DCs comprising at least one AAV vector comprising at least one heterologous gene selected from the group consisting of a gene encoding an antigen associated with said disease, a gene encoding a cytokine and combinations of one or more genes thereof, whereby the heterologous gene is expressed in the DCs and the patient's immune system is stimulated by the stimulation of the patient's T cell response.
- the method for stimulating the immune system of a patient afflicted with a disease comprises administering to the patient stimulated T cells, wherein the T-cells were stimulated by genetically altered DCs comprising at least one AAV vector comprising at least one heterologous gene selected from the group consisting of a gene encoding an antigen associated with the disease, a gene encoding a cytokine and combinations of one or more genes thereof, whereby the heterologous gene is expressed in the DCs and the patient's immune system is stimulated by the patient's T-cell response.
- the methods of the present invention are useful for generating DCs that can be manipulated, studied, utilized in in vitro experiments and in in vivo treatments of patients.
- the methods of the present invention are useful in generating DCs for use in the general stimulation of the immune response in animals and humans.
- the invention is directed to a pharmaceutical composition comprising cells selected from the group consisting of: a) genetically altered DCs comprising the AAV vector comprising at least one heterologous gene selected from the group consisting of a gene encoding an antigen, a gene encoding a cytokine and combinations of one or more genes expressed in the DCs; b) CD8+ cytotoxic T cells stimulated by the cells of a); c) CD4+ helper T cells stimulated by the cells of a); and d) a combination of at least two of cells of a), b) and c); and a pharmaceutically acceptable carrier.
- Figure 1 shows the map of the dl6-95/GM-CSF p5 /Neo SV4 ° virus vector and primer /probe design for PCR/Southern blot analysis of integrated provirus.
- Figure 1A shows a structural map of the dl6-95/GM-CSF p: 7Neo SV40 virus with the names of the components at the top.
- TR black box
- p5 (bent arrow) refers to the AAV p5 promoter.
- the cross hatched box is the GM-CSF open reading frame.
- SV40 epr (stipled box/bent arrow) refers to the SV 40 early enhancer/promoter.
- FIG. 1 The checkered box is the Neo open reading frame.
- Figure IB shows the location of the PCR primers and the probe by which chromosomal integration was demonstrated in Figure 9.
- Figure 2 shows the production and characterization of AAV/GM-CSF/Neo virus stock.
- Figure 2A shows a Southern blot of 11 putative producer cell lines as described in the Materials and Methods. The blot was probed with 32 P-Neo DNA. Note that 293-AGN clones 5 and 7 produced the highest levels of AAV/GM-CSF/Neo DNA replication.
- Figure 2B shows a titering dot blot hybridization of the AAV/GM-CSF/Neo virus stock generated from clone 293-AGN-5.
- FIG. 1 shows the overview of culture techniques for generating DCs.
- Method A shows the traditional technique of Sallusto and Lanzavecchia (1994) and Romani et al. (1994) for generating primary cell cultures enriched for DCs (2,3).
- Method B shows an alteration of this technique which allows for a period of precursor cell proliferation.
- the cells are treated sequentially, first with GM-CSF, then with IL-4.
- This technique also results in DCs, but the resulting population is slightly less pure.
- Method C shows the primary technique used in the present invention which is an alteration of B in which exogenous GM-CSF addition is replaced by infection with the AAV/GM-CSF/Neo virus.
- FIG. 4 shows G418 resistance by infected monocytes. Freshly isolated adherent cells were treated with AAV/GM-CSF/Neo virus, exogenous GM-CSF, or untreated as indicated. After 48 hours the cells were selected with 300 ⁇ gs G418. Viable cells were then counted at the indicated times post-infection. The symbol ⁇ indicates G418 selected, mock infected cells. ⁇ indicates G418 selected, exogenous GM-CSF treated cells. ⁇ indicates G418 selected. AAV/GM-CSF/Neo virus (1 ml) infected cells. Note that only the AAV dAAV/GM-CSF/Neo virus infected cells were resistant to G418.
- Figure 5 shows the secretion of GM-CSF by infected monocytes.
- Conditioned medium 100 ⁇ l from a total of 4ml
- EIA Sandwich enzyme immunoassay
- Figure 6 shows GM-CSF RNA expression in infected monocytes.
- Total RNA was isolated from three cell populations: mock infected, AAV-AP-infected, and AAV/GM-
- CSF/infected adherent monocytes at 48 hours post-infection. These samples were analyzed by RT-PCR and PCR, as indicated, for the presence of GM-CSF RNA as described below.
- the positive control was the PCR product resulting from using the AAV/GM-CSF/Neo vector plasmid as a template.
- Another control was PCR analysis of RNA from cells infected by AAV/GM-CSF/Neo virus.
- Figure 7 shows GM-CSF-induced monocyte proliferation by infected monocytes. Equivalent wells of freshly isolated adherent cells were treated as indicated, cultured for eight days, and then the cells counted.
- Figure 7 A shows the total monocyte numbers generated by the indicated treatments. The experiment was done in quadruplicate, with mean and standard deviation given, with the exception of the AAV/AP/Neo infections which were done only once.
- Quantified cell numbers were: exogenous GM-CSF, 5.91 +/- .67; mock, 3.42 + /-.26; AAV/AP/Neo: 1 ⁇ l, 3.48; 10 ⁇ l, 0.3.74; 100 ⁇ l, 4.27; 1000 ⁇ l, 4.56; AAV/GM-CSF: 1 ⁇ l 4.98 + /-.47; 10 ⁇ l, 5.75 + /-.04; 100 ⁇ l, 7.07 + /-.85; 1000 ⁇ l, 25.31 +/-8.11.
- Figure 7B shows the number of cells of dendritic morphology (large cells with pseudopodia) generated by the indicated treatments.
- FIG. 8 shows AAV/GM-CSF/Neo- infected monocytes differentiate into DCs, displaying multiple classical surface markers .
- Adherent monocytes were infected with with AAV/GM-CSF-Neo virus (1 ml) then, after 2 days, treated with IL-4 for four days. Finally the cells were treated with TNF ⁇ for two days. On day eight the cells were analyzed for the expression of HLA-DR (MHC class II)(97%), CD14 (0%), CD40 (74%), CD80 (64%), CD83 (37%), and CD86 (96%) by FACS analysis, as described below. Dendritic are DR+ , CD40+ , CD80+ , CD83 + , CD86 + , and CD14-. Thus, the FACS profiles are consistent with the AAV/GM-CSF/Neo infected cells being mature DCs.
- Figure 9 shows viral chromosomal integration in CD83 positive DCs.
- Traditionally generated DCs (exogenous IL- 4 and GM-CSF addition) served as uninfected controls.
- Total cellular DNA (0.1 ⁇ gs) from the infected, CD83 + selected cells and uninfected cells served as template in PCR amplification assays using primers targeting the SV40 early promoter of the vector and the cellular repetitive Alu I element. The products were Southern blotted and probed with 32 P- Neo DNA.
- the positive control lane contained 100 ng of linearized AAV/GM-CSF plasmid (6.9 Kb).
- the negative control lane contained products from a PCR reaction with no template DNA.
- Figure 10 shows a diagram of the structure of the DC pulsing techniques used in the present invention.
- Figure 11 shows HPV-16 E6-specific CD8+ CTL response with DCs pulsed with the E6 gene in an AAV vector compared with pulsing DCs with bacterially produced E6 protein.
- Figure 12 shows HPV-16 E7-specific CD8+ CTL response with DCs pulsed with the E7 gene in an AAV vector compared with pulsing DCs with bacterially produced GST- E7 that had been mixed with DOTAP.
- Figure 13 shows the FACS analysis of T cell populations resulting from different
- FIG. 14 shows the early onset of DC-Tcell priming rosettes formed in AAV/E7/Neo pulsed DC-Tcell incubation compared to GST-E7 and lysate pulsing.
- the present invention provides DCs that have been genetically altered by transduction with at least one AAV vector containing at least one heterologous gene.
- transduction refers to the process by which eukaryotic cells take up foreign DNA, and in some instances, integrate that foreign DNA into their chromosomes.
- transfection has a similar meaning to refer to the incorporation of foreign or heterologous DNA into eukaryotic cells. The success of this transduction indicates that AAV is an effective vector for manipulating DCs. There have been no reports of the successful transduction of DCs with AAV containing a heterologous gene where the AAV and heterologous gene are stably integrated into the cell's genome.
- the present invention is useful for generating DCs, particularly when the heterologous gene transduced into the DC precursor cells via AAV transduction is a cytokine that promotes cell proliferation, e.g. GM-CSF.
- a cytokine that promotes cell proliferation
- GM-CSF e.g. GM-CSF.
- transducing them with heterologous genes provides a research tool for studying the function and the role these cells play in the immune response and a means for stimulating the immune response.
- the introduction and over-expression of immunologically relevant surface proteins provides the DCs with the capability to become an even better APC.
- the over-expression of ⁇ 2 microglobulin may result in improvements of MHC class I expression and improvements in dendritic CD8 cytotoxic T cell interaction and antigen presentation because of its role in regulating class I levels (82-84).
- the transduction and stable expression of the antigen gene within the DC itself improves DC function.
- the heterologous gene when the heterologous gene is integrated in the DC and expresses one or more antigens and/or cytokines, such expression is a continuous source of the antigen or cytokine that is not lost or degraded when the DC is pulsed or incubated with these proteins.
- the heterologous gene also can be expressed, even if it is not integrated into the DC genome but exists in episomal form in the DC.
- the present invention provides a method for preparing genetically altered DCs, wherein the method comprises: (a) obtaining DC precursors from a human subject; and (b) transducing the DC precursors with at least one AAV vector comprising at least one heterologous gene to obtain genetically altered DCs expressing the heterolgous gene.
- the method of producing genetically altered DCs more specifically comprises incubating the transduced precursors in medium with or without at least one cytokine that promotes cell proliferation of the transduced precursors. If there is no cytokine that promotes cell proliferation present in the medium, then at least one of the heterologous genes must encode at least one cytokine that promotes cell proliferation.
- the DC precursors divide and proliferate during which time period, the AAV vector and its included heterologous gene(s) are preferably being integrated into the dendritic cell's genome.
- This cytokine can be any cytokine that promotes cell proliferation but GM-CSF is preferred.
- a second cytokine that promotes differentiation of the transduced dendritic cell precursors is added to the medium.
- any cytokine that promotes differentiation can be used.
- IL-4 and tumor necrosis factor ⁇ (TNF ⁇ ) or a combination of the two is preferred, but IL-4 is most preferred.
- This cytokine that promotes cell differentiation is added sequentially after incubation with the cytokine that promotes cell proliferation, and not at the same time immediately after transduction as the first added cytokine that promotes cell proliferation. It has been shown that the longer the DC precursors are cultured in GM-CSF alone before adding IL-4, the less number of cells that differentiate into DCs. (64) The data show decreasing numbers of differentiated DCs after adding IL-4 at 2 days, than at 5 days and than at 9 days. Therefore, the optimum time period to add the IL-4 is at least at 2 days after transduction. However, culture conditions may vary, thus an adjustment of the timing to add IL-4 may vary from the 2 day optimum.
- IL-4 at least 2 days after transduction provides consistent results for converting maximum numbers of precursors to DCs.
- these precursors are preferably incubated for an additional 3 days to obtain DCs.
- These DCs can additionally be incubated for another 2 days with TNF- ⁇ , IL-l ⁇ , and PGE2a (prostaglandin E2a) to produce the final maturation of the DCs.
- the AAV vector contains at least one heterologous gene that expresses at least one cytokine that promotes cell proliferation of the transduced dendritic cell precursors.
- the DC precursors transduced with a gene encoding at least one cytokine expresses a cytokine that is important to the cell for cell proliferation.
- the stable introduction of cytokine genes into the DCs offers an improvement over adding the cytokines exogenously and may benefit from the continuous production of cytokines from the cells.
- the medium for incubating the precursors after transduction can optionally contain a cytokine that promotes DC proliferation, such as, GM-CSF, to accelerate the cell proliferation stage of the incubation.
- the transduced cells alternatively are cultured in the absence of exogenous GM-CSF until the transduced cells produce their own GM-CSF, which is approximately 24 to 48 hours after transduction, and is in sufficient quantities to promote DC proliferation of the transduced precursors in the medium. Generally, it takes from 1 to 2 days for a newly integrated heterologous gene to be expressed in a mammalian cell. Then at least one cytokine that promotes differentiation of the DC precursors, such as IL-4, is added after transduction, using the time frame for addition discussed above, with addition of IL-4 preferably at approximately 2 days. Selecting the optimum time period for the addition of the cell differentiating cytokine is determined by the skilled artisan by trial and error experimentation.
- the minimum time for addition of the DC differentiation cytokine depends on a number of variables but can be affected by the addition of exogenous GM- CSF, in addition to the expression of heterologous GM-CSF from the transduced DC pecursors.
- heterologous is intended to mean that the source of the gene or protein is not from the specific cell that it has been introduced into.
- the AAV transduced DC precursors are initially incubated in a cytokine to promote cell proliferation or in media without the cytokine to promote cell proliferation, in the case where the transduced DC precursors express their own cell proliferation cytokine or the DC precursors can produce their own cytokine and be incubated in medium containing the cytokine as well. This initial incubation that allows DC proliferation is followed by subsequent addition of at least one cytokine that promotes cell differentiation. Additionally other cytokines, such as TNF- ⁇ , IL-l ⁇ and PGE2a can be added to obtain a fully mature DC beyond the incubation with GM-CSF and IL-4.
- AAV vector constructs for precursor transduction are preferred but the invention is not intended to be limited to these constructs: AAV-E6, AAV-E7, AAV-L1, AAV-E6-E7, AAV-E6- E7-L1, AAV-BA46, AAV-Her-2, AAV-CD24, and AAV-any combination of any other disease specific, pathogen specific or other tumor specific antigen encoding genes, AAV- GM-CSF, AAV-IL-12, AAV-IL-4, AAV-GM-CSF-IL-12, AAV-GM-CSF-IL-4, AAV-GM- CSF-IL-12-IL-4 , AAV-any other cytokine or combination of cytokines and antigens,
- the goal is to obtain DC proliferation to a specified number and then add or torn on expression of the cytokine that promotes cell differentiation into a mature DC.
- the AAV vectors that contain IL-4 can be used but should be monitored for early differentiation of the DCs.
- the timing of the expression of IL-4 from the integrated gene(s) should allow earlier cell proliferation by the GM-CSF prior to the expression of IL-4. It also is possible to transduce the DC precursors with two separate AAV vectors, one containing the proliferation cytokine gene and the other one containing the differentiation cytokine gene. The formed vector transforms the DC precursors and then the latter vectors transforms the same cells after an appropriate period of time to allow sufficient proliferation of the cells prior to differentiation.
- AAV-E7-GM-CSF AAV-E6-GMCSF, AAV-L1-GM-CSF, AAV-GM-CSF, AAV-IL-12-GM-CSF, AAV-IL-4- GM-CSF, AAV-any other cytokine-GM-CSF, AAV-E7-E6-GM-CSF, AAV-E6-E7-L1- GM-CSF.
- an AAV vector contains the AAV-GM-CSF- any pathogen specific, disease specific or tumor specific genes so that the DC precursors will proliferate with the expression of GM- CSF in the DC precursor and/or GM-CSF in the medium, and then at least one cytokine that promotes DC differentiation is added to the media.
- a DC that expresses a cytokine on a continuous basis after it has matured into a DC.
- an AAV-GM-CSF vector transduces the DC precursors, which are then incubated with or without at least GM-CSF in the medium.
- a cytokine that promotes DC differentiation is added to the medium or an AAV-IL-4 gene containing vector transduces the DC precursors.
- additional cytokines such as TNF- ⁇ , IL-l ⁇ and PGE2a also are added to the media after the differentiation of the DC precursors by IL-4.
- an AAV vector containing at least one or preferably all of genes encoding TNF- ⁇ . IL-l ⁇ and PGE2a transduces the DCs to obtain fully mature DCs.
- the cytokines that are added to the medium to differentiate the DC precursors alternatively may be added by transducing the DC precursors with AAV vectors that encodes these DC differentiation cytokines so that these cytokines are expressed after the DC precursors have proliferated.
- the mature DCs expressing only cytokines, such as GM-CSF, IL-2 or IL-12, are useful as adjunct therapy for cancer treatment or for infectious disease treatment. These latter DCs would be useful to stimulate the basal level of tumor cell recognition.
- the method for preparing genetically altered DCs comprises: (a) obtaining DC precursors from a subject; (b) transducing the DC precursors with at least one AAV vector comprising at least one heterologous gene selected from the group consisting of a gene encoding a protein or antigen, a gene encoding a cytokine and combinations of one or more genes thereof; and (c) incubating the DC precursors in medium under conditions whereby the DC precursors differentiate into DCs that contain the heterologous gene stably integrated into the genome of the DC to obtain genetically altered DCs.
- the medium of incubation step (c) comprises at least one cytokine that promotes cell proliferation of said precursors, and wherein a second cytokine that promotes differentiation of the precursors is added to the medium subsequent to the addition of the first cytokine.
- the timing of addition of the cytokines and the specific cytokines are discussed above.
- the differentiation DCs also can be made available to the DC precursors by transduction with at least one AAV vector containing the genes encoding one or more of the DC differentiation cytokines.
- the heterologous gene(s) contained in the AAV vector are operably linked to a promoter functional in the DCs. If more than one heterologous gene is present in the AAV vector, each heterologous gene is operably linked to a promoter functional in DCs or these genes can be connected as a polycistronic message under the control of a single promoter. Suitable promoters are known to persons skilled in the art.
- the heterologous gene or genes may be operably linked to the AAV p5 promoter but any promoter functional in the DCs are preferred.
- a promoter isolated from the DCs is also preferred as a useful promoter in the present invention and is expected to increase expression of the genes to which it is operably linked.
- the heterologous gene is an antigen, such as an antigen gene associated with a human disease
- the DCs are useful to study the function and role of DCs in the immune system as well as useftil for immunotherapy.
- the AAV vector transduction of antigens allows for better HLA (human leukocyte antigen) class I presentation of tumor and viral antigens when compared to exogenous protein introduction. Such class I presentation is critical for the induction of viral and tumor specific cytotoxic T cell response.
- the antigen gene is preferably a diseas specific antigen, a tumor specific antigen gene or a pathogen specific antigen gene.
- the preferred antigen is a human papilloma virus antigen, a hepatitis virus antigen, such a hepatitis B or C virus antigen, a HIV antigen and a breast cancer specific antigen.
- the more preferred antigens are HPV E6, HPV E7, HPV LI capsid gene, and breast cancer specific antigens, BA46, Her-2/neu and CD24.
- the heterologous gene is a gene encoding a cytokine
- the preferred cytokines are selected from the group consisting of a colony stimulating factor (CSF), interleukin (IL), such as IL-2, IL-4, IL-12, and IL-1, TNF, PG (prostatglandin) and combinations thereof. More preferably, the cytokines are GM-CSF, IL-4, IL-12, TNF ⁇ , IL-l ⁇ and PGE2a.
- the preferred cytokine for generating DCs for studying and analysis are GM-CSF
- GM-CSF is added initially to promote cell proliferation and then IL-4, and if fully mature DCs are desired, then TNF ⁇ , IL-l ⁇ and PGE2 are added to obtain further cell maturation.
- the GM-CSF, IL-2 and IL-12 are the preferred cytokines.
- the GM-CSF is preferably transduced into the cell precursors via AAV and the cell differentiation cytokines are added subsequent to the GM-CSF to obtain DCs for immunotherapy or priming the subject's T-cells.
- the AAV vector used in the present invention is obtained by partial digestion of a wild type AAV genome with Bsal to delete internal AAV sequences. More preferably the AAV vector contains a polylinker, and most preferably is dl6-95/PLl. (139)
- DCs encompassed by the present invention are any DCs comprising the AAV vector containing at least one heterologous gene, preferably stably integrated into the genome of DCs.
- the present invention provides a method for stimulating the immune system of a patient afflicted with a disease comprising administering to the patient genetically altered DCs, preferably the patient's DCs.
- AAV vector comprising at least one heterologous gene selected from the group consisting of a gene encoding an antigen associated with a disease afflicting the patient, a gene encoding a cytokine and combinations of one or more genes thereof, whereby the heterologous gene is expressed in the DCs and the patient's immune system is stimulated by the stimulation of the patient's T cell response.
- genetically altered DCs are obtained by the previously described methods, and then are administered to the patient.
- the AAV vectors used to transduce the patient's DCs can contain one or more antigens associated with the patient's disease and/or one or more cytokine that promotes cell proliferation and cell differentiation.
- AAV vector containing the heterologous gene(s) can be used to co-transduce the DCs and the AAV vectors can be transduced at different times to allow the expression of different cytokines at different times in the development of the DCs.
- AAV vectors can be used to transduce the precursors as vehicles for bringing the desired heterologous genes into the cells.
- the antigen and/or cytokine genes become stably integrated into the genome of the DCs and are expressed in these cells but the AAV containing the genes may survive and be maintained in an episomal form.
- the dendritic cell precursors are obtained from the patient's blood by separating out the peripheral blood monocytes according to methods disclosed below and isolating adherent monocytes, also referred to a dendritic cell precursors.
- This immunotherapy method uses genetically altered DCs as described herein that contain the appropriate antigens for stimulating the patient's T-cell response, as well as cytokines necessary for the preparation of the DCs from their precursors. These genetically altered DCs are then administered to the patient to stimulate the patient's T cell response.
- the genetically altered DCs produced by the present method are incubated with the patient's CD8 + cytotoxic T cells prior to administering the genetically altered DCs to said patient.
- the genetically altered DCs are incubated with the patient's CD8+ cytotoxic T cells, and with or without the patient's CD4+ helper T cells to stimulate the T cells against the antigens that the genetically altered DCs are carrying. These stimulated T cells then are administered to the patient to stimulate the patient's T cell response.
- the present invention provides a method for delivery of a pharmaceutical composition to a mammal, e.g. a human subject or patient, by transducing dendritic cell precursors with an AAV vector containing at least one heterologous gene of the present invention and introducing the transduced cells into the mammal.
- the heterologous gene(s) are expressed in the genetically altered DCs, and in turn, stimulates the subject's T cell response.
- the genetically altered DCs are incubated with the subject's CD8 + cytotoxic T cells, and optionally, to provide a stronger response, with the subject's CD4+ helper T cells.
- the genetically altered DCs are separated from the T cells or the DCs and the stimulated T cells are administered to the subject in a pharmaceutical composition.
- the patient is parenterally administered a therapeutically effective amount of genetically altered DCs and/or CD8 + cytotoxic T cells and/or CD4+ helper T cells in a pharmaceutically acceptable carrier pursuant to methods well known in the art, e.g. in a suspension of physiological PBS.
- the cells are administered intravenously, subcutaneously or directly into a tumor, however, the mode of administration can be any mode by which the cells are delivered to the patients body in an efficient manner to allow more efficient and effective delivery of the pharmaceutical composition. Dosages and frequency of administration varies with the age, weight and physical condition of the patient, accordingly to well-known protocols.
- the wild type AAV genome pSM620 (54) was partially digested with Bsa I so as to delete the internal AAV sequences from map units 6 to 95 (nt 286-4460) and a specially designed polylinker was ligated in place, resulting in the AAV vector plasmid dl6-95/PLl.
- the AAV vector dl6-95 is a Bsal-Bsal deletion vector with an intact p5 promoter.
- Neomycin resistance gene Neo
- GM- CSF human granulocyte macrophage-colony stimulating factor
- dl6-95/GM- CSF p5 /Neo SV40 (hereafter referred to as AAV/GM-CSF/Neo)
- the GM-CSF gene was expressed from the AAV p5 promoter while Neo was expresses from the SV40 early promoter which was present on in the Neo fragment.
- AAV/GFP/Neo have been described before.
- AAV vectors that utilize different promoters utilize the basic AAV vector dl3-94, which has the p5 promoter deleted.
- Generation of high-titer rAAV virus stocks High titer virus stocks were generated in a two step process. To generate an initial virus stock 4 ⁇ gs of the AAV vector plasmid was lipofected with 0.5 ⁇ gs of the large wild type-plus AAV complementor plasmid ins96-0.8 (57) into adenovirus infected 293 cells (multiplicity of infection [MOI] of 5) . After 24 hours the medium was removed and replaced with AIM-V medium (Gibco/BRL, Grand Island, NY).
- This virus stock was then used to generate high producer cell lines.
- 293 cells were infected with the initial virus stock (0.5 ml) and then placed under G418 selection (600 ⁇ gs/ml). After 10 days resistant colonies were picked and expanded, with continuous G418 selection.
- Equivalent numbers of cells from each producer clone were compared for their ability to generate replicative AAV/GM-CSF/Neo DNA.
- the cells were infected with adenovirus (MOI 5) for two hours. Then, 0.5 ⁇ g of ins96-0.8 plasmid was DEAE-dextran transfected into the cells. After 30 hours DNA was isolated by the method of Hirt (58), and the levels of replicating vector DNA analyzed by agarose gel electrophoresis and Southern blotting (59) using 32 P-labeled Neo DNA as a probe.
- the best producer cell line was infected with adenovirus at an MOI of 5 for two hours and then lipofected with 1 ⁇ g of ins96-0.8 plasmid. After 12 hours the medium was replaced with AIM-V medium without fetal bovine serum. The purpose of this step was to limit the amount of serum proteins in the virus stock, and to generate a virus stock which was compatible with the medium used to grow the DCs. After 48 hours the cells were frozen and thawed three times to lyse the cells, heated to 56°C to kill adenovirus helper, and filtered to remove cellular debris. The virus stocks were then frozen at -80°C.
- the virus stock 10 ⁇ ls were first treated with 100 units of DNase I/ml for 1 hour (Sigma Corp., cat. # D5025)(to destroy unencapsidated viral genomes). The Dnase I was then inactivated by heating to 65°C for 30 minutes. To isolate the virion DNA the virus stock was then digested with Proteinase K (0.5 mg/ml), phenol extracted, and ethanol precipitated. A series of known standardized amounts of AAV/GM-CSF/Neo plasmid, plus the DNA isolated from the virus stock, were then applied to a nylon membrane. The dot blotting was carried out as described previously.
- the DNA in 5 ⁇ ls of water, was first denatured by the addition of 10 ⁇ ls of 0.4 N NaOH, incubated for 10 minutes, re- neutralized by the mixing of 200 ⁇ ls of Tris/HCl, pH 7.0, then immediately adding the solution to a dot blot apparatus under suction. The blot was then probed with 32 P-labeled GM-CSF DNA. Comparing the signal strength of the unknown virus stock with the known standards determined the titer in encapsidated genomes/ml. Equivalent high titer virus stocks of AAV/AP/Neo and AAV/GFP/Neo were also generated in a similar manner as for AAV/GM-CSF/Neo.
- the peripheral blood mononuclear cells were separated by routine Ficoll gradient method from fresh blood drawn from a healthy person.
- the PBMCs were inoculated into six-well culture plates and incubated with two milliliters of AIM-V medium for two hours at 37 °C and 5 % CO 2 . At that time non-adherent cells were removed by carefully washing the monolayer three times with phosphate buffered saline (PBS, pH 7.0).
- PBS phosphate buffered saline
- PBMC Heparinized peripheral blood
- the mature DCs were harvested for pulsing with E7 HPV 16 or 18 oncoproteins generated using previously characterized plasmids encoding glutathione S-transferase (GST) E7 fusion protein as described in reference 100.
- GST glutathione S-transferase
- the cationic lipid DOTAP (Boehringer Mannheim, Indianapolis, IN) was used to deliver the HPV 16 or 18 E7 proteins into cells as described.
- Generation of HPV-E7-specific CTLs was obtained culturing responder PBMC (10-20x10° cells/ well in 6-well culture plates) (Costar) in AIM-V with E7 pulsed autologous DC (ratios from 20 : 1 to 30 : 1 responder PBMC: DC).
- the cultures were supplemented with recombinant human IL-2 (10 U/ml- Aldesleukin, Chiron Therapeutics, Emeryville, CA) and restimulated once with E7 -pulsed DC after 10-14 days.
- DC8+T cells were separated from the bulk cultures by positive selection with CD8-Dynabeads (Dynal Inc., Lake Success, NY) and further expanded in number for 5-7 days using autologous or allogeneic irradiated PBL (5000 cGy) (1x10° cells/well) and anti-CD3 monoclonal antibody (Ortho Pharmaceutical Corp, Raritan, NJ) (0.2 ⁇ g/ml) plus 5% autologous plasma and 100 U/ml of IL-2 in 24-well plates (Costar), before being assayed for phenotype characteristic and CTL activity.
- G418 resistance 300 ⁇ gs of G418 per ml was added at 2 days post-infection and for the remainder of the experiment. The survival and growth of the cells resistant to G418 was measured by counting cell numbers with a hemocytometer in conjunction with trypan blue exclusion.
- RT-PCR Reverse transcription-polymerase chain reaction
- First-strand cDNA synthesis was performed from 1 ⁇ g of the total RNA at 42°C for 1 hour in a final volume of 25 ⁇ ls (10 ⁇ l of denatured RNA, 5 ⁇ l of 5X reaction buffer 250 mM Tris-HCl (pH 8.3), 375 mM MgCl 2 , 15 mM KC1, 50 mM DTT), 300 units of Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega), 5 ⁇ l each of the four dNTPs. (10 mM each), 0.5 ⁇ g of oligo (dT) 15 (Promega), and 30 units of RNasin (Promega).
- M-MLV Moloney murine leukemia virus
- PCR amplification of the cDNA was performed in a 100 ⁇ l reaction volume, which contained 10 ⁇ l of 10X PCR buffer (lOOmM Tris-HCl, pH 8.3; 500 mM KC1; 15 mM MgCl 2 ; and 0.01 % gelatin), 80 ⁇ M of each dNTP (Promega), 1 ⁇ M of each primer, and 2.5 units of Tag DNA polymerase. Both PCR primers have been described and are designed to amplify a 381 base segment of the GM-CSF sequence (up-stream primer 5'TGCAGAGCCTGCTGCTCTTG, and down-stream primer 5'CAAGCAGAAAGTC CTTCAGG)(60).
- each sample was subjected to following amplification cycle; 50 second at 94°C, 55 second at 58°C, and 1 minutes at 72°C, for 32 cycles, and then 10 minutes at 72°C.
- the positive control was AAV/GM-CSF/Neo vector.
- the second control was the total RNA treated with DNase I from the cells infected by AAV/GM-CSF/Neo virus.
- the others were the cDNA from the total RNA of mock-infected cells and the cells infected by AAV/AP/Neo virus.
- FACS flourescent antibody cell sorting
- Control irrelevant isotype-matched FITC- or PE- conjugated mAb were obtained from Becton-Dickinson. Briefly, cells infected with AAV/GM-CSF/Neo virus and uninfected controls, were harvested at day 8 of culture by washing the plates with PBS (pH7.2, Gibco/BRL). Adherent cells were recovered by incubating the plates at room temperature for 30 minutes in the presence of Ca +2 and Mg +2 free PBS containing EDTA (2 mM), followed by gentle scrapping. These cells were greater than 95 % viable as assessed by trypan blue exclusion. Cell suspensions were counted and distributed into 12X75 mm tubes.
- Mouse monoclonal antibodies were diluted in cold assay buffer and the final pellet was resuspended in 500 ⁇ l volume. Tubes were incubated for 30 minutes followed by two washes with assay buffer and the final cell pellet was resuspended in 500 ⁇ ls of assay buffer for subsequent analysis. Cells were analyzed with a fluorescence activated cell sorter (FACS; Becton-Dickinson) with a 15 mW argon laser with an excitation of 488 nm. Fluorescent signals were gated on the basis of cell dimension (i.e. forward and right angle light scattering typical of DCs. Gated signals (5,000-10,000) were detected at 585 BP filter and analyzed using Cell Quest software (Becton-Dickinson).
- FACS fluorescence activated cell sorter
- CD83 positive and negative DCs Purification of CD83 positive and negative DCs by cell sorting.
- equivalent cells as above AAV/GM-CSF/Neo virus, IL-4 and TNF ⁇ treated
- FACSStarPlus Becton Dickinson
- All the procedures of staining and sorting were performed in the presence of 5nM EDTA in order to avoid cell aggregation.
- DCs were separated from contaminating lymphocytes, by incubating them in PE-conjugated CD83 on ice for 30 minutes and washed before cell sorting.
- the Gate was set for cells of the dimension of DCs (i.e. characteristic high forward and side light scatter), and two different populations were separated according to CD83 expression in CD83+ and CD83-.
- DCs positive and negative for the CD83 lineage specific marker were evaluated for integrated AAV/GM-CSF/NEO provirus.
- lysis buffer 5 mM Tris/HCL (pH 7.4), 5 mM EDTA, 0.5 mg proteinase K/ml
- Amplification of DNA samples was carried out in 100 ⁇ l reactions using approximately 0.1 ⁇ gs of total cellular DNA, 2 mM of each dNTP; 1 ⁇ M of each primer and 2.5 U of Taq DNA polymerase according to the supplier's (Fisher Scientific Company) instruction, After 5 minutes at 94 °C, each sample was subjected to following amplification cycle; 50 second at 94 °C, 1 minute at 60 °C and 2 minutes at 72 °C, for 30 cycles, and then 10 minutes at 72 °C.
- Primer 1 was complementary to the SV40 early promoter ( 5'-GCAGGCAGAAGT ATGCAAAG-3').
- Primer 2 (5'-GAATTCAGCACAAATTGTAG), previously characterized by Batzer et al (1991)(61), was complementary to a common human repetitive element, Alu I . After electrophoresis, the reaction products, along with sizing marker DNAs, were directly visualized by ethidium bromide staining and UV fluorescence. The gel was then Southern blotted and probed with P 32 -Neo fragment DNA from pBR-Neo.(63)
- CD8 + cells are separated from the bulk cultures by positive selection with CD8-Dynabeads (Dynal Inc. , Lake
- Either cultored primary autologous tumor cells from patients with cervical cancer are prepared or target "HPV-infected" cells are generated by first immortalizing autologous B cells with Epstein Barr Virus and then lipofecting (DOTAP) or transducing (AAV) the antigen protein into these EBV transformed B cells.
- DOTAP Epstein Barr Virus
- AAV transducing
- Patients who have undergone tissue removal provide tumor, tissue and peripheral blood lymphocytes. Specimens are obtained at the time of surgery or biopsy.
- the antigenic protein may be proteins, such as HPV antigens (E6 or E7), specific breast cancer antigens (BA46, Her-2, CD24 or others), hepatitis virus antigens (hepatitis B or C virus antigens), HIV antigens or any other antigen that is linked to a cancer or infectious disease.
- HPV antigens E6 or E7
- specific breast cancer antigens BA46, Her-2, CD24 or others
- hepatitis virus antigens hepatitis B or C virus antigens
- HIV antigens any other antigen that is linked to a cancer or infectious disease.
- Fresh autologous tumor cells are maintained in serum-free keratinocyte medium (KSFM-Gibco/BRL), supplemented with 5 ng/ml epidermal growth factor and 35-50 ug/ml bovine pituitary growth extract (Gibco Life Technologies) at 37°C, 5% CO 2 .
- KSFM-Gibco/BRL serum-free keratinocyte medium
- bovine pituitary growth extract Gibco Life Technologies
- the portions of minced tumor are placed into 250 ml trypsinizing flasks containing 30 ml of enzyme solution (0.14% Collagenase Type I [Sigma], and 0.01 % DNAse [Sigma, 2000 KU/mg]) in RPMI 1640, and incubated on a magnetic platform overnight at 4°C. Enzymatically dissociated tumor is filtered through 150-um nylon mesh to generate a single cell suspension. The resultant cell suspension is then be washed twice in RPMI 1640 plus 10% autologous plasma. All experiments are performed with fresh or cryopreserved tumor cultures, which have at least 90% viability.
- the natural killer (NK) sensitive target K562 (a human erythroleukemia cell line), obtained from the American Type Culture Collection (ATCC), also is used.
- GST glutathione-S- transferase
- IPTG isopropyl- ⁇ -D-thiogalactoside
- Cells are pelleted and washed once in ice-cold lx PBS, and then resuspended for disruption using sonication on ice in short bursts. 20% Triton X-100 are then be added to a final concentration of 1 % and mixed gently for 30 minutes to aid solubilization of the fusion proteins. Bacterial lysates are centrifuged at 10,000 rpm for 10 minutes at 4°C and supernatant purified using a Glutathione Sepharose 4B RediPack column in accordance with procedures suggested by the manufacturer (Pharmacia Biotech, Inc., Piscataway, NJ). Cleavage of protein from GST are achieved using a site-specific protease (human thrombin, Sigma).
- the antigen protein is eluted from the column by centrifugation (3000 rpm x 5 minutes), and collected material is sterilize-filtered. Purity of the protein is analyzed by SDS-PAGE and Coomassie staining while quantification is obtained spectrophotometrically using the BIO-RAD protein assay (Bio-Rad Laboratories, Hercules, CA). Preparations were typically > 95% pure protein is generated from bacterially produced GST-fusions ( 100) .
- rAAV infection usually takes place at the initial step of isolating adherent monocytes. This is because, in preliminary studies, cells still have some proliferative capacity which favors AAV integration/ transduction (64). As described above, freshly adherent monocytes are infected with the indicated amount of rAAV. After 36 hours, the cells are treated with IL-4 and GM-CSF to generate standard DC cultures. For protein pulsing, following standard culture (as described above), DCs are washed twice in AIM-V and added to 50-ml polypropylene tubes (Falcon, Oxnard, CA).
- Proteins such as full-length E6 and E7 proteins are used for pulsing.
- the cationic lipid DOTAP (Boehringer Mannheim, Indianapolis, IN) is used to deliver the antigenic proteins and peptides into cells.
- Antigenic protein 100 ug/ml
- DOTAP 125 ug in 500 ul of AIM-V
- the complex is added to the DC culture in a total volume of 2-5 ml of AIM-V and incubated at 37°C in an incubator with occasional agitation for 3 hours.
- the cells are washed twice with PBS and resuspended in AIM-V, as described below.
- rAAV and protein pulsed DCs for stimulating CTL activity: Fresh or cryopreserved responder PBMCs are washed and resuspended in AIM-V at 10-20 x 10 6 cells/well in 6-well culture plates (Costar, Cambridge, MA) with rAAV or protein pulsed autologous DCs (ratios from 20-30: 1, responders: dendritic). The cultures are supplemented with recombinant human GM-CSF (500 U/ml) and recombinant human IL-2 (10 U/ml).
- CD8+ cells are separated from the bulk cultures by positive selection with CD8- Dynabeads (Dynal Inc., Lake Success, NY) and further expanded in number for 5-7 days using autologous or allogeneic irradiated PBL (5000cGy, 1 X 10 6 cells/ well) and 0.2 ug/ml anti- CD3 monoclonal antibody (Ortho Pharmaceutical Corp., Raritan, NJ) plus 5% autologous plasma in 24-well plates (Costar), before being assayed for CTL activity.
- CD8- Dynabeads CD8- Dynabeads
- PBL 5000cGy, 1 X 10 6 cells/ well
- anti- CD3 monoclonal antibody Ortho Pharmaceutical Corp., Raritan, NJ
- autologous lymphoblasts are prepared by 3-day stimulation with 1 ug/ml Con-A (Gibco/BRL) in RPMI 1640 plus IL-2 (25 U/ml).
- EBV-transformed autologous lymphoblastoid B-cell lines are established by cocultore of PBMCs with EBV- containing supernatant from the B95.8 cell line in the presence of 0.5 % ug/ml cyclosporin A (Sandoz, Camberley, UK). These are maintained in AIM-V supplemented with 10% human AB serum (Gemini Bioproducts, Calabasas, CA).
- a 6-hour chromium-51 release assay are performed as previously described ( Figure 1, in reference 100), to measure the cytotoxic reactivity of DCs-antigen specific-stimulated T lymphocytes.
- Autologous cervical tumor cells, allogeneic partially HLA- and HPV -matched cell lines, and K562 tumor cells are used as targets.
- Autologous Con-A-activated peripheral blood lymphocytes and/or EBV-transformed autologous LCL also are used as autologous control targets.
- monoclonal antibodies are used to block cytotoxicity.
- Effector cells are preincubated for 30 minutes at 4°C with Mabs, which recognize human CD3 (10 ug/ml) (Ortho Pharmaceutical Corp.) or anti-CD l la/LFA-1 (10 ug/ml) (Pharmingen, San Diego, CA) and its isotype control (IgGlK mAB isotype standard anti-TNP [lOug/ml] [Pharmingen]).
- Mabs recognize human CD3 (10 ug/ml) (Ortho Pharmaceutical Corp.) or anti-CD l la/LFA-1 (10 ug/ml) (Pharmingen, San Diego, CA) and its isotype control (IgGlK mAB isotype standard anti-TNP [lOug/ml] [Pharmingen]).
- the 51 Cr- labeled tumor targets are preincubated with Mabs specific for monomorphic HLA class I
- W6/32 50ug/ml (hybridoma obtained from the ATCC, Rockville, MD).
- the effector cells and 51 Cr-labeled targets are then incubated in a final volume of 200 ul for 6 hours at 37°C with 5% CO 2 .
- T cell proliferation assay CD4+ T cells, derived from day 14-21 CD8+ -depleted T cell populations, are re-stimulated once with rAAV or antigen protein-pulsed DCs, and 2 weeks later further purified by positive selection with CD4-Dynabeads (Dynal, Inc.) to obtain a > 99% pure population. Specific lymphoproliferative responses against E6 and E7 are tested using autologous LCL pulsed with full-length antigenic proteins, such as, BA46, Her-2, or CD24, in the presence of DOTAP, as described above for DC pulsing.
- CD4-Dynabeads CD4-Dynabeads
- irradiated BA46-pulsed or unpulsed autologous LCL are seeded in a 96-well plate (2 x 10 4 cells/well).
- CD4+ T cells (2 x 10 4 cells/well) are tested for specific proliferation after 72 hours.
- Cultures are pulsed with 1 uCi/well of [ 3 H]thymidine for the next 16 hours, and incorporated radioactivity measured as described (138).
- Cytokine release assay Autologous LCL pulsed with antigenic, or unpulsed (control), are cultored overnight with CD4+ T cell populations obtained after the different primings (AAV or DOTAP), after which supernatants are harvested by centrifugation and stored at -80°C until assayed for the presence of cytokines. Secreted cytokines are measured with commercially available ELISA kits for GM-CSF and INF ⁇ (Research and Diagnostic Systems, Minneapolis, MN), with a detectable range of 8-500 pg/ml. Cytokine concentration are expressed as pg/ml/24 hrs. Secretion by CD4+ T cells in the presence of protein-pulsed LCL are considered significant if it exceeds secretion in response to control LCL by at least 2-fold.
- Unpulsed, mock infected DCs serve as a negative control.
- the full- length antigenic protein-pulsed DCs serve as the positive and comparative control. Any of the experimental rAAV/antigen vectors that show stimulation of significant proliferation or cytokine secretion, particularly if better than antiagenic protein-pulsed DCs, are tested multiple times for reliability and to give quantitative results with standard deviation.
- FIG. 1 shows the structure of the AAV/GM-CSF/Neo vector which was constructed for this study.
- producer cell lines were generated as described in the Material and Methods section, and a Southern blot comparison of these cell lines is shown in Figure 2A.
- Clone 5 (293/AGN-5), which generated the highest level of replicating AAV/GM-CSF/Neo vector, was picked as the primary producer cell line.
- rescue levels from these clones. The majority of clones rescued only low levels of the vector, and some did not rescue at even low levels.
- the G418 resistance assay was utilized as the vector containing the Neo gene which confers resistance to this reagent.
- Three experimental populations were included in this experiment: mock infected cells, mock-infected cells treated with exogenous GM-CSF, and cells infected with 1000 ⁇ ls of AAV/GM-CSF/Neo virus. At two days post-infection the three populations were put under G418 selection at 300 ⁇ gs of G418/ml. At time 0, and at 2 day intervals thereafter, viable cell counts were taken. The results of one of three such experiments, all of which demonstrated AAV-mediated transduction of G418 resistance, is shown in Figure 4.
- the results ( Figure 5) show that conditioned medium from control cells had only low levels of GM-CSF (28 pg total at 48 hours). Monocytes and DCs are known to express GM-CSF at low levels.
- monocytes infected with two different doses (500 and 1000 ⁇ ls) of AAV/GM-CSF/Neo virus secreted significantly higher levels of GM-CSF (210 and 622 pg, respectively) at 48 hours.
- the AAV/GM-CSF/Neo virus vector appeared active for both the Neo and the GM-CSF genes and the AAV/GM-CSF/Neo infected cells secred much more GM-CSF than control cells.
- Monocytes infected with AAV/GM-CSF/Neo virus expressed GM-CSF RNA did not due to the Neo and the GM-CSF genes.
- IL-4 contributes to monocyte differentiation and arrests cell proliferation.
- GM- CSF is monitored by functional activity shown by cell proliferation.
- Figure 7B shows the number of cells of dendritic morphology; i.e. , large cells with pseudopodia, generated by the indicated treatments. Note that the number of cells in the AAV/GM-CSF/Neo treated wells was directly dependent upon the amount of virus used, and that the cell numbers stimulated were higher those stimulated by exogenous GM-CSF addition and infection by AAV/AP/Neo.
- AAV/GM-CSF/Neo virus infected monocytes give rise cells with classical dendritic surface markers.
- the monocytes were analyzed to determine whether the introduction and stable expression of the GM-CSF gene causes alterations in DC phenotype, as when compared to the traditional technique adding exogenous GM-CSF to the cultore.
- the putative dendritic cell populations resulting from AAV/GM-CSF/Neo transduction were analyzed for a number of classical dendritic cell markers.
- To generate these cells freshly adherent monocytes were infected with AAV/GM-CSF/Neo virus. At two days post-infection these cells were treated with IL-4 for 4 days.
- the cells were treated with TNF ⁇ for 2 days. (69-73) On day eight the resulting cells were then analyzed by FACS analysis for HLA-DR (97%). CD 14 (0%), CD40 (74%), CD80 (64%), CD83 (37%), and CD86 (96%) expression. These results are shown and quantitated in Figure 8, and are fully consistent with these cells being highly enriched for mature DCs.
- the infection with AAV/GM- CSF/Neo virus can fully replace the need for exogenous GM-CSF and the resulting cells appear to be a normal dendritic cell population when analyzed for a series of standard dendritic cell markers.
- the AAV/GM-CSF/Neo virus is able to chromosomally integrate in DCs.
- PCR amplification of the AAV provirus-chromosomal DNA junction was carried out using total cellular DNA as a template which had been isolated from these sorted CD83 + DCs.
- the homology and strategy of these primers are shown in Figure IB, with one primer targeting the SV40 early promoter of the provirus and the other targeting the well characterized Alu I repetitive element. This analysis is similar to that done by the Terwilliger laboratory to observe AAV vector integration in neurons. (65)
- the resulting PCR products were then separated by agarose gel electrophoresis, Southern blotted, and probed with 32 P-Neo gene probe.
- Wild type AAV is known to latently infect cells at high frequency (74-76), and recombinant AAV has been shown to be a versatile virus vector, being able transduce a wide variety of cell types (43-45,48,49,57,65,66,79,80).
- AAV stably transduces cells by chromosomal integration(43,51,65) and transduced cells are not usually a significant target of the immune system.
- AAV may be an effective vector for manipulating DCs. From this data, at least five general strategies for dendritic cell genetic manipulation are considered useful and envisioned within the context of the present invention.
- the stable introduction of cytokine genes may allow for improvements in dendritic cell production or function over the exogenous addition of cytokines. As cytokine proteins have limited half-lives (t 1/2 ), benefits may be derived from continuous expression.
- FIG. 10 provides a diagram of the structure of the experiments AAV/antigen (E6 and E7) pulsing of DCs for stimulating CTL activity against cervical cancer, and equally applicable to breast cancer, as compared to protein pulsing experiments as previously described (100).
- Figure 11 demonstrates that pulsing DCs with AAV-E6 results in higher CTL response when the DCs are pulsed with the AAV-E6 compared to pulsing DCs with bacterial produced antigen protein (DOTAP transfected GST-antigen protein).
- DC/T cell incubation was only for 7 days. The CTL activity ranged from 28-60% with the AAV/Ag vectors. It is important to note that the DC/T cell incubation in these experiments was much shorter than previous stodies on only antigen protein pulsing of DCs. (1 week compared to 2-3 weeks).
- Figure 14 show the DC/T cell co-cultures at 2 days post-addition of T cells. Note that there are many more DC-T cell rosettes present in the AAV/E7/Neo pulsed culture than the GST-E7 and Lysate controls. This result demonstrates that priming occurs more rapidly using AAV pulsing rather than protein pulsing.
- AAV/p5-BA46/Neo, AAV/p5-Her-2/neu/Neo, and AAV/p5- CD24/Neo virus use the AAV p5 transcriptional promoter to express the antigen genes.
- This promoter although not DC-specific, is a good general purpose promoter and significantly active in many cell types. Standard recombinant DNA techniques are used.
- rAAV virus is produced by first generating high producer cell lines to make high-titer virus stocks. The virus stocks are CsCl-purified and titered by quantitating the amount of encapsidated genomes (virus) by Southern blot analysis. Vectors with different promoters expressing the antigen genes are performed are constructed and compared. Comparison of the effectiveness of the above AAV-antigen vectors with full- length BA46, Her-2/neu, and CD24 protein lipofection of DCs for their ability to stimulate responses to antigen-containing target cells
- This experiment compares phenotypic characteristics (i.e. , % of CD4 + , CD8 + , and CD56+ cells) as well as the % cytotoxicity of BA46, Her-2, and CD24-sensitized, class I-restricted CD8 + T cells by DCs treated by AAV-Ag gene transfer and pulsed by full-length Ag protein pulsing.
- the DCs are generated from primary peripheral blood adherent monocytes by the standard treatment with GM-CSF and IL-4.
- the most important experiments are a comparison of DCs treated by antigen-gene transfer versus antigen- lipofection for their ability to stimulate CTL response against a class I restriction target.
- DC pulsing by the lipofection of the full-length antigen protein (E6 or E7) and by infection with one of the following virus: AAV/BA46, AAV/Her-2, and AAV/CD24 are compared.
- An infection level of 1000 encapsidated genomes (EG) per cell will be used (MOI of approximately 10).
- Equivalent numbers of the differently treated DCs are then added to equivalent numbers of CD4+ and CD8 + T cells. After 2-3 weeks CD8+ T cell populations are tested for specific cytotoxicity against autologous tumor cells. Either technique can be used and the selection is made by observing and comparing the number of CD8 + T cells stimulated and the percent of target cell killing in a chromium release assay using both of the DC treatments.
- the antigen and cytokine gene delivery protocol can be modified by changing variables.
- variables include the dosage of recombinant virus used to infect the DC. changing the time between infection and T cell incubation. Percent killing stimulated by the use of the AAV/BA46, AAV/Her-2. and AAV/CD24 virus are also compared. It is preferable to use the double virus, AAV/Agl + Ag2, with the highest epitope presentation potential, to provide the best in directing killing.
- AAV AAV to introduce the antigen gene
- the adherent monocyte is the best time at which to infect as the monocytes are still proliferating at this time point, and AAV is known to preferentially transduce dividing cells. Mature DCs do not divide and, thus, these cells may not be a good target for AAV.
- the comparison of immediate infection of adherent monocytes to infection of DCs after treatment with GM-CSF and IL-4 for 5-7 days is investigated.
- the efficiency of vector transduction also is monitored, and specific AAV vectors that transduce DCs well are selected. Transduction is analyzed by two assays.
- One assay is the G418 selection Neo resistance, as shown in Figure 4 except the cell growth is done in soft agar to allow the counting of colonies.
- the second assay is PCR analysis for chromosomally integrated provirus, using one primer targeting the vector and another targeting the common chromosomal repetitive element Alu I. Each PCR product (or band on the gel) is the result of one originally transformed cell. Thus, the number of products or bands provide an approximate indication of the transduction efficiency of the vector.
- CD4 and CD8 E6/E7-specific responses are measured by cytotoxic response assay against autologous tumor cells (CD8 +) and proliferation by LCL lipofected with E6/E7 oncoproteins (CD4).
- CD4+ helper cell proliferation and/or specific release of cytokine release are measured to show specific recognition of breast cancer antigens on antigen-presenting DCs.
- Adherent monocytes/dendritic cells are isolated, treated with antigen by virus (gene) or lipofection (protein), incubated with CD4+ T cells, then class II restricted proliferation or specific cytokine release (ie. INF ⁇ or GM-CSF) measured against BA46, Her-2/neu, or CD24 positive target cells (LCL pulsed with antigen protein or infected with AAV/Ag virus).
- AAV/BA46 infection 1000 EG, or an MOI of approximately 10 at day 0
- AAV/BA46 infection are compared at different MOIs: 100, 1000, 10,000, and 100,00 EG, 3)
- AAV/BA46 infection of adherent monocytes are compared to infection of DCs at day 5-7.
- AAV/Her-2 and AAV/CD24 infection are compared to full-length Her-2 or CD24 protein pulsing.
- BA46, AAV/Her-2/neu and AAV-CD24 to a dual antigen vectors are incubated with PBMCs to induced a priming against the breast cancer antigen, as described above.
- PBMCs a pure population of CD8 + T cells are analyzed for specific CTL response against appropriate HPV antigen-positive targets and compared for CTL response (% killing).
- DCs are infected with the indicated AAV/antigen virus and incubated with CD4 and CD 8 T cells. Class I restricted cytotoxicity are then measured against BA46, Her-2/neu, or CD24 positive target cells.
- AAV/single Ag vector infection are compared to AAV/dual Ag vector infection. Specific methods are the sdame as described above. Controls include mock-treated DCs and full-length BA46. Her-2/neu, or CD24 protein-pulsed DCs.
- Breast cancer antigen-positive targets are used to measured class I restricted CTL response in a 6-hour chromium release assay.
- HLA class I restriction elements involved in the presentation of BA46.
- Her-2/neu, or CD24 E7-derived epitopes blocking antibodies specific for HLA class I A2, B7, and the monomorphic anti-class I antigens (W6/32, 50 ug/ml) (hybridomas obtained from the ATCC, Rockville, MD) are used. All assays are carried out multiple times.
- AAV/p5-BA46/Neo infection 1000 EG, MOI 10) are compared to full length BA46 protein pulsing for haplotype dependence.
- AAV/p5-Her-2/Neo and AAV/p5- CD24/Neo infection are compared to pulsing with those full length proteins for haplotype dependence. These analyses are performed essentially as those described above. However, anti-class I haplotypes are added to potentially block the cytotoxic activity. Any antibody which inhibits cytotoxic activity strongly suggests the involvement of that haplotype in antigen epitope presentation. Comparative controls include allogenic partially HLA A2-matched breast cancer antigen-positive and negative cell lines. Comparison of the efficiency of DCs transduced with AAV/BA46/Neo to DCs lipofected with BA46 protein for their ability to directly stimulate CD8+ CTL responses both with and without CD4+ T cells
- CD8+ T cells Delivery of the antigen by virus infection may circumvent the need for helper CD4+ T cells.
- Results showing significant CTL response in the absence of CD4+ T cells are analyzed for the introduction of the antigen by AAV infection, or other factors which induce significant cytotoxic activity by CD8+ T cells stimulated with DCs. Pure CD8 + T cells stimulated with AAV/p5-BA46/Neo infected DCs are then compared to the traditional DCs lipofected with E7 protein plus CD8+T cell alone.
- CMV transcriptional promoter
- ⁇ -actin HLA class I
- New vectors are selected by analyzing and identifying promoters which are more specific for expression in DCs and are prepared that use alternative promoters.
- the original vectors use the endogenous AAV p5 promoter.
- equal amounts of chloramphenicol acetyltransferase (CAT) expression plasmids are lipofected, each containing a different transcriptional promoter, into adherent monocytes.
- the series of CAT expression plasmids includes the AAV p5 promoter, the cytomegalo virus immediate early promoter, the ⁇ -actin promoter, and the HLA A2 class I promoter.
- the vectors are based on the AAV vector dl3-94, which has the p5 promoter deleted. After transfection, the cells are treated with GM-CSF and IL-4 to induce differentiation. The cells are then be analyzed for CAT activity at 2 days post-lipofection. The promoter which gives the highest level of CAT activity is used in improved, DC- optimized vectors. Standard recombinant DNA methods are used in the constructions. Comparison of the effectiveness of the first generation p5-driven AAV/antigen vectors to the improved vectors for their ability to effectively transduce dendritic cells and stimulate class I restricted CTL response to antigen-containing target cells
- Infection of DCs with AAV/CMV-BA46/Neo, AAV/ ⁇ actin-BA46/Neo, and AAV/classI- BA46/Neo are compared to the original AAV/p5-BA46/Neo vector and to full-length BA46 protein pulsing.
- infection of DCs with AAV/CM V-Her- 2/Neo, AAV/ ⁇ actin-Her-2/Neo, and AAV/classI-Her-2/Neo (MOI 10 at day 0) are compared to the original AAV/p5-Her-2/Neo vector and to full-length Ner-2/neu protein pulsing. Methods are the same as those described above. Controls include mock-treated DCs and full-length BA46 protein-pulsed DCs.
- any gene encoding a tumors specific or disease specific antigenic protein can be substituted for these genes to prepare AAV vectors for pulsing DC precursors using the methods of the present invention.
- DC Dendritic cell manipulation in vitro can stimulate a significant HLA class I restricted CD8+ T cell cytotoxic activity.
- DCs are the most effective APC at activating naive T cells, and recently the combination of GM-CSF and IL- 4 has been shown to generate large numbers of DCs to manipulate the immune response of autologous human T cells.
- the present inventors have shown that autologous DCs pulsed with full length HPV-16 or -18 E7 oncoprotein induces an HPV E7-specific T cell response from HPV-16 and -18 positive cervical cancer patients (100).
- HPV-specific CTL responses in humans. Most of HPV-specific CTLs have been documented in mice, in which HPV is not a natural pathogen. This has lead to the suggestion that HPV has coadapted to the human host evading the immune system. However, HPV infected epithelial cells could fail to generate CTL responses, not for the lack of specific CTL precursors, but because they do not present appropriate levels of antigenic peptides in association with HLA Class I molecules, and fail to express costimulatory molecules necessary for priming of naive T cells.
- HPV-specfic CTLs recognizing HPV oncoproteins have recently been generated from peripheral blood of cervical cancer patients using a peptide based-epitope approach.
- cytotoxic responses against naturally HPV infected autologous tumor cells were not tested in these studies.
- previous reports have warned against the sole use of allogeneic partially HLA- matched lines or autologous in vitro pulsed/transduced cell lines as a means to reliably demonstrate specific lysis of targets endogenously expressing antigens.
- CTL cell lines generated by in vitro primary stimulation with high concentratiion of peptides often fail to lyse targets expressing endogenous antigen.
- E7 pulsed autologous DCs can stimulate CD8 + cytotoxic T cell response that is capable of killing autologous tomor cells in patients with invasive cervical cancer (100). It is shown that E7- pulsed DCs can elicit antigen-specific CD4 + T cell proliferative responses from the same patients.
- HPV-16 E7 oncoprotein was chosen as a target antigen for the following resasons: a) HPV-16 is associated with most cervical cancers and the HPV oncogenic proteins E6 and E7 are important in the induction and maintenance of cellular transformation and are coexpressed in most HPV-containing cervical cancers, and b) E7 is a well characterized cytoplasmic/nuclear protein with little internal atypic sequence variation, and is more abundant than E6 in HPV-associated cervical cancers. This study took advantage of the cloning and expression in bacteria of E7 as a GST-fusion protein. This allowed the use of protein affinity -purification under non-denaturing conditions, and the production of large amounts of antigens for DCs pulsing.
- DOTAP cationic lipid DOTAP
- epitope based immunotherapy for cervical cancer faces several important limitations.
- One of the major constraints is that T cell immune responses to a protein are limited to those epitopes presented by host HLA molecules. This imposes severe limitations on the use of synthetic peptides as immunogens in an heterologous (i.e. outbred) population such as human.
- autologous DCs pulsed with E7 of the specific HPV cancer-involved genotype leave to the autologous professional antigen presenting cells the processing and presentation of one or more epitopes in association with host HLA molecules.
- Type 1 T cells (CD4 or CD8) express IL-2, IFN- ⁇ , and TNF- ⁇ , and are cytotoxic, whereas Type 2 T cells express IL-4, IL-5, IL-6, IL-10 and IL-13, provide efficient help for B cell activation, and are non-cytotoxic. Consistent with this view, IL-2 and IFN- ⁇ producing Tl Tcells are believed to promote the development of cell mediated immunity against HPV-associated neoplasms.
- CD8 + and CD4 + E7 specific T cells demonstrated that HPV-specific T cells from cervical cancer patients showed a major Type 1 bias in cytokine expression. Indeed, the majority of cytokine expressing T cells showed IFN- ⁇ secretion while the minority expressed only IL-4 ( Figure 4 and 5 of 100). These findings, therefore, support the view that even in patients with progressive HPV infection leading to invasive cervical cancer, presentation of HPV E7 by DCs is still able, at least in vitro, to activate a strong Tl response, and that Type 1 cytokine expression correlates with high cytotoxic activity against the autologous tomor cells by CD8+ T cells.
- the present immunotherapeutic protocols for treating cancer are geared toward stimulating an effective cytotoxic CD8+ T cell response in the patient, and thus, generating a broad spectrum approach toward treating cancer (those with known antigen genes).
- the present invention takes advantage of the genetically altered DCs of the present invention containing AAV vectors containing one or more known antigen genes and/or one or more cytokines for use in stimulating the patients' T-cell response.
- the GM-CSF and IL4 genes are introduced into adherent monocytes by AAV vectors.
- the present immunotherapy is based upon the direct delivery of one or more antigen and/or cytokine genes into DCs by an AAV vector that get stably integrated into the genome of the DCs resulting in improvements in DC production and function resulting in a superior cytotoxic CD8+ T cell response and CD4+ T cell proliferation.
- the genetically altered DCs produced by the present invention are useful in an immuno-stimulatory treatment of cancer by the genetic alteration of the patient's antigen presenting DCs (DC) with full length (FL) antigen (Ag) genes. Others have shown that the introduction of a cancer Ag polypeptide into DCs by lipofection can result in a cytotoxic T cell response.
- the present inventors have shown that introducing FL E7 Ag into DCs with CD4+ and CD8+ T cells results in an effective class I-restricted CD8+ cytotoxic T cell response against the patients own HPV+ cervical cancer cells in vitro (as much as 80% killing) (138).
- the present invention introduces the genes that encode these antigens and cytokines via AAV vector transduction. The transduction of these genes into the chromosome of DCs provides the continuous expression of the FL antigen proteins, by AAV vector gene delivery into DCs.
- Virus introduction of the antigen provides an efficient way to increase class I presentation of the Ag epitopes which is critical for CD8+ cytotoxic response.
- the processing and trafficking of antigen epitopes toward expression on the DC surface in the context of class I presentation is likely to be enhanced by viral delivery when compared to lipofection of the antigen protein.
- This form of antigen delivery to the DCs is believed to circumvent the need for CD4 + T cells for inducing final DC maturation and for the stimulation of the CD8+ T cells, resulting in a simplified regime.
- the AAV vectors provide a delivery vector for the Ag and cytokine genes into DCs because of its efficiency and minimal intrinsic immunogenicity.
- AAV-E6, AAV-E7, and AAV-E6-E7 vector transduction efficiency is measurable and the effectiveness of antigen gene delivery is compared to traditional DC polypeptide and FL antigen protein "pulsing", by lipofection, for the ability to stimulate tomor cell killing and proliferation.
- Multigene AAV vectors including HSV-TK genes (as a "suicide gene") or single AAV vectors each containing one of the genes are useful in the present invention.
- the use of antigen oligopeptides generally limits the epitope presentation to a favored class I molecule.
- FL Ags full-length antigens
- the results of DC expression of antigens and the role of specific class I haplotype molecules on the tumor target in the class I restricted cytotoxic response are determined by specific monoclonal antibodies.
- the patient's blood is monitored for evidence of increased T- cell stimulation in the patient against the introduced disease associated antigens by methods known to persons skilled in the art. For instance, computerized tomography, x-rays and screening for tomor-related markers can be used in monitoring the success of treatment.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- AIDS & HIV (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA 2381293 CA2381293A1 (en) | 1999-08-05 | 2000-08-07 | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof |
| AU68943/00A AU6894300A (en) | 1999-08-05 | 2000-08-07 | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof |
| AT00957305T ATE456662T1 (de) | 1999-08-05 | 2000-08-07 | Genetisch veränderte dendritische zellen, die mit adeno-assoziiertem virus transduziert wurden, verfahren zur herstellung dieser zellen und ihre verwendungen |
| JP2001515852A JP2003506095A (ja) | 1999-08-05 | 2000-08-07 | アデノ随伴ウイルス(aav)で形質導入された遺伝子改変樹状細胞、該細胞の調製方法および該細胞の使用 |
| EP20000957305 EP1206563B1 (en) | 1999-08-05 | 2000-08-07 | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof |
| DE60043779T DE60043779D1 (de) | 1999-08-05 | 2000-08-07 | Genetisch veränderte dendritische zellen, die mit adeno-assoziiertem virus transduziert wurden, verfahren zur herstellung dieser zellen und ihre verwendungen |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14726399P | 1999-08-05 | 1999-08-05 | |
| US60/147,263 | 1999-08-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2001011067A1 true WO2001011067A1 (en) | 2001-02-15 |
Family
ID=22520891
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/021410 Ceased WO2001011067A1 (en) | 1999-08-05 | 2000-08-07 | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP1206563B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2003506095A (cg-RX-API-DMAC7.html) |
| AT (1) | ATE456662T1 (cg-RX-API-DMAC7.html) |
| AU (1) | AU6894300A (cg-RX-API-DMAC7.html) |
| CA (2) | CA2309313A1 (cg-RX-API-DMAC7.html) |
| DE (1) | DE60043779D1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2001011067A1 (cg-RX-API-DMAC7.html) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003093440A3 (en) * | 2002-04-30 | 2004-05-21 | Univ Florida | Methods and compositions for expressing a nucleic acid in a dendritic cell |
| WO2004089413A1 (en) * | 2003-04-14 | 2004-10-21 | Mallen Huang | Nucleotide and cellular vaccine composition |
| JP2006508664A (ja) * | 2002-12-04 | 2006-03-16 | ベイラ、リサーチ、インスティテュート | 抗原負荷した樹状細胞ワクチンを前駆体から発生させる迅速ワンステップ法 |
| US7465583B2 (en) | 2000-06-01 | 2008-12-16 | The University Of North Carolina At Chapel Hill | Duplexed parvovirus vectors |
| US8877206B2 (en) | 2007-03-22 | 2014-11-04 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| US9085807B2 (en) | 2004-09-14 | 2015-07-21 | Argos Therapeutics, Inc. | Strain-independent amplification of pathogens and vaccines thereto |
| WO2018102612A1 (en) | 2016-12-02 | 2018-06-07 | Juno Therapeutics, Inc. | Engineered b cells and related compositions and methods |
| US11612652B2 (en) | 2015-11-13 | 2023-03-28 | Pds Biotechnology Corporation | Lipids as synthetic vectors to enhance antigen processing and presentation ex-vivo in dendritic cell therapy |
| US11801257B2 (en) | 2008-04-17 | 2023-10-31 | Pds Biotechnology Corporation | Stimulation of an immune response by enantiomers of cationic lipids |
| US11904015B2 (en) | 2012-09-21 | 2024-02-20 | Pds Biotechnology Corporation | Vaccine compositions and methods of use |
| US12201685B2 (en) | 2012-06-15 | 2025-01-21 | Pds Biotechnology Corporation | Methods of modulating immune responses with cationic lipid vaccine compositions |
| US12551460B2 (en) | 2017-12-05 | 2026-02-17 | Pds Biotechnology Coporation | Methods and compositions comprising cationic lipids for stimulating type 1 interferon genes |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013174760A1 (en) | 2012-05-25 | 2013-11-28 | Deutsches Krebsforschungszentrum | Optimized aav-vectors for high transduction rates in dendritic cells |
| EP4200427A1 (en) * | 2020-10-15 | 2023-06-28 | Aavocyte, Inc. | Recombinant adeno-associated virus vectors with cd14 promoter and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997003703A1 (en) * | 1995-07-21 | 1997-02-06 | Rhone-Poulenc Rorer Pharmaceuticals Inc. | Adeno-associated viral liposomes and their use in transfecting dendritic cells to stimulate specific immunity |
| WO1997029183A2 (en) * | 1996-02-08 | 1997-08-14 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Methods and compositions for transforming dendritic cells and activating t cells |
| WO1998024479A1 (en) * | 1996-12-02 | 1998-06-11 | Cell Genesys, Inc. | Adeno-associated viral vector-mediated delivery of dna to cells of the liver |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ID27813A (id) * | 1998-01-28 | 2001-04-26 | Corixa Corp | Senyawa-senyawa untuk terapi dan diagnosa kanker paru-paru dan metoda untuk penggunaannya |
-
2000
- 2000-06-09 CA CA 2309313 patent/CA2309313A1/en not_active Abandoned
- 2000-08-07 AU AU68943/00A patent/AU6894300A/en not_active Abandoned
- 2000-08-07 AT AT00957305T patent/ATE456662T1/de not_active IP Right Cessation
- 2000-08-07 WO PCT/US2000/021410 patent/WO2001011067A1/en not_active Ceased
- 2000-08-07 JP JP2001515852A patent/JP2003506095A/ja active Pending
- 2000-08-07 EP EP20000957305 patent/EP1206563B1/en not_active Expired - Lifetime
- 2000-08-07 CA CA 2381293 patent/CA2381293A1/en not_active Abandoned
- 2000-08-07 DE DE60043779T patent/DE60043779D1/de not_active Expired - Lifetime
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997003703A1 (en) * | 1995-07-21 | 1997-02-06 | Rhone-Poulenc Rorer Pharmaceuticals Inc. | Adeno-associated viral liposomes and their use in transfecting dendritic cells to stimulate specific immunity |
| WO1997029183A2 (en) * | 1996-02-08 | 1997-08-14 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Methods and compositions for transforming dendritic cells and activating t cells |
| WO1998024479A1 (en) * | 1996-12-02 | 1998-06-11 | Cell Genesys, Inc. | Adeno-associated viral vector-mediated delivery of dna to cells of the liver |
Non-Patent Citations (1)
| Title |
|---|
| KROUSE R. S. ET AL.: "rAAV Vector transduction of dendritic cells (DC) for development of tumor specific vaccines.", BLOOD, vol. 92, no. 10 SUPPL. 1 PART 1-2, 15 November 1998 (1998-11-15), 40th Annual Meeting of the American Society of Hematology; Miami Beach, Florida, USA; December 4-8, 1998, pages 146A - 147A, XP000978926, ISSN: 0006-4971 * |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7465583B2 (en) | 2000-06-01 | 2008-12-16 | The University Of North Carolina At Chapel Hill | Duplexed parvovirus vectors |
| US7790154B2 (en) | 2000-06-01 | 2010-09-07 | The University Of North Carolina At Chapel Hill | Duplexed parvovirus vectors |
| US8361457B2 (en) | 2000-06-01 | 2013-01-29 | The University Of North Carolina At Chapel Hill | Duplexed parvovirus vectors |
| US8784799B2 (en) | 2000-06-01 | 2014-07-22 | The University Of North Carolina At Chapel Hill | Duplexed parvovirus vectors |
| WO2003093440A3 (en) * | 2002-04-30 | 2004-05-21 | Univ Florida | Methods and compositions for expressing a nucleic acid in a dendritic cell |
| JP2006508664A (ja) * | 2002-12-04 | 2006-03-16 | ベイラ、リサーチ、インスティテュート | 抗原負荷した樹状細胞ワクチンを前駆体から発生させる迅速ワンステップ法 |
| JP2011046717A (ja) * | 2002-12-04 | 2011-03-10 | Baylor Research Inst | 抗原負荷した樹状細胞ワクチンを前駆体から発生させる迅速ワンステップ法 |
| JP2013224313A (ja) * | 2002-12-04 | 2013-10-31 | Baylor Research Inst | 抗原負荷した樹状細胞ワクチンを前駆体から発生させる迅速ワンステップ法 |
| WO2004089413A1 (en) * | 2003-04-14 | 2004-10-21 | Mallen Huang | Nucleotide and cellular vaccine composition |
| CN1805758B (zh) * | 2003-04-14 | 2012-04-25 | 黄冉阳 | 核酸和细胞疫苗的组分 |
| US11298398B2 (en) | 2003-04-14 | 2022-04-12 | Mallen Huang | Method of treating a philadelphia chromosome-positive tumor |
| US10799553B2 (en) | 2003-04-14 | 2020-10-13 | Mallen Huang | Composition comprising a nucleotide sequence encoding an ELA2 fusion protein and plasmacytoid dendritic cells |
| US9879053B2 (en) | 2004-09-14 | 2018-01-30 | Argos Therapeutics, Inc. | Strain-independent amplification of pathogens and vaccines thereto |
| US9085807B2 (en) | 2004-09-14 | 2015-07-21 | Argos Therapeutics, Inc. | Strain-independent amplification of pathogens and vaccines thereto |
| US8877206B2 (en) | 2007-03-22 | 2014-11-04 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| US11911359B2 (en) | 2007-03-22 | 2024-02-27 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| US11801257B2 (en) | 2008-04-17 | 2023-10-31 | Pds Biotechnology Corporation | Stimulation of an immune response by enantiomers of cationic lipids |
| US12201685B2 (en) | 2012-06-15 | 2025-01-21 | Pds Biotechnology Corporation | Methods of modulating immune responses with cationic lipid vaccine compositions |
| US11904015B2 (en) | 2012-09-21 | 2024-02-20 | Pds Biotechnology Corporation | Vaccine compositions and methods of use |
| US11911465B2 (en) | 2012-09-21 | 2024-02-27 | Pds Biotechnology Corporation | Vaccine compositions and methods of use |
| US11612652B2 (en) | 2015-11-13 | 2023-03-28 | Pds Biotechnology Corporation | Lipids as synthetic vectors to enhance antigen processing and presentation ex-vivo in dendritic cell therapy |
| US11638753B2 (en) | 2015-11-13 | 2023-05-02 | PDS Biotechnology Corporalion | Lipids as synthetic vectors to enhance antigen processing and presentation ex-vivo in dendritic cell therapy |
| WO2018102612A1 (en) | 2016-12-02 | 2018-06-07 | Juno Therapeutics, Inc. | Engineered b cells and related compositions and methods |
| US11793833B2 (en) | 2016-12-02 | 2023-10-24 | Juno Therapeutics, Inc. | Engineered B cells and related compositions and methods |
| US12551460B2 (en) | 2017-12-05 | 2026-02-17 | Pds Biotechnology Coporation | Methods and compositions comprising cationic lipids for stimulating type 1 interferon genes |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2381293A1 (en) | 2001-02-15 |
| CA2309313A1 (en) | 2001-02-05 |
| EP1206563A1 (en) | 2002-05-22 |
| DE60043779D1 (de) | 2010-03-18 |
| EP1206563B1 (en) | 2010-01-27 |
| ATE456662T1 (de) | 2010-02-15 |
| JP2003506095A (ja) | 2003-02-18 |
| AU6894300A (en) | 2001-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chiriva‐Internati et al. | Efficient generation of cytotoxic T lymphocytes against cervical cancer cells by adeno‐associated virus/human papillomavirus type 16 E7 antigen gene transduction into dendritic cells | |
| CN102268457B (zh) | 一种afp重组腺相关病毒载体及其构建方法与应用 | |
| EP1206563B1 (en) | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof | |
| AU2011201652B8 (en) | Improved transfection of eukaryotic cells with linear polynucleotides by electroporation | |
| Liu et al. | Rapid induction of cytotoxic T-cell response against cervical cancer cells by human papillomavirus type 16 E6 antigen gene delivery into human dendritic cells by an adeno-associated virus vector | |
| JP2002509716A (ja) | テロメラーゼ抗原に対する免疫応答を惹起するための方法および組成物 | |
| JP2023551819A (ja) | 抗原特異的t細胞並びにその作製及び使用方法 | |
| Liu et al. | Transduction and utility of the granulocyte-macrophage colony-stimulating factor gene into monocytes and dendritic cells by adeno-associated virus | |
| Rouas et al. | Lentiviral-mediated gene delivery in human monocyte-derived dendritic cells: optimized design and procedures for highly efficient transduction compatible with clinical constraints | |
| EP1346036B1 (en) | Helper virus-free herpes virus amplicon particles and uses thereof | |
| EP3570852B1 (en) | Autologous cytotoxic t cells (ctls) expressing an ebv-binding t cell receptor for use in treating or preventing primary progressive multiple sclerosis (ms) or secondary progressive ms | |
| CN116355058A (zh) | Eb病毒抗原表位及其应用 | |
| MXPA02001261A (en) | Genetically altered dendritic cells transduced with adeno-associated virus (aav), methods of producing said cells and uses thereof | |
| EP1562635A2 (en) | Modified dendritic cells | |
| Chang | Lentiviral vector transduction of dendritic cells for novel vaccine strategies | |
| CN117402233A (zh) | 抗原短肽用于筛选治疗与hpv相关的疾病的药物中的用途及其筛选的tcr | |
| US20100291683A1 (en) | Modified Antigen Presenting Cells and Methods of Use | |
| JP2000506013A (ja) | 細胞の免疫原性を高めるためのアデノ随伴ウイルスベクター | |
| AU4226999A (en) | Method for preparation and (in vivo) administration of antigen presenting cell composition | |
| WO2020164167A1 (zh) | 一种用于通用型car-t制备的重组腺相关病毒载体及其构建方法和应用 | |
| CN118028235A (zh) | 人工抗原提呈细胞及其制备方法和应用 | |
| CN110885855A (zh) | 一种携带精子蛋白17抗原基因的重组腺相关病毒载体及其应用价值 | |
| MXPA00005780A (es) | Estimulacion de la respuesta inmunologica mediante manipulacion de celula dendritica humana | |
| AU2003220722A1 (en) | Method for preparation and in vivo administration of antigen presenting cell composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2002/001261 Country of ref document: MX Ref document number: 2381293 Country of ref document: CA Ref document number: 68943/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000957305 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000957305 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |