WO2001002436A1 - Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor - Google Patents

Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor Download PDF

Info

Publication number
WO2001002436A1
WO2001002436A1 PCT/AU2000/000799 AU0000799W WO0102436A1 WO 2001002436 A1 WO2001002436 A1 WO 2001002436A1 AU 0000799 W AU0000799 W AU 0000799W WO 0102436 A1 WO0102436 A1 WO 0102436A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
receptor
nucleotide sequence
ecr
Prior art date
Application number
PCT/AU2000/000799
Other languages
English (en)
French (fr)
Inventor
Ronald Johnston Hill
Garry Noel Hannan
Original Assignee
Commonwealth Scientific And Industrial Research Organisation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/346,470 external-priority patent/US7312322B1/en
Application filed by Commonwealth Scientific And Industrial Research Organisation filed Critical Commonwealth Scientific And Industrial Research Organisation
Priority to CA002377804A priority Critical patent/CA2377804A1/en
Priority to JP2001508223A priority patent/JP2003505019A/ja
Priority to AU55141/00A priority patent/AU771153B2/en
Priority to NZ516439A priority patent/NZ516439A/xx
Priority to EP00940058A priority patent/EP1203022A4/en
Priority to IL14729500A priority patent/IL147295A0/xx
Publication of WO2001002436A1 publication Critical patent/WO2001002436A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor

Definitions

  • the present invention relates generally to novel genetic sequences encoding receptor polypeptides and insecticidal modalities therefor, which insecticidal modalities are based upon non-polypeptide insect hormones and their receptors. More specifically, the present invention provides isolated nucleic acid molecules encoding polypeptides comprising functional steroid hormone and juvenile hormone receptors, in particular isolated nucleic acid molecules which encode polypeptides comprising the Lucilia cuprina (sheep blowfly), Myzus persicae (aphid) and Bemesia tabaci (Silverleaf whitefly) ecdysone receptors and juvenile hormone receptors.
  • the present invention relates to isolated nucleic acid molecules which encode the L. cuprina, M. persicae, and B. tabaci EcR polypeptide subunits or fragments thereof, or which encode the EcR partner protein (USP polypeptide) subunits of L. cuprina, M. persicae, and B. tabaci.
  • the EcR and USP polypeptides disclosed herein associate to form functional heterodimeric ecdysone receptors or receptor analogues.
  • the present invention further provides the L. cuprina, M. persicae, and B. tabaci EcR proteins or fragments thereof, in addition to providing the L cuprina, M. persicae, and ⁇ .
  • the present invention further relates to the production of functional recombinant insect receptors and recombinant polypeptide subunits thereof and derivatives and analogues thereof.
  • the present invention further relates to the uses of the recombinant receptor and isolated nucleic acid molecules of the present invention in the regulation of gene expression.
  • the present invention further relates to screening systems and methods of identifying insecticidally- active agents which are capable of agonising or antagonising insect receptor function, such as molecules or ligands which associate with steroid receptors or juvenile hormone receptors so as to modify the affinity of said receptors for their cognate c/s-acting response elements (eg. insect steroid response elements, juvenile hormone response elements) in the genes which they regulate, or alternatively or in addition, which modify the affinity of said receptors for their cellular stimuli (eg.
  • insect steroids or juvenile hormones or analogues thereof, or alternatively or in addition, which act as insecticides by virtue of their ability to agonise or antagonise the activity of insect hormones, such as by mimicry of a ligand which binds to said receptor or a ligand-binding region thereof.
  • the invention further extends to such compounds or ligands.
  • nucleotide and amino acid sequence information prepared using the programme Patentln Version 2.0, presented herein after the bibliography.
  • Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator ⁇ 210> followed by the sequence identifier (e.g. ⁇ 210>1 , ⁇ 210>2, etc).
  • the length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields ⁇ 211>, ⁇ 212> and ⁇ 213>, respectively.
  • Nucleotide and amino acid sequences referred to in the specification are defined by descriptor "SEQ ID NO:" followed by the numeric identifier.
  • SEQ ID NO: 1 refers to the information provided in the numeric indicator field designated ⁇ 400> 1 , etc.
  • nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.
  • the term "derived from” shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.
  • Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications.
  • the invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.
  • WO91/13167 International Patent Application No WO91/13167 (applicant, The Board of Trustees of Leyland Stanford University, and hereinafter referred to as WO91/13167) describes the identification, characterization, expression and uses of insect steroid receptors and DNA sequences encoding same and, in particular, the identification, characterization, expression and uses of the steroid receptor of the common fruit fly, Drosophila melanogaster.
  • the D. melanogaster steroid receptor described in WO91/13167 is temperature-sensitive, showing reduced activity at temperatures above 30°C, such as at temperatures about 37°C, particularly at low concentrations of the receptor. Accordingly, the D. melanogaster steroid receptor described in WO91/13167 is of limited utility at physiological temperatures applicable to animal or bacterial cells. Moreover, wherein it is desirable to produce a biologically-active steroid receptor using in vivo or in situ expression systems, which expression systems routinely utilise cells or tissues in the temperature range of about 28°C to about 42°C, the D. melanogaster steroid receptor is also of limited utility.
  • the present inventors developed a novel screening protocol, involving the utilisation of highly-degenerate oligonucleotide probes and primers derived from the amino acid sequences of the DNA-binding domains of the D. melanogaster and Chironomus tentans ecdysone receptor polypeptides, to identify nucleotide sequences encoding novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides.
  • the present inventors have further identified specific regions within these novel polypeptides which are suitable for use in preparing a surprising range of novel steroid receptor polypeptide derivatives and insect juvenile hormone receptor polypeptide derivatives.
  • novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides of the present invention and derivative polypeptides thereof, and assembled steroid receptors and insect juvenile hormone receptors derived from said polypeptides and derivatives, and nucleic acid molecules encoding same as exemplified herein, provide the means for developing a wide range of insecticidally-active agents, as well as methods for the regulated production of bioactive molecules.
  • the present invention provides the means for developing specific ligands which bind to and either agonise or antagonise the steroid receptors or juvenile hormone receptors, and/or which bind to polypeptide subunits of said receptors as described herein, thereby functioning as highly-specific insecticides, offering significant commercial and environmental benefits.
  • the present inventors have been surprisingly successful in characterizing the ecdysone receptor and juvenile hormone receptor derived from insects of the orders Diptera and Hemiptera, and polypeptide components thereof and functional derivatives of said polypeptides and receptors, particularly in light of the extreme difficulties in dealing with these organisms.
  • the nature of these molecules was unknown prior to the present invention.
  • the various aspects of this invention overcome the problems associated with Drosophila ecdysone receptors which lack thermal stability.
  • those aspects of the invention pertaining to methods of screening for insecticidally active agents do not involve competition assays which are generally complex, and often inaccurate or difficult to calibrate.
  • One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of an steroid receptor, the partner protein (USP polypeptide) of an steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence that is at least 40% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4,
  • SEQ ID NO: 6 SEQ ID NO: 8 SEQ ID NO: 10
  • SEQ ID NO: 14 SEQ ID NO: 16
  • the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of an steroid receptor, the partner protein (USP polypeptide) of an steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said nucleotide sequence is selected from the group consisting of:
  • nucleotide sequence that is capable of hybridising under at least low stringency conditions to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or to a complementary nucleotide sequence to any one of said sequences;
  • nucleotide sequence that is capable of hybridising under at least low stringency conditions to a nucleotide sequence contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581 ;
  • the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor EcR polypeptide and comprises the nucleotide sequence set forth in SEQ ID NO: 1 , or SEQ ID NO: 13.
  • the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor USP polypeptide or a juvenile hormone receptor polypeptide and comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41.
  • the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 21 , SEQ ID NO: 37, and SEQ ID NO: 41 , or a complementary nucleotide sequence to any one of said sequences.
  • the present invention provides an isolated nucleic acid molecule which comprises the nucleotide sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31 , and SEQ ID NO: 32, or a complementary nucleotide sequence thereto.
  • a second aspect of the present invention provides a method of identifying an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide comprising the steps of:
  • a probe comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ
  • a probe comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos.
  • a hybridisation probe comprising a nucleotide sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or a complementary nucleotide sequence to any one of said sequences, or a homologue, analogue or derivative of any one of said sequences or complementary sequences having at least 40% identity thereto; and (ii) detecting the hybridisation.
  • the inventive method comprises the steps of:
  • PCR primers selected from the group consisting of:
  • a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ
  • SEQ ID NO: 12 SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or a complementary nucleotide sequence to any one of said sequences;
  • a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581 ; and (ii) amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction.
  • the inventive method comprises the steps of:
  • a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:
  • a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL
  • a probe comprising at least 10 contiguous nucleotides in length derived from a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,
  • SEQ ID NO: 27 SEQ ID NO: 28, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or a complementary nucleotide sequence to any one of said sequences;
  • a probe comprising at least 10 contiguous nucleotides in length derived from a cDNA contained in a plasmid selected from the group consisting of
  • a hybridisation probe comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 37,
  • SEQ ID NO: 39 and SEQ ID NO: 41 , or a complementary nucleotide sequence to any one of said sequences, or a homologue, analogue or derivative of any one of said sequences or complementary sequences having at least 40% identity thereto; and (iii) detecting the hybridisation.
  • a third aspect of the present invention provides a genetic construct comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence.
  • the subject nucleic acid molecule is in an expressible format, such that it is possible to produce a recombinant polypeptide therefrom.
  • a fourth aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence that is at least 40% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4,
  • SEQ ID NO: 6 SEQ ID NO: 8 SEQ ID NO: 10
  • SEQ ID NO: 14 SEQ ID NO: 16
  • polypeptide is substantially free of naturally-associated insect cell components.
  • the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence that is at least 40% identical to a polypeptide encoded by cDNA present in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581 ; wherein said polypeptide is substantially free of naturally-associated insect cell components.
  • a fifth aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.
  • the cell of the present invention expresses the polypeptide encoded by the nucleic acid molecule.
  • the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said reporter molecule.
  • an animal such as a mammal
  • microorganism such as a plant or aquatic organism, containing one or more cells as mentioned above.
  • a further aspect of the present invention provides a method of identifying a modulator of insect steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene expression comprising:
  • a still further aspect of the invention provides a method of identifying a potential insecticidal compound comprising:
  • a still further aspect of the invention provides a method of identifying a candidate insecticidally- active agent comprising the steps of: a) expressing an EcR polypeptide of a steroid receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR partner protein (USP polypeptide) of a steroid receptor or ligand binding domain thereof, optionally in association with an insect steroid or analogue thereof so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.
  • a expressing an EcR polypeptide of a steroid receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR partner protein (USP polypeptide) of a steroid receptor or lig
  • a still further aspect of the invention provides a method of identifying a candidate insecticidally- active agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.
  • this invention relates to a method or assay for screening insecticidally active compounds which comprises reacting a candidate insecticidal compound with a steroid receptor polypeptide or fragment thereof encompassing the ligand binding domain, or complex thereof with a partner protein or a fragment thereof which encompasses the ligand binding domain, and detecting binding or absence of binding of said compound so as to determine insecticidal activity.
  • a still further aspect of the invention provides a synthetic compound which interacts with the three dimensional structure of a polypeptide or protein selected from the group consisting of:
  • the synthetic compounds are derived from the three dimensional structure of insect steroid receptor(s) or juvenile hormone receptor(s) which compounds bind to said receptor(s) and have the effect of either inactivating the receptor(s) or potentiating the activity of the receptor(s). More preferably, the compounds mimic the three-dimensional structure of a ligand which binds to the receptor(s) and more preferably, mimic the three-dimensional structure of a ligand which binds to the ligand-binding region of said receptor(s).
  • a screening system for insecticidally active agents comprising a nucleotide sequence encoding a steroid receptor or a fragment thereof, and a nucleotide sequence encoding a partner protein or a fragment thereof which associates with the receptor so as to confer enhanced affinity for insect steroid response elements, or enhanced affinity for insect steroids or analogues thereof or insecticidally active agents, or thermostability or enhanced ther ostability of said receptor, which receptor and partner protein is capable of binding to a candidate insecticidally active agent to form an activated complex, and a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence, wherein on exposure to said agent expression of the bioactive molecule or reporter molecule correlates with insecticidal activity.
  • a method for the regulated production of a bioactive molecule or a reporter molecule in a cell comprising the steps of introducing into said cell: a) a nucleotide sequence encoding a steroid receptor or a fragment thereof which is capable of binding an insect steroid or analogue thereof, to form an activated complex; and b) a nucleotide sequence encoding said bioactive molecule or reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence encoding said bioactive molecule or reporter molecule, wherein exposing the cell to an insect steroid or analogue thereof regulates expression of the bioactive molecule or reporter molecule.
  • SEQ ID NO: 1 The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the L. cuprina ecdysone receptor and amino acid sequence therefor.
  • SEQ ID NO: 2 The amino acid sequence of the EcR polypeptide subunit of the L cuprina ecdysone receptor.
  • SEQ ID NO: 3 The nucleotide sequence of the cDNA molecule contained in plasmid pBLU1 which encodes the EcR partner protein (USP polypeptide) subunit of the L cuprina ecdysone receptor or which encodes the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 4 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: 3.
  • SEQ ID NO: 5 The nucleotide sequence of the cDNA molecule from plasmid pLSP5 which encodes the EcR partner protein (USP polypeptide) subunit of the
  • SEQ ID NO: 6 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L cup na ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: 5.
  • SEQ ID NO: 7 The nucleotide sequence of the cDNA molecule from plasmid pLSP12 which encodes the EcR partner protein (USP polypeptide) subunit of the
  • SEQ ID NO: 8 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: 7.
  • SEQ ID NO: 9 The nucleotide sequence of a cDNA molecule which encodes part of the EcR polypeptide subunit of the M. persicae ecdysone receptor and amino acid sequence therefor.
  • SEQ ID NO: 10 The amino acid sequence of a part of the EcR polypeptide subunit of the
  • SEQ ID NO: 11 The nucleotide sequence of the EcR probe 1 which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the EcR polypeptide subunit of the M. persicae ecdysone receptor.
  • SEQ ID NO: 12 The nucleotide sequence of the EcR probe 2 sequence which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the EcR polypeptide subunit of the M. persicae ecdysone receptor.
  • SEQ ID NO: 13 The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the M. persicae ecdysone receptor and amino acid sequence therefor.
  • SEQ ID NO: 14 The amino acid sequence of the EcR polypeptide subunit of the M. persicae ecdysone receptor.
  • SEQ ID NO: 15 The nucleotide sequence of the open reading frame of a first cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.
  • USP polypeptide EcR partner protein
  • SEQ ID NO: 16 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: 15.
  • SEQ ID NO: 17 The nucleotide sequence of the open reading frame of a second cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 18 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: 17.
  • SEQ ID NO: 19 The nucleotide sequence of the open reading frame of a third cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 20 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: 19.
  • SEQ ID NO: 21 The nucleotide sequence of a 150 base-pair probe which is specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of L. cuprina ecdysone receptor or the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 22 The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22: The amino acid sequence encoded
  • SEQ ID NO: 23 The nucleotide sequence of the degenerate primer Rdna3.
  • SEQ ID NO: 24 The nucleotide sequence of the degenerate primer Rdna4.
  • SEQ ID NO: 25 The nucleotide sequence of the primer Mdnal .
  • SEQ ID NO: 26 The nucleotide sequence of the primer Mdna2.
  • SEQ ID NO: 27 The nucleotide sequence of the primer AP1.
  • SEQ ID NO: 28 The nucleotide sequence of the degenerate primer AP2.
  • SEQ ID NO: 29 The sequence of oligonucleotide SPX5 used to construct plasmid pVPLcEcR.
  • SEQ ID NO: 30 The sequence of oligonucleotide XPS5 used to construct plasmid pVPLcEcR.
  • SEQ ID NO: 31 The nucleotide sequence of oligonucleotide A used to construct plasmid pSGDM.
  • SEQ ID NO: 32 The nucleotide sequence of oligonucleotide B used to construct plasmid pSGDM.
  • SEQ ID NO: 33 The sequence of oligonucleotide A used to construct the expression plasmid pMpEcR.LcUSP.DUAL.
  • SEQ ID NO: 34 The sequence of oligonucleotide B used to construct the expression plasmid pMpEcR.LcUSP.DUAL.
  • SEQ ID NO: 35 The sequence of oligonucleotide C used to construct the expression plasmid pMpEcR.USP.DUAL.
  • SEQ ID NO: 36 The sequence of oligonucleotide D used to construct the expression plasmid pMpEcR.USP.DUAL.
  • SEQ ID NO: 37 The nucleotide sequence of a probe which is specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of S. tabaci ecdysone receptor or the USP polypeptide subunit of the B. tabaci juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 38 The amino acid sequence encoded by the nucleotide sequence of SEQ
  • SEQ ID NO: 37 The nucleotide sequence of the open reading frame of a cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the B. tabaci ecdysone receptor or the USP polypeptide subunit of the B. tabaci juvenile hormone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 40 The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the ⁇ . tabaci ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the B. tabaci juvenile hormone receptor encoded by SEQ ID NO: 39.
  • SEQ ID NO: 41 The nucleotide sequence of a probe which is specific for genetic sequences encoding the EcR polypeptide subunit of B. tabaci ecdysone receptor, and amino acid sequence therefor.
  • SEQ ID NO: 42 The amino acid sequence encoded by the nucleotide sequence of SEQ
  • Figure 1 is a graphical representation showing function of the EcR polypeptide subunit of the L cuprina ecdysone receptor in vivo. CHO cells were co transfected with:
  • CAT expression was induced with Muristerone A at either 10 ⁇ M or 50 ⁇ M while control cells received only the carrier ethanol.
  • ELISA kits were used to quantify the synthesis of CAT and ⁇ -galactosidase in extracts of cells forty eight hours after transfection.
  • the level of CAT was normalized to the level of ⁇ -galactosidase in the same extract.
  • Fold-induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone, relative to the normalized values for CAT gene expression in cells transfected with the same plasmid, but in the absence of hormone.
  • the average values of three independent experiments are shown and the error bars indicate standard error of the mean.
  • Figure 2 is a copy of a graphical representation showing the activity of plasmids pSGLD and pSGDL, containing chimeric EcR polypeptide subunits of insect ecdysone receptors, produced as described in the Examples.
  • Cotransfection assays were performed as described in the Examples using plasmids pSGLD and pSGDL and the CAT reporter plasmid p(EcRE) 7 -CAT (1 ug/ml) and an independent reporter, pPGKLacZ at 1 ⁇ g/ml each.
  • CAT/ ⁇ -Gal (%) refers to CAT reporter activity expressed as a percentage relative to ⁇ -galactosidase activity produced by the internal control reporter, pPGKLacZ.
  • Figure 3 is a copy of a graphical representation showing the binding activity in extracts of Sf9 and Sf21 cells containing a baculovirus expressing LcEcRDEF and LcUSPDEF, as described in the Examples.
  • Control cells contained baculovirus expressing ⁇ -glucuronidase and CAT only.
  • Figure 4 is a graphical representation showing the ecdysteroid binding activities of an in vitro- translated Myzus persicae EcR (MpEcR) polypeptide, an in ' fro-translated Myzus persicae USP (MpUSP) polypeptide, and a complex formed by in v#ra-translated M. persicae EcR and USP polypeptides.
  • MpEcR Myzus persicae EcR
  • MpUSP Myzus persicae USP
  • Figure 5 is a copy of a graphical representation showing the expression activity of plasmid pVPLcEcR, encoding a chimeric L. cuprina EcR polypeptide, and plasmid pSGLcUSP encoding the L. cuprina EcR partner protein (USP polypeptide), in CV1 cells, in accordance with the description provided in Example 18.
  • the CAT reporter plasmid p(EcRE) 7 -CAT (1 ug/ml), and an independent reporter plasmid, pPGKLacZ (1 ⁇ g/ml) were used to assay ecdysteroid-dependent gene expression.
  • Data indicate expression of the CAT reporter gene relative to the level of expression of the transfection control ⁇ -galactosidase reporter gene.
  • the symbols + and - indicate the presence or absence, respectively, of the plasmids pVPLcEcR and pSGLcUSP, or the presence (+) or absence (-) of 1 ⁇ M Ponasterone A (PonA). Error bars indicate the standard error of the mean.
  • Figure 6 is a graphical representation showing in vivo function of a modified EcR polypeptide subunit of the M. persicae ecdysone receptor in CHO cells.
  • the CHO cells were co-transfected with a.reporter plasmid p(EcRE) 7 -CAT (1 ⁇ g/ml) and an expression plasmid selected from the group consisting of pSGDmEcR, pSGMpEcR, pSGDM, pSGMD, and pSG5 (described in the examples), also at 1 ⁇ g/ml concentration.
  • Data indicate CAT reporter gene expression as determined by ELISA, for cells lacking Muristerone A (open bars) or containing 10 ⁇ M Muristerone A (filled bars). The level of CAT expression is directly correlated to the concentration of the product of the enzymatic reaction in the assay and was measured as an absorbance at 405nm.
  • Figure 7 is a copy of a graphical representation showing the binding of [ 3 H] ponasterone A to extracts of Sf9 cells infected with baculovirus expressing the ligand binding regions (i.e. domains D/E/F) of (i) the M. persicae EcR polypeptide and the L. cuprina EcR partner protein (USP polypeptide); (ii) the M. persicae EcR polypeptide and the M. persicae EcR partner protein (USP polypeptide); and (iii) the L cuprina EcR polypeptide and the L. cuprina EcR partner protein (USP polypeptide). Highly significant binding (i.e. above background) of the ecdysteroid analogue is apparent for all three constructs tested.
  • the ligand binding regions i.e. domains D/E/F
  • Figure 8 is a copy of a graphical representation showing the activity of plasmid pSGDM (Example 19), encoding a chimeric M. persicae EcR polypeptide, and plasmid pBKMpUSPI , encoding an M. persicae EcR partner protein (USP polypeptide), in CV1 cells.
  • the CAT reporter plasmid p(EcRE) 7 -CAT (1ug/ml) and an internal control reporter plasmid, pPopNLacZ (1 ⁇ g/ml) were present in all assays.
  • One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4,
  • SEQ ID NO: 6 SEQ ID NO: 8 SEQ ID NO: 10
  • SEQ ID NO: 14 SEQ ID NO: 16
  • the isolated nucleic acid molecule of the invention may comprise a fragment of a nucleotide sequence encoding a full-length receptor polypeptide.
  • a "fragment" of a nucleotide sequence encoding an EcR polypeptide subunit of a steroid receptor or an EcR partner protein (USP polypeptide) of a steroid receptor or a USP polypeptide of a juvenile hormone receptor refers to a nucleotide sequence encoding a part or fragment of such a receptor which is capable of binding or associating with an insect steroid or an analogue thereof, or a candidate insecticidally active compound. Fragments of a nucleotide sequence would generally comprise in excess of twenty contiguous nucleotides derived from the base sequence and may encode one or more domains of a functional insect steroid receptor or juvenile hormone receptor.
  • the isolated nucleic acid molecule of the invention encodes an ecdysteroid receptor polypeptide.
  • ecdysteroid receptors derived from insects are heterodimeric receptors comprising an EcR polypeptide subunit and an EcR partner protein (USP polypeptide) (see also Jones and Sharp, 1997).
  • USP polypeptide an EcR partner protein
  • the present inventors have discovered that the USP polypeptide of the insect juvenile hormone receptor is structurally- identical to the EcR partner protein of the ecdysteroid receptor of the present invention, however juvenile hormone receptors comprise monomers or multimers of the USP polypeptide acting without the EcR polypeptide subunit that is present in the ecdysteroid receptors.
  • the present invention extends equally to nucleotide sequences encoding polypeptides of both the ecdysteroid receptors and polypeptides of the juvenile hormone receptors of insects.
  • the isolated nucleic acid molecule of the invention encodes an ecdysteroid receptor that is modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.
  • the isolated nucleic acid molecule of the invention may be derived from any organism that contains steroid receptors that are responsive to ecdysteroids or ecdysteroid-like compounds or juvenile hormones, or analogues of such receptor-ligands. Accordingly, the present invention is not to be limited in any of its embodiments to the particular source of the subject nucleic acid, or polypeptide encoded therefor.
  • the isolated nucleic acid molecule of the invention is derived from insects, helminths (nematodes, cestodes, trematodes), protozoa, and ants, amongst others.
  • the isolated nucleic acid molecule of the invention is derived from an insect selected from the group consisting of diptera, hemiptera, coleoptera, neuroptera, lepidoptera and ants, amongst others. Still more preferably, the isolated nucleic acid molecule of the present invention is derived from aphids, scale insects, leaf hoppers, white fly, and blowflies such as sheep blowflies.
  • the present invention does not extend to amino acid sequences comprising the complete EcR polypeptide subunit of the D. melanogaster ecdysone receptor as described in WO91/13167. However, this exclusion is made on the understanding that the present invention does encompass chimeric genes and fusion proteins which include the D. melanogaster nucleotide and amino acid sequences, respectively.
  • the isolated nucleic acid molecule of the present invention is derived from the aphid M. persicae or alternatively, from the Australian sheep blowfly, L cuprina.
  • the ecdysteroid receptor is preferably modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.
  • analogue of an ecdysteroid shall be taken to indicate any compound that binds to one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, which binds to the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, which binds to a bioactive derivative or analogue of said polypeptides or holoreceptor.
  • analogue of an ecdysteroid shall further be taken to indicate any compound that modulates the bioactivity of one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, that modulates the bioactivity of the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, that modulates the bioactivity of a bioactive derivative or analogue of said polypeptides or holoreceptor.
  • the present invention is not to be limited in scope to the specific L cuprina, M. persicae, and ⁇ . tabaci nucleotide and amino acid sequences set forth in the accompanying Sequence Listing, and persons skilled in the art will readily be able to identify additional related sequences from other sources using art-recognised procedures, for example using nucleic acid hybridisation and/or polymerase chain reaction essentially as described by Ausubel et al. (1992) and/or McPherson et al. (1991 ) and/or Sambrook et al . (1989).
  • the present invention clearly encompasses isolated nucleic acid molecules which encode or are complementary to isolated nucleic acid molecules which encode the subject EcR polypeptide of a steroid receptor or fragments thereof, or the subject EcR partner protein (USP polypeptide) of a steroid receptor or the subject USP polypeptide of a juvenile hormone receptor, in addition to derivatives, fragments and analogues thereof which comprise amino acid sequences having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42.
  • the present invention clearly extends further to isolated nucleic acid molecules which encode or are complementary to isolated nucleic acid molecules which encode the subject EcR polypeptide of a steroid receptor or fragments thereof, or the subject EcR partner protein (USP polypeptide) of a steroid receptor or the subject USP polypeptide of a juvenile hormone receptor, in addition to derivatives, fragments and analogues thereof which comprise amino acid sequences having at least 40% identity to an amino acid sequence encoded by L cuprina, M. persicae or B. tabaci cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581.
  • plasmid pLcEcR contains the cDNA encoding the EcR polypeptide subunit of the Lucilia cuprina ecdysone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04566.
  • plasmid pLcUSP contains the cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Lucilia cuprina ecdysone receptor or the USP polypeptide subunit of the L. cuprina juvenile hormone receptor.
  • This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04565.
  • plasmid pMpEcR contains the cDNA encoding the EcR polypeptide subunit of the Myzus persicae ecdysone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04567.
  • plasmid pMpUSP contains a first cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Myzus persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor.
  • This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04568.
  • plasmid pMpUSP2 contains a second cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Myzus persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor.
  • This plasmid was deposited on 21 June, 2000 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM00/12581.
  • plasmid pBtUSP contains the cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Bemesia tabaci ecdysone receptor or the USP polypeptide subunit of the B. tabaci juvenile hormone receptor.
  • This plasmid was deposited on 21 June, 2000 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM00/12580.
  • NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581 is at least about 60%, more preferably at least about 80%, even more preferably at least about 90%.
  • amino acid sequence identities or similarities may be calculated using the GAP programme and/or aligned using the PILEUP programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).
  • the GAP programme utilizes the algorithm of Needleman and Wunsch (1970) to maximise the number of identical/similar residues and to minimise the number and length of sequence gaps in the alignment.
  • the ClustalW programme of Thompson et al (1994) is used.
  • the isolated nucleic acid molecule of the invention encodes or is complementary to an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a fragment thereof, or a partner protein (USP) or a fragment thereof, which at least comprises an amino acid sequence which is substantially identical to a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42, or substantially identical to the amino acid sequence of a polypeptide encoded by cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581.
  • the term "substantially identical” or similar term shall be taken to include any sequence which is at least about 95% identical and preferably at least 99% or 100% identical to a stated nucleotide sequence or amino acid sequence, including any homologue, analogue or derivative of said stated nucleotide sequence or amino acid sequence.
  • variants include any genomic sequences, cDNA sequences mRNA or other isolated nucleic acid molecules derived from the nucleic acid molecules exemplified herein by the Sequence Listing. Additional variants are not excluded.
  • the variant nucleotide sequences encode a fragment of the EcR polypeptide of the insect steroid receptor or a fragment of the EcR partner protein (USP polypeptide) of the insect steroid receptor or a fragment of the USP polypeptide of the insect juvenile hormone receptor.
  • USP polypeptide EcR partner protein
  • Preferred fragments of the subject polypeptides include one or more regions or domains which are involved in the interaction or association between the monomeric polypeptide subunits of a multimeric receptor and/or which are involved in the interaction or association between (i) a cognate steroid or receptor ligand or c/s-acting DNA sequence; and (ii) said monomeric polypeptide subunits or the receptor per se.
  • the fragments comprise the DNA-binding domain, linker domain (domain D) or a part thereof, or ligand-binding domain (eg. hormone-binding domain) of a steroid receptor polypeptide or juvenile hormone receptor polypeptide or receptor holoenzyme.
  • the L. cuprina ecdysone receptor is preferably to include at least a ligand-binding region comprising the ligand-binding domain and at least a part of the linker domain of the EcR polypeptide subunit, optionally in association with a ligand-binding region comprising at least the ligand-binding domain and at least a part of the linker domain of the EcR partner protein (USP polypeptide) subunit of said receptor. Additional fragments are not excluded.
  • Homologues, analogues and derivatives of the nucleotide sequences exemplified herein may be isolated by hybridising same under at least low.stringency conditions and preferably under at least medium stringency conditions, to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ
  • the isolated nucleic acid molecule according to this aspect of the invention is capable of hybridising under at least high stringency conditions to a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ
  • a low stringency is defined herein as being a hybridisation or a wash carried out in 6xSSC buffer, 0.1 % (w/v) SDS at 28°C or alternatively, as exemplified herein.
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridisation and/or wash.
  • a medium stringency comprises a hybridisation and/or a wash carried out in 0.2xSSC-2xSSC buffer, 0.1% (w/v) SDS at 42°C to 65°C, while a high stringency comprises a hybridisation and/or a wash carried out in 0.1xSSC-0.2xSSC buffer, 0.1% (w/v) SDS at a temperature of at least 55°C.
  • Conditions for hybridisations and washes are well understood by one normally skilled in the art. For the purposes of further clarification only, reference to the parameters affecting hybridisation between nucleic acid molecules is found in Ausubel et al. (1992), which is herein incorporated by reference.
  • a hybridising nucleic acid molecule further comprises a sequence of nucleotides which is at least 40% identical to at least 10 contiguous nucleotides, preferably at least 50 contiguous nucleotides and more preferably at least 100 contiguous nucleotides, derived from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or a complementary strand of any one of said sequences, or a nucleotide sequence of a cDNA contained in any one or more of the deposited plasmids referred to herein.
  • nucleotide sequences In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment.
  • reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).
  • nucleotide sequences encoding EcR polypeptide subunits of insect steroid receptors or fragments thereof or EcR partner proteins (USP polypeptides) of insect steroid receptor or fragments thereof, or USP polypeptides of insect juvenile hormone receptor polypeptides are amplified in the polymerase chain reaction.
  • nucleic acid "primer molecules” derived from a nucleotide sequence exemplified herein, such as, for example, a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or a complementary sequence to any one of said sequences, or a sequence from a cDNA contained in any one or more of the deposited plasmids referred to herein, are annealed or hybridized to a nucleic acid "template molecule" which at least comprises a nucleotide sequence encoding a related genetic sequence or a functional part thereof, and nucleic acid molecule copies of the template molecule are amplified enzymatically
  • one of the primer molecules comprises contiguous nucleotides derived from a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO:
  • SEQ ID NO: 21 SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41 , or from a cDNA contained in any one or more of the deposited plasmids referred to herein; and another of said primers comprises contiguous nucleotides complementary to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO:
  • each nucleic acid primer molecule is at least 10 nucleotides in length, more preferably at least 20 nucleotides in length, even more preferably at least 30 nucleotides in length, still more preferably at least 40 nucleotides in length and even still more preferably at least 50 nucleotides in length.
  • nucleic acid primer molecules consists of a combination of any of the nucleotides adenine, cytidine, guanine, thymidine, or inosine, or functional analogues or derivatives thereof which are at least capable of being incorporated into a polynucleotide molecule without having an inhibitory effect on the hybridisation of said primer to the template molecule in the environment in which it is used.
  • nucleic acid primer molecules may be contained in an aqueous mixture of other nucleic acid primer molecules, for example a mixture of degenerate primer sequences which vary from each other by one or more nucleotide substitutions or deletions.
  • nucleic acid primer molecules may be in a substantially pure form.
  • two primer nucleotide sequences are used to amplify related sequences, said primers comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23 to 30 inclusive.
  • the primers are used in a primer combination selected from the group consisting of (i)SEQ ID NO: 23 and SEQ ID NO: 24; (ii) SEQ ID NO: 25 and SEQ ID NO: 26; (iii) SEQ ID NO: 27 and SEQ ID NO: 28; and (iv) SEQ ID NO: 31 and SEQ ID NO: 32.
  • the nucleic acid template molecule may be in a recombinant form, in a virus particle, insect cell, bacteriophage particle, yeast cell, animal cell, or a plant cell.
  • the nucleic acid template molecule is derived from an insect species.
  • the isolated nucleic acid molecule of the present invention may be cloned into a plasmid or bacteriophage 5 molecule, for example to facilitate the preparation of primer molecules or hybridisation probes or for the production of recombinant gene products.
  • Methods for the production of such recombinant plasmids, cosmids, bacteriophage molecules or other recombinant molecules are well-known to those of ordinary skill in the art and can be accomplished without undue experimentation. Accordingly, the invention further extends to any recombinant plasmid,
  • SEQ ID NO: 10 bacteriophage, cosmid or other recombinant molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO:
  • the nucleic acid molecule of the present invention is also useful for developing genetic constructs which comprise and preferably, express, the EcR polypeptide subunit of the insect steroid receptor and/or the EcR partner protein (USP polypeptide) of the steroid receptor or the USP polypeptide of the juvenile hormone receptor, thereby providing for the production of the recombinant polypeptides in isolated cells or transformed tissues.
  • the EcR polypeptide subunit of the insect steroid receptor and/or the EcR partner protein (USP polypeptide) of the steroid receptor or the USP polypeptide of the juvenile hormone receptor thereby providing for the production of the recombinant polypeptides in isolated cells or transformed tissues.
  • a further aspect of the present invention provides a genetic construct comprising the subject isolated nucleic acid molecule encoding the insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence.
  • the subject nucleic acid molecule is in an expressible format, such that it is possible to produce
  • promoter includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation in a eukaryotic cell, with or without a CCAAT box sequence or alternatively, the Pribnow box required for accurate expression in prokaryotic cells.
  • Promoters may be cell, tissue, organ or system specific, or may be non-specific. Using specific promoters, the expression of a bioactive agent or other polypeptide encoded by a structural gene to which the promoter is operably connected may be targeted to a desired cellular site.
  • cells of the transgenic animal may contain a gene encoding a steroid receptor, preferably a steroid receptor linked to an epidermal specific promoter and a separate gene encoding, for example, epidermal growth factor (EGF) which is functionally linked to one or more insect hormone response elements and may or may not also be linked to epidermal specific promoter elements.
  • EGF epidermal growth factor
  • the activated complex between the insect steroid receptor and insect steroid may bind to the one or more insect steroid hormone response element thereby inducing EGF production solely in epidermal cells which may give rise to defleecing.
  • this aspect of the invention is independent of the degree of thermostability of the insect steroid receptor
  • the same principal applies to expression of any bioactive molecule or reporter molecule in a specific cell type which is regulated by a transactivating complex between a steroid receptor complex and an appropriate insect steroid.
  • promoter is also used to describe a synthetic or fusion molecule, or derivative which confers, activates or enhances expression in a cell in response to an external stimulus.
  • the promoter may include further regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner.
  • Preferred promoters may contain copies of one or more specific regulatory elements, in particular steroid responsive elements (SREs) or hormone-responsive elements (HREs), to further enhance expression and/or to alter the spatial expression and/or temporal expression pattern.
  • SREs steroid responsive elements
  • HREs hormone-responsive elements
  • steroid response element refers to one or more c/s-acting nucleotide sequences present in a naturally-occurring or synthetic or recombinant gene the expression of which is regulated by an insect steroid, such as an ecdysteroid, for example ecdysone or ponasterone A, wherein said regulation of expression results from an direct or indirect interaction between a steroid receptor and said c/s-acting nucleotide sequence response element.
  • an insect steroid such as an ecdysteroid, for example ecdysone or ponasterone A
  • Exemplary insect steroid hormone response elements include the ecdysone response element hsp27 (EcRE) and any other nucleotide sequence which is capable of binding ecdysteroid receptors or polypeptide subunits thereof or fragments or analogies thereof (such as associated with E75, E74 or other Drosophila early genes), as described for example by Riddihough and Pelham (1987).
  • EcRE ecdysone response element hsp27
  • an SRE or a plurality of such elements may be operably linked to a promoter such as the polyhedron promoter, p10 promoter, MMTV promoter or SV40 promoter, to make transcription of a structural gene to which said promoter is operably connected responsive to the presence of a steroid bound to the insect receptor (which may act as a transcription factor).
  • a promoter such as the polyhedron promoter, p10 promoter, MMTV promoter or SV40 promoter
  • One or more insect SREs may be located within a promoter, and may replace sequences within a selected promoter which confer responsiveness to hormones or other agents which regulate promoter activity. Where response elements are different they may lead to preferential binding of different insect steroids or analogues thereof such that a promoter may be differentially regulated.
  • SREs include, but are not limited to, the hsp27 ecdysone response element described by Riddihough and Pelham (1987) or the 13 base-pair palindromic core contained therein.
  • a promoter is usually, but not necessarily, positioned upstream or 5', of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene.
  • Placing a gene or isolated nucleic acid molecule operably under the control of a promoter sequence means positioning said gene or isolated nucleic acid molecule such that its expression is controlled by the promoter sequence. Promoters are generally positioned 5' (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function.
  • the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i.e., the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.
  • promoter will depend upon the nature of the cell being transformed and when expression is required. Furthermore, it is well-known in the art that the promoter sequence used in the expression vector will also vary depending upon the level of expression required and whether expression is intended to be constitutive or regulated.
  • the genetic construct For expression in eukaryotic cells, the genetic construct generally comprises, in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate expression of said nucleic acid molecule.
  • the promoter may be derived from a genomic clone which normally encodes the expressed protein or alternatively, it may be a heterologous promoter derived from another genetic source. Promoter sequences suitable for expression of genes in eukaryotic cells are well-known in the art.
  • Suitable promoters for use in eukaryotic expression vectors include those capable of regulating expression in mammalian cells, insect cells such as Sf9 or Sf21. (Spodoptera frugiperda) cells, yeast cells and plant cells.
  • Preferred promoters for expression in eukaryotic cells include the p10 promoter, MMTV promoter, polyhedron promoter, the SV40 early promoter and the cytomegalovirus (CMV- IE) promoter, promoters derived from immunoglobulin-producing cells (see, United States Patent No 4,663,281), polyoma virus promoters, and the LTR from various retroviruses (such as murine leukemia virus, murine or Rous sarcoma virus and HIV), amongst others ( See, Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, New York, 1983, which is incorporated herein by reference).
  • Examples of other expression control sequences are enhancers or promoters derived from viruses, such as SV40
  • the promoter is further selected such that it is capable of regulating expression in a cell which is capable of performing any post-translational modification to the polypeptide which may be required for the subject recombinant polypeptide to be functional, such as N-linked glycosylation.
  • Cells suitable for such purposes may be readily determined by those skilled in the art.
  • Chinese hamster ovary (CHO) cells may be employed to carry out the N-terminal glycosylation and signal sequence cleavage of a recombinant polypeptide produced therein.
  • baculovirus expression vector such as the pFastBac vector supplied by GibcoBRL may be used to express recombinant polypeptides in Sf9 (Spodoptera frugiperda) cells, following standard protocols.
  • the expression vector may be based upon the pcDNA3 vector distributed by Medos Company Pty Ltd, Victoria, Australia, which comprises the CMV promoter and BGH terminator sequences for regulating expression of the recombinant polypeptide of the invention in a eukaryotic cell, when isolated nucleic acid sequences encoding same are inserted, in the sense orientation relative to the CMV promoter, into the multiple cloning site of said vector.
  • the SG5 expression vector of Greene et al. (1988), supplied by Stratagene, or the pQE series of vectors supplied by Qiagen are particularly useful for such purposes, as exemplified herein.
  • Examples of eukaryotic cells contemplated herein to be suitable for expression include mammalian, yeast, insect, plant cells or cell lines such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK), MDCK, sf21 (insect) or Sf9 (insect) cell lines. Such cell lines are readily available to those skilled in the art.
  • the prerequisite for expression in prokaryotic cells such as Escherichia coli is the use of a strong promoter with an effective ribosome binding site.
  • Typical promoters suitable for expression in bacterial cells such as E.
  • coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG-inducible tac promoter.
  • a number of other vector systems for expressing the nucleic acid molecule of the invention in E.coli are well-known in the art and are described for example in Ausubel et al (1992).
  • pKC30 ⁇ L :Shimatake and Rosenberg, 1981
  • pKK173-3 tac: Amann and Brosius, 1985
  • pET-3 T7: Studier and Moffat, 1986
  • pQE series of expression vectors Qiagen, CA
  • Suitable prokaryotic cells include corynebacterium, salmonella, Escherichia coli, Bacillus sp. and Pseudomonas sp, amongst others. Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1992).
  • the genetic constructs described herein may further comprise genetic sequences corresponding to a bacterial origin of replication and/or a selectable marker gene such as an antibiotic-resistance gene, suitable for the maintenance and replication of said genetic construct in a prokaryotic or eukaryotic cell, tissue or organism.
  • a selectable marker gene such as an antibiotic-resistance gene
  • Selectable marker genes include genes which when expressed are capable of conferring resistance on a cell to a compound which would, absent expression of said selectable marker gene, prevent or slow cell proliferation or result in cell death.
  • Preferred selectable marker genes contemplated herein include, but are not limited to antibiotic-resistance genes such as those conferring resistance to ampicillin, Claforan, gentamycin, G-418, hygromycin, rifampicin, kanamycin, neomycin, spectinomycin, tetracycline or a derivative or related compound thereof or any other compound which may be toxic to a cell.
  • origin of replication or a selectable marker gene will be spatially-separated from those genetic sequences which encode the recombinant receptor polypeptide or fusion polypeptide comprising same.
  • the genetic constructs of the invention are capable of introduction into, and expression in, an in vitro cell culture, or for introduction into, with or without integration into the genome of a cultured cell, cell line or transgenic animal.
  • the expression vector is selected from the group consisting of: pLcEcR (AGAL Accession No. NM99/04566); pLcUSP (AGAL Accession No. NM99/04565); pMpEcR (AGAL Accession No. NM99/04567); pMpUSP (AGAL Accession No. NM99/04568.); pMpUSP2 (AGAL Accession No. NMOO/12581); and pBtUSP (AGAL Accession No. NM00/12580).
  • a further aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.
  • cell shall be taken to refer to a single cell, or a cell lysate, or a tissue, organ or whole organism comprising same, including a tissue, organ or whole organism comprising a clonal group of cells or a heterogenous mixture of cell types, which may be a prokaryotic or eukaryotic cell as described supra.
  • the cell of the present invention expresses the isolated or recombinant polypeptide encoded by the nucleic acid molecule.
  • the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said reporter molecule.
  • host cells are transfected or co-transfected or transformed with nucleotide sequences containing the DNA segments of interest (for example, the insect steroid receptor gene, the recombinant steroid response elements, or both) by well-known methods, which vary depending on the type of cellular host.
  • nucleotide sequences containing the DNA segments of interest for example, the insect steroid receptor gene, the recombinant steroid response elements, or both
  • DNA segments of interest for example, the insect steroid receptor gene, the recombinant steroid response elements, or both
  • nucleotide sequences containing the DNA segments of interest for example, the insect steroid receptor gene, the recombinant steroid response elements, or both
  • DNA segments of interest for example, the insect steroid receptor gene, the recombinant steroid response elements, or both
  • calcium chloride transfection is commonly utilized for prokaryotic cells
  • lipofection or calcium phosphate treatment are often used for other cellular hosts. See
  • transformed cell is meant to also include the progeny of a transformed cell.
  • an animal such as a mammal or insect
  • microorganism such as a mammal or insect
  • plant or aquatic organism containing one or more cells as mentioned above.
  • Reference to plants, microorganisms and aquatic organisms includes any such organisms.
  • an induced protein may have a therapeutic effect ameliorating a disease state or preventing susceptibility to disease or may modify in some way the phenotype of an organism to produce a desired effect.
  • cell transplants such as liver cells
  • desirable hormones such as insulin, growth hormone, growth factors and the like.
  • a further aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide derived from an insect or a bioactive derivative or analogue thereof, wherein said polypeptide: (i) is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4,
  • SEQ ID NO: 6 SEQ ID NO: 8 SEQ ID NO: 10
  • SEQ ID NO: 14 SEQ ID NO: 16
  • polypeptide is substantially free of naturally-associated insect cell components.
  • the recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide derived from an insect or a bioactive derivative or analogue thereof, wherein said polypeptide:
  • (i) is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and
  • (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence encoded by cDNA present in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NMOO/12581 ; wherein said polypeptide is substantially free of naturally-associated insect cell components.
  • Reference herein to "substantially free of naturally associated insect cell components” refers to at least 80% purity, preferably more than 90% purity, and more preferably more than 95% purity. Normally, purity is measured on a polyacrylamide gel with homogeneity determined by staining of protein bonds. Alternatively, high resolution may be necessary using HPLC or similar means. For most purposes, a simple chromatography column or polyacrylamide gel may be used to determine purity. A protein which is chemically synthesized or synthesized in a cell system different from an insect cell from which it naturally originates would be free of naturally-associated insect cell components.
  • the present invention clearly provides for the isolation of EcR polypeptide subunits and EcR partner protein (USP polypeptide) subunits of ecdysteroid receptors and USP polypeptides of juvenile hormone receptors, from various organisms of the class Insecta, as described supra, in addition to protozoa and helminth sources.
  • USP polypeptide EcR partner protein
  • Insect steroid receptors are characterized by functional ligand-binding domains, and DNA- binding domains, both of which interact to effect a change in the regulatory state of a gene operably linked to the DNA-binding site of the holoreceptor or a polypeptide or polypeptide fragment thereof.
  • insect steroid receptors seem to be ligand-responsive transcription factors.
  • insect steroid receptors generally contain a DNA-binding domain (Domain C), and a ligand-binding domain (Domain E), separated and flanked by additional domains as identified by Krust et al (1986).
  • the C domain preferably comprises a zinc-finger DNA-binding domain which is usually hydrophilic, having high cysteine, lysine and arginine content.
  • the E domain preferably comprises hydrophobic amino acid residues and is further characterized by regions E1 , E2 and E3.
  • the ligand-binding domain of the members of the insect steroid receptor superfamily is typically carboxyl-proximal, relative to a DNA-binding domain (Evans, 1988).
  • the entire ligand-binding domain is typically between about 200 and 250 amino acids but is potentially shorter. This domain has the subregions of high homology, designated the E1 , E2 and E3 regions - which may be collectively referred to as the "E region".
  • Amino acid residues proximal to the C domain comprise a region initially defined as separate A and B domains.
  • Region D separates the more conserved domains C and E.
  • Region D typically has a hydrophilic region whose predicted secondary structure is rich in turns and coils.
  • the F region is carboxy promixal to the E region (see, Krust et al, supra).
  • the receptor polypeptides of the present invention exhibit at least a ligand-binding domain, as characterized by sequence homology to regions E1 , E2 and E3.
  • the ligand-binding domains of the present invention are typically characterized by having significant homology in sequence and structure to these three regions. Fragments of insect steroid receptors and partner proteins capable of binding insect steroids, and candidate insecticidally active compounds comprise an E-region or a sufficient portion of the E-region to allow binding.
  • the recombinant or isolated EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor as described herein is thermostable.
  • thermostability is meant that a stated integer does not exhibit reduced activity at bacterial, plant or animal physiological temperatures above about 28°C or above about 30°C.
  • the thermostability of insect steroid hormone receptors also refers to the capacity of such receptors to bind to ligand-binding domains or regions or to transactivate genes linked to insect steroid hormone response elements at bacterial,. plant or animal physiological temperatures above about 28°C or above about 30°C.
  • the present invention clearly extends to variants of said polypeptides, as described supra.
  • the polypeptide may be substantially free of naturally associated insect cell components, or may be in combination with a partner protein which associates with the insect steroid receptor so as to confer enhanced affinity for insect steroid response elements, enhanced affinity for insect steroids or analogues thereof.
  • the amino acid sequences exemplified herein may be varied by the deletion, substitution or insertion of one or more amino acids.
  • amino acids of a polypeptide exemplified herein may be replaced by other amino acids having similar properties, for example hydrophobicity, hydrophilicity, hydrophobic moment, charge or antigenicity, and so on.
  • substitutions encompass amino acid alterations in which an amino acid of the base polypeptide is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as "conservative", in which case an amino acid residue contained in the base polypeptide is replaced with another naturally-occurring amino acid of similar character, for example Gly ⁇ Ala, Val ⁇ lle ⁇ Leu, Asp- ⁇ GIu, Lys ⁇ Arg, Asn ⁇ Gln or Phe ⁇ Trp* ⁇ Tyr.
  • substitutions encompassed by the present invention may also be "non-conservative", in which an amino acid residue which is present in the base polypeptide is substituted with an amino acid having different properties, such as a naturally-occurring amino acid from a different group (eg. substituted a charged or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid.
  • an amino acid residue which is present in the base polypeptide is substituted with an amino acid having different properties, such as a naturally-occurring amino acid from a different group (eg. substituted a charged or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid.
  • polypeptide variants which are capable of binding insect steroids clearly form part of the present invention.
  • Assays to determine such binding may be carried out according to procedures well known in the art.
  • One such variant polypeptide encompassed by the present invention comprises an "in-frame" fusion polypeptide between different regions of different insect receptor polypeptides.
  • the present inventors have discovered that, by producing synthetic genes in which various domains of a base insect steroid receptor-encoding nucleotide sequence derived from a first source are interchanged or substituted with similar sequences derived from a second source (referred to as "domain swapping"), it is possible to modify the bioactivity of the insect steroid receptor encoded therefor. For example, the biological activity of the EcR polypeptide of the L. cuprina or M.
  • persicae ecdysone receptor exemplified herein may be modulated by replacing portions of its C-terminal or N-terminal sequences with the equivalent domains from the EcR polypeptide of the D. melanogaster ecdysone receptor or alternatively, by swapping regions of the EcR polypeptides of the L. cuprina and M. persicae ecdysone receptors perse.
  • such changes in biological function can similarly be effected by making specific changes (e.g. addition, substitution or deletion) to only those amino-acids within each domain that are critical for determining the relevant catalytic function (eg. ligand-binding activity, DNA binding site affinity, etc), such as by site-directed mutagenesis.
  • a synthetic EcR polypeptide subunit of a steroid receptor or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, or a synthetic USP polypeptide of a juvenile hormone receptor, or an analogue or derive of said synthetic polypeptides, wherein said synthetic polypeptides comprise an amino acid sequence which has the following properties:
  • the first sequence of amino acids is derived from the EcR polypeptide subunit of a steroid receptor, more preferably from the EcR polypeptide of the L. cuprina or M. persicae ecdysone receptor, and even more preferably from the EcR polypeptide of the L. cuprina ecdysone receptor.
  • the synthetic EcR polypeptide subunit of a steroid receptor, or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, or a synthetic USP polypeptide of a juvenile hormone receptor comprises a fusion polypeptide in which the ligand- binding regions of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42 are replaced, in-frame, by the ligand-binding region of a different receptor polypeptide.
  • 5'-end of the open reading frame of a first nucleotide sequence encoding the N-terminal portion of the EcR polypeptide of a first ecdysteroid receptor to the end of the DNA-binding domain of said polypeptide, is fused in-frame, to the 3'- end of the open reading frame of a second nucleotide sequence, encoding the C-terminal portion of the EcR polypeptide of a second ecdysteroid receptor, from the D domain and hormone-binding domain to the carboxyl terminus.
  • the present invention extends to any variants of the insect receptor polypeptides referred to herein and genetic sequences encoding same, wherein said variants are derived from a receptor polypeptide as described herein and exhibit demonstrable ligand-binding activity, and either comprises an amino acid sequence which differs from a naturally-occurring receptor polypeptide, or exhibit biological activity.
  • the variants described herein may be produced as recombinant polypeptides or in transgenic organisms, once the subject synthetic genes are introduced into a suitable host cell and expressed therein.
  • the recombinant receptor polypeptide of the invention is produced as an "in-frame" fusion polypeptide with a second polypeptide, for example a detectable reporter polypeptide such as ⁇ -galactosidase, ⁇ -glucuronidase, luciferase or other enzyme, or a FLAG peptide, hapten peptide such as a poly-lysine or poly-histidine or other polypeptide molecule.
  • a detectable reporter polypeptide such as ⁇ -galactosidase, ⁇ -glucuronidase, luciferase or other enzyme, or a FLAG peptide, hapten peptide such as a poly-lysine or poly-histidine or other polypeptide molecule.
  • in-frame means that a nucleotide sequence which encodes a first polypeptide is placed (i.e. cloned or ligated) in the same open reading frame adjacent to a nucleotide sequence which encodes a second polypeptide with no intervening stop codons there between, such that when the ligated nucleic acid molecule is expressed, a single fusion polypeptide is produced which comprises a sequence of amino acids corresponding to the summation of the individual amino acid sequences of the first and second polypeptides.
  • the nucleic acid molecule which encodes the polypeptide of the invention, or an analogue or derivative thereof is cloned adjacent to a second nucleic acid molecule encoding the second polypeptide, optionally separated by a spacer nucleic acid molecule which encodes one or more amino acids (eg: poly-lysine or poly histidine, amongst others), such that the first coding region and the second coding region are in the same open reading frame, with no intervening stop codons between the two coding regions.
  • the polypeptide thus produced comprises a fusion between the polypeptide products of the first and second coding regions.
  • spacer nucleic acid molecule is utilised in the genetic construct, it may be desirable for said spacer to at least encode an amino acid sequence which is cleavable to assist in separation of the fused polypeptide products of the first and second coding regions, for example a thrombin cleavage site.
  • a genetic construct which encodes a fusion polypeptide further comprises at least one start codon and one stop codon, capable of being recognised by the cell's translational machinery in which expression is intended.
  • a genetic construct which encodes a fusion polypeptide may be further modified to include a genetic sequence which encodes a targeting signal placed in-frame with the coding region of the nucleotide sequence encoding the fusion polypeptide, to target the expressed recombinant polypeptide to the extracellular matrix or other cell compartment. More preferably, the genetic sequence encoding targeting signal is placed in-frame at the 5'-terminus or the 3'- terminus, but most preferably at the 5'-terminus, of the coding region of the nucleotide sequence which encodes the fusion polypeptide.
  • USP polypeptide subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor may be purified by standard techniques, such as column chromatography (using various matrices which interact with the protein products, such as ion exchange matrices, hydrophobic matrices and the like), affinity chromatography utilizing antibodies specific for the protein or other ligands such as dyes or insect steroids which bind to the protein.
  • the recombinant polypeptide is expressed as a fusion polypeptide
  • the fusion polypeptide may be purified based upon the properties of the non- receptor moiety of said fusion polypeptide, for example substrate affinity. Once purified, the fusion polypeptide may be cleaved to release the intact polypeptide of the invention.
  • proteins may be synthesized by standard protein synthetic techniques as are well known in the art.
  • the recombinant or isolated polypeptides of the invention are provided as a precipitate or crystallized by standard techniques, preferably for X-ray crystal structure determination.
  • the three-dimensional structure of the polypeptide of the invention or a holoreceptor comprising same or a fragment of said polypeptide or holoreceptor is particularly useful for identifying candidate insecticidal agents which mimic ligands that bind to said three-dimensional structure and/or modulate the ability of insect steroids to bind thereto and activate the receptor (see, for example, Von Itzstein et al., 1993; and Bugg er a/., 1993).
  • the EcR polypeptides of the invention or ligand binding domains thereof, or their complexes with EcR partner proteins or ligand binding domains thereof, which confer enhanced affinity for insect steroid response elements or partner proteins (USP polypeptides) or ligands, are particularly useful to model the three-dimensional structure of the receptor ligand-binding region.
  • insecticidal compounds may be produced which bind to, or otherwise interact with, the ligand-binding region of the receptor, and preferably interfere with ligand binding.
  • compounds may be developed which have a potentiated interaction with the insect steroid receptor over and above that of the physiological insect steroid which binds to the receptor.
  • a still further aspect of the invention provides a method of identifying a candidate insecticidally-active agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.
  • Standard procedures are used to determine the three dimensional structure of the receptor polypeptides of the invention, for example using X-ray crystallography and/or nuclear magnetic resonance analysis (see, for example, Bugg et al., 1993; Von Itstein et al., 1993).
  • Insecticidally-active agents contemplated herein include synthetic chemicals that mimic one or more ligands of the holoreceptor or its polypeptide subunit, or the ligand-binding region of said holoreceptor or subunit, thereby modulating binding of steroids to said holoreceptor or subunit.
  • Preferred insecticidally-active agents include bisacylhydrazines, iridoid glycosides or other non- steroidal modulators of ecdysteroid receptors or insect juvenile hormone receptors.
  • EcR partner protein USP polypeptide
  • USP polypeptide USP polypeptide subunits of insect steroid receptors
  • USP polypeptides of insect juvenile hormone receptors bind insect juvenile hormones, a sesquiterpenoid group of ligands that regulate developmental transitions in insects
  • a further aspect of the present invention provides a method of identifying a modulator of insect steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene expression comprising:
  • a “modulator” is a compound or molecule that agonises or antagonises the binding properties and/or biological activity of a receptor polypeptide or holoreceptor.
  • Preferred modulators according to this embodiment include those synthetic compounds that are suitable for use as insecticidally-active agents described supra.
  • the reporter gene may be any gene, the expression of which may be monitored or assayed readily.
  • the reporter gene is a structural gene that encodes a peptide, polypeptide or enzyme that is assayed readily by enzymic or immunological means, for example the ⁇ - galactosidase, ⁇ -glucuronidase, luciferase or chloramphenicol acetyltransferase (CAT) genes.
  • the reporter gene may be a gene which encodes an immunologically-detectable protein, for example a FLAG peptide, poly-lysine peptide or poly-histidine peptide.
  • This embodiment of the invention may be applied directly to the identification of potential insecticidally-active compounds or alternatively, modified for such purposes by assaying for the binding (direct or indirect) of the recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE), rather than by assaying for reporter gene expression.
  • the binding assayed in the presence or absence of a potential insecticidally-active compound is compared, wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.
  • substances may be screened for insecticidal activity by assessing their ability to bind, in vivo or in vitro, to the intact ecdysone receptor or alternatively, the ligand-binding regions of the EcR polypeptide subunit of the ecdysone receptor (eg. SEQ ID NO: 2 or SEQ ID NO: 10 or SEQ ID NO: 14) or the EcR partner protein ( USP polypeptide) of the ecdysone receptor (eg.
  • Competition assays involving the native insect steroid may be employed to assess insecticidal activity.
  • the performance of this embodiment may, for example, involve binding the insect steroid receptor polypeptide to a support such as a plurality of polymeric pins, whereafter the polypeptide resident on the plurality of pins is brought into contact with candidate insecticidal molecules for screening.
  • the molecules being screened may be isotopically labelled so as to permit ready detection of binding.
  • reporter molecules may be utilized which bind to the insect steroid receptor candidate molecule complex.
  • compounds for screening may be bound to a solid support, such as a plurality of pins which are then reacted with the thermostable insect steroid receptor or complex with a partner protein. Binding may, for example, be determined again by isotopic-labelling of the receptor, or by antibody detection or use of another reporting agent.
  • insecticidally-active agent are identified using rational drug design, by expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex, determining the three-dimensional structure of the ligand binding domain of the complex, and identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.
  • the methods described herein for identifying modulators of gene expression and insecticidal compounds may be performed using prokaryotic or eukaryotic cells, cell lysates or aqueous solutions.
  • a further aspect of this invention accordingly relates to synthetic compounds derived from the three dimensional structure of EcR polypeptides or EcR partner protein (USP polypeptide) subunits of insect steroid receptors, or fragments thereof, or insect steroid receptors or fragments thereof, or USP polypeptides of insect juvenile hormone receptors or fragments thereof, which compounds are capable of binding to said receptors which have the effects of either inactivating the receptors (and thus acting as antagonists) or potentiating the activity of the receptor.
  • USP polypeptide EcR partner protein
  • derived from it is meant that the compounds are based on the three dimensional structure of the aforementioned proteins, that is, synthesized to bind, associate or interfere with insect steroid binding or juvenile hormone binding.
  • the compounds may bind strongly or irreversibly to the. ligand binding site or another region of the receptor or USP and act as agonists or antagonists of insect steroids, or juvenile hormone binding, or otherwise interfere with the binding of ligand, such that ecdysteroids or juvenile hormones.
  • Such compounds would have potent insecticidal activity given the key role of insect steroids, or juvenile hormone, in insect physiology and biochemistry. Such compounds would also possess a unique specificity.
  • EXAMPLE 1 Construction of a plasmid (pSV40-EcR) expressing the EcR polypeptide subunit of the D. melanogaster ecdysone receptor
  • a 3110 base-pair Fspl-H/ndlll fragment was excised from a cDNA encoding the EcR polypeptide subunit of the D. melanogaster ecdysone receptor (Koelle et al., 1991 ), the excised sequence comprising the complete 2634 base pair coding region and 214 base pairs of 5'- leader sequence and 258 base pairs of 3'- untranslated sequence.
  • the fragment was ligated into the ⁇ amHI site of the expression plasmid pSG5 (Greene et al, 1988) to produce the expression plasmid pSV40-EcR, wherein expression of the EcR polypeptide subunit of the Drosophila melanogaster ecdysone receptor is placed operably under the control of the SV40 promoter sequence.
  • EXAMPLE 2 Construction of the reporter plasmid p(EcRE) 7 -CAT
  • the reporter plasmid p(EcRE) 7 -CAT was constructed by insertion of multiple copies (i.e. 5 to 7 copies) of the hsp27 ecdysone response element, containing a central 13 base pair palindromic ecdysone response element (EcRE), derived from the hsp27 gene (Riddihough and Pelham, 1987) into the Hind ⁇ site of the plasmid pMMTV-CAT (Hollenberg and Evans, 1988), 93 base pairs upstream of the transcription start site of the MMTV promoter, thereby operably connecting expression of the chloramphenicoLacetyltransferase structural gene to regulation by an insect receptor which binds to the hsp27- ecdysone response element.
  • EcRE palindromic ecdysone response element
  • CHO cells were maintained in 50% (v/v) Dubbecco's modified Eagle's medium (DMEM) and 50% (v/v) Hamm F12 nutrient mixture (GIBCO) supplemented with 10% (v/v) foetal bovine serum. Transfection was carried out by the DNA-calcium phosphate co- precipitation method (Ausubel et al, 1992). One day before transfection with the plasmids described in Examples 1 and/or 2 , or other expression plasmids, CHO cells were plated out at 5 - 8 x 10 5 cells per 6 cm diameter culture dish in the above DMEM/F12 medium.
  • the cells were washed with phosphate buffered saline (PBS; Sambrook et al., 1989) and cultured in fresh DMEM plus 10% (v/v) foetal bovine serum. The cells were incubated in the presence of the co-precipitate for eighteen hours before excess DNA was removed by washing with PBS. The cells were then cultured for another day in DMEM/F12 supplemented with 10% (v/v) foetal bovine serum with or without added ponasterone A (PNA), before harvesting. Cells were washed with PBS, harvested by mechanical scraping in 0.25 M Tris-HCI (pH 7.8), and disrupted by three freeze- thaw cycles.
  • PBS phosphate buffered saline
  • PNA ponasterone A
  • transfections included, in addition to expression and reporter plasmids, a ⁇ -galactosidase- expressing plasmid designated pPgK-LacZ (McBurney etal, 1991), which served as an internal control for the efficiency of transfection, and pUC18 DNA in an amount sufficient to produce 10 ⁇ g total DNA per culture dish.
  • pPgK-LacZ McBurney etal, 1991
  • the chloramphenicol acetyltransferase (CAT) and ⁇ -galactosidase activities encoded by the reporter genes present in the reporter plasmids were assayed as described in Sambrook et al, (1989). Cells that were co-transfected with p(EcRE) 7 -CAT and pSV40-EcR clearly showed induction of CAT activity in the presence of PNA, showing 50 units of activity. Controls showed negligible activity.
  • CAT chloramphenicol acetyltransferase
  • ⁇ -galactosidase activities encoded by the reporter genes present in the reporter plasmids were assayed as described in Sambrook et al, (1989). Cells that were co-transfected with p(EcRE) 7 -CAT and pSV40-EcR clearly showed induction of CAT activity in the presence of PNA, showing 50 units of activity. Controls showed negligible activity.
  • the ecdysone receptor can lead to stimulation of expression from an ecdysone responsive promoter in some cell types, for example in CHO cells, but not in CV-1 cells. Whilst not being bound by any theory or mode of action, this may reflect a cell-type specific distribution of at least one other transcription factor essential for ecdysone responsiveness.
  • the cell-type specificity of ecdysone- responsive gene expression is assayed in cell-free transcription lysates derived from several target cell lines.
  • any essential auxiliary factors are defined and the genes encoding them cloned.
  • Co-transfection of the receptor-encoding genes with genes encoding such auxiliary factors removes limitations imposed by cell-type restricted ecdysone responsiveness.
  • CHO cells were transfected as described in Example 3, with the plasmid pSV40-EcR and the reporter plasmid p(EcRE) 7 -CAT in the 10 presence of PNA, at 30°C and 37°C.
  • CHO cells were plated out at 37°C sixteen to twenty hours before transfection. After washing away the DNA, the cells were cultured for two hours in fresh medium with or without hormone and the dishes divided into duplicate sets. One set was cultured for another day at 15 37°C before harvesting for CAT and ⁇ -galactosidase assays. The other set was cultured for three days at 30°C before assaying enzyme activities. Results indicated a reduction in the fold- induction of gene expression regulated by the D. melanogaster ecdysone receptor polypeptide at 37°C, compared to the fold-induction at 30°C, as shown in Table 1.
  • the nucleotide sequences of the primers Rdna3 (SEQ ID NO: 23) and Rdna4 (SEQ ID NO: 24) were derived from the amino acid sequence conserved between the DNA-binding domains of the EcR polypeptide subunits of the D. melanogaster and C. tentans ecdysone receptors. However, amino acid sequences homologous to two other members of the steroid receptor superfamily of D. melanogaster, Drosophila hormone receptor 3 (DHR3; Koelle, et al., 1991) and Drosophila early gene (E75; Segraves and Hogness, 1990) were excluded from the primer designs, to reduce the possibility of amplifying the L. cuprina homologues of genes encoding DHR3 or E75 by PCR.
  • DHR3 Drosophila hormone receptor 3
  • E75 Segraves and Hogness, 1990
  • Rdna3 (32mer with EcoRI site): 5'-CGGAATTCCGCCTCTGGTTA(C/T)CA(C/T)TA(C/T)AA(C/T)GC 3' (i.e. SEQ ID NO: 23);
  • Amplification reactions employed Taq ⁇ DNA polymerase (Promega) and the following amplification conditions: cycle 1 : 97°C/5 minutes, 50°C hold; add polymerase 50°C/5 minutes; cycles 2-3: 72°C/3 minutes, 94°C/1 minute, 50°C/1 minute; cycles 4-43: 72°C/3 minutes, 94°C//1 minute, 55°C/1 minute; cycle 44: 72°C/10 minutes.
  • the 5' end of primer Rdna3 contained an EcoRI site and the 5' end of primer Rdna4 contained a ⁇ amHI site.
  • the amplified L. cuprina gene fragments were cloned into pBluescript SK+, following digestion using the enzymes EcoRI and ⁇ amHI, purification of the digested DNA by agarose gel electrophoresis and electro elution of the product band.
  • the insert was cut out of the pBluescript SK+ vector using EcoRI and ⁇ amHI, and 32 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Sydney, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the specific primers Rdna3 and Rdna4 (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 10 6 cpm/ml in hybridizations.
  • L cuprina cDNA libraries derived from late third instar L. cuprina larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/Zapl / vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols. Both cDNA libraries generated are superior to existing L. cuprina libraries in terms of their phage titre (i.e. pfu/ml) and insert sizes (0.5 - 4 kbp in both cases).
  • the primary oligo-dT primed library comprised 4.7 x 10 6 pfu
  • the amplified oligo-dT primed library comprised 7.5 x 10 10 pfu/ml
  • the primary random-primed library comprised 1.3 x 10 6 pfu
  • the amplified random-primed library comprised 3.4 x 10 10 pfu/ml.
  • the prepared cDNA libraries were screened by lifting 500,000 plaques from each library in duplicate on to Hybond N membranes (Amersham) and hybridizing same under low stringency conditions to the 32 P-labelled amplification product produced using the primers Rdna3 and Rdna4 (see above).
  • hybridisations were performed for twenty four hours at 37°C in a hybridisation solution comprising 42% (w/v) formamide; 5 x SSPE solution; 5 x Denhardt's solution; and 0.1 % (w/v) sodium dodecyl sulphate, as described essentially by Ausubel et al, (1992) or Sambrook et al. (1989).
  • the membranes were then washed at 37°C in 2XSSC solution containing 0.1% (w/v) sodium dodecyl sulphate. Following washing, positive plaques were detected by autoradiography, using XOMAT-AR film (Kodak) for two to three days, at - 70°C.
  • Two positive-hybridising plaques were obtained from screening of the random-primed library (containing cDNA inserts comprising 561 base pairs and 1600 base pairs in length, respectively), and one positive-hybridising plaque was obtained from the screening of the oligo- dT primed library (containing a cDNA insert comprising approximately 3400 base pairs in length).
  • pBluescript phagemids containing cDNA inserts were excised in vivo from these positive plaques using the Exassist Helper Phage system (Stratagene).
  • the nucleotide sequences of the isolated cDNA clones were obtained using the USB Sequenase Version 2.5 Kit. Sequence data obtained indicated that the 561 bp and 1600 bp cDNAs encode amino acid sequences comprising the important DNA-binding domain and the hormone-binding domain of the EcR polypeptide subunit of the L. cuprina ecdysone receptor, whilst the 3400 bp cDNA comprises an entire 2274 bp open reading frame encoding the EcR polypeptide subunit of the L. cuprina ecdysone receptor. Accordingly, the 3400 bp cDNA is a full-length cDNA clone.
  • the nucleotide sequence of the open reading frame and 3'- untranslated region is set forth herein as SEQ ID NO: 1.
  • the derived amino acid sequence of the EcR polypeptide subunit of the L. cuprina ecdysone receptor encoded by this open reading frame is set out in SEQ ID NO: 2.
  • DNA encoding the DNA-binding domain of the EcR polypeptide of the M. persicae ecdysone receptor was isolated successfully, by amplification as described in Example 6 for the amplification of the homologous L cuprina fragment.
  • the amplified DNA was cloned into pBluescript SK+ and the nucleotide sequence of the cloned insert was obtained using the USB Sequenase version 2.0 Kit, as described in Example 6.
  • Mdna2 (23mer): 5'- GCACTCCTGACACTTTCGTCTCA -3' (i.e. SEQ ID NO: 26).
  • Hybridisation probe preparation For M. persicae probe preparation, the amplified 105 bp DNA insert was excised from the pBluescript SK+ vector using EcoRI and BamHI, and 32 P-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Sydney, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the specific primers Mdnal and Mdna2 (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 10 6 cpm/ml in hybridizations. Construction and screening of M. persicae cDNA libraries:
  • M. persicae cDNA libraries derived from late third instar M. persicae larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/Zapll vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols.
  • Both cDNA libraries generated are superior to existing M. persicae libraries in terms of their phage titre (i.e. pfu/ml) and insert sizes (0.5 - 4 kbp in both cases).
  • the primary oligo-dT-primed library comprised 1 x 10 7 pfu
  • the amplified oligo-dT primed library comprised 1 x 10 10 pfu/ml
  • the primary random-primed library comprised 1 x 10 6 pfu
  • the amplified random-primed library comprised 2 x 10 11 pfu/ml.
  • a further cDNA library was produced in the Lambda ZAP Express insertion vector (Stratagene).
  • cDNA derived from late third instar M. persicae larvae was prepared by oligo-dT priming and cloned directionally into EcoRI-Xhol digested vector DNA.
  • the primary library comprised 1 x 10 6 pfu
  • the amplified oligo-dT primed library comprised 1 x 10 9 pfu/ml, with insert sizes in the range 0.5 - >4 kbp.
  • the random-primed M. persicae cDNA phage library was screened as described in Example 6, using the M. persicae hybridisation probe prepared as described above.
  • This cDNA clone comprises a 585bp protein-encoding sequence which encodes the DNA-binding domain of a EcR polypeptide of a putative M. persicae ecdysone receptor.
  • the amino acid sequence encoded by this partial cDNA clone is set forth herein as SEQ ID NO: 6.
  • Hybridisation probe preparation Further hybridisation probes specific for the EcR polypeptide of the M. persicae ecdysone receptor were generated using PCR from the Lambda ZAPII oligo dT-primed library using primers AP1 and AP2.
  • the forward primer AP1 was designed to anneal to nucleotide sequences of the partial cDNA (SEQ ID NO: 9) encoding part of the first zinc finger motif present in the DNA-binding domain.
  • the reverse primer, AP2 was adapted from degenerate primers designed to anneal to nucleotide sequences complementary to those encoding an EcR ligand binding domain (Kamimura et al., 1996).
  • the nucleotide sequences of primers AP1 and AP2 are as follows:
  • Primer AP1 5'- TCGTCCGGTTACCATTACAACGC -3' (SEQ ID NO: 27); and Primer AP2: 5'- TAGACCTTTGGC(A/G)AA(C/T)TC(A/G/C/T)ACAAT -3'(SEQ ID NO: 28)
  • the PCR reaction mixture contained 4 ⁇ l of each primer (50 pm/ ⁇ l), 5 ⁇ l of deoxynucleotide triphosphate mix (2mM), 1 ⁇ l of aphid oligo dT primed Lambda ZAPII cDNA library, 1 ⁇ l of recombinant Pfu DNA Polymerase (5 units/ ⁇ l, Stratagene®), 5 ⁇ l of 10x Pfu buffer (Stratagene®) and 30 ⁇ l of MilliQ water.
  • the Pfu polymerase was used in this reaction because it possesses proof-reading activity, which reduces the possibility of misincorporation of nucleotides.
  • the PCR conditions included 42 cycles, each cycle comprising annealing at 55°C, extension at 72°C and melting at 94°C.
  • the major amplification product obtained in this reaction was gel-purified, kinased and ligated into the S al site of pUC18.
  • EcR probe 1 i.e. SEQ ID NO: 11
  • EcR probe 2 i.e. SEQ ID NO: 12
  • digestion of the cloned product with Sp ⁇ I produced a DNA fragment comprising a nucleotide sequence specific for a region encoding the DNA-binding domain (EcR probe 1 ; SEQ ID NO: 11), whilst digestion with Sph ⁇ /EcoR ⁇ produced a DNA fragment comprising a nucleotide sequence having homology to a region encoding a putative linker domain, designated domain D, and the 5'-end of a putative hormone-binding domain, present in the EcR polypeptide of the insect ecdysone receptors (EcR probe 2, SEQ 5 ID NO: 12).
  • EcR probe 1 and EcR probe 2 were labelled with [ ⁇ - 3Z P]dATP in a reaction catalysed by Klenow fragment. All reagents were components of a GIGAprime DNA labelling kit (BresaGen Limited, Sydney, Australia), except that the random primers were replaced with specific 10 oligonucleotides synthetisezed to be complementary to the ends of EcR probe 1 and EcR probe 2.
  • Plasmid pF3 was constructed in four steps as follows: 30 First, plasmid p5S1 , comprising the full-length cDNA encoding the EcR polypeptide of the L. cuprina ecdysone receptor , was digested with Ea ⁇ and a 3' Ea ⁇ cDNA fragment thus generated, encoding the C-terminal end of the EcR polypeptide of the L. cuprina ecdysone receptor, was end-filled and sub-cloned into the Hindll site of pUC19, to construct plasmid pEAR. In plasmid pEAR, the 3' end of the cDNA was oriented towards the Kpnl site of the pUC 19 vector.
  • plasmid p5S1 was also digested separately with:
  • fragment A Apol and Psfl, to isolate the 5' end of the cDNA as a 179 bp fragment (fragment A);
  • plasmid pEAR was digested with BglW and Kpn ⁇ , to isolate the 3' end of the cloned cDNA fragment therein as a 313 bp fragment (fragment D).
  • DNA fragments A, B, C and D were each isolated by agarose electrophoresis and ligated together into pBluescriptSK+, which had been digested with EcoRI and Kpnl, to produce plasmid pF3.
  • Plasmid pF3 thus contains the complete open reading frame of the cDNA encoding the EcR polypeptide of the L. cuprina ecdysone receptor, as a 2368 bp fragment located between two ⁇ amHI sites.
  • Plasmid pSGLcEcR was constructed by cloning the 2368 bp ⁇ amHI fragment from pF3, into the ⁇ amHI site of the mammalian expression vector pSG5 (Stratagene). Plasmid pLcK8 is a clone of pSGLcEcR.
  • Plasmid pSGDmEcR is identical to plasmid pSV40-EcR (Example 1) comprising the EcR polypeptide of the D. melanogaster ecdysone receptor placed operably under control of the SV40 promoter. Transfection of CHO cells
  • CHO cells were co-transfected with a mixture comprising the following DNAs, lysed and assayed for CAT and ⁇ -galactosidase enzyme activity, as described in the preceding Examples:
  • ELISA was used to quantify the synthesis of CAT and ⁇ -galactosidase enzymes, in extracts of cells forty eight hours after transfection. Account was taken of the variation between experiments, by normalizing the level of CAT enzyme to the level of ⁇ -galactosidase enzyme present in the same extract. Fold induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone divided by the normalized values for CAT gene expression in cells transfected with the same plasmid but in the absence of hormone. The average values of three independent experiments are shown in Figure 1 and the error bars indicate standard error of the mean.
  • Candidate insecticidal compounds are identified by their ability to modulate the reporter gene expression which results from trans-activation by the EcR polypeptide of the L. cuprina ecdysone receptor.
  • EXAMPLE 10 Chimeric EcR polypeptides of insect ecdysone receptors
  • Chimeric ecdysone receptors comprsing regions derived from EcR polypeptides of ecdysone receptors of different species are produced and assayed for enhanced activity.
  • a chimeric ecdysone receptor is produced using the EcR polypeptides of the D. melanogaster, M. persicae and L. cuprina ecdysone receptors.
  • plasmids pSGLD and pSGDL are produced comprising coding regions derived from the EcR.polypeptides of the D. melanogaster and L. cuprina ecdysone receptors.
  • the 5'-end of the open reading frame of the D. melanogaster sequence encoding the N-terminal portion of the EcR polypeptide of the D. melanogaster ecdysone receptor to the end of the DNA-binding domain of said polypeptide, is fused to the 3'-end of the open reading frame of the L. cuprina sequence, encoding the C- terminal portion of the EcR polypeptide of the L.
  • chimeric EcR polypeptides of L. cuprina and D. melanogaster ecdysone receptors comprising fusion polypeptides between the DNA-binding domains and hormone- binding domains of the base L. cuprina and D. melanogaster polypeptides, exhibit bioactivity when measured in the CAT assay described above.
  • the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor also functions alone as a USP polypeptide of the L. cuprina juvenile hormone receptor.
  • a cDNA encoding both receptor polypeptide activities was isolated using PCR and hybridisation as follows.
  • Hybridisation probe preparation A 150 base-pair probe, specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of insect ecdysone receptors or the USP polypeptide subunit of insect juvenile hormone receptors (SEQ ID NO: 21), was isolated by PCR from L. cuprina genomic DNA using the degenerate primers described by Tzertzinis et al. (1994). The PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of Taq polymerase.
  • the amplified DNA fragment was sub-cloned into EcoRI and C/al double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and C/al, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band.
  • the nucleotide sequence of the probe was obtained using the USB Sequenase version 2.0 Kit ( SEQ ID NO: 21).
  • the amplified L. cuprina DNA fragment was excised from the vector using EcoRI and Sa/I, gel purified and 32 P-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Sydney, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the two degenerate primers described by Tzertzinis et al. (1994) (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 10 6 cpm/ml in hybridizations.
  • L. cuprina cDNA libraries The L. cuprina cDNA library described above (Example 6) was screened with the amplified probe as described in Example 6. From one positive plaque, we derived plasmid pLSP4 containing a 3800 bp insert. Sequencing revealed that the 5' portion of pLSP4 encodes the EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor, followed by a long (2.4 kb), apparently untranslated region (UTR).
  • USP polypeptide EcR partner protein
  • UTR apparently untranslated region
  • Plasmid pLSP4 A 2453 bp EcoRI fragment of plasmid pLSP4 was isolated and sub-cloned into pBluescript SK+ (Stratagene), to construct plasmid pBLU1 , which contains the full-length cDNA sequence.
  • the open reading frame (ORF) of SEQ ID NO: 3 encodes a polypeptide comprising 467 amino acids in length.
  • the ATG start codon is located within a very favourable translational start context (i.e. 5'-GAAAATG-3') having 75% identity to the consensus sequence (i.e. 5'- C/AAAAATG -3') for D. melanogaster mRNA sequences (Cavener et al., 1987).
  • the derived amino acid sequence of the L. cuprina EcR partner protein (USP polypeptide) comprises domains A/B, C, D, and E/F that are characteristic of nuclear hormone receptors (Evans, 1988; Forman and Samuels, 1990).
  • nucleotide sequences of the 5'- untranslated region and coding region of the cDNA contained in plasmid pLSP5, and the amino acid sequence encoded therefor are set forth herein as SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
  • the nucleotide sequences of the 5'- untranslated region and coding region of the cDNA contained in plasmid pLSP12, and the amino acid sequence encoded therefor, are set forth herein as SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
  • nucleotide sequence analyses revealed differences in the 5'- untranslated regions of pLSP4, pLSP5, and pLSP12, however the coding regions appeared to be identical, suggesting a possible splice variation. This conclusion is supported by the fact that the cDNAs of pLSP4, pLSP5 and pLSP12 contained identical nucleotide sequences within their 5'- untranslated regions, however differed by the addition/deletion of sequences. In particular, the 5'-terminal 13 nucleotides of all three cDNA clones were identical, as was the nucleotide sequence surrounding the translation start codon (i.e. 5'-AAAATG-3').
  • Clone pLSP5 (SEQ ID NO: 5) differed from clone pLSP 4 (SEQ ID NO: 3) in so far as it included an additional 176 bp of 5'- untranslated sequence inserted between nucleotides 13 and 14 of pLSP4.
  • Clone pLSP12 (SEQ ID NO: 7) also differed from pLSP4 (SEQ ID NO: 3) in so far as it included an additional 5 116 bp of 5'- untranslated sequence inserted between nucleotides 13 and 14 of pLSP4.
  • the ATG start codons of both clones pLSP5 and pLSP12 are within translational start context sequences (i.e. 5'-CAAAATG-3') having absolute identity to the consensus sequence (i.e. 5'- C/AAAAATG -3') for D. melanogaster mRNA sequences (Cavener et al., 1987).
  • EXAMPLE 12 5 Isolation and characterisation of a partial cDNA encoding the EcR partner protein (USP polypeptide)of the M. persicae ecdysone receptor
  • the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor also functions alone as a USP polypeptide of the M. persicae juvenile hormone receptor.
  • USP polypeptide The EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor also functions alone as a USP polypeptide of the M. persicae juvenile hormone receptor.
  • a 140 bp probe was amplified from M. persicae genomic DNA, by PCR, using the two degenerate primers described by Tzertzinis et a/.(1994) (see preceding Example).
  • the PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of Taq ⁇ polymerase.
  • the amplified DNA fragment was sub-cloned into EcoRI and C/al double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and C/al, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band.
  • nucleotide sequence of the insert in the pBluescript SK+ vector was obtained using automated fluorescent dye terminator sequencing (SUPAMAC, Sydney Australia). Hybridisation probe preparation and library screening
  • the amplified M. persicae DNA insert was cut out of the pBluescript+ vector with EcoRI and Sail, gel purified and 32 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Sydney, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the degenerate primers described by Tzertzinis et a/.(1994) (see preceding Example). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 10 6 cpm/ml in hybridizations to screen the M. persicae cDNA library as described in Examples 7 and 8.
  • the positive-hybridising clones were plaque-purified and sequenced using standard procedures as described herein.
  • the nucleotide sequence of the open reading frame of the full-length cDNA encoding the partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide of the M. persicae juvenile hormone receptor is set forth herein as SEQ ID NO: 15.
  • the derived amino acid sequence of this open reading frame is set forth as SEQ ID NO: 16.
  • EXAMPLE 13 A construct for the baculovirus-directed co-expression of functional ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) of the D. melanogaster ecdysone receptor
  • a vector was prepared to facilitate the baculovirus-directed co- expression of ligand-binding regions derived from the EcR polypeptide and partner protein (USP polypeptide) of the D. melanogaster ecdysone receptor, the protein products of which associate on co-expression to form a functional hormone-binding complex.
  • the associated proteins are then used in high through-put assays or three-dimensional structural analysis. We have found that the ligand- binding domain, together with most of the linker domain of the EcR polypeptide subunit and of the EcR partner protein (USP polypeptide), are sufficient to associate to form a functional hormone-binding complex. 1. Isolation of the ligand-binding region of the EcR polypeptide of the D. melanogaster ecdysone receptor.
  • a Sac I- HindW ⁇ fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the Drosophila melanogaster ecdysone receptor was excised from a plasmid comprising DNA encoding the complete EcR polypeptide (Koelle et al. 1991).
  • the excised fragment was cloned into Sac ⁇ - H/ndlll-digested expression vector pQE31 (Qiagen), to produce the plasmid vector pQE31 DmECR.
  • a baculovirus was constructed for the co-expression in insect cells of:
  • a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the D. melanogaster ecdysone receptor isolated as described at paragraph (1) above; and (ii) a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the D. melanogaster ecdysone receptor.
  • USP polypeptide partner protein
  • nucleotide sequence encoding a "FLAG" peptide was subsequently incorporated upstream of, and in the same reading frame as, the nucleotide sequence encoding ligand-binding region of the partner protein (USP polypeptide), by ligation into the unique Smal site, thereby producing the plasmid pDmEcR.USP.DUAL. Plasmids containing the FLAG-encoding nucleotide sequence in the correct orientation were selected by nucleotide sequence determination.
  • the protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak). It was further demonstrated that the oligo-His-tagged EcR polypeptide and the FLAG-tagged EcR partner protein (USP polypeptide) bound as a hetero-oligomeric complex to FLAG M2 Affinity Gel (Kodak).
  • binding assays performed using a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the a labelled ecdysone analogue, [ 3 H] ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos.
  • cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of [ 3 H] ponasterone A, above background levels.
  • a vector for the baculovirus-directed co- expression of ligand-binding domains derived from the EcR polypeptide and partner protein (USP polypeptide) of the L. cuprina ecdysone receptor was prepared essentially as described in the preceding Example.
  • a Spnl - Kpn ⁇ fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the L. cuprina ecdysone receptor was excised from a cDNA clone encoding the complete EcR polypeptide and cloned into the Spnl - Kpnl cleaved expression vector pQE32 (Qiagen), to produce the plasmid pQE32LcEcR.
  • a DNA fragment encoding most of the linker domain and all of the ligand-binding domain of the partner protein (USP polypeptide) of the L. cuprina ecdysone receptor was sub-cloned to produce the plasmid pBLU1.
  • a baculovirus was constructed for the co-expression in insect cells of:
  • a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the L. cuprina ecdysone receptor isolated as described at paragraph (1) above;
  • a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the L. cuprina ecdysone receptor isolated as described at paragraph (2) above.
  • cuprina partner protein (USP polypeptide) was excised from plasmid pBLUI and ligated, together with a "FLAG" encoding sequence into the Pvull site of pLcEcR.DUAL, to produce plasmid pLcEcR.USP.DUAL .
  • binding assays carried out by a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the tritiated ecdysone analogue, ponasterone A, in cells infected by recombinant virus indicating correct folding and association of the two protein subunits (Figure 3), greater than that of the ecdysone holoreceptor in L. cuprina embryos. Cells infected by a control virus displayed neither antibody-positive bands on western analysis nor specific binding of tritiated hormone above background.
  • the protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak).
  • binding assays performed using a modification of the method of Yund et al (1978), demonstrated a significant increase in the binding of the labelled ecdysone analogue, [ 3 H] ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos ( Figure 3).
  • cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of [ 3 H] ponasterone A, above background levels.
  • the donor plasmid pLcEcR.USP.DUAL (Example 14) was digested with ⁇ ssHII and Psfl to remove the L. cuprina EcR polypeptide-encoding segment therein, thereby leaving the tagged ligand-binding region of the L. cuprina USP polypeptide-encoding nucleotide sequence.
  • the digested plasmid was blunt-ended using T4 DNA polymerase and Klenow polymerase, isolated by gel purification, and finally re-ligated to produce the plasmid pLcUSP.SINGLE.
  • the segment of pLcUSP.SINGLE encoding this polypeptide and the p10 promoter sequence to which said segment is operably connected was recombined into a baculovirus genome employing the Tn7 transposition system (Luckow et al., 1993).
  • the polypeptide product is then expressed to form a functional juvenile hormone-binding polypeptide and preferably, a modulator of a juvenile hormone receptor.
  • the correctly-folded truncated USP polypeptide is used for X-ray and NMR structural analysis and for high- throughput screens.
  • the EcR partner protein (USP polypeptide) of the insect ecdysone receptor and USP polypeptide of the insect juvenile hormone receptor of the present invention are coupled to pins according to the procedure of Geysen et al. (1987), and reacted with candidate insecticidal compounds, generally at a concentration in the range from about 0.05 ⁇ M to about 100 ⁇ M of the candidate compound.
  • candidate insecticidal compounds generally at a concentration in the range from about 0.05 ⁇ M to about 100 ⁇ M of the candidate compound.
  • the binding of compounds is detected using standard procedures, and compounds having insecticidal activity are identified.
  • such compounds exhibit insecticidal activity against a range of insects, including diptera, hemiptera, coleoptera, ants, and moths, amongst others. More preferably, the compounds will exhibit insecticidal activity against L. cuprina, M. persicae, D. melanogaster, scale insect, white fly, and leaf hopper, amongst others. In a particularly preferred embodiment, insecticidal compounds are specific to L. cuprina or M. persicae and close relatives thereof.
  • M.persicae USP (MpUSP) polypeptide were produced labelled with [ 35 S]Methionine, using the Promega TNT-Coupled Reticulocyte Lysate System. Each batch of lysate contained 100-200 mg/ml of endogenous proteins (using BSA as a standard). The products were analysed by SDS-PAGE and radioautography. The results confirmed that the cloned cDNAs encode proteins of the sizes predicted from the length of putative open reading frames of the cDNAs present in plasmids pMpEcR and pMpUSP. The yields of EcR and USP were similar as assessed by SDS-PAGE.
  • DNA plasmids pMpEcR AGAL Accession No. NM99/04567; 1 mg
  • pMpUSP AGAL Accession No. NM99/04568; 1 mg
  • pMpUSP2 AGAL Accession No. NMOO/12581 ; 1 mg
  • a Luciferase T3 control DNA (Promega) was used in place of pMpEcR or pMpUSP.
  • T7 RNA Polymerase was used for transcription of the M. persicae EcR RNA from plasmid pMpEcR, whilst T3 RNA Polymerase was used for transcription of M. persicae USP RNA from the plasmid pMpUSP and the Luciferase T3 control DNA. The reactions were carried out for 90 minutes at 30 °C .
  • the control reaction produces 150-500 ng of luciferase per 50 ml reaction.
  • MpEcR Myzus persicae EcR
  • USP TNT-Coupled Reticulocyte Lysate System
  • the samples were pipetted onto Whatman GF/C filters and incubated for 30 sec.
  • the filters were then placed on a vacuum sinter, washed with 10 ml EcR40 buffer and transferred to scintillation vials. After adding 7 ml of InstaGel Plus to each vial, the contents were vortexed and left at room temperature until the filters became transparent.
  • the receptor bound ligand was quantified using a TriCarb 2100TR scintillation counter.
  • EXAMPLE 18 In vivo function of a chimeric L. cuprina ecdysone receptor and a L. cuprina EcR partner protein (USP polypeptide)
  • Plasmid pSGLcUSP A 2453 bp fragment from the 5' end of clone pLSP4 (Example 11 ), containing nucleotide sequence encoding the L. cuprina EcR partner protein (USP polypeptide), was subcloned into the EcoRI site of the mammalian expression vector pSG5 (Stratagene), to construct pSGLcUSP.
  • Plasmid pVPLcEcR was constructed as follows:
  • Plasmid pMOD31 To construct plasmid pMOD31 , plasmid pNLVP16 (a gift from Dr G. Muscat) was digested with Sal ⁇ and bal, and re-ligated using a double-stranded oligonucleotide linker formed by annealing of the following complementary oligonucleotides:
  • SPX5 5'-TCGACATATAACTTCGCTGCAGATGCATCCGAGCTCT-3' (SEQ ID NO: 29); and XPS3: 5'-CTAGAGCTCGGATGCATCTGCAGCGAAGTTATATG-3' (SEQ ID NO: 30),
  • plasmid pVPLcEcR contains nucleotide sequences encoding the ligand binding region of the L. cuprina EcR polypeptide placed operably in connection with the VP16 activation domain.
  • CV1 cells were cotransfected with (i) plasmid pSGLcUSP or unmodified plasmid pSG5, at 1 ⁇ g/ml; (ii) plasmid pVPLcEcR or unmodified plasmid pSG5, at 0.2 ⁇ g/ml; (iii) the CAT reporter plasmid p(EcRE) 7 -CAT (Example 9), at 1 ⁇ g/ml; and (iv) an independent LacZ reporter plasmid, pPGKLacZ (Example 9), at a concentration of 1 ug/ml, included as a control to monitor transfection efficiency.
  • the CAT and ⁇ -galactosidase activities present in extracts of cells were measured 48 hours after transfection as described previously (Hannan and Hill, 1997). Variations between experiments were controlled, by normalising the level of CAT to ⁇ -galactosidase for each extract.
  • L. cuprina EcR partner protein USP polypeptide
  • USP polypeptide can interact with a chimeric L. cuprina EcR polypeptide to form an ecdysteroid-dependent transcription factor in mammalian cells.
  • ecdysteroid in particular 1 mM ponasterone A, induced significant levels of expression of the CAT reporter gene relative to the induction of ⁇ -galactosidase gene expression, which indicates transfection efficiency.
  • plasmid pVPLcEcR alone produced only a 4-fold induction of CAT gene expression relative to ⁇ -galactosidase gene expression (column 4 of Figure 5). This low level of activity is presumably due to formation of an active complex by the chimeric L. cuprina EcR polypeptide and endogenous RXR present in CV1 cells.
  • Plasmids pSGDM and pSGMD both comprise nucleotide sequences encoding chimeric D. melanogaster and M. persicae ecdysone receptor EcR polypeptides.
  • plasmid pSGDM comprises a chimeric cDNA sequence consisting of nucleotide sequence encoding the A/B domain of the D. melanogaster EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the M. persicae EcR polypeptide.
  • Plasmid pSGMD comprises a chimeric cDNA sequence consisting of nucleotide sequence encoding the A/B domain of the M. persicae EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the D. melanogaster EcR polypeptide.
  • Linkerl was ligated into Vector 1 and the resultant plasmid was digested with EcoRV to produce Vector 2.
  • a 940 bp EcoRI cDNA fragment encoding the A/B domain of full length D. melanogaster EcR polpypeptide was isolated from plasmid pSGDmEcR and ligated into the EcoRV site in Vector 2, using the linker-primer from the Stratagene cDNA Synthesis Kit, to produce Vector 3.
  • the cDNA sequence encoding the A/B domain of the M. persicae EcR polypeptide was removed from Vector 3 by digestion with Sacll and the truncated plasmid was then religated to produce plasmid pSGDM.
  • a 2200 bp EcoRI/ ⁇ amHI cDNA fragment encoding the DNA-binding and ligand-binding domains of the full length D. melanogaster EcR polypeptide was isolated from plasmid pSGDmEcR and end-filled and ligated into the EcoRV site present in Vector 2 (see above), to produce Vector 4.
  • the cDNA encoding the DNA-binding and ligand-binding domains of the M. persicae EcR polypeptide were then excised from Vector 4 by digestion with ⁇ amHI and the truncated plasmid was then religated, to produce plasmid pSGMD.
  • Plasmids pSGDM and pSGMD contain cDNA sequences encoding full-length functional EcR polypeptides, as shown by SDS/PAGE of in vitro translation products, and using biological activity assays carried out in vivo using CHO cells, as follows:
  • CHO cells were co-transfected with a mixture comprising the following plasmids: (i) an expression plasmid selected from the group consisting of pSGDmEcR, pSGMpEcR, pSGDM, pSGMD, and pSG5, wherein each plasmid was at a concentration of 1 ⁇ g/ml; and (ii) the CAT reporter plasmid p(EcRE) 7 -CAT at a concentration of 1 ⁇ g/ml.
  • an expression plasmid selected from the group consisting of pSGDmEcR, pSGMpEcR, pSGDM, pSGMD, and pSG5, wherein each plasmid was at a concentration of 1 ⁇ g/ml
  • the CAT reporter plasmid p(EcRE) 7 -CAT at a concentration of 1 ⁇ g/ml.
  • Transfected cells were incubated for two days at 37°C in the presence of absence of 10 ⁇ M Muristerone A.
  • ethanol solvent was added to the cells.
  • CAT enzyme activity was assayed by ELISA.
  • the modified EcR subunit of the M. persicae ecdysone receptor is biologically active in vivo.
  • the M. persicae EcR polypeptide having an A B domain derived from D. melanogaster confers ecdysone responsiveness on CAT reporter gene expression in CHO cells, under the control of a promoter sequence containing the D. melanogaster hsp27 ecdysone response elements present in plasmid p(EcRE) 7 -CAT.
  • EcR protein and partner protein (USP polypeptide) of the Myzus persicae ecdysone receptor was prepared in two stages:
  • Plasmid pLcUSP.SINGLE contains cDNA encoding linker and ligand binding domain of the L. cuprina partner protein (USP polypeptide) placed operably in connection with the p10 promoter.
  • pLcUSP.SINGLE was linearised using ⁇ amHI and HindW ⁇ restriction enzymes, and ligated to a synthetic linker (i.e Linker 1 ) which was constructed by annealing the following oligonucleotides:
  • Linker 1 comprises ⁇ amHI and HindW ⁇ sticky ends to facilitate cloning, and internal Stu ⁇ and
  • a 1 ,9kb Sful/Smal cDNA fragment encoding the linker and ligand-binding domain of the M. persicae EcR polypeptide was subsequently ligated into the Sfivl restriction site within the Linker 1 sequence, to produce plasmid pMpEcR.LcUSP.DUAL, comprising nucleotide sequences encoding the tagged Linker 1 sequence, and domains D and E and F of the M. persicae EcR polypeptide, and the linker and ligand-binding domains (i.e. domains D/E/F) of the L. cuprina partner protein (USP polypeptide), placed operably under the control of polyhedrin and p10 promoters, respectively.
  • pMpEcR.LcUSP.DUAL comprising nucleotide sequences encoding the tagged Linker 1 sequence, and domains D and E and F of the M. persicae EcR polypeptide, and the linker
  • plasmid pMpEcR.LcUSP.DUAL was digested with Xmal and pnl to excise nucleotide sequence encoding linker and ligand binding domains of the L. cuprina partner protein (USP polypeptide), to produce Vector 1 B.
  • Linker 2 was constructed by annealing the following oligonucleotides: Oligonucleotide C:
  • Linker 2 comprises Xmal and ⁇ /col compatible ends and a "FLAG" encoding sequence.
  • Linker 2 was ligated to a 1.2kb Kpn ⁇ /Nco ⁇ DNA fragment in Vector 1 B, encoding the linker and ligand binding domains of the M. persicae partner protein (USP polypeptide), to produce plasmid pMpEcR.USP.DUAL, comprising nucleotide sequences encoding the tagged linker and domains D and E and F of the M. persicae EcR polypeptide, and the linker and ligand-binding domains of the M. persicae partner protein (USP polypeptide), placed operably under the control of polyhedrin and p10 promoters, respectively.
  • USP polypeptide M. persicae partner protein
  • Plasmids pMpEcR.LcUSP.DUAL and pMpEcR.USP.DUAL were sequenced to confirm the presence of the open reading frames.
  • the segment of pMpEcR.LcUSP.DUAL or pMpEcR.USP.DUAL encoding the chimeric tagged ligand binding regions of the receptor polypeptides was recombined in a baculovirus genome, by employing the Tn7 transposition system (Luckow et al., 1993).
  • the chimeric ligand binding regions of the recombinant ecdysone receptors were then expressed in insect Sf9 cells, where they associated into functional complexes.
  • heterologous M. persicae/L. cuprina ecdysone receptor i.e. comprising tagged linker and domains D/E/F of the M. persicae EcR polypeptide and the linker and ligand- binding domains of the L. cuprina EcR partner protein (USP polypeptide)
  • expression of the homologous M. persicae ecdysone receptor i.e. comprising tagged Linker 2 and domains D/E/F of the M. persicae EcR polypeptide and the linker and ligand-binding domains of the M.
  • CV1 cells were co transfected with the following plasmid constructs: (i) plasmid pBKMpUSPI , containing the cDNA clone encoding the M. persicae
  • EcR partner protein operably in connection with the CMV promoter in pBK-CMV, at 2 ⁇ g/ml; or alternatively, a negative control gene construct, plasmid pBSK ⁇ , at 2 ⁇ g/ml; and
  • plasmid pSGDM comprising a chimeric cDNA sequence consisting of nucleotide sequence encoding the a/B domain of the D. melanogaster EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the M. persicae EcR polypeptide (Example 19), at 1 ⁇ g/ml; and (iii) the CAT reporter gene construct, plasmid p(EcRE) 7 -CAT, comprising the CAT reporter gene placed operably under the control of a promoter sequence containing multiple copies of the D.
  • plasmid pPopNLacZ melanogaster hsp27 ecdysone response elements present in plasmid at 1 ⁇ g/ml
  • plasmid pPopNLacZ the ⁇ -galactosidase reporter gene construct to control for transfection efficiency
  • the ecdysone analogue 10 mM ponasterone a (a gift from Dr Denis Horn), was added to cells 6 hours after transfection, to induce CAT gene expression mediated the chimeric recombinant ecdysone receptor.
  • ponasterone a a gift from Dr Denis Horn
  • CAT and ⁇ -galactosidase enzyme activities were measured in cell extracts 48 hours after transfection, as described previously (Hannan and Hill, 1997). The relative level of CAT/ ⁇ -galactosidase for each extract was determined, to normalise the variation in transfection efficiency between samples.
  • EXAMPLE 22 Isolation and characterisation of a cDNA encoding the EcR partner protein (USP polypeptide) of the Bemesia tabaci ecdysone receptor Construction and screening of ⁇ . tabaci cDNA libraries
  • ⁇ . tabaci cDNA libraries Two independent B. tabaci cDNA libraries derived from red-eye nymph stage animals were prepared by oligo-dT priming, and cloned into the EcoRI site of the Lambda/Zapll vector (Stratagene). The titres of the two primary libraries produced were 1.9 x 10 6 pfu, and 3.15 x 10 6 pfu. Tests indicated that the insert size range for these libraries was 0.7 kb to 7.6 kb in length.
  • the primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols, to produce final titres of 1.5 x 10 9 pfu/ml, and 2.5 x 10 9 pfu/ml.
  • the prepared cDNA libraries were screened by lifting 500,000 plaques from each amplified cDNA library, in duplicate, onto Hybond N membranes (Amersham), and then hybridizing same under low stringency conditions to radiolabelled probes specified below.
  • hybridisations were carried out overnight at 37°C, in a hybridisation solution comprising 42% (w/v) formamide; 5 x SSPE solution; 5 x Denhardt's solution; and 0.1% (w/v) sodium dodecyl sulphate, as described essentially by Ausubel et al, (1992) or Sambrook et al. (1989).
  • the membranes were then washed at 37°C in 2XSSC solution containing 0.1% (w/v) sodium dodecyl sulphate.
  • plaques were detected by autoradiography, using XOMAT-AR film (Kodak) for two to three days, at -70°C. Positive-hybridising plaques were plaque-purified, rescued as plasmids, and their cDNA inserts analysed by nucleotide sequence determination.
  • the EcR partner protein (USP polypeptide) subunit of the ⁇ . tabaci ecdysone receptor also functions in the absence of the EcR polypeptide as a USP polypeptide of the B. tabaci juvenile hormone receptor.
  • a 140 bp probe was amplified from B. tabaci genomic DNA, using two degenerate primers described by Tzertzinis et al. (1994) and in the preceding Examples.
  • the PCR reaction was performed using 1 unit Taq ⁇ polymerase (Boehringer Mannheim), 1 mM each primer, in a 50 ⁇ l reaction volume, essentially under conditions recommended by the manufacturer (Boehringer Mannheim ).
  • the amplified DNA fragment was sub-cloned into the EcoRI and C/al sites of linearised pBluescript SK+ (Stratagene) vector.
  • the nucleotide sequence of the insert in the pBluescript SK+ vector was obtained using automated fluorescent dye terminator sequencing (Automated DNA Analysis Facility at University of NSW, Sydney Australia) and is set forth herein as SEQ ID NO: 37.
  • This fragment encodes the amino acid sequence set forth in SEQ ID NO: 38.
  • the amplified B. tabaci DNA was released from the pBluescript+ vector by double-digestion using the enzymes EcoRI and Sa/I, separation by agarose gel electrophoresis, and purification by electro-elution. DNA was subsequently [ 32 P]-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Sydney, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the degenerate primers described by Tzertzinis et a/.(1994). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used as described herein above at in Examples 7 and 8, to screen the B. tabaci cDNA library.
  • Positive-hybridising clones were plaque-purified and sequenced using standard procedures as described herein.
  • the nucleotide sequence of one clone was obtained and is set forth herein as SEQ ID NO: 39.
  • the amino acid sequence of the B. tabaci EcR partner protein (USP polypeptide) is shown in SEQ ID NO: 40.
  • EXAMPLE 23 Cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the B. tabaci ecdysone receptor
  • the amplified B. tabaci gene fragment was cloned into pBluescript SK+ (Stratagene), following digestion using the enzymes EcoRI and ⁇ amHI, purification of the digested DNA by agarose gel electrophoresis and BresaClean (Bresatec)-purification of the product band, as described herein above.
  • the nucleotide sequence of the amplified hybridisation probe was obtained using automated fluorescent dye terminator sequencing (Automated DNA Analysis Facility at University of NSW, Sydney Australia), and is set forth herein as SEQ ID NO: 41.
  • the derived amino acid sequence of this gene fragment is provided in SEQ ID NO: 42.
  • the insert was excised from the pBluescript SK+ vector using EcoRI and ⁇ amHI, labelled, and used as described in the preceding Example, to screen the ⁇ . tabaci cDNA library.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Insects & Arthropods (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
PCT/AU2000/000799 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor WO2001002436A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA002377804A CA2377804A1 (en) 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor
JP2001508223A JP2003505019A (ja) 1999-07-01 2000-06-30 ステロイドおよび幼若ホルモン受容体ポリペプチドをコードする新規遺伝子配列ならびにその用途
AU55141/00A AU771153B2 (en) 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor
NZ516439A NZ516439A (en) 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor
EP00940058A EP1203022A4 (en) 1999-07-01 2000-06-30 NOVEL GENETIC SEQUENCES ENCODING THE STEROID HORMONE AND NEOTININ RECEPTORS AND USES THEREOF
IL14729500A IL147295A0 (en) 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/346,470 1999-07-01
US09/346,470 US7312322B1 (en) 1998-01-15 1999-07-01 Genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor

Publications (1)

Publication Number Publication Date
WO2001002436A1 true WO2001002436A1 (en) 2001-01-11

Family

ID=23359536

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2000/000799 WO2001002436A1 (en) 1999-07-01 2000-06-30 Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor

Country Status (9)

Country Link
EP (1) EP1203022A4 (cs)
JP (1) JP2003505019A (cs)
AU (1) AU771153B2 (cs)
CA (1) CA2377804A1 (cs)
CZ (1) CZ20014707A3 (cs)
IL (1) IL147295A0 (cs)
NZ (1) NZ516439A (cs)
WO (1) WO2001002436A1 (cs)
ZA (1) ZA200200019B (cs)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004106374A1 (en) * 2003-05-27 2004-12-09 Commonwealth Scientific And Industrial Research Organisation Ecdysone receptor ligand-binding domain structure
EP1534738A2 (en) * 2001-02-20 2005-06-01 RheoGene, Inc. Novel substitution mutant receptors and their use in a nuclear receptor-based inducible gene expression system
WO2005083442A1 (en) * 2004-02-23 2005-09-09 Syngenta Limited Methods for screening insecticides
EP1572862A2 (en) * 2001-02-20 2005-09-14 RheoGene Holdings, Inc. Chimeric retinoid x receptors and their use in a novel ecdysone receptor-based inducible gene expression system
US7081350B2 (en) 2001-09-07 2006-07-25 Regents Of The University Of Minnesota Methods for identifying ecdysteroid synthesis inhibitors using the drosophila P450 enzyme shade
EP1456346A4 (en) * 2001-02-20 2006-12-20 Rheogene Holdings Inc NOVEL GENETIC EXPRESSION SYSTEM BASED ON ECDYSONE RECEPTOR / REINOID X RECEPTOR INVERTEBRATES
US7563879B2 (en) 2001-09-26 2009-07-21 Intrexon Corporation Leafhopper ecdysone receptor nucleic acids, polypeptides, and uses thereof
JP2009159957A (ja) * 2001-09-26 2009-07-23 Intrexon Corp コナジラミエクジソン受容体核酸、ポリペプチド、およびそれらの使用
US7776587B2 (en) 2000-03-22 2010-08-17 Intrexon Corporation Ecdysone receptor-based inducible gene expression system
US7935510B2 (en) 2004-04-30 2011-05-03 Intrexon Corporation Mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US8105825B2 (en) 2000-10-03 2012-01-31 Intrexon Corporation Multiple inducible gene regulation system
CN103555727A (zh) * 2013-10-14 2014-02-05 中国水产科学研究院淡水渔业研究中心 一种中华绒螯蟹性早熟个体活体分子检测方法
US8669051B2 (en) 2001-02-20 2014-03-11 Intrexon Corporation Substitution mutant receptors and their use in a nuclear receptor-based inducible gene expression system

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013167A1 (en) * 1990-02-26 1991-09-05 The Board Of Trustees Of The Leland Stanford Junior University Identification and expression of insect steroid receptor dna sequences
WO1998035550A2 (en) * 1997-02-14 1998-08-20 New Zealand Pastoral Agriculture Research Institute Limited Insect ecdysteroid receptors
WO1999036520A1 (en) * 1998-01-15 1999-07-22 Commonwealth Scientific And Industrial Research Organisation Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor
WO1999048915A1 (en) * 1998-03-27 1999-09-30 Glaxo Group Limited Orphan nuclear receptor
US6025483A (en) * 1996-06-05 2000-02-15 The Regents Of The University Of California Maize and cauliflower apetalai gene products and nucleic acid molecules encoding same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013167A1 (en) * 1990-02-26 1991-09-05 The Board Of Trustees Of The Leland Stanford Junior University Identification and expression of insect steroid receptor dna sequences
US6025483A (en) * 1996-06-05 2000-02-15 The Regents Of The University Of California Maize and cauliflower apetalai gene products and nucleic acid molecules encoding same
WO1998035550A2 (en) * 1997-02-14 1998-08-20 New Zealand Pastoral Agriculture Research Institute Limited Insect ecdysteroid receptors
WO1999036520A1 (en) * 1998-01-15 1999-07-22 Commonwealth Scientific And Industrial Research Organisation Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor
WO1999048915A1 (en) * 1998-03-27 1999-09-30 Glaxo Group Limited Orphan nuclear receptor

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
DATABASE GENPEPT [online] 13 October 1998 (1998-10-13), VAILLANCOURT P. ET AL., Database accession no. AAC95154 *
DATABASE GENPEPT [online] 1990, HENRICH V.C., Database accession no. CAA36827 *
DATABASE GENPEPT [online] 1995, JONES B.B. ET AL., Database accession no. AAC59721 *
DATABASE GENPEPT [online] 1995, JONES B.B. ET AL., Database accession no. AAC59722 *
DATABASE GENPEPT [online] 1997, GUO X. ET AL., Database accession no. AAB94565 *
DATABASE GENPEPT [online] 1997, GUO X. ET AL., Database accession no. AAB94566 *
DATABASE GENPEPT [online] 1997, MOUILLET J.F. ET AL., Database accession no. CAA72296 *
DATABASE GENPEPT [online] 1998, SALEH D.S. ET AL., Database accession no. AAD19828 *
DATABASE SWISS-PROT [online] 1 December 1992 (1992-12-01), LEID M. ET AL., Database accession no. P28700 *
DATABASE SWISS-PROT [online] 1 February 1991 (1991-02-01), MANGLESDORF D.J. ET AL., Database accession no. P19793 *
DATABASE SWISS-PROT [online] 1 February 1991 (1991-02-01), ORO A.E. ET AL., Database accession no. P20153; Q9W535 *
DATABASE SWISS-PROT [online] 1 February 1994 (1994-02-01), KOELLE M.R. ET AL., Database accession no. P34021 *
DATABASE SWISS-PROT [online] 15 December 1998 (1998-12-15), HANNAN G.N., HILL R.J., Database accession no. 018531 *
See also references of EP1203022A4 *

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8202718B2 (en) 2000-03-22 2012-06-19 Intrexon Corporation Ecdysone receptor-based inducible gene expression system
US7807417B2 (en) 2000-03-22 2010-10-05 Intrexon Corporation Ecdysone receptor-based inducible gene expression system
US7776587B2 (en) 2000-03-22 2010-08-17 Intrexon Corporation Ecdysone receptor-based inducible gene expression system
US8822754B2 (en) 2000-03-22 2014-09-02 Intrexon Corporation Ecdysone receptor-based inducible gene expression system
US8105825B2 (en) 2000-10-03 2012-01-31 Intrexon Corporation Multiple inducible gene regulation system
US8168426B2 (en) 2000-10-03 2012-05-01 Intrexon Corporation Multiple inducible gene regulation system
US8728808B2 (en) 2000-10-03 2014-05-20 Intrexon Corporation Multiple inducible gene regulation system
US9249207B2 (en) 2001-02-20 2016-02-02 Intrexon Corporation Substitution mutant receptors and their use in an ecdysone receptor-based inducible gene expression system
EP1572862A2 (en) * 2001-02-20 2005-09-14 RheoGene Holdings, Inc. Chimeric retinoid x receptors and their use in a novel ecdysone receptor-based inducible gene expression system
US9493540B2 (en) 2001-02-20 2016-11-15 Intrexon Corporation Ecdysone receptor/invertebrate retinoid X receptor-based inducible gene expression system
EP1572862A4 (en) * 2001-02-20 2007-08-15 Rheogene Holdings Inc X-RECEPTOR OF CHIMERIC RETINOIDS AND USES THEREOF IN A NEW INDUCIBLE GENE EXPRESSION SYSTEM BASED ON AN ECDYSONE RECEPTOR
EP1534738A4 (en) * 2001-02-20 2007-05-09 Rheogene Inc NEW SUBSTITUTION MUTANT RECEPTORS AND THEIR USE IN AN INDUCIBLE GENE EXPRESSION SYSTEM BASED ON A NUCLEAR RECEPTOR
EP1456346A4 (en) * 2001-02-20 2006-12-20 Rheogene Holdings Inc NOVEL GENETIC EXPRESSION SYSTEM BASED ON ECDYSONE RECEPTOR / REINOID X RECEPTOR INVERTEBRATES
EP1534738A2 (en) * 2001-02-20 2005-06-01 RheoGene, Inc. Novel substitution mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US7531326B2 (en) 2001-02-20 2009-05-12 Intrexon Corporation Chimeric retinoid X receptors and their use in a novel ecdysone receptor-based inducible gene expression system
US8691527B2 (en) 2001-02-20 2014-04-08 Intrexon Corporation Substitution mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US8669051B2 (en) 2001-02-20 2014-03-11 Intrexon Corporation Substitution mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US8598409B2 (en) 2001-02-20 2013-12-03 Intrexon Corporation Non-human organism comprising a gene expression modulation system encoding a chimeric retinoid X receptor
US8236556B2 (en) 2001-02-20 2012-08-07 Intrexon Corporation Method of modulating gene expression using an ecdysone receptor-based inducible gene expression system
US10087231B2 (en) 2001-02-20 2018-10-02 Intrexon Corporation Substitution mutant receptors and their use in an ecdysone receptor-based inducible gene expression system
EP2374891A3 (en) * 2001-02-20 2011-10-26 Intrexon Corporation Chimeric retinoid X receptors and their use in a novel ecdysone receptor-based inducible gene expression system
US7081350B2 (en) 2001-09-07 2006-07-25 Regents Of The University Of Minnesota Methods for identifying ecdysteroid synthesis inhibitors using the drosophila P450 enzyme shade
US7563879B2 (en) 2001-09-26 2009-07-21 Intrexon Corporation Leafhopper ecdysone receptor nucleic acids, polypeptides, and uses thereof
US9063140B2 (en) 2001-09-26 2015-06-23 Intrexon Corporation Whitefly ecdysone receptor nucleic acids, polypeptides, and uses thereof
US8030067B2 (en) 2001-09-26 2011-10-04 Intrexon Corporation Whitefly ecdysone receptor nucleic acids, polypeptides, and uses thereof
US8021878B2 (en) 2001-09-26 2011-09-20 Intrexon Corporation Leafhopper ecdysone receptor nucleic acids, polypeptides, and uses thereof
US8497093B2 (en) 2001-09-26 2013-07-30 Intrexon Corporation Leafhopper ecdysone receptor nucleic acids, polypeptides, and uses thereof
US7919269B2 (en) 2001-09-26 2011-04-05 Intrexon Corporation Whitefly ecdysone receptor nucleic acids, polypeptides, and uses thereof
US7829676B2 (en) 2001-09-26 2010-11-09 Intrexon Corporation Whitefly ecdysone receptor antibody
US7601508B2 (en) 2001-09-26 2009-10-13 Intrexon Corporation Whitefly ecdysone receptor polypeptide and methods
JP2009159957A (ja) * 2001-09-26 2009-07-23 Intrexon Corp コナジラミエクジソン受容体核酸、ポリペプチド、およびそれらの使用
JP2009159958A (ja) * 2001-09-26 2009-07-23 Intrexon Corp ヨコバイエクジソン受容体核酸、ポリペプチド、およびそれらの使用
WO2004106374A1 (en) * 2003-05-27 2004-12-09 Commonwealth Scientific And Industrial Research Organisation Ecdysone receptor ligand-binding domain structure
WO2005083442A1 (en) * 2004-02-23 2005-09-09 Syngenta Limited Methods for screening insecticides
US7935510B2 (en) 2004-04-30 2011-05-03 Intrexon Corporation Mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US9163256B2 (en) 2004-04-30 2015-10-20 Intrexon Corporation Mutant receptors and their use in a nuclear receptor-based inducible gene expression system
US8076454B2 (en) 2004-04-30 2011-12-13 Intrexon Corporation Mutant receptors and their use in a nuclear receptor-based inducible gene expression system
CN103555727B (zh) * 2013-10-14 2015-06-10 中国水产科学研究院淡水渔业研究中心 一种中华绒螯蟹性早熟个体活体分子检测方法
CN103555727A (zh) * 2013-10-14 2014-02-05 中国水产科学研究院淡水渔业研究中心 一种中华绒螯蟹性早熟个体活体分子检测方法

Also Published As

Publication number Publication date
IL147295A0 (en) 2002-08-14
JP2003505019A (ja) 2003-02-12
ZA200200019B (en) 2003-01-02
NZ516439A (en) 2002-12-20
CZ20014707A3 (cs) 2002-06-12
EP1203022A4 (en) 2004-09-08
EP1203022A1 (en) 2002-05-08
AU5514100A (en) 2001-01-22
CA2377804A1 (en) 2001-01-11
AU771153B2 (en) 2004-03-18

Similar Documents

Publication Publication Date Title
US7297781B2 (en) Genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor
Marks et al. H‐2RIIBP (RXR beta) heterodimerization provides a mechanism for combinatorial diversity in the regulation of retinoic acid and thyroid hormone responsive genes.
Iyer et al. The human hypoxia-inducible factor 1α gene: Hif1astructure and evolutionary conservation
Cho et al. Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis
US7060490B1 (en) DNA encoding novel estrogen receptor
US5217867A (en) Receptors: their identification, characterization, preparation and use
Wang et al. Molecular determinants of differential ligand sensitivities of insect ecdysteroid receptors
US20040171114A1 (en) Isolation and use of ryanodine receptors
AU771153B2 (en) Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor
Martinez et al. Transcriptional activation of the cloned Heliothis virescens (Lepidoptera) ecdysone receptor (HvEcR) by muristeroneA
Bailey et al. Transcriptional repression by COUP-TF II is dependent on the C-terminal domain and involves the N-CoR variant, RIP13Δ1
WO1990014356A1 (en) Dominant negative members of the steroid/thyroid superfamily of receptors
AU737769B2 (en) Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor
AU711041B2 (en) Methods, polypeptides, nucleotide sequence of XOR-6, a vitamin D-like receptor from xenopus
AU2006304329A1 (en) GPR22 and methods relating thereto
US20070212716A1 (en) Nezara viridula Ecdysone Receptor
JP2002345484A (ja) ヘリオティスビレッセンス(Heliothisvirescens)のウルトラスピクラル(USP)タンパク質
EP1544307A1 (en) LAC9 chimeric receptor and uses thereof
WO2008092212A1 (en) Bovicola ovis ecdysone receptor
US20030044914A1 (en) Methods employing XOR-6, a vitamin D-like receptor from xenopus
Wong Ligand dependence of the human androgen receptor dimerization and DNA binding by recombinant baculovirus expression
WO1997047172A1 (fr) Proteine isoforme du recepteur de la vitamine d

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 55141/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: PV2001-4707

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 2377804

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2002/00019

Country of ref document: ZA

Ref document number: 200200019

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 516439

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2000940058

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2000940058

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV2001-4707

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: 516439

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 516439

Country of ref document: NZ

WWR Wipo information: refused in national office

Ref document number: 2000940058

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000940058

Country of ref document: EP