WO2001009377A1 - Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase - Google Patents

Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase Download PDF

Info

Publication number
WO2001009377A1
WO2001009377A1 PCT/GB2000/002962 GB0002962W WO0109377A1 WO 2001009377 A1 WO2001009377 A1 WO 2001009377A1 GB 0002962 W GB0002962 W GB 0002962W WO 0109377 A1 WO0109377 A1 WO 0109377A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
target
promoter
rna
complementary
Prior art date
Application number
PCT/GB2000/002962
Other languages
English (en)
Inventor
John Scott Lloyd
Anthony Weston
Donald Leonard Nicholas Cardy
Original Assignee
Cytocell Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9917813.9A external-priority patent/GB9917813D0/en
Application filed by Cytocell Limited filed Critical Cytocell Limited
Priority to US10/048,225 priority Critical patent/US7005261B1/en
Priority to EP00949760A priority patent/EP1200627A1/fr
Priority to JP2001513632A priority patent/JP2004507203A/ja
Priority to CA2381954A priority patent/CA2381954C/fr
Priority to AU63033/00A priority patent/AU779591B2/en
Publication of WO2001009377A1 publication Critical patent/WO2001009377A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]

Definitions

  • This invention relates to nucleic acid complexes comprising a functional RNA polymerase promoter, and to a method of detecting a target nucleic acid sequence of interest.
  • RNA polymerases are enzyme molecules well-known to those skilled in the fields of molecular biology and molecular diagnostic kits. RNA polymerases synthesise RNA molecules from a DNA template strand.
  • RNA polymerases especially bacteriophage RNA polymerases.
  • RNA polymerase from the bacteriophage T7 has been shown to be very selective for specific promoters that are rarely encountered in DNA unrelated to T7 DNA
  • T7 RNA polymerase is able to make complete transcripts of almost any DNA that is placed under control of a T7 promoter.
  • T7 RNA polymerase is a highly active enzyme that transcribes about five times faster than does Esche ⁇ chia coli RNA polymerase (Studier et al, 1990 Methods Enzymol. 185, 60).
  • the synthesis of small RNAs using T7 RNA polymerase has been described whereby sequences around the RNA polymerase promoter sequence are shown to be important in the reproducible improvement of yield of RNA produced (Milligan & Uhienbeck, 1989 Methods Enzymol. 180, 51 and Milligan et al,
  • RNA polymerases that have similar properties to T7 include those from bacteriophage T3 and SP6, the genes for which have all been cloned and the corresponding enzymes are commercially available.
  • the optimum promoter sequences for T7, T3 and SP6 polymerases are known, and are essentially 17 nucleotides long.
  • a number of methods have been disclosed, which utilise RNA polymerases to synthesise RNA directly or indirectly as the result of the presence of a particular nucleic acid sequence of interest ("target").
  • target nucleic acid sequence of interest
  • the presence of RNA thus serves to signal the presence of the sequence of interest and can be used as the basis of assay methods and/or diagnostic methods or kits. Examples include the disclosures of WO 93/06240, WO 94/29481 , EP 0851033, and EP 0552931.
  • WO 93/06240 discloses the use of two probes, which hybridise together only in the presence of a target nucleic acid sequence of interest, such that hybridisation of the probes to each other is indicative of the presence of the sequence of interest.
  • the invention provides a complex formed by a hybridisation reaction comprising four nucleic acid molecules; the complex comprising a target nucleic acid molecule and first, second and third nucleic acid probe molecules; wherein the first probe comprises a foot region which is complementary to a first portion of the target and is hybridised thereto, and an arm region which is substantially non-complementary to the target; the second probe comprises a foot region which is complementary to a second portion of the target, such that the foot region of the second probe is hybridised to the target adjacent or substantially adjacent to the foot region of the first probe, the second probe also comprising an arm region which is substantially non-complementary to the target but which is complementary and hybridised to the arm region of the first probe; the third probe being complementary, at least in part, to a portion of the arm region of the first probe, such that the third probe is hybridised to the arm region of the first probe adjacent or substantially adjacent to the second probe; and wherein formation of the complex creates a functional double-stranded RNA polymerase promoter,
  • the invention provides a method of detecting the presence of a target nucleic acid molecule in a sample, the method comprising the steps of contacting the sample comprising the target with first and second nucleic acid probes, each probe comprising a foot region complementary to respective first and second portions of the target, which portions are adjacent or substantially so; wherein the first and second probes each further comprise an arm region substantially non-complementary to the target, at least part of the arm region of the first probe being complementary to at least part of the arm region of the second probe, such that respective foot regions of the first and second probes hybridise to the target, allowing hybridisation of the complementary parts of the arm regions of the first and second probes; and causing to be present a third nucleic acid probe molecule which is complementary to a portion of the arm region of the first probe, such that the third probe hybridises to the first probe adjacent or substantially adjacent to the arm region of the second probe, thereby creating a functional double-stranded RNA polymerase promoter, one strand of the
  • the method of the second aspect of the invention thus results in formation of the complex of the first aspect.
  • the first and second probes when hybridised to the target sequence, are adjacent or substantially adjacent to each other.
  • adjacent is herein intended to mean that there are no nucleotides of the target sequence left without base-pairing between those portions of the target sequence which are base- paired to the complementary sequence of the probes. This proximity between the probes enables the complementary arm portions of the probes to anneal.
  • gaps may be introduced between the loci in the target nucleotide sequence to which the probes hybridise.
  • the probes are said to be “substantially adjacent” , because there may be some nucleotides of the target sequence left without base-pairing between those portions of the target sequence which are base-paired to the probes.
  • the number of intervening un-paired nucleotides of the target sequence can vary according to the design of the probes.
  • the probes may be separated by up to 5 nucleotides of target sequence, and the term “substantially adjacent” is intended to refer to such situations.
  • the second and third probes must hybridise to the arm region of the first probe such that the second and third probes are "adjacent", or substantially so, which terms are intended to have the same meanings as defined above.
  • the second and third probes together constitute one strand of the promoter, it is very much to be desired that they hybridise in an adjacent manner so as to provide optimum promoter activity: the inventors have found that the amount of promoter activity is greatly reduced even if a single nucleotide gap occurs between the second and third probes.
  • the third probe may, for example, be hybridised to the first probe before the second probe and sample are added.
  • all three probes may be simultaneously mixed with the sample containing the target molecule.
  • the second and third probes which jointly provide one of the strands of the RNA polymerase promoter, are not covalently joined and the promoter sequence thus contains a "nick" in the phosphodiester backbone of one of the strands.
  • Preferred promoters for use in the invention are those recognised by bacteriophage polymerases, especially those promoters recognised by one of T3, T7 or SP6 polymerase. These will generally comprise a minimum of 17 or 18 bases, essentially double-stranded.
  • the sequence of the double-stranded T3 RNA polymerase promoter (described in the prior art) is:
  • T3 promoter sequences are also known, especially those in which the first three bases of the non-template strand [the upper strand shown above] are 5' TTA 3' , rather than AAT.
  • T7 RNA polymerase promoter (described in the prior art) is:
  • the sequence of the SP6 RNA polymerase promoter (described in the prior art) is:
  • the first probe One of the strands of the promoter is provided by the first probe.
  • this will be the "sense" (+) strand, which is transcribed by the polymerase.
  • the first probe will generally comprise a stretch of "template” nucleic acid to be transcribed.
  • the template will desirably comprise sequences which facilitate capture (e.g. hybridisation) of the resulting RNA transcript and/or detection.
  • the first probe may desirably contain sequences (e.g. a " + 12 sequence") adjacent to the promoter sequence, which serve to increase the activity of the promoter. Specific instances of such sequences are disclosed in the examples below.
  • a " + 12 sequence” is so-termed because it consists of 12 bases immediately downstream (i.e. at positions + 1 to + 12) of the promoter, and causes enhanced transcription levels.
  • the inventors have elucidated the optimum sequence of + 12 regions for the T7 polymerase (discussed in greater detail below) - it is not known at present if these are also optimum for, say, T3 and SP6 polymerases. If, as is possible, SP6 and T3 polymerases have different optimum + 12 regions, it would be a simple matter for the person skilled in the art to identify the relevant sequence by trial-and-error, with the benefit of the present disclosure.
  • sequences of preferred + 12 regions, for inclusion in the template portion of the first probe, are shown below in Table 1.
  • the most active + 12 region (giving greatest transcription) is at the top, with the other sequences shown in decreasing order of preference.
  • Table 1 Alternative template + 1 to + 12 sequences for T7 polymerase, in descending order of transcription efficiency (Seq ID Nos. 5-14).
  • the 5 base is numbered as + 1 , being the first base downstream from the end of the promoter sequence, the 3 base as + 12).
  • the template portion of the complex (generally on the first probe) could contain sequences that can be used to isolate, identify, detect, quantify or amplify the de novo synthesised RNA transcripts (see, for example, WO 93/06240, US 5,554,516, or, for example, using molecular beacon sequences such as those disclosed by Tyagi & Kramer 1996 Nature Biotech 14, 303-308). These sequences are conveniently placed adjacent to, and downstream of, a + 12 region (as described above) and may comprise, but are not limited to, one or more of the following: unique "molecular beacon" sequences; capture sequences; and detection probe complementary sequences.
  • the seventeen bases of the promoter sequence may be partitioned between the second and third probes in any manner, provided that, in combination, the second and third probes provide one strand of the full promoter sequence.
  • the inventors have found that optimum results are generally obtained when the second probe provides 2 to 4 (preferably 3) bases at the 5' end of the promoter sequence, with the rest of the promoter (15 to 13 bases) being contributed by the third probe.
  • promoter activity may be enhanced by including some additional bases (typically 1-3 bases or more) at the 3' end of the third probe (e.g. by providing at least some bases complementary to the + 12 sequence on the template strand, so that the + 12 sequence becomes at least partially double stranded).
  • any of the first, second or third probes may comprise DNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), (less preferably RNA) or any combination thereof. It will, however, generally be desirable that those portions of the probes which constitute the promoter comprise conventional DNA, so as to ensure recognition by the relevant polymerase.
  • the terms "nucleic acid complex” , “nucleic acid molecule” and “nucleic acid probe” should accordingly not be construed as being limited to complexes, molecules or probes (respectively) which consist solely of conventional nucleic acid, but also encompass complexes, molecules or probes which comprise non-conventional nucleic acid (such as PNA or LNA) or non-nucleic acid po ⁇ ions.
  • PNA is a synthetic nucleic acid analogue in which the sugar/phosphate backbone is replaced by a peptide-linked chain (typically of repeated N-(2-aminoethyl)-glycine units), to which the bases are joined by methylene carbonyl linkages.
  • PNA/DNA hybrids have high Tm values compared to double stranded DNA molecules, since in DNA the highly negatively-charged phosphate backbone causes electrostatic repulsion between the respective strands, whilst the backbone of PNA is uncharged.
  • Another characteristic of PNA is that a single base mis-match is, relatively speaking, more destabilizing than a single base mis-match in heteroduplex DNA.
  • PNA is useful to include in probes for use in the present invention, as the resulting probes have greater specificity than probes consisting entirely of DNA. Synthesis and uses of PNA have been disclosed by, for example, Orum et al, (1993 Nucl. Acids Res. 21, 5332); Egholm et al, (1992 J. Am. Chem. Soc. 114, 1895); and Egholm et al, (1993 Nature 365, 566).
  • LNA is a synthetic nucleic acid analogue, incorporating "internally bridged" nucleoside analogues. Synthesis of LNA, and properties thereof, have been described by a number of authors: Nielsen et al, (1997 J. Chem. Soc. Perkin Trans. 1, 3423); Koshkin et al, (1998 Tetrahedron Letters 39, 4381); Singh & Wengel (1998 Chem. Commun. 1247); and Singh et al, (1998 Chem. Commun. 455). As with PNA, LNA exhibits greater thermal stability when paired with DNA, than do conventional DNA/DNA heteroduplexes. However, LNA can be synthesised on conventional nucleic acid synthesising machines, whereas PNA cannot.
  • any one or more of the probes of use in the invention may comprise one or more destabilizing moieties.
  • the destabilizing moiety is a chemical entity which is generally unable to undergo base pairing and hydrogen bonding in the normal manner as usually occurs when complementary strands of nucleic acid become hybridised.
  • Destabilizing moieties which cannot base pair, but which nevertheless are capable of forming flexible folds and/or hairpin structures, are especially suitable.
  • One such preferred destabilizing moiety comprises hexaethylene glycol (abbreviated herein as "Hex”) (see Figure 5), which may be present singly or in tandem up to n times (where n can be any number 1, but conveniently has a maximum value of 5).
  • the third probe comprises one Hex molecule, where the number of bases opposite the destabilising moiety in the arm region of the first probe should be three to four bases.
  • An alternative preferred destabilizing moiety comprises a plurality of alkylene (especially methylene) repeats. Particularly preferred are penta- or hexa- methylene spacers.
  • destabilizing moieties may alternatively be used. These include, but are not limited to, inosine, VirazoleTM (N[l]-[1- -D ribofuranosyl] 3-carboxamido- 1,2,4, - triazole), NebularinTM (N[9]-[l- -D ribofuranosyl] -purine), nitropyrrole, ribose, propyl or combinations of the above eg. propyl-Hex-propyl, propyl-Hex-Hex-propyl, etc.
  • Propyl may be replaced by, for example, ethyl, butyl, pentyl, heptyl, octyl etc.
  • the number of bases opposite the destabilizing moiety in the arm region of the reciprocal probe should be x, where x is an integer greater than or equal to 1. The exact number of bases will of course depend on the size of the destabilizing moiety and the value of n.
  • the opposite probe should preferably comprise 3-4 bases (preferably 3) (i.e. X is between 3n and 4n); for each other molecule or radical mentioned above present in the destabilizing moiety, the opposite probe should preferably comprise a single base, with the exception of the following: butyl - two bases, pentyl - two bases, heptyl - three bases, and octyl - four bases.
  • the person skilled in the art will appreciate how to select appropriate conditions, materials and sequences for the probes, in order to ensure that the complex of the first, second and third probes (and hence formation of the functional RNA promoter) occurs in a target dependent manner.
  • the degree of complementarity between the arm regions of the first and second probes must be such that, in the conditions employed, they will not hybridise unless stabilised by hybridisation of the respective foot regions of the first and second probes to the target.
  • the foot regions of the first and second probes will comprise at least 10 bases, preferably at least 20 bases, and more preferably at least 25 bases. There is no upper limit on the size of the foot regions (which may, for example, comprise several kilobases). However, in practice, the probes will normally be in vitro synthesised ohgonucleotides and so it will be preferred for the foot regions to comprise no more than about 75 bases.
  • the number of complementary bases between the arm regions of the first and second probes will normally be no more than 25, typically less than 15, and optimally between 5 and 13 bases, such that the arm regions will not (under the assay conditions employed) become hybridised to each other in the absence of target.
  • the invention provides a method of generating a signal in a target-dependent manner (i.e. creation of the complex and hence formation of the functional promoter) and causing amplification of this signal (generation of multiple RNA transcripts under the control of the promoter) in a system which may require the use of a single enzyme type (RNA polymerase), without the need for additional enzymes (e.g. DNA polymerases) to bring about the amplification.
  • RNA polymerase e.g. DNA polymerases
  • RNA produced in accordance with the invention could be detected in a number of ways, optionally following amplification (most preferably by means of an isothermal amplification step e.g. as disclosed in US 5,399,491 and US 5,480,784).
  • amplification most preferably by means of an isothermal amplification step e.g. as disclosed in US 5,399,491 and US 5,480,784.
  • newly-synthesised RNA could be detected in a conventional manner (e.g. by gel electrophoresis), with or without incorporation of labelled bases during the synthesis.
  • RNA could be captured at a solid surface (e.g. on a bead, or in a microtitre plate), and the captured molecule detected by hybridisation with a labelled nucleic acid probe (e.g. radio-labelled, or more preferably labelled with an enzyme, chromophore, fluorophore and the like).
  • a labelled nucleic acid probe e.g. radio-labelled, or more preferably labelled with an enzyme, chromophore, fluorophore and the like.
  • Preferred enzyme labels include horseradish peroxidase and alkaline phosphatase.
  • One preferred detection method involves the use of molecular beacons or the techniques of fluorescence resonance energy transfer (“FRET"), delayed fluorescence energy transfer (“DEFRET”) or homogeneous time-resolved fluorescence (“HTRF”).
  • FRET fluorescence resonance energy transfer
  • DEFRET delayed fluorescence energy transfer
  • HTRF homogeneous time-resolved flu
  • Molecular beacons are molecules which a fluorescence signal may or may not be generated, depending on the conformation of the molecule. Typically, one part of the molecule will comprise a fluorophore, and another part of the molecule will comprise a "quencher" to quench fluorescence from the fluorophore. Thus, when the conformation of the molecule is such that the fluorophore and quencher are in close proximity, the molecular beacon does not fluoresce, but when the fluorophore and the quencher are relatively widely-separated, the molecule does fluoresce.
  • the molecular beacon conveniently comprises a nucleic acid molecule labelled with an appropriate fluorophore and quencher.
  • the conformation of the molecular beacon is by hybridisation to a nucleic acid, for example inducing looping out of parts of the molecular beacon.
  • the molecular beacon may initially be in a hair-pin type structure (stabilised by self-complementary base-pairing), which structure is altered by hybridisation, or by cleavage by an enzyme or ribozyme.
  • FRET Fluorescence Resonance Energy Transfer
  • Europium is encapsulated in a protective cage (cryptate) and attached to the 5' end of an oligomer.
  • the acceptor molecule that has been developed for this system is a protein fluorophore, called XL665. This molecule is linked to the 3' end of a second probe. This system has been developed by Packard.
  • RNA or other nucleic acid molecules are further described in our prior patent applications WO 99/37805 and WO 99/37806.
  • the newly-synthesised RNA before or after amplification, results in formation of a ribozyme, which can be detected by cleavage of a particular nucleic acid substrate sequence (e.g. cleavage of a fluorophore/quencher dual-labelled oligonucleotide).
  • the invention provides a complex comprising three nucleic acid molecules: a target nucleic acid sequence; a first probe; and a second probe; wherein the first probe comprises, in the 5' to 3' direction, a template portion transcribable by an RNA polymerase, a template strand of an RNA polymerase promoter, and a target complementary portion which is hybridised to at least a 3' end region of the target sequence; and wherein the second probe is hybridised to the first probe adjacent or substantially adjacent to the 3' end of the target sequence, the second probe comprising part of the non-template strand complementary to the template strand of the promoter present in the first probe, the remaining part of the non-template strand of the promoter sequence being present at the 3' end of the target sequence; the arrangement being such that formation of the complex creates a functional double stranded RNA polymerase promoter with a discontinuity in the non-template strand, between the second probe and the target sequence.
  • RNA transcripts of the template portion of the first probe are indicative of the presence in a sample of the target sequence.
  • the complex of the third aspect of the invention provides the basis for an assay for detecting the presence in a sample of a nucleic acid sequence of interest.
  • the invention provides a method of detecting in a sample the presence of a nucleic acid sequence of interest; the method comprising the steps of: contacting a first and second probe as defined above, with the sample, so as to form the complex of the third aspect of the invention wherein the target sequence is the sequence of interest or is formed as a result of the presence in the sample of the sequence of interest; and detecting directly or indirectly RNA transcripts of the template portion of the first probe.
  • the target sequence may be RNA or DNA, and may be a sequence of interest, or may be formed as a result of the presence in the sample of the sequence of interest (e.g. by PCR, or by one of the processes disclosed in one of WO 93/06240, WO 94/29481 , EP 0851033 or EP 0552931).
  • the RNA transcript is conveniently amplified and detected by means of the methods described elsewhere in this specification.
  • the discontinuity in the non-template strand of the promoter may, in principle, occur at any position (i.e. the 3' end of the target sequence may contribute any number of bases to the promoter sequence).
  • the target sequence contributes between 1 and 5 bases, more preferably 3 bases, to the promoter sequence, such that the resulting promoter has optimal activity.
  • the second probe hybridises to the first probe immediately adjacent to the target sequence, so that the discontinuity in the non-template strand of the promoter is as small as possible. Again, this optimises promoter activity when the complex is formed.
  • Figures 1 and 3 are schematic representations of a nucleic acid complex in accordance with the first aspect of the invention
  • Figures 2, 4 and 6-9 are bar charts showing amount of RNA produced (in femtomoles) from various nucleic acid complexes;
  • Figure 5 is a schematic representation of a preferred destabilizing moiety for use in some embodiments of the invention.
  • Figure 10 is a schematic representation of a nucleic acid complex in accordance with the third aspect of the invention.
  • Probe 1 contained, sequentially, a 34 base foot region complementary to the target sequence; an 8 base overlap sequence; the 17 base template strand of the T7 promoter; a + 12 sequence and a capture and probe sequence for detection.
  • Probe 2 (“complement”) comprised a 31 base foot region complementary to the target sequence; an 8 base overlap sequence and the first three bases of the complementary (or non- template) strand of the T7 promoter.
  • Probe 3 (“split complement”) contained the remaining 14 bases of the complementary (or non- template) strand of the 17 base T7 promoter sequence. The example is illustrated schematically in Figure 1.
  • a complex formed by a hybridisation reaction comprises four nucleic acid molecules: a 120 base target sequence 2, a first probe 4 ("template”), a second prob° ("complement") 6, and a third probe (“split complement”) 8.
  • the orientation (5' to 3') of the four molecules 2, 4, 6 and 8 is indicated.
  • the first probe/template 4 comprises, in the 5' to 3' direction: a template portion 4a which facilitates isolation and detection of RNA transcripts; a + 12 sequence 4b to enhance promoter activity; a promoter sequence 4c which consists of 17 bases of the T7 promoter; an overlap region 4d to hybridise to a complementary portion 6b of the second probe/complement 6; and a foot region 4e comprising 34 bases to hybridise to a complementary portion of the target 2.
  • the second probe/complement 6 comprises in the 5' to 3 ' direction: a 31 base foot region 6a to hybridise to the target; an 8 base overlap region 6b to hybridise to the complementary portion 4d of the first probe 4; and a partial promoter region 6c consisting of the first three bases (TAA) of one strand of the T7 promoter.
  • TAA first three bases
  • the third probe 8 comprises the remaining 14 bases of the T7 promoter strand.
  • oligonucleotide probes were synthesised by phosphoramidite chemistry using an Applied Biosy stems 380A synthesiser according to the manufacturer's instructions. Biotinylation of oligonucleotide probes was achieved by incorporation of a biotin phosphoramidite. Oligonucleotides functionalised with alkaline phosphatase were prepared using the manufacturers proprietary method (Oswel). All oligonucleotides were HPLC purified using standard techniques.
  • Hybridisation was achieved in an assay mixture that contained 10 fmol of probe 1, 50 fmol of probe 2, 25 fmol of probe 3 and 1 fmol of probe 4 (target for CFTR gene), together with T7 RNA polymerase buffer (Promega) (Promega; 40 mM Tris-HCl, pH 7.9, 6 mM MgC , 2 mM spermidine, 10 mM NaCl at final concentration).
  • the reaction volume was made up to 20 ⁇ l with RNase-free distilled water (allowing for later additions of enzymes and NTPs). Control reactions contained probes 1 , 2 and 3 without target (probe 4).
  • the mixture was heated to 90 °C for 3 minutes to denature the nucleic acids, then cooled (by ramping at 0.1 °C/second) to 37°C.
  • T7 RNA polymerase 25 units
  • 2 ⁇ l rNTP mix from Amersham Pharmacia Biotech (20 mM of each r NTP: adenosine 5' -triphosphate (ATP), guanosine 5 -triphosphate (GTP), cytidine 5'-triphosphate (CTP) uridine 5'- triphosphate (UTP)) were added and the mixture incubated at 37 °C for 3 hours.
  • Probe 3 split complement Seq ID No. 17 5' TACGACTCACTATA 3' Probe 4 (target) Seq ID No. 18
  • Hexaethylene glycol linker positioned 3 bases from the 3' end of Probe 3 (i.e. the split complement probe) increased the amount of signal obtained.
  • the example is illustrated schematically in Figure 3. Corresponding integers are denoted using the same reference numerals adopted in Figure 1. H marks the approximate position of the hexaethylene residue incorporated in the split complement probe.
  • oligonucleotide probes were prepared and functionalised as described in Example 1.1. Hex incorporation was accomplished by reaction of the growing chain with 18- dimethoxytrityl hexaethylene glycol, l-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite. All oligonucleotides were HPLC purified using standard techniques. The oligonucleotides used were identical to those described in Example 1, with the exception of the variant Probe 3 (split complement) oligo (referred to below as "Probe 5"), which contained a Hex between the 11 th and 12 th bases (counting from the 5' end).
  • Probe 3 split complement
  • Hybridisation was achieved in an assay mixture that contained 10 fmol of probe 1, 50 fmol of probe 2, 50 fmol of probe 3 or probe 5 (Hex containing variant of probe 3) and 1 fmol of probe 4 (target for CFTR gene), together with T7 RNA polymerase buffer (Promega).
  • the reaction volume was made up to 20 ⁇ l with RNase-free distilled water (allowing for later additions of enzymes and NTPs).
  • Control reactions contained probes 1, 2 and 3, or probes 1 , 2 and 5, without target (probe 4).
  • the mixture was heated to 90 °C for 3 minutes to denature the nucleic acids, then cooled (by ramping at 0.1 °C / second) to 37°C.
  • T7 RNA polymerase 25 units
  • 2 ⁇ l rNTP mix (Amersham Pharmacia Biotech) were added and the mixture incubated at 37° C for 3 hours.
  • Hybridisation was achieved in an assay mixture that contained 10 fmol of probe 1 , 50 fmol of probe 2, 50 fmol of probe 3 (14 base split complement), 4 (15 base split complement), 5 (16 base split complement) or 6 (17 base split complement) and 1 fmol of probe 7 (target for CFTR gene) , together with T7 RNA polymerase buffer (Promega) . All reactions also contained 50 ng salmon sperm DNA (Sigma) and 5 % Polyethylene glycol 300 (Sigma). The reaction volume was made up to 20 ⁇ l with RNase-free distilled water (allowing for later additions of enzymes and NTPs). Control reactions contained probes 1 , 2 and one of probes 4, 5 or 6, without target (probe 7).
  • the mixture was heated to 90 °C for 3 minutes to denature the nucleic acids, then cooled (by ramping at 0.1 °C / second) to 37°C. After 1 hr, T7 RNA polymerase (Promega) (25 units) and 2 ⁇ l rNTP mix (Amersham Pharmacia Biotech).
  • Probe 4 (15 base split complement) - as Probe 3, Example 1 but with additional G at 3' end
  • Probe 5 (16 base split complement) - as Probe 3, Example 1 but with additional GG at 3 'end
  • Probe 6 (17 base split complement) - as Probe 3 , Example 1 but with additional GGG at 3' end
  • the foot region of the complement probe was 30 bases whilst the foot region of the template probe was either 14 bases or 30 bases.
  • the three base deletion was located 7 bases from the junction point on the template probe foot side of the junction.
  • oligonucleotide probes were prepared and purified as described previously.
  • Octanediol was incorporated by reaction of the growing chain with 8-dimethoxytrityl octanediol, 1- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
  • Hybridisation was achieved in an assay mixture that contained 10 fmol of probe 1 (14 base template foot), 50 fmol of probe 3, 50 fmol of probe 4 and 1 fmol of probe 5 (wild type target sequence) or 1 fmol of probe 6 (mutant target sequence); 10 fmol of probe 2 (30 base template foot), 50 fmol of probe 3, 50 fmol of probe 4 and 1 fmol of probe 5 (wild type target sequence) or 1 fmol of probe 6 (mutant target sequence). All reactions also contained 50 ng salmon sperm DNA (Sigma) and 5 % Polyethylene glycol 300 (Sigma). T7 RNA polymerase buffer (Promega) was added.
  • the reaction volume was made up to 20 ⁇ l with RNase-free distilled water (allowing for later additions of enzymes and NTPs). Control reactions excluded the target (probe 5 or 6).
  • the mixture was heated to 90 °C for 3 minutes to denature the nucleic acids, then cooled (by ramping at 0.1 °C / second) to 37°C. After 1 hr, T7 RNA polymerase (Promega) (25 units) and 2 ⁇ l rNTP mix (Amersham Pharmacia Biotech) were added and the mixture incubated at 37 °C for 3 hours.
  • Figure 7 shows the amount of RNA-produced for reactions in which the template comprised a 14 or 30 base foot region respectively ("A" and "B"), for wild type (i) or mutant (ii) target sequences, or controls (iii) with no target. The results demonstrate that it was readily possible to discriminate between the wild type and mutant targets.
  • Probe 1 template probe with a 14 base foot region (Seq ID No. 26)
  • Probe 2 template probe with a 30 base foot region
  • 5'TCGTCTTCCGGTCTCTCCTCTCAAGCCTCAGCGCTCTCTCTCCCTATAGTGAGT CGTATTAATTTCGAAOATATCATCTTTGGTGTTTCCTATGATGAAT 3 ' O Octanediol Probe 3 (complement probe) (Seq ID No. 28)
  • Bold text represents the 3 bases that are deleted in the mutant.
  • Probe 6 (mutant target sequence) (Seq ID No. 29) .
  • Capture Probe (as Seq ID No. 24, Example 3)
  • E. coli was grown in Luria-Bertani medium (10 g l "1 bacto-tryptone, 5 g l “1 yeast extract and 10 g l “1 sodium chloride) at 37 °C until the culture reached an OD 600 of 1.0.
  • a Qiagen RNeasy ® Mini Kit was used to purify the total RNA. Cells were harvested and lysed according to the manufacturer's instructions. RNA was quantified using GeneQuant II (Amersham Pharmacia Biotech) according to the manufacturer's instructions and aliquots were stored at -80 °C until ready for use.
  • Hybridisation was achieved in an assay mixture that contained 1 fmol of probe 1 , 5 fmol of probe 2, 5 fmol of probe 3 and 10, 1 or 0.1 ng of total RNA from E. coli K12. 50 ng salmon sperm DNA (Sigma) and 5 % Polyethylene glycol 300 (Sigma) were also included in all reactions. T7 RNA polymerase buffer (Promega) was added and the reaction volume made up to 20 ⁇ l with RNase-free distilled water (allowing for later additions of enzymes and NTPs). Control reactions contained probes 1, 2 and 3 without any target RNA. The mixture was heated to 95 °C for 5 minutes and then cooled (by ramping at 0.1 °C / second) to 37 °C.
  • RNA transcribed from the T7 promoter in the complex a linear DNA template (probe 4) was used, which contained a single stranded T7 promoter sequence.
  • a 10 ⁇ l aliquot of each reaction was added to a mix containing 20 fmol of probe 4, 8 ⁇ l T7 RNA polymerase buffer, 50 ⁇ M dNTPs, 2 mM rNTPs, 51 Units T7 RNA polymerase and 4 Units Bst DNA polymerase.
  • the volume was made up to 40 ⁇ l with RNase-free distilled water. The mixture was incubated at 37°C for 3 hours.
  • the RNA from the initial reaction (5.3) hybridised with probe 4 and was extended by the Bst polymerase, forming a fully functional double stranded RNA promoter, which then produced multiple RNA transcripts of the second DNA template, probe 4.
  • Figure 8 shows the amount of RNA produced in reactions using varying amounts (10, 1 or O. lng) of total RNA from E. coli K12 as target, compared with a control reaction (no target).
  • Probe 1 template probe (Seq ID No. 30)
  • Probe 2 (complement probe) (Seq ID No. 31)
  • T3 promoter and T3 RNA polymerase could be used instead of a T7 promoter and T7 RNA polymerase.
  • a 14 base split complement probe was used for the 17 base T3 promoter.
  • Control reactions contained probes 1, 2 and 3 or probes 5, 6 and 7.
  • the mixture was heated to 90 °C for 3 minutes and then cooled (by ramping at 0.1 °C/second) to 37°C.
  • T7 RNA polymerase (25 units) or T3 RNA polymerase (25 units) and 2 ⁇ l rNTP mix (Amersham Pharmacia Biotech) were added and the mixture incubated at 37 °C for 3 hours. The reactions were stored at -80°C. 6.3 Capture and detection of synthesised RNA
  • Figure 9 shows the amount of RNA produced in reactions using T7 or T3 RNA polymerase.
  • the reaction was specific in that T7 RNA polymerase would only produce RNA from a T7 promoter, not from a T3 promoter; and vice versa for T3 RNA polymerase.
  • T3 polymerase produced slightly more RNA than T7 polymerase but, in this system, the background signal (in the absence of target) was much higher for T3.
  • Probe 7 (T3 split complement) (Seq ID No. 38) 5' TAACCCTCACTAAA 3'
  • a complex comprises a first probe 20, a second probe 22 and a target nucleic acid 24.
  • the first probe 20 comprises a transcribable portion 20a, a template strand 20b of an RNA polymerase promoter (such as the T3, T7 or SP6 RNA promoter), and a target complementary portion 20c which is hybridised to 3' end of the target sequence 24.
  • an RNA polymerase promoter such as the T3, T7 or SP6 RNA promoter
  • the second probe 22 is hybridised to the first probe 20 adjacent to the target sequence 24.
  • the second probe 22 comprises bases which are complementary to part (preferably the majority, e.g. 13-15 bases) of the template strand of the promoter on first probe 20 (i.e. the second probe 22 comprises part, preferably the majority, of the non-template strand of the promoter).
  • the remainder of the non-template strand (typically 4-2 bases) is contributed by the 3' end of the target sequence 24.
  • the complex is such that it comprises a functional double stranded RNA polymerase promoter which, in the presence of a relevant RNA polymerase and ribonucleotide triphosphates, causes synthesis of RNA transcripts 26 of the template portion 20a of the first probe.
  • RNA transcripts 26 may be detected, preferably following an optional amplification step, to indicate the presence of the target sequence 24, which may be the sequence of interest or which may have been generated in turn by the presence of the sequence of interest (e.g. by PCR, or by means of one of the other processes described in the prior art, such as WO 93/06240, WO 94/29481 or EP 0851033).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un complexe formé par hybridation et constitué de quatre molécules d'acide nucléique. Ce complexe comprend une molécule d'acide nucléique cible ainsi qu'une première, une deuxième et une troisième molécule sonde d'acide nucléique, la première sonde comprenant une zone de pied complémentaire d'une première partie de la cible, au niveau de laquelle elle est hybridée, et une zone de bras sensiblement non complémentaire de la cible. La deuxième sonde comprend une zone de pied complémentaire d'une seconde partie de la cible. Ainsi, la zone de pied de la deuxième sonde s'hybride avec la cible adjacente ou sensiblement adjacente à la zone de pied de la première sonde, la deuxième sonde comprenant également une zone de bras sensiblement non complémentaire de la cible, mais complémentaire de la zone de bras de la première sonde et hybridée avec cette dernière. La troisième sonde est au moins partiellement complémentaire d'une partie de la zone de bras de manière à s'hybrider avec la zone de bras de la première sonde adjacente ou sensiblement adjacente à la deuxième sonde, la formation dudit complexe permettant de produire un promoteur d'ARN polymérase bicaténaire dont un brin est produit par la première sonde, l'autre brin étant conjointement produit par la deuxième sonde et la troisième sonde. L'invention concerne également une méthode de détection d'une séquence d'acide nucléique d'intérêt impliquant la formation dudit complexe.
PCT/GB2000/002962 1999-07-29 2000-07-31 Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase WO2001009377A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US10/048,225 US7005261B1 (en) 1999-07-29 2000-07-31 Method for detecting nucleic acid target sequences involving in vitro transcription from an RNA polymerase promoter
EP00949760A EP1200627A1 (fr) 1999-07-29 2000-07-31 Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase
JP2001513632A JP2004507203A (ja) 1999-07-29 2000-07-31 Ｒｎａポリメラーゼプロモーターからのインビトロ転写を伴う核酸標的配列の検出方法
CA2381954A CA2381954C (fr) 1999-07-29 2000-07-31 Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase
AU63033/00A AU779591B2 (en) 1999-07-29 2000-07-31 Method for detecting nucleic acid target sequences involving in vitro transcription from an RNA polymerase promoter

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GBGB9917813.9A GB9917813D0 (en) 1999-07-29 1999-07-29 Improvements in or relating to rna polymerase promoters
GB9917813.9 1999-07-29
US14917699P 1999-08-17 1999-08-17
US60/149,176 1999-08-17

Publications (1)

Publication Number Publication Date
WO2001009377A1 true WO2001009377A1 (fr) 2001-02-08

Family

ID=26315806

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/002962 WO2001009377A1 (fr) 1999-07-29 2000-07-31 Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase

Country Status (5)

Country Link
EP (1) EP1200627A1 (fr)
JP (1) JP2004507203A (fr)
AU (1) AU779591B2 (fr)
CA (1) CA2381954C (fr)
WO (1) WO2001009377A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022081764A1 (fr) 2020-10-14 2022-04-21 RNAimmune, Inc. Vaccins contre le cancer à arnm pan-ras

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006240A1 (fr) * 1991-09-13 1993-04-01 Cytocell Limited Technique d'amplification d'acides nucleiques
EP0552931A1 (fr) * 1992-01-22 1993-07-28 Gen-Probe Incorporated Essai d'hybridation utilisant des sondes acides nucléiques ramifiées
EP0851033A1 (fr) * 1996-12-30 1998-07-01 Gen-Probe Incorporated Amplification dépendant d'acides nucléiques cibles
WO1999037805A1 (fr) * 1998-01-27 1999-07-29 Cytocell Limited Procede de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro a partir d'un promoteur d'arn
WO1999037806A2 (fr) * 1998-01-27 1999-07-29 Cytocell Limited Sondes d'acide nucleique modifiees et leurs utilisations

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006240A1 (fr) * 1991-09-13 1993-04-01 Cytocell Limited Technique d'amplification d'acides nucleiques
EP0552931A1 (fr) * 1992-01-22 1993-07-28 Gen-Probe Incorporated Essai d'hybridation utilisant des sondes acides nucléiques ramifiées
EP0851033A1 (fr) * 1996-12-30 1998-07-01 Gen-Probe Incorporated Amplification dépendant d'acides nucléiques cibles
WO1999037805A1 (fr) * 1998-01-27 1999-07-29 Cytocell Limited Procede de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro a partir d'un promoteur d'arn
WO1999037806A2 (fr) * 1998-01-27 1999-07-29 Cytocell Limited Sondes d'acide nucleique modifiees et leurs utilisations

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022081764A1 (fr) 2020-10-14 2022-04-21 RNAimmune, Inc. Vaccins contre le cancer à arnm pan-ras

Also Published As

Publication number Publication date
AU6303300A (en) 2001-02-19
CA2381954C (fr) 2010-04-06
AU779591B2 (en) 2005-02-03
EP1200627A1 (fr) 2002-05-02
JP2004507203A (ja) 2004-03-11
CA2381954A1 (fr) 2001-02-08

Similar Documents

Publication Publication Date Title
US7005261B1 (en) Method for detecting nucleic acid target sequences involving in vitro transcription from an RNA polymerase promoter
US6391593B1 (en) Modified nucleic acid probes and use thereof
US10704042B2 (en) Ligation-based RNA amplification
EP2253717B1 (fr) Méthode d'amplification d'acides nucléiques en utilisant comme matrice des acides nucléiques double-brin
AU769219B2 (en) High specificity primers, amplification methods and kits
EP2473634B1 (fr) Sonde td et ses utilisations
EP1049806B1 (fr) Procede de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro a partir d'un promoteur d'arn
JPH08205894A (ja) 核酸の高感度検出方法
JPH10502259A (ja) 有機相中への抽出による疎水性増幅生成物の検出
JPH08508636A (ja) 核酸配列の増幅
CA2381954C (fr) Methodes de detection de sequences cibles d'acide nucleique impliquant la transcription in vitro d'un promoteur d'arn polymerase
EP1602734B1 (fr) Procede d'amplification d'adn et kit correspondant
EP1200626A1 (fr) Procedes d'amplification d'acides nucleiques
US20230348957A1 (en) Methods and compositions for nucleic acid analysis
JP2004242585A (ja) Ｒｎａ断片を用いたオリゴヌクレオチドによる自己集合体の形成方法、自己集合体及び遺伝子の検出方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 63033/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2381954

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2000949760

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000949760

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10048225

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 63033/00

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 2000949760

Country of ref document: EP