AU771153B2

AU771153B2 - Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and uses therefor

Info

Publication number: AU771153B2
Application number: AU55141/00A
Authority: AU
Inventors: Garry Noel Hannan; Ronald Johnston Hill
Original assignee: Commonwealth Scientific and Industrial Research Organization CSIRO
Current assignee: Commonwealth Scientific and Industrial Research Organization CSIRO
Priority date: 1999-07-01
Filing date: 2000-06-30
Publication date: 2004-03-18
Anticipated expiration: 2020-06-30
Also published as: CA2377804A1; ZA200200019B; EP1203022A4; NZ516439A; EP1203022A1; IL147295A0; WO2001002436A1; JP2003505019A; CZ20014707A3; AU5514100A

Description

WO 01/02436 PCT/AU00/00799 -1- NOVEL GENETIC SEQUENCES ENCODING STEROID AND JUVENILE HORMONE RECEPTOR POLYPEPTIDES AND USES THEREFOR FIELD OF THE INVENTION The present invention relates generally to novel genetic sequences encoding receptor polypeptides and insecticidal modalities therefor, which insecticidal modalities are based upon non-polypeptide insect hormones and their receptors. More specifically, the present invention provides isolated nucleic acid molecules encoding polypeptides comprising functional steroid hormone and juvenile hormone receptors, in particular isolated nucleic acid molecules which encode polypeptides comprising the Lucilia cuprina (sheep blowfly), Myzus persicae (aphid) and Bemesia tabaci (Silverleaf whitefly) ecdysone receptors and juvenile hormone receptors.

In a particularly preferred embodiment, the present invention relates to isolated nucleic acid molecules which encode the L. cuprina, M. persicae, and B. tabaci EcR polypeptide subunits or fragments thereof, or which encode the EcR partner protein (USP polypeptide) subunits of L. cuprina, M. persicae, and B. tabaci. The EcR and USP polypeptides disclosed herein associate to form functional heterodimeric ecdysone receptors or receptor analogues. The present invention further provides the L. cuprina, M. persicae, and B. tabaci EcR proteins or fragments thereof, in addition to providing the L. cuprina, M. persicae, and B. tabaci EcR partner protein (USP polypeptide) subunits of ecdysone receptors, and the L. cuprina, M.

persicae, and B. tabaci USP polypeptides of the juvenile hormone receptors of these insects.

The present invention further relates to the production of functional recombinant insect receptors and recombinant polypeptide subunits thereof and derivatives and analogues thereof.

The present invention further relates to the uses of the recombinant receptor and isolated nucleic acid molecules of the present invention in the regulation of gene expression. The present invention further relates to screening systems and methods of identifying insecticidallyactive agents which are capable of agonising or antagonising insect receptor function, such as molecules or ligands which associate with steroid receptors or juvenile hormone receptors so as to modify the affinity of said receptors for their cognate cis-acting response elements (eg.

insect steroid response elements, juvenile hormone response elements) in the genes which they regulate, or alternatively or in addition, which modify the affinity of said receptors for their cellular stimuli (eg. insect steroids or juvenile hormones) or analogues thereof, or alternatively or in addition, which act as insecticides by virtue of their ability to agonise or antagonise the activity of insect hormones, such as by mimicry of a ligand which binds to said receptor or a ligand-binding region thereof. The invention further extends to such compounds or ligands.

WO 01/02436 PCT/AU00/00799 -2-

GENERAL

This specification contains nucleotide and amino acid sequence information prepared using the programme Patentin Version 2.0, presented herein after the bibliography. Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier <210>1, <210>2, etc). The length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide and amino acid sequences referred to in the specification are defined by descriptor "SEQ ID NO:" followed by the numeric identifier. For example, SEQ ID NO: 1 refers to the information provided in the numeric indicator field designated <400> 1, etc.

The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.

Bibliographic details of the publications referred to in this specification are collected at the end of the description. Reference herein to prior art, including any one or more prior art documents, is not to be taken as an acknowledgment, or suggestion, that said prior art is common general knowledge in Australia or forms a part of the common general knowledge in Australia.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

As used herein the term "derived from" shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.

WO 01/02436 WO 0102436PCT/AUOO/00799 -3- Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

BACKGROUND TO THE INVENTION International Patent Application No W091/1 3167 (applicant, The Board of Trustees of Leyland Stanford University, and hereinafter referred to as W09111 3167) describes the identification, characterization, expression and uses of insect steroid receptors and DNA sequences encoding same and, in particular, the identification, characterization, expression and uses of the steroid receptor of the common fruit fly, Drosophila melanogaster.

It has been found by the present inventors that the limited homology between the D.

melanoga ster steroid receptor-encoding gene sequences and the steroid receptor -encoding sequences derived from other insects, in particular those derived from diptera such as the Australian sheep blowfly L. cupnina;, hemniptera such as the aphid M. persicae, leaf sucking insects such as the whitefly tabaci), scale insects and leaf hoppers; coleoptera; neuroptera; lepidoptera; and ants, as well as from helminths and protozoa, prevents the routine isolation of DNA sequences encoding steroid receptors or juvenile hormone receptors from these lattermentioned organisms.

Moreover, the present inventors have discovered that the D. melanogaster steroid receptor described in W091/13167 is temperature-sensitive, showing reduced activity at temperatures above 30*C, such as at temperatures about 37*C, particularly at low concentrations of the WO 01/02436 PCT/AU00/00799 -4receptor. Accordingly, the D. melanogaster steroid receptor described in W091/13167 is of limited utility at physiological temperatures applicable to animal or bacterial cells. Moreover, wherein it is desirable to produce a biologically-active steroid receptor using in vivo or in situ expression systems, which expression systems routinely utilise cells or tissues in the temperature range of about 28°C to about 42 0 C, the D. melanogastersteroid receptor is also of limited utility.

In work leading up to the present invention, the present inventors developed a novel screening protocol, involving the utilisation of highly-degenerate oligonucleotide probes and primers derived from the amino acid sequences of the DNA-binding domains of the D. melanogaster and Chironomus tentans ecdysone receptor polypeptides, to identify nucleotide sequences encoding novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides. The present inventors have further identified specific regions within these novel polypeptides which are suitable for use in preparing a surprising range of novel steroid receptor polypeptide derivatives and insect juvenile hormone receptor polypeptide derivatives. The novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides of the present invention, and derivative polypeptides thereof, and assembled steroid receptors and insect juvenile hormone receptors derived from said polypeptides and derivatives, and nucleic acid molecules encoding same as exemplified herein, provide the means for developing a wide range of insecticidally-active agents, as well as methods for the regulated production of bioactive molecules. In particular, the present invention provides the means for developing specific ligands which bind to and either agonise or antagonise the steroid receptors or juvenile hormone receptors, and/or which bind to polypeptide subunits of said receptors as described herein, thereby functioning as highly-specific insecticides, offering significant commercial and environmental benefits.

The present inventors have been surprisingly successful in characterizing the ecdysone receptor and juvenile hormone receptor derived from insects of the orders Diptera and Hemiptera, and polypeptide components thereof and functional derivatives of said polypeptides and receptors, particularly in light of the extreme difficulties in dealing with these organisms.

The nature of these molecules was unknown prior to the present invention.

WO 01/02436 PCT/AU00/00799 The various aspects of this invention overcome the problems associated with Drosophila ecdysone receptors which lack thermal stability. Moreover, those aspects of the invention pertaining to methods of screening for insecticidally active agents do not involve competition assays which are generally complex, and often inaccurate or difficult to calibrate.

SUMMARY OF THE INVENTION One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of an steroid receptor, the partner protein (USP polypeptide) of an steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42.

In an alternative embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of an steroid receptor, the partner protein (USP polypeptide) of an steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to an amino acid sequence encoded by the DNA of insects which is present in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581.

WO 01/02436 PCT/AU00/00799 -6- In a further alternative embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said nucleotide sequence is selected from the group consisting of: a nucleotide sequence having at least 40% identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences; (ii) a nucleotide sequence that is capable of hybridising under at least low stringency conditions to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or to a complementary nucleotide sequence to any one of said sequences; (iii) a nucleotide sequence that is capable of hybridising under at least low stringency conditions to a nucleotide sequence contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; (iv) a nucleotide sequence having at least 40% identity to a nucleotide sequence contained in a plasmid selected from the group consisting of AGAL Accession Nos.

NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; and a nucleotide sequence that is amplifiable by PCR using a nucleic acid primer sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, and SEQ ID NO: 32.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor EcR polypeptide and comprises the nucleotide WO 01/02436 PCT/AU00/00799 -7sequence set forth in SEQ ID NO: 1, or SEQ ID NO: 13.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor USP polypeptide or a juvenile hormone receptor polypeptide and comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 37, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which comprises the nucleotide sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, and SEQ ID NO: 32, or a complementary nucleotide sequence thereto.

A second aspect of the present invention provides a method of identifying an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide comprising the steps of: hybridising genomic DNA, mRNA or cDNA with a hybridisation-effective amount of one or more probes selected from the group consisting of: a probe comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences; WO 01/02436 PCT/AU00/00799 -8a probe comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; and a hybridisation probe comprising a nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences, or a homologue, analogue or derivative of any one of said sequences or complementary sequences having at least identity thereto; and (ii) detecting the hybridisation.

In an alternative embodiment, the inventive method comprises the steps of: annealing to genomic DNA, mRNA or cDNA, one or more PCR primers selected from the group consisting of: a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences; a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM0/12580, and NM00/12581; and (ii) amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction.

WO 01/02436 PCT/AU00/00799 -9- In a further alternative embodiment, the inventive method comprises the steps of: amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction using one or more PCR primers selected from the group consisting of: a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences; and a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; (ii) hybridising the amplified nucleotide sequence to genomic DNA, mRNA or cDNA with a hybridisation-effective amount of one or more probes selected from the group consisting of: a probe comprising at least 10 contiguous nucleotides in length derived from a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences; a probe comprising at least 10 contiguous nucleotides in length derived from a cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, WO 01/02436 PCT/AU00/00799 NMOO/12580, and NM00/12581; and a hybridisation probe comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary nucleotide sequence to any one of said sequences, or a homologue, analogue or derivative of any one of said sequences or complementary sequences having at least identity thereto; and (iii) detecting the hybridisation.

A third aspect of the present invention provides a genetic construct comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence. Preferably, the subject nucleic acid molecule is in an expressible format, such that it is possible to produce a recombinant polypeptide therefrom.

Accordingly, a fourth aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42; wherein said polypeptide is substantially free of naturally-associated insect cell components.

In an alternative embodiment, the invention provides a recombinant or isolated polypeptide WO 01/02436 PCT/AU00/00799 -11 comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to a polypeptide encoded by cDNA present in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; wherein said polypeptide is substantially free of naturally-associated insect cell components.

A fifth aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.

In a preferred embodiment, the cell of the present invention expresses the polypeptide encoded by the nucleic acid molecule.

In a preferred embodiment, the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an.activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said reporter molecule.

In a further aspect of this invention, there is provided an animal (such as a mammal), microorganism, plant or aquatic organism, containing one or more cells as mentioned above.

A further aspect of the present invention provides a method of identifying a modulator of insect WO 01/02436 PCT/AU00/00799 -12steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene expression comprising: assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and a potential modulator; and (ii) assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and without said potential modulator; and (ii) comparing expression of the reporter gene in the presence of the potential modulator to the expression of a reporter gene in the absence of the potential modulator, wherein said reporter gene is placed operably under the control of a steroid response element (SRE) to which said insect steroid receptor binds or a promoter sequence comprising said SRE.

A still further aspect of the invention provides a method of identifying a potential insecticidal compound comprising: assaying the binding directly or indirectly of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE) to which said insect steroid receptor binds, in the presence of a candidate compound; and (ii) assaying the binding directly or indirectly of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE) to which said insect steroid receptor binds, in the absence of said candidate compound; and (ii) comparing the binding assayed at and wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.

A still further aspect of the invention provides a method of identifying a candidate insecticidallyactive agent comprising the steps of: a) expressing an EcR polypeptide of a steroid receptor or a fragment thereof which WO 01/02436 PCT/AU00/00799 -13includes the ligand-binding region, optionally in association with an EcR partner protein (USP polypeptide) of a steroid receptor or ligand binding domain thereof, optionally in association with an insect steroid or analogue thereof so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

A still further aspect of the invention provides a method of identifying a candidate insecticidallyactive agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

In another aspect this invention relates to a method or assay for screening insecticidally active compounds which comprises reacting a candidate insecticidal compound with a steroid receptor polypeptide or fragment thereof encompassing the ligand binding domain, or complex thereof with a partner protein or a fragment thereof which encompasses the ligand binding domain, .and detecting binding or absence of binding of said compound so as to determine insecticidal activity.

A still further aspect of the invention provides a synthetic compound which interacts with the WO 01/02436 PCT/AU00/00799 -14three dimensional structure of a polypeptide or protein selected from the group consisting of: an EcR polypeptide of a steroid receptor or a fragment thereof; (ii) an EcR partner protein (USP polypeptide) of a steroid receptor or a fragment thereof; (iii) a USP polypeptide of a juvenile hormone receptor; and (iv) a functional receptor or protein complex formed by association of and (ii), wherein said compound is capable of binding to said polypeptide or protein to agonise or antagonise the binding activity or bioactivity thereof.

Preferably, the synthetic compounds are derived from the three dimensional structure of insect steroid receptor(s) or juvenile hormone receptor(s) which compounds bind to said receptor(s) and have the effect of either inactivating the receptor(s) or potentiating the activity of the receptor(s). More preferably, the compounds mimic the three-dimensional structure of a ligand which binds to the receptor(s) and more preferably, mimic the three-dimensional structure of a ligand which binds to the ligand-binding region of said receptor(s).

In a still further aspect of this invention, there is provided a screening system for insecticidally active agents comprising a nucleotide sequence encoding a steroid receptor or a fragment thereof, and a nucleotide sequence encoding a partner protein or a fragment thereof which associates with the receptor so as to confer enhanced affinity for insect steroid response elements, or enhanced affinity for insect steroids or analogues thereof or insecticidally active agents, or thermostability or enhanced thermostability of said receptor, which receptor and partner protein is capable of binding to a candidate insecticidally active agent to form an activated complex, and a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence, wherein on exposure to said agent expression of the bioactive molecule or reporter molecule correlates with insecticidal activity.

In another aspect of this invention, there is provided a method for the regulated production of a bioactive molecule or a reporter molecule in a cell, said method comprising the steps of WO 01/02436 PCT/AU00/00799 introducing into said cell: a) a nucleotide sequence encoding a steroid receptor or a fragment thereof which is capable of binding an insect steroid or analogue thereof, to form an activated complex; and b) a nucleotide sequence encoding said bioactive molecule or reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence encoding said bioactive molecule or reporter molecule, wherein exposing the cell to an insect steroid or analogue thereof regulates expression of the bioactive molecule or reporter molecule.

SUMMARY OF SEQUENCE LISTING SEQ ID NO: 1: The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the L. cuprina ecdysone receptor and amino acid sequence therefor.

SEQ ID NO: 2: The amino acid sequence of the EcR polypeptide subunit of the L.

cuprina ecdysone receptor.

SEQ ID NO: 3: The nucleotide sequence of the cDNA molecule contained in plasmid pBLU1 which encodes the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or which encodes the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.

SEQ ID NO: 4: The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuptina ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: 3.

SEQ ID NO: 5: The nucleotide sequence of the cDNA molecule from plasmid which encodes the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or which encodes the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.

WO 01/02436 PCT/AU00/00799 -16- SEQ ID NO: 6: SEQ ID NO: 7: SEQ ID NO: 8: SEQ ID NO: 9: SEQ ID NO: 10: SEQ ID NO: 11: SEQ ID NO: 12: SEQ ID NO: 13: SEQ ID NO: 14: The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: The nucleotide sequence of the cDNA molecule from plasmid pLSP12 which encodes the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or which encodes the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, encoded by SEQ ID NO: 7.

The nucleotide sequence of a cDNA molecule which encodes part of the EcR polypeptide subunit of the M. persicae ecdysone receptor and amino acid sequence therefor.

The amino acid sequence of a part of the EcR polypeptide subunit of the M. persicae ecdysone receptor.

The nucleotide sequence of the EcR probe 1 which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the.EcR polypeptide subunit of the M.

persicae ecdysone receptor.

The nucleotide sequence of the EcR probe 2 sequence which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the EcR polypeptide subunit of the M.

persicae ecdysone receptor.

The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the M. persicae ecdysone receptor and amino acid sequence therefor.

The amino acid sequence of the EcR polypeptide subunit of the M.

persicae ecdysone receptor.

WO 01/02436 PCT/AU00/00799 -17- SEQ ID NO: 15: SEQ ID NO: 16: SEQ ID NO: 17: SEQ ID NO: 18: SEQ ID NO: 19: The nucleotide sequence of the open reading frame of a first cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: The nucleotide sequence of the open reading frame of a second cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: 17.

The nucleotide sequence of the open reading frame of a third cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, encoded by SEQ ID NO: 19.

The nucleotide sequence of a 150 base-pair probe which is specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of L. cuprina ecdysone receptor or the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence SEQ ID NO: 20: SEQ ID NO: 21: WO 01/02436 PCT/AU00/00799 -18- SEQ ID NO: 22: SEQ ID NO: 23: SEQ ID NO: 24: SEQ ID NO: 25: SEQ ID NO: 26: SEQ ID NO: 27: SEQ ID NO: 28: SEQ ID NO: 29: SEQ ID NO: 30: SEQ ID NO: 31: SEQ ID NO: 32: SEQ ID NO: 33: SEQ ID NO: 34: SEQ ID NO: 35: SEQ ID NO: 36: SEQ ID NO: 37: therefor.

The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 21, comprising amino acid residues 108-149 of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor or amino acid residues 108-149 of the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor set forth herein as SEQ ID NO: 4.

The nucleotide sequence of the degenerate primer Rdna3.

The nucleotide sequence of the degenerate primer Rdna4.

The nucleotide sequence of the primer Mdnal.

The nucleotide sequence of the primer Mdna2.

The nucleotide sequence of the primer AP1.

The nucleotide sequence of the degenerate primer AP2.

The sequence of oligonucleotide SPX5 used to construct plasmid pVPLcEcR.

The sequence of oligonucleotide XPS5 used to construct plasmid pVPLcEcR.

The nucleotide sequence of oligonucleotide A used to construct plasmid pSGDM.

The nucleotide sequence of oligonucleotide B used to construct plasmid pSGDM.

The sequence of oligonucleotide A used to construct the expression plasmid pMpEcR.LcUSP.DUAL.

The sequence of oligonucleotide B used to construct the expression plasmid pMpEcR.LcUSP.DUAL.

The sequence of oligonucleotide C used to construct the expression plasmid pMpEcR.USP.DUAL.

The sequence of oligonucleotide D used to construct the expression plasmid pMpEcR.USP.DUAL.

The nucleotide sequence of a probe which is specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit WO 01/02436 PCT/AU00/00799 -19- SEQ ID NO: 38: SEQ ID NO: 39: SEQ ID NO: 40: of B. tabaci ecdysone receptor or the USP polypeptide subunit of the B.

tabacijuvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 37.

The nucleotide sequence of the open reading frame of a cDNA molecule encoding the EcR partner protein (USP polypeptide) subunit of the B.

tabaci ecdysone receptor or the USP polypeptide subunit of the B.

tabacijuvenile hormone receptor, and amino acid sequence therefor.

The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the B. tabaci ecdysone receptor or the amino acid sequence of the USP polypeptide subunit of the B. tabaci juvenile hormone receptor encoded by SEQ ID NO: 39.

The nucleotide sequence of a probe which is specific for genetic sequences encoding the EcR polypeptide subunit of B. tabaci ecdysone receptor, and amino acid sequence therefor.

The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 37.

SEQ ID NO: 41: SEQ ID NO: 42: BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graphical representation showing function of the EcR polypeptide subunit of the L. cuprina ecdysone receptor in vivo. CHO cells were co transfected with: one of the following expression plasmids: pSGDmEcR, pSGLcEcR, or the parental expression plasmid pSG5 as a control, at 1 pg/ml; plasmid p(EcRE) 7 -CAT (1 pg/ml); and an independent reporter plasmid pPGKLacZ, at 1 pg/ml.

CAT expression was induced with Muristerone A at either 10 pM or 50 pM while control cells received only the carrier ethanol. ELISA kits were used to quantify the synthesis of CAT and p-galactosidase in extracts of cells forty eight hours after transfection. The level of CAT was normalized to the level of -galactosidase in the same extract. Fold-induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone, relative to the normalized values for CAT gene WO 01/02436 PCT/AUOO/00799 expression in cells transfected with the same plasmid, but in the absence of hormone. The average values of three independent experiments are shown and the error bars indicate standard error of the mean.

Figure 2 is a copy of a graphical representation showing the activity of plasmids pSGLD and pSGDL, containing chimeric EcR polypeptide subunits of insect ecdysone receptors, produced as described in the Examples. Cotransfection assays were performed as described in the Examples using plasmids pSGLD and pSGDL and the CAT reporter plasmid p(EcRE), -CAT (lug/ml) and an independent reporter, pPGKLacZ at 1 pg/ml each. CAT/P-Gal refers to CAT reporter activity expressed as a percentage relative to P-galactosidase activity produced by the internal control reporter, pPGKLacZ.

Figure 3 is a copy of a graphical representation showing the binding activity in extracts of Sf9 and Sf21 cells containing a baculovirus expressing LcEcRDEF and LcUSPDEF, as described in the Examples. Control cells contained baculovirus expressing P-glucuronidase and CAT only.

Figure 4 is a graphical representation showing the ecdysteroid binding activities of an in vitrotranslated Myzus persicae EcR (MpEcR) polypeptide, an in vitro-translated Myzus persicae USP (MpUSP) polypeptide, and a complex formed by in vitro-translated M. persicae EcR and USP polypeptides.

Figure 5 is a copy of a graphical representation showing the expression activity of plasmid pVPLcEcR, encoding a chimeric L. cuprina EcR polypeptide, and plasmid pSGLcUSP encoding the L. cuprina EcR partner protein (USP polypeptide), in CV1 cells, in accordance with the description provided in Example 18. The CAT reporter plasmid p(EcRE), -CAT (lug/ml), and an independent reporter plasmid, pPGKLacZ (1 pg/ml) were used to assay ecdysteroid-dependent gene expression. Data indicate expression of the CAT reporter gene relative to the level of expression of the transfection control P-galactosidase reporter gene. The symbols and indicate the presence or absence, respectively, of the plasmids pVPLcEcR and pSGLcUSP, or the presence or absence of 1 pM Ponasterone A (PonA). Error bars WO 01/02436 PCT/AU00/00799 -21indicate the standard error of the mean.

Figure 6 is a graphical representation showing in vivo function of a modified EcR polypeptide subunit of the M. persicae ecdysone receptor in CHO cells. The CHO cells were co-transfected with a.reporter plasmid p(EcRE) 7 -CAT (1 pg/ml) and an expression plasmid selected from the group consisting of pSGDmEcR, pSGMpEcR, pSGDM, pSGMD, and pSG5 (described in the examples), also at 1pg/ml concentration. Data indicate CAT reporter gene expression as determined by ELISA, for cells lacking Muristerone A (open bars) or containing Muristerone A (filled bars). The level of CAT expression is directly correlated to the concentration of the product of the enzymatic reaction in the assay and was measured as an absorbance at 405nm.

Figure 7 is a copy of a graphical representation showing the binding of 3 H] ponasterone A to extracts of Sf9 cells infected with baculovirus expressing the ligand binding regions (i.e.

domains D/E/F) of the M. persicae EcR polypeptide and the L. cuprina EcR partner protein (USP polypeptide); (ii) the M. persicae EcR polypeptide and the M. persicae EcR partner protein (USP polypeptide); and (iii) the L. cuprina EcR polypeptide and the L. cuprina EcR partner protein (USP polypeptide). Highly significant binding above background) of the ecdysteroid analogue is apparent for all three constructs tested.

Figure 8 is a copy of a graphical representation showing the activity of plasmid pSGDM (Example 19), encoding a chimeric M. persicae EcR polypeptide, and plasmid pBKMpUSPI, encoding an M. persicae EcR partner protein (USP polypeptide), in CV1 cells. The CAT reporter plasmid p(EcRE) 7 -CAT (lug/ml) and an internal control reporter plasmid, pPopNLacZ (1 pg/ml) were present in all assays. The symbols and indicate the presence or absence, respectively, of plasmids indicated in the figure, or the presence or absence of 10 pM Ponasterone a. Data indicate expression of the CAT reporter gene relative to the level of expression of the independent reporter gene 3-galactosidase. Error bars indicate the standard error of the mean.

WO 01/02436 PCT/AU00/00799 -22- DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42.

Accordingly, the isolated nucleic acid molecule of the invention may comprise a fragment of a nucleotide sequence encoding a full-length receptor polypeptide.

It is to be understood that a "fragment" of a nucleotide sequence encoding an EcR polypeptide subunit of a steroid receptor or an EcR partner protein (USP polypeptide) of a steroid receptor or a USP polypeptide of a juvenile hormone receptor, refers to a nucleotide sequence encoding a part or fragment of such a receptor which is capable of binding or associating with an insect steroid or an analogue thereof, or a candidate insecticidally active compound. Fragments of a nucleotide sequence would generally comprise in excess of twenty contiguous nucleotides derived from the base sequence and may encode one or more domains of a functional insect steroid receptor or juvenile hormone receptor.

Preferably, the isolated nucleic acid molecule of the invention encodes an ecdysteroid receptor polypeptide. Those skilled in the art are aware that ecdysteroid receptors derived from insects are heterodimeric receptors comprising an EcR polypeptide subunit and an EcR partner protein (USP polypeptide) (see also Jones and Sharp, 1997). In this regard, the present inventors have discovered that the USP polypeptide of the insect juvenile hormone receptor is structurally- WO 01/02436 PCT/AUOO/00799 -23identical to the EcR partner protein of the ecdysteroid receptor of the present invention, however juvenile hormone receptors comprise monomers or multimers of the USP polypeptide acting without the EcR polypeptide subunit that is present in the ecdysteroid receptors.

Accordingly, the present invention extends equally to nucleotide sequences encoding polypeptides of both the ecdysteroid receptors and polypeptides of the juvenile hormone receptors of insects.

More preferably, the isolated nucleic acid. molecule of the invention encodes an ecdysteroid receptor that is modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.

The isolated nucleic acid molecule of the invention may be derived from any organism that contains steroid receptors that are responsive to ecdysteroids or ecdysteroid-like compounds or juvenile hormones, or analogues of such receptor-ligands. Accordingly, the present invention is not to be limited in any of its embodiments to the particular source of the subject nucleic acid, or polypeptide encoded therefor.

Preferably, the isolated nucleic acid molecule of the invention is derived from insects, helminths (nematodes, cestodes, trematodes), protozoa, and ants, amongst others.

More preferably, the isolated nucleic acid molecule of the invention is derived from an insect selected from the group consisting of diptera, hemiptera, coleoptera, neuroptera, lepidoptera and ants, amongst others. Still more preferably, the isolated nucleic acid molecule of the present invention is derived from aphids, scale insects, leaf hoppers, white fly, and blowflies such as sheep blowflies.

The present invention does not extend to amino acid sequences comprising the complete EcR polypeptide subunit of the D. melanogaster ecdysone receptor as described in W091/13167.

However, this exclusion is made on the understanding that the present invention does encompass chimeric genes and fusion proteins which include the D. melanogaster nucleotide and amino acid sequences, respectively.

WO 01/02436 PCT/AU00/00799 -24- In a particularly preferred embodiment, the isolated nucleic acid molecule of the present invention is derived from the aphid M. persicae or alternatively, from the Australian sheep blowfly, L. cuprina.

The ecdysteroid receptor is preferably modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.

As used herein, the term "analogue of an ecdysteroid" shall be taken to indicate any compound that binds to one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, which binds to the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, which binds to a bioactive derivative or analogue of said polypeptides or holoreceptor. The term "analogue of an ecdysteroid" shall further be taken to indicate any compound that modulates the bioactivity of one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, that modulates the bioactivity of the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, that modulates the bioactivity of a bioactive derivative or analogue of said polypeptides or holoreceptor.

The present invention is not to be limited in scope to the specific L. cupnna, M. persicae, and B. tabaci nucleotide and amino acid sequences set forth in the accompanying Sequence Listing, and persons skilled in the art will readily be able to identify additional related sequences from other sources using art-recognised procedures, for example using nucleic acid hybridisation and/or polymerase chain reaction essentially as described by Ausubel et al. (1992) and/or McPherson et al. (1991) and/or Sambrook et al. (1989).

Accordingly, the present invention clearly encompasses isolated nucleic acid molecules which encode or are complementary to isolated nucleic acid molecules which encode the subject EcR polypeptide of a steroid receptor or fragments thereof, or the subject EcR partner protein (USP polypeptide) of a steroid receptor or the subject USP polypeptide of a juvenile hormone receptor, in addition to derivatives, fragments and analogues thereof which comprise amino WO 01/02436 PCT/AU00/00799 acid sequences having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42.

The present invention clearly extends further to isolated nucleic acid molecules which encode or are complementary to isolated nucleic acid molecules which encode the subject EcR polypeptide of a steroid receptor or fragments thereof, or the subject EcR partner protein (USP polypeptide) of a steroid receptor or the subject USP polypeptide of a juvenile hormone receptor, in addition to derivatives, fragments and analogues thereof which comprise amino acid sequences having at least 40% identity to an amino acid sequence encoded by L. cuprina, M. persicae or B. tabaci cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581.

For the purposes of nomenclature, plasmid pLcEcR contains the cDNA encoding the EcR polypeptide subunit of the Lucilia cuprina ecdysone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit.of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04566.

For the purposes of nomenclature, plasmid pLcUSP contains the cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Lucilia cuprina ecdysone receptor or the USP polypeptide subunit of the L. cuprina juvenile hormone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04565.

For the purposes of nomenclature, plasmid pMpEcR contains the cDNA encoding the EcR WO 01/02436 PCT/AU00/00799 -26polypeptide subunit of the Myzus persicae ecdysone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04567.

For the purposes of nomenclature, plasmid pMpUSP contains a first cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Myzus persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor. This plasmid was deposited on 1 July, 1999 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM99/04568.

For the purposes of nomenclature, plasmid pMpUSP2 contains a second cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Myzus persicae ecdysone receptor or the USP polypeptide subunit of the M. persicae juvenile hormone receptor. This plasmid was deposited on 21 June, 2000 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NMOO/12581.

For the purposes of nomenclature, plasmid pBtUSP contains the cDNA encoding the EcR partner protein (USP polypeptide) subunit of the Bemesia tabaci ecdysone receptor or the USP polypeptide subunit of the B. tabacijuvenile hormone receptor. This plasmid was deposited on 21 June, 2000 with the Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and accorded AGAL Accession No. NM00/12580.

The deposits referred to herein will be maintained under the Budapest Treaty on the WO 01/02436 PCT/AU00/00799 -27- International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. These deposits are provided merely for the purposes of exemplification and are not an admission that a deposit is required under 35USC §112. A license may be required to make, use or sell the deposited materials or a polypeptide encoded by a cDNA thereof and no such license is hereby granted. It is to be understood however, that the deposits will become publicly available upon the grant of a patent pertaining to the instant disclosure in so far as that patent relates to the deposits referred to herein.

Preferably, the percentage similarity to any one of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, or SEQ ID NO: 42, or to a polypeptide encoded by a cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581, is at least about 60%, more preferably at least about 80%, even more preferably at least about In determining whether or not two amino acid sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences will arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity or similarity between two or more amino acid sequences shall be taken to refer to the number of identical and similar residues respectively, between said sequences as determined using any standard algorithm known to those skilled in the art. For example, amino acid sequence identities or similarities may be calculated using the GAP programme and/or aligned using the PILEUP programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984). The GAP programme utilizes the algorithm of Needleman and Wunsch (1970) to maximise the number of identical/similar residues and to minimise the number and length of sequence gaps in the alignment. Alternatively or in addition, wherein more than two amino acid sequences are being compared, the ClustalW programme of Thompson et al (1994) is used.

WO 01/02436 PCT/AU00/00799 -28- In an alternative embodiment, the isolated nucleic acid molecule of the invention encodes or is complementary to an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a fragment thereof, or a partner protein (USP) or a fragment thereof, which at least comprises an amino acid sequence which is substantially identical to a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42, or substantially identical to the amino acid sequence of a polypeptide encoded by cDNA contained in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581.

As used herein, the term "substantially identical" or similar term shall be taken to include any sequence which is at least about 95% identical and preferably at least 99% or 100% identical to a stated nucleotide sequence or amino acid sequence, including any homologue, analogue or derivative of said stated nucleotide sequence or amino acid sequence.

Those skilled in the art will be aware that variants of the nucleotide sequences set forth in any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, or SEQ ID NO: 41, or variants of the cDNAs contained in any one of the deposited plasmids, which variants encode EcR polypeptides of insect steroid receptors or fragments thereof or EcR partner proteins (USP polypeptides) or fragments thereof, or USP polypeptides of insect juvenile hormone receptors, may be isolated by hybridization under low stringency conditions as exemplified herein.

Such variants include any genomic sequences, cDNA sequences mRNA or other isolated nucleic acid molecules derived from the nucleic acid molecules exemplified herein by the Sequence Listing. Additional variants are not excluded.

In a particularly preferred embodiment of the invention, the variant nucleotide sequences encode a fragment of the EcR polypeptide of the insect steroid receptor or a fragment of the WO 01/02436 PCT/AU00/00799 -29- EcR partner protein (USP polypeptide) of the insect steroid receptor or a fragment of the USP polypeptide of the insect juvenile hormone receptor.

Preferred fragments of the subject polypeptides include one or more regions or domains which are involved in the interaction or association between the monomeric polypeptide subunits of a multimeric receptor and/or which are involved in the interaction or association between a cognate steroid or receptor ligand or cis-acting DNA sequence; and (ii) said monomeric polypeptide subunits or the receptor per se. In a particularly preferred embodiment, the fragments comprise the DNA-binding domain, linker domain (domain D) or a part thereof, or ligand-binding domain (eg. hormone-binding domain) of a steroid receptor polypeptide or juvenile hormone receptor polypeptide or receptor holoenzyme. As exemplified herein, wherein biological activity of the L. cuprina ecdysone receptor is required, it is preferably to include at least a ligand-binding region comprising the ligand-binding domain and at least a part of the linker domain of the EcR polypeptide subunit, optionally in association with a ligand-binding region comprising at least the ligand-binding domain and at least a part of the linker domain of the EcR partner protein (USP polypeptide) subunit of said receptor. Additional fragments are not excluded.

Homologues, analogues and derivatives of the nucleotide sequences exemplified herein may be isolated by hybridising same under at least low.stringency conditions and preferably under at least medium stringency conditions, to a nucleotide sequence selected from the group consisting of SEQ ID NO:.1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary strand of any one of said sequences, or to a cDNA contained in any one or more of the deposited plasmids. More preferably, the isolated nucleic acid molecule according to this aspect of the invention is capable of hybridising under at least high stringency conditions to a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or to a complementary strand of any one of said sequences, or to the cDNAs contained in any one or more of the deposited plasmids.

WO 01/02436 PCT/AU00/00799 For the purposes of defining the level of stringency, a low stringency is defined herein as being a hybridisation or a wash carried out in 6xSSC buffer, 0.1% SDS at 28 0 C or alternatively, as exemplified herein. Generally, the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridisation and/or wash. A medium stringency comprises a hybridisation and/or a wash carried out in 0.2xSSC-2xSSC buffer, 0.1% SDS at 42 0 C to 65 0 C, while a high stringency comprises a hybridisation and/or a wash carried out in 0.1xSSC-0.2xSSC buffer, 0.1% (w/v) SDS at a temperature of at least 55°C. Conditions for hybridisations and washes are well understood by one normally skilled in the art. For the purposes of further clarification only, reference to the parameters affecting hybridisation between nucleic acid molecules is found in Ausubel et al. (1992), which is herein incorporated by reference.

In an even more preferred embodiment of the invention, a hybridising nucleic acid molecule further comprises a sequence of nucleotides which is at least 40% identical to at least contiguous nucleotides, preferably at least 50 contiguous nucleotides and more preferably at least 100 contiguous nucleotides, derived from a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary strand of any one of said sequences, or a nucleotide sequence of a cDNA contained in any one or more of the deposited plasmids referred to herein.

In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University WO 01/02436 PCT/AU00/00799 -31- Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).

In an alternative embodiment, nucleotide sequences encoding EcR polypeptide subunits of insect steroid receptors or fragments thereof or EcR partner proteins (USP polypeptides) of insect steroid receptor or fragments thereof, or USP polypeptides of insect juvenile hormone receptor polypeptides, are amplified in the polymerase chain reaction. According to this embodiment, one or two or more nucleic acid "primer molecules" derived from a nucleotide sequence exemplified herein, such as, for example, a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary sequence to any one of said sequences, or a sequence from a cDNA contained in any one or more of the deposited plasmids referred to herein, are annealed or hybridized to a nucleic acid "template molecule" which at least comprises a nucleotide sequence encoding a related genetic sequence or a functional part thereof, and nucleic acid molecule copies of the template molecule are amplified enzymatically using a thermostable DNA polymerase enzyme, such as Taql polymerase or Pfu polymerase, amongst others.

More particularly, one of the primer molecules comprises contiguous nucleotides derived from a sequence selected from the group consisting of SEQ ID NO:.1, SEQ ID NO: 3, SEQ ID NO: SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or from a cDNA contained in any one or more of the deposited plasmids referred to herein; and another of said primers comprises contiguous nucleotides complementary to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or alternatively, from a cDNA contained in any one or more of the deposited plasmids referred to herein, subject to the proviso that the first and second primers are not complementary to each other.

In a preferred embodiment, each nucleic acid primer molecule is at least 10 nucleotides in WO 01/02436 PCT/AU00/00799 -32length, more preferably at least 20 nucleotides in length, even more preferably at least nucleotides in length, still more preferably at least 40 nucleotides in length and even still more preferably at least 50 nucleotides in length.

Furthermore, the nucleic acid primer molecules consists of a combination of any of the nucleotides adenine, cytidine, guanine, thymidine, or inosine, or functional analogues or derivatives thereof which are at least capable of being incorporated into a polynucleotide molecule without having an inhibitory effect on the hybridisation of said primer to the template molecule in the environment in which it is used.

Furthermore, one or both of the nucleic acid primer molecules may be contained in an aqueous mixture of other nucleic acid primer molecules, for example a mixture of degenerate primer sequences which vary from each other by one or more nucleotide substitutions or deletions.

Alternatively, one or both of the nucleic acid primer molecules may be in a substantially pure form.

In a particularly preferred embodiment exemplified herein, two primer nucleotide sequences are used to amplify related sequences, said primers comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23 to 30 inclusive. Even more preferably, the primers are used in a primer combination selected from the group consisting of (i)SEQ ID NO: 23 and SEQ ID NO: 24; (ii) SEQ ID NO: 25 and SEQ ID NO: 26; (iii) SEQ ID NO: 27 and SEQ ID NO: 28; and (iv) SEQ ID NO: 31 and SEQ ID NO: 32.

The nucleic acid template molecule may be in a recombinant form, in a virus particle, insect cell, bacteriophage particle, yeast cell, animal cell, or a plant cell. Preferably, the nucleic acid template molecule is derived from an insect species.

Those skilled in the art will be aware that there are many known variations of the basic polymerase chain reaction procedure. Such variations are discussed, for example, in McPherson et al (1991). The present invention extends to the use of all such variations in the isolation of variant insect steroid receptor-encoding genes or fragments thereof, or variant WO 01/02436 PCT/AU00/00799 -33partner protein-encoding genes or fragments thereof to those exemplified herein.

The isolated nucleic acid molecule of the present invention, including those sequences exemplified herein and any variants thereof, may be cloned into a plasmid or bacteriophage molecule, for example to facilitate the preparation of primer molecules or hybridisation probes or for the production of recombinant gene products. Methods for the production of such recombinant plasmids, cosmids, bacteriophage molecules or other recombinant molecules are well-known to those of ordinary skill in the art and can be accomplished without undue experimentation. Accordingly, the invention further extends to any recombinant plasmid, bacteriophage, cosmid or other recombinant molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41, or a complementary sequence to any one of said sequences, or a homologue, analogue or derivative of any one of said sequences or complements, or a cDNA contained in any one or more of the deposited plasmids referred to herein.

The nucleic acid molecule of the present invention is also useful for developing genetic constructs which comprise and preferably, express, the EcR polypeptide subunit of the insect steroid receptor and/or the EcR partner protein (USP polypeptide) of the steroid receptor or the USP polypeptide of the juvenile hormone receptor, thereby providing for the production of the recombinant polypeptides in isolated cells or transformed tissues.

Accordingly, a further aspect of the present invention provides a genetic construct comprising the subject isolated nucleic acid molecule encoding the insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence. Preferably, the subject nucleic acid molecule is in an expressible format, such that it is possible to produce a recombinant polypeptide therefrom.

WO 01/02436 PCT/AU00/00799 -34- Reference herein to a "promoter" is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation in a eukaryotic cell, with or without a CCAAT box sequence or alternatively, the Pribnow box required for accurate expression in prokaryotic cells.

Promoters may be cell, tissue, organ or system specific, or may be non-specific. Using specific promoters, the expression of a bioactive agent or other polypeptide encoded by a structural gene to which the promoter is operably connected may be targeted to a desired cellular site.

For example, in transgenic animals such as sheep, it can be envisaged that cells of the transgenic animal may contain a gene encoding a steroid receptor, preferably a steroid receptor linked to an epidermal specific promoter and a separate gene encoding, for example, epidermal growth factor (EGF) which is functionally linked to one or more insect hormone response elements and may or may not also be linked to epidermal specific promoter elements. On administration of the appropriate insect steroid hormone to the transgenic animal, the activated complex between the insect steroid receptor and insect steroid may bind to the one or more insect steroid hormone response element thereby inducing EGF production solely in epidermal cells which may give rise to defleecing. It is to be understood that this aspect of the invention is independent of the degree of thermostability of the insect steroid receptor The same principal applies to expression of any bioactive molecule or reporter molecule in a specific cell type which is regulated by a transactivating complex between a steroid receptor complex and an appropriate insect steroid.

In the present context, the term "promoter" is also used to describe a synthetic or fusion molecule, or derivative which confers, activates or enhances expression in a cell in response to an external stimulus. Accordingly, the promoter may include further regulatory elements (i.e.

upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or extemrnal stimuli, or in a tissue-specific manner. Preferred promoters may contain copies of one or more specific regulatory elements, in particular steroid responsive elements (SREs) or hormone-responsive elements (HREs), to further enhance expression and/or to alter the spatial expression and/or temporal expression pattern.

WO 01/02436 PCT/AU00/00799 Reference herein to the term "steroid response element" shall be taken to refers to one or more cis-acting nucleotide sequences present in a naturally-occurring or synthetic or recombinant gene the expression of which is regulated by an insect steroid, such as an ecdysteroid, for example ecdysone or ponasterone A, wherein said regulation of expression results from an direct or indirect interaction between a steroid receptor and said cis-acting nucleotide sequence response element. Exemplary insect steroid hormone response elements include the ecdysone response element hsp27 (EcRE) and any other nucleotide sequence which is capable of binding ecdysteroid receptors or polypeptide subunits thereof or fragments or analogies thereof (such as associated with E75, E74 or other Drosophila early genes), as described for example by Riddihough and Pelham (1987).

For example, an SRE or a plurality of such elements may be operably linked to a promoter such as the polyhedron promoter, p10 promoter, MMTV promoter or SV40 promoter, to make transcription of a structural gene to which said promoter is operably connected responsive to the presence of a steroid bound to the insect receptor (which may act as a transcription factor).

One or more insect SREs may be located within a promoter, and may replace sequences within a selected promoter which confer responsiveness to hormones or other agents which regulate promoter activity. Where response elements are different they may lead to preferential binding of different insect steroids or analogues thereof such that a promoter may be differentially regulated.

Particularly preferred SREs according to this embodiment include, but are not limited to, the hsp27 ecdysone response element described by Riddihough and Pelham (1987) or the 13 base-pair palindromic core contained therein.

A promoter is usually, but not necessarily, positioned upstream or of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene.

Placing a gene or isolated nucleic acid molecule operably under the control of a promoter sequence means positioning said gene or isolated nucleic acid molecule such that its WO 01/02436 PCT/AU00/00799 -36expression is controlled by the promoter sequence. Promoters are generally positioned (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.

Those skilled in the art will recognise that the choice of promoter will depend upon the nature of the cell being transformed and when expression is required. Furthermore, it is well-known in the art that the promoter sequence used in the expression vector will also vary depending upon the level of expression required and whether expression is intended to be constitutive or regulated.

For expression in eukaryotic cells, the genetic construct generally comprises, in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate expression of said nucleic acid molecule. The promoter may be derived from a genomic clone which normally encodes the expressed protein or alternatively, it may be a heterologous promoter derived from another genetic source. Promoter sequences suitable for expression of genes in eukaryotic cells are well-known in the art.

Suitable promoters for use in eukaryotic expression vectors include those capable of regulating expression in mammalian cells, insect cells such as Sf9 or Sf21. (Spodoptera frugiperda) cells, yeast cells and plant cells. Preferred promoters for expression in eukaryotic cells include the pl0 promoter, MMTV promoter, polyhedron promoter, the SV40 early promoter and the cytomegalovirus (CMV- IE) promoter, promoters derived from immunoglobulin-producing cells (see, United States Patent No 4,663,281), polyoma virus promoters, and the LTR from various retroviruses (such as murine leukemia virus, murine or Rous sarcoma virus and HIV), amongst WO 01/02436 PCT/AU00/00799 -37others See, Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, New York, 1983, which is incorporated herein by reference). Examples of other expression control sequences are enhancers or promoters derived from viruses, such as SV40, Adenovirus, Bovine Papilloma Virus, and the like.

Wherein the expression vector is intended for the production of recombinant protein, the promoter is further selected such that it is capable of regulating expression in a cell which is capable of performing any post-translational modification to the polypeptide which may be required for the subject recombinant polypeptide to be functional, such as N-linked glycosylation. Cells suitable for such purposes may be readily determined by those skilled in the art. By way of exemplification, Chinese hamster ovary (CHO) cells may be employed to carry out the N-terminal glycosylation and signal sequence cleavage of a recombinant polypeptide produced therein. Alternatively, a baculovirus expression vector such as the pFastBac vector supplied by GibcoBRL may be used to express recombinant polypeptides in Sf9 (Spodoptera frugiperda) cells, following standard protocols.

Numerous expression vectors suitable for the present purpose have been described and are readily available. The expression vector may be based upon the pcDNA3 vector distributed by Medos Company Pty Ltd, Victoria, Australia, which comprises the CMV promoter and BGH terminator sequences for regulating expression of the recombinant polypeptide of the invention in a eukaryotic cell, when isolated nucleic acid sequences encoding same are inserted, in the sense orientation relative to the CMV promoter, into the multiple cloning site of said vector.

Alternatively, the SG5 expression vector of Greene et al. (1988), supplied by Stratagene, or the pQE series of vectors supplied by Qiagen are particularly useful for such purposes, as exemplified herein.

Examples of eukaryotic cells contemplated herein to be suitable for expression include mammalian, yeast, insect, plant cells or cell lines such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK), MDCK, sf21 (insect) or Sf9 (insect) cell lines. Such cell lines are readily available to those skilled in the art.

WO 01/02436 PCT/AU00/00799 -38- The prerequisite for expression in prokaryotic cells such as Escherichia coli is the use of a strong promoter with an effective ribosome binding site. Typical promoters suitable for expression in bacterial cells such as E. coli include, but are not limited to, the lacz promoter, temperature-sensitive A, or A, promoters, T7 promoter or the IPTG-inducible tac promoter. A number of other vector systems for expressing the nucleic acid molecule of the invention in E.coli are well-known in the art and are described for example in Ausubel et al (1992).

Numerous vectors having suitable promoter sequences for expression in bacteria have been described, such as for example, pKC30 (k:Shimatake and Rosenberg, 1981), pKK173-3 (tac: Amann and Brosius, 1985), pET-3 (T7: Studier and Moffat, 1986) or the pQE series of expression vectors (Qiagen, CA), amongst others.

Suitable prokaryotic cells include corynebacterium, salmonella, Escherichia coli, Bacillus sp.

and Pseudomonas sp, amongst others. Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1992).

The genetic constructs described herein may further comprise genetic sequences corresponding to a bacterial origin of replication and/or a selectable marker gene such as an antibiotic-resistance gene, suitable for the maintenance and replication of said genetic construct in a prokaryotic or eukaryotic cell, tissue or organism. Such sequences are well-known in the art.

Selectable marker genes include genes which when expressed are capable of conferring resistance on a cell to a compound which would, absent expression of said selectable marker gene, prevent or slow cell proliferation or result in cell death. Preferred selectable marker genes contemplated herein include, but are not limited to antibiotic-resistance genes such as those conferring resistance to ampicillin, Claforan, gentamycin, G-418, hygromycin, rifampicin, kanamycin, neomycin, spectinomycin, tetracycline or a derivative or related compound thereof or any other compound which may be toxic to a cell.

The origin of replication or a selectable marker gene will be spatially-separated from those WO 01/02436 PCT/AU00/00799 -39genetic sequences which encode the recombinant receptor polypeptide or fusion polypeptide comprising same.

Preferably, the genetic constructs of the invention, including any expression vectors, are capable of introduction into, and expression in, an in vitro cell culture, or for introduction into, with or without integration into the genome of a cultured cell, cell line or transgenic animal.

In a particularly preferred embodiment, the expression vector is selected from the group consisting of: pLcEcR (AGAL Accession No. NM99/04566); pLcUSP (AGAL Accession No.

NM99/04565); pMpEcR (AGAL Accession No. NM99/04567); pMpUSP (AGAL Accession No.

NM99/04568.); pMpUSP2 (AGAL Accession No. NM00/12581); and pBtUSP (AGAL Accession No. NM00/12580).

A further aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.

As used herein, the word "cell" shall be taken to refer to a single cell, or a cell lysate, or a tissue, organ or whole organism comprising same, including a tissue, organ or whole organism comprising a clonal group of cells or a heterogenous mixture of cell types, which may be a prokaryotic or eukaryotic cell as described supra.

In a preferred embodiment, the cell of the present invention expresses the isolated or recombinant polypeptide encoded by the nucleic acid molecule.

In a preferred embodiment, the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said WO 01/02436 PCT/AU00/00799 reporter molecule.

To produce the cells of the invention, host cells are transfected or co-transfected or transformed with nucleotide sequences containing the DNA segments of interest (for example, the insect steroid receptor gene, the recombinant steroid response elements, or both) by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas lipofection or calcium phosphate treatment are often used for other cellular hosts. See, generally, Sambrook et al, (1989); Ausubel et al, (1992); and Potrykus (1990). Other transformation techniques include electroporation, DEAE-dextran, microprojectile bombardment, lipofection, microinjection, and others.

As used herein, the term "transformed cell" is meant to also include the progeny of a transformed cell.

In a further aspect of this invention, there is provided an animal (such as a mammal or insect), microorganism, plant or aquatic organism, containing one or more cells as mentioned above.

Reference to plants, microorganisms and aquatic organisms includes any such organisms.

In this embodiment of the invention, it is to be appreciated that administration of an insect steroid or an analogue thereof to an organism will induce expression of the desired bioactive molecule, such as a polypeptide, with attendant advantages. For example, an induced protein may have a therapeutic effect ameliorating a disease state or preventing susceptibility to disease or may modify in some way the phenotype of an organism to produce a desired effect.

In humans, for example, cell transplants (such as liver cells) may under the action of insect steroids, produce desirable hormones such as insulin, growth hormone, growth factors and the like.

A further aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide derived from an insect or a bioactive derivative or analogue thereof, wherein said polypeptide: WO 01/02436 PCT/AU00/00799 -41is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42; wherein said polypeptide is substantially free of naturally-associated insect cell components.

In an alternative embodiment, the recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide derived from an insect or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the group consisting of the EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence having at least 40% identity to an amino acid sequence encoded by cDNA present in a plasmid selected from the group consisting of AGAL Accession Nos. NM99/04565, NM99/04566, NM99/04567, NM99/04568, NM00/12580, and NM00/12581; wherein said polypeptide is substantially free of naturally-associated insect cell components.

Reference herein to "substantially free of naturally associated insect cell components" refers to at least 80% purity, preferably more than 90% purity, and more preferably more than purity. Normally, purity is measured on a polyacrylamide gel with homogeneity determined by staining of protein bonds. Alternatively, high resolution may be necessary using HPLC or similar means. For most purposes, a simple chromatography column or polyacrylamide gel may be used to determine purity. A protein which is chemically synthesized or synthesized in a cell system different from an insect cell from which it naturally originates would be free of naturally-associated insect cell components.

The present invention clearly provides for the isolation of EcR polypeptide subunits and EcR WO 01/02436 PCT/AU00/00799 -42partner protein (USP polypeptide) subunits of ecdysteroid receptors and USP polypeptides of juvenile hormone receptors, from various organisms of the class Insecta, as described supra, in addition to protozoa and helminth sources.

Insect steroid receptors are characterized by functional ligand-binding domains, and DNAbinding domains, both of which interact to effect a change in the regulatory state of a gene operably linked to the DNA-binding site of the holoreceptor or a polypeptide or polypeptide fragment thereof. Thus, insect steroid receptors seem to be ligand-responsive transcription factors. Additionally, insect steroid receptors generally contain a DNA-binding domain (Domain and a ligand-binding domain (Domain separated and flanked by additional domains as identified by Krust et al(1986). The C domain preferably comprises a zinc-finger DNA-binding domain which is usually hydrophilic, having high cysteine, lysine and arginine content. The E domain preferably comprises hydrophobic amino acid residues and is further characterized by regions El, E2 and E3. The ligand-binding domain of the members of the insect steroid receptor superfamily is typically carboxyl-proximal, relative to a DNA-binding domain (Evans,1988). The entire ligand-binding domain is typically between about 200 and 250 amino acids but is potentially shorter. This domain has the subregions of high homology, designated the El, E2 and E3 regions -which may be collectively referred to as the "E region". Amino acid residues proximal to the C domain comprise a region initially defined as separate A and B domains. Region D separates the more conserved domains C and E. Region D typically has a hydrophilic region whose predicted secondary structure is rich in turns and coils. The F region is carboxy promixal to the E region (see, Krust et al, supra).

The receptor polypeptides of the present invention exhibit at least a ligand-binding domain, as characterized by sequence homology to regions El, E2 and E3. The ligand-binding domains of the present invention are typically characterized by having significant homology in sequence and structure to these three regions. Fragments of insect steroid receptors and partner proteins capable of binding insect steroids, and candidate insecticidally active compounds comprise an E-region or a sufficient portion of the E-region to allow binding.

Preferably, the recombinant or isolated EcR polypeptide subunit of the insect steroid receptor WO 01/02436 PCT/AU00/00799 -43or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor as described herein is thermostable.

By "thermostable" is meant that a stated integer does not exhibit reduced activity at bacterial, plant or animal physiological temperatures above about 28 0 C or above about 30 0 C. The thermostability of insect steroid hormone receptors also refers to the capacity of such receptors to bind to ligand-binding domains or regions or to transactivate genes linked to insect steroid hormone response elements at bacterial,.plant.or animal physiological temperatures above about 28 0 C or above about The present invention clearly extends to variants of said polypeptides, as described supra. The polypeptide may be substantially free of naturally associated insect cell components, or may be in combination with a partner protein which associates with the insect steroid receptor so as to confer enhanced affinity for insect steroid response elements, enhanced affinity for insect steroids or analogues thereof. For Example, the amino acid sequences exemplified herein may be varied by the deletion, substitution or insertion of one or more amino acids.

In one embodiment, amino acids of a polypeptide exemplified herein may be replaced by other amino acids having similar properties, for example hydrophobicity, hydrophilicity, hydrophobic moment, charge or antigenicity, and so on.

Substitutions encompass amino acid alterations in which an amino acid of the base polypeptide is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as "conservative", in which case an amino acid residue contained in the base polypeptide is replaced with another naturally-occurring amino acid of similar character, for example Gly-Ala, Val-lle-+Leu, Asp-Glu, Lys-Arg, Asn-GIn or Phe<-Trp-Tyr.

Substitutions encompassed by the present invention may also be "non-conservative", in which an amino acid residue which is present in the base polypeptide is substituted with an amino acid having different properties, such as a naturally-occurring amino acid from a different group WO 01/02436 PCT/AU00/00799 -44- (eg. substituted a charged or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid.

Those skilled in the art will be aware that several means are available for producing variants of the exemplified EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor, when provided with the nucleotide sequence of the nucleic acid molecule which encodes said polypeptide, for example site-directed mutagenesis of DNA and polymerase chain reaction utilising mutagenised oligonucleotide primers, amongst others.

Such polypeptide variants which are capable of binding insect steroids clearly form part of the present invention. Assays to determine such binding may be carried out according to procedures well known in the art.

One such variant polypeptide encompassed by the present invention comprises an "in-frame" fusion polypeptide between different regions of different insect receptor polypeptides. As exemplified herein, the present inventors have discovered that, by producing synthetic genes in which various domains of a base insect steroid receptor-encoding nucleotide sequence derived from a first source are interchanged or substituted with similar sequences derived from a second source (referred to as "domain swapping"), it is possible to modify the bioactivity of the insect steroid receptor encoded therefor. For example, the biological activity of the EcR polypeptide of the L. cuprina or M. persicae ecdysone receptor exemplified herein may be modulated by replacing portions of its C-terminal or N-terminal sequences with the equivalent domains from the EcR polypeptide of the D. melanogaster ecdysone receptor or alternatively, by swapping regions of the EcR polypeptides of the L. cuprina and M. persicae ecdysone receptors per se.

As a further refinement, such changes in biological function can similarly be effected by making specific changes addition, substitution or deletion) to only those amino-acids within each domain that are critical for determining the relevant catalytic function (eg. ligand-binding activity, DNA binding site affinity, etc), such as by site-directed mutagenesis.

WO 01/02436 PCT/AU00/00799 According to this embodiment, there is provided a synthetic EcR polypeptide subunit of a steroid receptor, or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, or a synthetic USP polypeptide of a juvenile hormone receptor, or an analogue or derive of said synthetic polypeptides, wherein said synthetic polypeptides comprise an amino acid sequence which has the following properties: it differs in amino acid sequence or exhibits different biological properties to a naturally-occurring EcR polypeptide subunit of a steroid receptor, or a naturallyoccurring EcR partner protein (USP polypeptide) subunit of a steroid receptor, or a naturally-occurring USP polypeptide of a juvenile hormone receptor; (ii) it comprises a first sequence of amino acids having at least about 40% identity to a part of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42, or having at least about 40% identity to a part of an amino acid sequence encoded by any one of the deposited plasmids referred to herein, linked covalently to a second sequence of amino acids derived from an EcR polypeptide subunit of a steroid receptor, EcR partner protein (USP polypeptide) subunit of a steroid receptor, or USP polypeptide of a juvenile hormone receptor, wherein said first and second sequences are derived from different genomic sources.

Preferably, the first sequence of amino acids is derived from the EcR polypeptide subunit of a steroid receptor, more preferably from the EcR polypeptide of the L. cupnna or M. persicae ecdysone receptor, and even more preferably from the EcR polypeptide of the L. cuprina ecdysone receptor.

In one embodiment, the synthetic EcR polypeptide subunit of a steroid receptor, or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, or a synthetic USP polypeptide of a juvenile hormone receptor comprises a fusion polypeptide in which the ligandbinding regions of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 40, and SEQ ID NO: 42 are WO 01/02436 PCT/AU00/00799 -46replaced, in-frame, by the ligand-binding region of a different receptor polypeptide.

In a particularly preferred embodiment, 5'-end of the open reading frame of a first nucleotide sequence, encoding the N-terminal portion of the EcR polypeptide of a first ecdysteroid receptor to the end of the DNA-binding domain of said polypeptide, is fused in-frame, to the 3'end of the open reading frame of a second nucleotide sequence, encoding the C-terminal portion of the EcR polypeptide of a second ecdysteroid receptor, from the D domain and hormone-binding domain to the carboxyl terminus.

Accordingly, the present invention extends to any variants of the insect receptor polypeptides referred to herein and genetic sequences encoding same, wherein said variants are derived from a receptor polypeptide as described herein and exhibit demonstrable ligand-binding activity, and either comprises an amino acid sequence which differs from a naturally-occurring receptor polypeptide, or exhibit biological activity.

As with other aspects of the invention, the variants described herein may be produced as recombinant polypeptides or in transgenic organisms, once the subject synthetic genes are introduced into a suitable host cell and expressed therein.

In an alternative embodiment, the recombinant receptor polypeptide of the invention is produced as an "in-frame" fusion polypeptide with a second polypeptide, for example a detectable reporter polypeptide such as P-galactosidase, 0-glucuronidase, luciferase or other enzyme, or a FLAG peptide, hapten peptide such as a poly-lysine or poly-histidine or other polypeptide molecule.

By "in-frame" means that a nucleotide sequence which encodes a first polypeptide is placed cloned or ligated) in the same open reading frame adjacent to a nucleotide sequence which encodes a second polypeptide with no intervening stop codons there between, such that when the ligated nucleic acid molecule is expressed, a single fusion polypeptide is produced which comprises a sequence of amino acids corresponding to the summation of the individual amino acid sequences of the first and second polypeptides.

WO 01/02436 PCT/AU00/00799 -47- In order to produce a fusion polypeptide, the nucleic acid molecule which encodes the polypeptide of the invention, or an analogue or derivative thereof, is cloned adjacent to a second nucleic acid molecule encoding the second polypeptide, optionally separated by a spacer nucleic acid molecule which encodes one or more amino acids (eg: poly-lysine or poly histidine, amongst others), such that the first coding region and the second coding region are in the same open reading frame, with no intervening stop codons between the two coding regions. When translated, the polypeptide thus produced comprises a fusion between the polypeptide products of the first and second coding regions. Wherein a spacer nucleic acid molecule is utilised in the genetic construct, it may be desirable for said spacer to at least encode an amino acid sequence which is cleavable to assist in separation of the fused polypeptide products of the first and second coding regions, for example a thrombin cleavage site.

A genetic construct which encodes a fusion polypeptide further comprises at least one start codon and one stop codon, capable of being recognised by the cell's translational machinery in which expression is intended.

Preferably, a genetic construct which encodes a fusion polypeptide may be further modified to include a genetic sequence which encodes a targeting signal placed in-frame with the coding region of the nucleotide sequence encoding the fusion polypeptide, to target the expressed recombinant polypeptide to the extracellular matrix or other cell compartment. More preferably, the genetic sequence encoding targeting signal is placed in-frame at the 5'-terminus or the 3'terminus, but most preferably at the 5'-terminus, of the coding region of the nucleotide sequence which encodes the fusion polypeptide.

Methods for the production of a fusion polypeptide are well-known to those skilled in the art.

The recombinant EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor may be purified by standard techniques, such as column chromatography (using various matrices which interact with the protein products, such as ion exchange matrices, WO 01/02436 PCT/AU00/00799 -48hydrophobic matrices and the like), affinity chromatography utilizing antibodies specific for the protein or other ligands such as dyes or insect steroids which bind to the protein.

Wherein the recombinant polypeptide is expressed as a fusion polypeptide, it is also possible to purify the fusion polypeptide based upon its properties (eg size, solubility, charge etc).

Alternatively, the fusion polypeptide may be purified based upon the properties of the nonreceptor moiety of said fusion polypeptide, for example substrate affinity. Once purified, the fusion polypeptide may be cleaved to release the intact polypeptide of the invention.

Alternatively, proteins may be synthesized by standard protein synthetic techniques as are well known in the art.

In a preferred embodiment, the recombinant or isolated polypeptides of the invention are provided as a precipitate or crystallized by standard techniques, preferably for X-ray crystal structure determination.

The three-dimensional structure of the polypeptide of the invention or a holoreceptor comprising same or a fragment of said polypeptide or holoreceptor is particularly useful for identifying candidate insecticidal agents which mimic ligands that bind to said three-dimensional structure and/or modulate the ability of insect steroids to bind.thereto and activate the receptor (see, for example, Von Itzstein et al, 1993; and Bugg et al., 1993).

According to this embodiment, the EcR polypeptides of the invention or ligand binding domains thereof, or their complexes with EcR partner proteins or ligand binding domains thereof, which confer enhanced affinity for insect steroid response elements or partner proteins (USP polypeptides) or ligands, are particularly useful to model the three-dimensional structure of the receptor ligand-binding region. In this manner, insecticidal compounds may be produced which bind to, or otherwise interact with, the ligand-binding region of the receptor, and preferably interfere with ligand binding. In the same way, compounds may be developed which have a potentiated interaction with the insect steroid receptor over and above that of the physiological insect steroid which binds to the receptor.

WO 01/02436 PCT/AU00/00799 -49- Accordingly, a still further aspect of the invention provides a method of identifying a candidate insecticidally-active agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

Standard procedures are used to determine the three dimensional structure of the receptor polypeptides of the invention, for example using X-ray crystallography and/or nuclear magnetic resonance analysis (see, for example, Bugg et al., 1993; Von Itstein et al., 1993).

Insecticidally-active agents contemplated herein include synthetic chemicals that mimic one or more ligands of the holoreceptor or its polypeptide subunit, or the ligand-binding region of said holoreceptor or subunit, thereby modulating binding of steroids to said holoreceptor or subunit.

Preferred insecticidally-active agents include bisacylhydrazines, iridoid glycosides or other nonsteroidal modulators of ecdysteroid receptors or insect juvenile hormone receptors.

Additionally, because the EcR partner protein (USP polypeptide) subunits of insect steroid receptors, and the USP polypeptides of insect juvenile hormone receptors, bind insect juvenile hormones, a sesquiterpenoid group of ligands that regulate developmental transitions in insects (see Jones and Sharp, 1997), compounds which interfere with the binding of juvenile hormone are also candidate insecticides.

A further aspect of the present invention provides a method of identifying a modulator of insect steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene WO 01/02436 PCT/AU00/00799 expression comprising: assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and a potential modulator and (ii) assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and without said potential modulator; and (ii) comparing expression of the reporter gene in the presence of the potential modulator to the expression of a reporter gene in the absence of the potential modulator, wherein said reporter gene is placed operably under the control of a steroid response element (SRE) to which said insect steroid receptor binds or a promoter sequence comprising said SRE.

In the present context, a "modulator" is a compound or molecule that agonises or antagonises the binding properties and/or biological activity of a receptor polypeptide or holoreceptor.

Preferred modulators according to this embodiment include those synthetic compounds that are suitable for use as insecticidally-active agents described supra.

The reporter gene may be any gene, the expression of which may be monitored or assayed readily. Preferably, the reporter gene is a structural gene that encodes a peptide, polypeptide or enzyme that is assayed readily by enzymic or immunological means, for example the Pgalactosidase, 0-glucuronidase, luciferase or chloramphenicol acetyltransferase (CAT) genes.

Alternatively, the reporter gene may be a gene which encodes an immunologically-detectable protein, for example a FLAG peptide, poly-lysine peptide or poly-histidine peptide.

Standard methods are used to assay the expression of the reporter gene.

This embodiment of the invention may be applied directly to the identification of potential insecticidally-active compounds or alternatively, modified for such purposes by assaying for the binding (direct or indirect) of the recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE), WO 01/02436 PCT/AU00/00799 -51rather than by assaying for reporter gene expression. According to this alternative embodiment, the binding assayed in the presence or absence of a potential insecticidally-active compound is compared, wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.

In addition, substances may be screened for insecticidal activity by assessing their ability to bind, in vivo or in vitro, to the intact ecdysone receptor or alternatively, the ligand-binding regions of the EcR polypeptide subunit of the ecdysone receptor (eg. SEQ ID NO: 2 or SEQ ID NO: 10 or SEQ ID NO: 14) or the EcR partner protein USP polypeptide) of the ecdysone receptor (eg. SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20 or SEQ ID NO: 22 or SEQ ID NO: 38 or SEQ ID NO: 40 or SEQ ID NO: 42). Competition assays involving the native insect steroid may be employed to assess insecticidal activity.

The performance of this embodiment may, for example, involve binding the insect steroid receptor polypeptide to a support such as a plurality of polymeric pins, whereafter the polypeptide resident on the plurality of pins is brought into contact with candidate insecticidal molecules for screening. The molecules being screened may be isotopically labelled so as to permit ready detection of binding. Alternatively, reporter molecules may be utilized which bind to the insect steroid receptor candidate molecule complex. Alternatively, compounds for screening may be bound to a solid support, such as a plurality of pins which are then reacted with the thermostable insect steroid receptor or complex with a partner protein. Binding may, for example, be determined again by isotopic-labelling of the receptor, or by antibody detection or use of another reporting agent.

In an alternative embodiment, insecticidally-active agent are identified using rational drug design, by expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex, determining the three-dimensional structure of the ligand binding domain of the complex, and identifying compounds which bind WO 01/02436 PCT/AU00/00799 -52to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

The methods described herein for identifying modulators of gene expression and insecticidal compounds, may be performed using prokaryotic or eukaryotic cells, cell lysates or aqueous solutions.

A further aspect of this invention accordingly relates to.synthetic compounds derived from the three dimensional structure of EcR polypeptides or EcR partner protein (USP polypeptide) subunits of insect steroid receptors, or fragments thereof, or insect steroid receptors or fragments thereof, or USP polypeptides of insect juvenile hormone receptors or fragments thereof, which compounds are capable of binding to said receptors which have the effects of either inactivating the receptors (and thus acting as antagonists) or potentiating the activity of the receptor.

By "derived from" it is meant that the compounds are based on the three dimensional structure of the aforementioned proteins, that is, synthesized to bind, associate or interfere with insect steroid binding or juvenile hormone binding.

The compounds may bind strongly or irreversibly to the:ligand binding site or another region of the receptor or USP and act as agonists or antagonists of insect steroids, or juvenile hormone binding, or otherwise interfere with the binding of ligand, such that ecdysteroids or juvenile hormones. Such compounds would have potent insecticidal activity given the key role of insect steroids, or juvenile hormone, in insect physiology and biochemistry. Such compounds would also possess a unique specificity.

This invention is also described with reference to the following non-limiting examples.

WO 01/02436 PCT/AU00/00799 -53- EXAMPLE 1 Construction of a plasmid (pSV40-EcR) expressing the EcR polypeptide subunit of the D. melanogasterecdysone receptor A 3110 base-pair Fspl-Hindlll fragment was excised from a cDNA encoding the EcR polypeptide subunit of the D. melanogasterecdysone receptor (Koelle et al.,1991), the excised sequence comprising the complete 2634 base pair coding region and 214 base pairs of leader sequence and 258 base pairs of untranslated sequence. The fragment was ligated into the BamHI site of the expression plasmid pSG5 (Greene et al, 1988) to produce the expression plasmid pSV40-EcR, wherein expression of the EcR polypeptide subunit of the Drosophila melanogasterecdysone receptor is placed operably under the control of the promoter sequence.

EXAMPLE 2 Construction of the reporter plasmid p(EcRE),-CAT The reporter plasmid p(EcRE)7-CAT was constructed by insertion of multiple copies 5 to 7 copies) of the hsp27 ecdysone response element, containing a central 13 base pair palindromic ecdysone response element (EcRE), derived from the hsp27 gene (Riddihough and Pelham, 1987) into the Hindlll site of the plasmid pMMTV-CAT (Hollenberg and Evans, 1988), 93 base pairs upstream of the transcription start site of the MMTV promoter, thereby operably connecting expression of the chloramphenicol.acetyltransferase structural gene to regulation by an insect receptor which binds to the hsp27'ecdysone response element.

EXAMPLE 3 Cell Culture and Transient Transfection Chinese hamster ovary (CHO) cells were maintained in 50% Dubbecco's modified Eagle's medium (DMEM) and 50% Hamm F12 nutrient mixture (GIBCO) supplemented with foetal bovine serum. Transfection was carried out by the DNA-calcium phosphate coprecipitation method (Ausubel et al, 1992). One day before transfection with the plasmids described in Examples 1 and/or 2 or other expression plasmids, CHO cells were plated out at 5 8 x 105 cells per 6 cm diameter culture dish in the above DMEM/F12 medium. Three WO 01/02436 PCT/AU00/00799 -54hours before the addition of the DNA-calcium phosphate co-precipitate, the cells were washed with phosphate buffered saline (PBS; Sambrook et 1989) and cultured in fresh DMEM plus foetal bovine serum. The cells were incubated in the presence of the co-precipitate for eighteen hours before excess DNA was removed by washing with PBS. The cells were then cultured for another day in DMEM/F12 supplemented with 10% foetal bovine serum with or without added ponasterone A (PNA), before harvesting. Cells were washed with PBS, harvested by mechanical scraping in 0.25 M Tris-HCI (pH and disrupted by three freezethaw cycles.

All transfections included, in addition to expression and reporter plasmids, a P-galactosidaseexpressing plasmid designated pPgK-LacZ (McBumey et al, 1991), which served as an internal control for the efficiency of transfection, and pUC18 DNA in an amount sufficient to produce pg total DNA per culture dish.

The chloramphenicol acetyltransferase (CAT) and P-galactosidase activities encoded by the reporter genes present in the reporter plasmids were assayed as described in Sambrook et al, (1989). Cells that were co-transfected with p(EcRE) 7 -CAT and pSV40-EcR clearly showed induction of CAT activity in the presence of PNA, showing 50 units of activity. Controls showed negligible activity.

We have observed that the ecdysone receptor can lead to stimulation of expression from an ecdysone responsive promoter in some cell types, for example in CHO cells, but not in CV-1 cells. Whilst not being bound by any theory or mode of action, this may reflect a cell-type specific distribution of at least one other transcription factor essential for ecdysone responsiveness. To determine cell types suitable for expressing reporter genes under the control of the steroid receptor of the present invention, the cell-type specificity of ecdysoneresponsive gene expression is assayed in cell-free transcription lysates derived from several target cell lines. Additionally, by fractionating or isolating the nuclear proteins of cell lines that express the reporter genes and supplementing lysates derived from non-expressing cell lines with such nuclear protein fractions or isolated proteins, any essential auxiliary factors are defined and the genes encoding them cloned. Co-transfection of the receptor-encoding genes WO 01/02436 PCT/AU00/00799 with genes encoding such auxiliary factors removes limitations imposed by cell-type restricted ecdysone responsiveness.

EXAMPLE 4 Testing the Effect of temperature on transient expression To determine whether the D. melanogaster ecdysone receptor polypeptide is stable at physiological temperatures above about 30 0 C, CHO cells were transfected as described in Example 3, with the plasmid pSV40-EcR and the reporter.plasmid p(EcRE),-CAT in the presence of PNA, at 30 0 C and 37 0

C.

Briefly, CHO cells were plated out at 37°C sixteen to twenty hours before transfection. After washing away the DNA, the cells were cultured for two hours in fresh medium with or without hormone and the dishes divided into duplicate sets. One set was cultured for another day at 37 0 C before harvesting for CAT and 1-galactosidase assays. The other set was cultured for three days at 30°C before assaying enzyme activities. Results indicated a reduction in the foldinduction of gene expression regulated by the D. melanogasterecdysone receptor polypeptide at 37°C, compared to the fold-induction at 30°C, as shown in Table 1.

EXAMPLE Attempted screening of an L. cuprina genomic DNA library to isolate genes encoding the EcR polypeptide subunit of the L. cuprina ecdysone receptor A 627 bp Eco Kpn I fragment encompassing the DNA-binding domain of the EcR polypeptide subunit of the D. melanogaster ecdysone receptor was isolated, radioactively labelled and used to screen a L. cuprina genomic library constructed in bacteriophage lambda (prepared by CSIRO, division of Entomology, Canberra, Australia). In the first round of screening, twenty-four regions of the plates showed potential positive hybridization to the D. melanogaster probe.

However, second-round screening of these 24 first round positive plaques failed to yield any plaque giving a reproducible positive signal when hybridized to the D. melanogaster probe.

WO 01/02436 PCT/AU00/00799 -56- TABLE 1 PNA Fold-induction of (pg/dish) (pM) expression 37 0 C 20 14X 100 59X 54X 20 8X 26X 100 47X 33X 0.1 20 1.6X 100 9.0X 39X EXAMPLE 6 Cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the L. cuprina ecdysone receptor Rationale for amplification primer design The nucleotide sequences of the primers Rdna3 (SEQ ID NO: 23) and Rdna4 (SEQ ID NO: 24) were derived from the amino acid sequence conserved between the DNA-binding domains of the EcR polypeptide subunits of the D. melanogaster and C. tentans ecdysone receptors.

However, amino acid sequences homologous to two other members of the steroid receptor superfamily of D. melanogaster, Drosophila.hormone receptor 3 (DHR3; Koelle, et al., 1991) and Drosophila early gene (E75; Segraves.and Hogness, 1990) were excluded from the primer designs, to reduce the possibility of amplifying the L. cuprina homologues of genes encoding DHR3 or E75 by PCR.

Amplification primers and PCR conditions A 105 base pair DNA fragment, encoding the DNA-binding domain of the EcR polypeptide subunit of the L. cuprina ecdysone receptor, was amplified from the L. cuprina genome by PCR, by using the following degenerate primers: Rdna3 (32mer with EcoRI site): 3' SEQ ID NO: 23); WO 01/02436 PCT/AU00/00799 -57and Rdna4 (32mer with BamHI site): 3' SEQ ID NO: 24).

Amplification reactions employed Taql DNA polymerase (Promega) and the following amplification conditions: cycle 1: 97 0 C/5 minutes, 50 0 C hold; add polymerase 50°C/5 minutes; cycles 2-3: 72 0 C/3 minutes, 94 0 C/1 minute, 50°C/1 minute; cycles 4-43: 72 0 C/3 minutes, 94C//1 :minute, 55°C/1 minute; cycle 44: 72 0 C/10 minutes.

To facilitate cloning of the amplified fragments for use as hybridisation probes, the 5' end of primer Rdna3 contained an EcoRI site and the 5' end of primer Rdna4 contained a BamHI site.

The amplified L. cuprina gene fragments were cloned into pBluescript SK+, following digestion using the enzymes EcoRI and BamHI, purification of the digested DNA by agarose gel electrophoresis and electro elution of the product band.

Hybridisation probe preparation For probe preparation, the insert was cut out of the pBluescript SK+ vector using EcoR1 and BamHI, and 3 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Adelaide, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the specific primers Rdna3 and Rdna4 (see above). Unincorporated label was removed by size exclusion' chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations.

Construction and screening of L. cuprina cDNA libraries Two independent L. cuprina cDNA libraries derived from late third instar L. cuprina larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/ZaplI vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols.

WO 01/02436 PCT/AU00/00799 -58- Both cDNA libraries generated are superior to existing L. cuprina libraries in terms of their phage titre pfu/ml) and insert sizes (0.5 4 kbp in both cases). In particular, the primary oligo-dT primed library comprised 4.7 x 106 pfu, whilst the amplified oligo-dT primed library comprised 7.5 x 1010 pfu/ml; the primary random-primed library comprised 1.3 x 106 pfu, whilst the amplified random-primed library comprised 3.4 x 1010 pfu/ml.

The prepared cDNA libraries were screened by lifting 500,000 plaques from each library in duplicate on to Hybond N membranes (Amersham) and hybridizing same under low stringency conditions to the 32 P-labelled amplification product produced using the primers Rdna3 and Rdna4 (see above). In particular, hybridisations were performed for twenty four hours at 37°C in a hybridisation solution comprising 42% formamide; 5 x SSPE solution; 5 x Denhardt's solution; and 0.1% sodium dodecyl sulphate, as described essentially by Ausubel et al, (1992) or Sambrook et al. (1989). The membranes were then washed at 37 0 C in 2XSSC solution containing 0.1% sodium dodecyl sulphate. Following washing, positive plaques were detected by autoradiography, using XOMAT-AR film (Kodak) for two to three days, at 700C.

Two positive-hybridising plaques were obtained from screening of the random-primed library (containing cDNA inserts comprising 561 base pairs and 1600 base pairs in length, respectively), and one positive-hybridising plaque wasobtained from the screening of the oligodT primed library (containing a cDNA insert comprising:approximately 3400 base pairs in length). pBluescript phagemids containing cDNA inserts were excised in vivo from these positive plaques using the Exassist Helper Phage system (Stratagene).

The nucleotide sequences of the isolated cDNA clones were obtained using the USB Sequenase Version 2.5 Kit. Sequence data obtained indicated that the 561 bp and 1600 bp cDNAs encode amino acid sequences comprising the important DNA-binding domain and the hormone-binding domain of the EcR polypeptide subunit of the L. cuprina ecdysone receptor, whilst the 3400 bp cDNA comprises an entire 2274 bp open reading frame encoding the EcR polypeptide subunit of the L. cuprina ecdysone receptor. Accordingly, the 3400 bp cDNA is a full-length cDNA clone. The nucleotide sequence of the open reading frame and 3'- WO 01/02436 PCT/AU00/00799 -59untranslated region is set forth herein as SEQ ID NO: 1. The derived amino acid sequence of the EcR polypeptide subunit of the L. cuprina ecdysone receptor encoded by this open reading frame is set out in SEQ ID NO: 2.

EXAMPLE 7 First attempt at cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the M. persicae ecdysone receptor Direct screening of a M. persicae cDNA library was not effective in isolating a full-length cDNA encoding the EcR polypeptide of the M. persicae ecdysone receptor.

DNA encoding the DNA-binding domain of the EcR polypeptide of the M. persicae ecdysone receptor was isolated successfully, by amplification as described in Example 6 for the amplification of the homologous L. cuprina fragment. The amplified DNA was cloned into pBluescript SK+ and the nucleotide sequence of the cloned insert was obtained using the USB Sequenase version 2.0 Kit, as described in Example 6.

Based upon the nucleotide sequence of the amplified DNA fragment, two authentic primers were synthesized as follows: Mdnal (23mer): GCCTCGGGGTATCACTATAACGC SEQ ID NO: 25); and Mdna2 (23mer): GCACTCCTGACACTTTCGTCTCA SEQ ID NO: 26).

Hybridisation probe preparation For M. persicae probe preparation, the amplified 105 bp DNA insert was excised from the pBluescript SK+ vector using EcoRI and BamHI, and UP-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Adelaide, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the specific primers Mdnal and Mdna2 (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations.

WO 01/02436 PCT/AU00/00799 Construction and screening of M. persicae cDNA libraries: Two independent M. persicae cDNA libraries derived from late third instar M. persicae larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/Zapll vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols.

Both cDNA libraries generated are superior to existing M. persicae libraries in terms of their phage titre pfu/ml) and insert sizes (0.5 4 kbp in both cases). In particular, the primary oligo-dT-primed library comprised 1 x 10 7 pfu, whilst the amplified oligo-dT primed library comprised 1 x 1010 pfu/ml; the primary random-primed library comprised 1 x 106 pfu, whilst the amplified random-primed library comprised 2 x 1011 pfu/ml.

Additionally, a further cDNA library was produced in the Lambda ZAP Express insertion vector (Stratagene). To produce this library, cDNA derived from late third instar M. persicae larvae was prepared by oligo-dT priming and cloned directionally into EcoRI-Xhol digested vector DNA.

The primary library comprised 1 x 106 pfu, whilst the amplified oligo-dT primed library comprised 1 x 109 pfulml, with insert sizes in the range 0.5 >4 kbp.

The random-primed M. persicae cDNA phage library was screened as described in Example 6, using the M. persicae hybridisation probe prepared as described above.

A single positive-hybridising plaque was isolated and sequenced according to standard procedures. The nucleotide sequence of this clone is set forth herein as SEQ ID NO: 9. This cDNA clone comprises a 585bp protein-encoding sequence which encodes the DNA-binding domain of a EcR polypeptide of a putative M. persicae ecdysone receptor. The amino acid sequence encoded by this partial cDNA clone is set forth herein as SEQ ID NO: 6.

WO 01/02436 PCT/AU00/00799 -61- EXAMPLE 8 Second attempt at cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the M. persicae ecdysone receptor Hybridisation probe preparation Further hybridisation probes specific for the EcR polypeptide of the M. persicae ecdysone receptor were generated using PCR from the Lambda ZAPII oligo dT-primed library using primers AP1 and AP2. The forward primer AP1 was designed to anneal to nucleotide sequences of the partial cDNA (SEQ ID NO: 9) encoding part of the first zinc finger motif present in the DNA-binding domain. The reverse primer, AP2, was adapted from degenerate primers designed to anneal to nucleotide sequences complementary to those encoding an EcR ligand binding domain (Kamimura et al., 1996). The nucleotide sequences of primers AP1 and AP2 are as follows: Primer AP1: TCGTCCGGTTACCATTACAACGC (SEQ ID NO: 27); and Primer AP2: TAGACCTTTGGC(A/G)AA(CIT)TC(A/G/ClT)ACAAT -3'(SEQ ID NO: 28) The PCR reaction mixture contained 4 pl of each primer (50 pm/pl), 5 pl of deoxynucleotide triphosphate mix (2mM), 1 ul of aphid oligo dT primed Lambda ZAPII cDNA library, 1 pl of recombinant Pfu DNA Polymerase (5 units/pl, Stratagene®), 5 pl of 10x Pfu buffer (Stratagene®) and 30 pl of MilliQ water. The Pfu polymerase was used in this reaction because it possesses proof-reading activity, which reduces the possibility of misincorporation of nucleotides. The PCR conditions included 42 cycles, each cycle comprising annealing at extension at 72 0 C and melting at 94 0

C.

The major amplification product obtained in this reaction was gel-purified, kinased and ligated into the Smal site of pUC18.

To screen M. persicae cDNA libraries, the cloned amplification product was digested to generate two non-overlapping probes, designated "EcR probe 1" SEQ ID NO: 11) and "EcR probe 2" SEQ ID NO: 12). In this regard, digestion of the cloned product with Sphl produced a DNA fragment comprising a nucleotide sequence specific for a region encoding the WO 01/02436 PCT/AU00/00799 -62- DNA-binding domain (EcR probe 1; SEQ ID NO: 11), whilst digestion with SphVEcoRl produced a DNA fragment comprising a nucleotide sequence having homology to a region encoding a putative linker domain, designated domain D, and the 5'-end of a putative hormone-binding domain, present in the EcR polypeptide of the insect ecdysone receptors (EcR probe 2, SEQ ID NO: 12).

EcR probe 1 and EcR probe 2 were labelled with [a- 32 P]dATP in a reaction catalysed by Klenow fragment. All reagents were components of a GIGAprime DNA labelling kit (BresaGen Limited, Adelaide, Australia), except that the random primers were replaced with specific oligonucleotides synthetisezed to be complementary to the ends of EcR probe 1 and EcR probe 2.

Screening of M. persicae cDNA libraries 480,000 plaques from the oligo dT primed Lambda Zap Express cDNA library (Example 7) were screened as described above, using EcR probe 1. This approach yielded about 300 positive clones. Positive-hybridising clones were pooled and rescreened separately using EcR probe 1 and EcR probe 2, on duplicate lifts. Only four plaques were identified which hybridised to both probes. One of these was found by sequencing to contain a full-length cDNA encoding the EcR polypeptide of the M. persicae.ecdysone receptor. The nucleotide sequence of the open reading frame of this cDNA is set forth herein as SEQ ID NO: 9. The derived amino acid sequence of the EcR polypeptide subunit of the M. persicae ecdysone receptor encoded by this open reading frame is set out in SEQ ID NO: EXAMPLE 9 In vivo function of recombinant EcR polypeptides of the L. cuprina ecdysone receptor Construction of plasmid oF3 Plasmid pF3 was constructed in four steps as follows: First, plasmid p5S1, comprising the full-length cDNA encoding the EcR polypeptide of the L.

cuprina ecdysone receptor was digested with Earl and a 3' Ea/i cDNA fragment thus WO 01/02436 PCT/AU00/00799 -63generated, encoding the C-terminal end of the EcR polypeptide of the L. cuprina ecdysone receptor, was end-filled and sub-cloned into the Hindll site of pUC19, to construct plasmid pEAR. In plasmid pEAR, the 3' end of the cDNA was oriented towards the Kpnl site of the pUC19 vector.

Second, plasmid p5S1 was also digested separately with: Apol and Psfl, to isolate the 5' end of the cDNA as a 179 bp fragment (fragment A); Pstl and Spel, to isolate a 1650 bp:cDNA.fragment (fragment B);.and Spel and Bg/ll, to isolate a 203 bp fragment (fragment C).

Third, plasmid pEAR was digested with Bg/ll and Kpnl, to isolate the 3' end of the cloned cDNA fragment therein as a 313 bp fragment (fragment D).

Fourth, DNA fragments A, B, C and D were each isolated by agarose electrophoresis and ligated together into pBluescriptSK+, which had been digested with EcoRI and Kpnl, to produce plasmid pF3.

Plasmid pF3 thus contains the complete open reading frame of the cDNA encoding the EcR polypeptide of the L. cuprina ecdysone receptor, as a 2368 bp fragment located between two BamHI sites.

Construction of plasmid pSGLcEcR and plasmid pLcK8 Plasmid pSGLcEcR was constructed by cloning the 2368 bp BamHI fragment from pF3, into the BamHI site of the mammalian expression vector pSG5 (Stratagene). Plasmid pLcK8 is a clone of pSGLcEcR.

Construction of plasmid pSGDmEcR Plasmid pSGDmEcR is identical to plasmid pSV40-EcR (Example 1) comprising the EcR polypeptide of the D. melanogaster ecdysone receptor placed operably under control of the SV40 promoter.

WO 01/02436 PCT/AU00/00799 -64- Transfection of CHO cells CHO cells were co-transfected with a mixture comprising the following DNAs, lysed and assayed for CAT and -galactosidase enzyme activity, as described in the preceding Examples: one of the expression plasmids designated pSGDmEcR, or pSGLcEcR, or the parental expression plasmid pSG5 as a negative control, at a concentration of 1 pg/ml; and the CAT reporter plasmid p(EcRE) 7 -CAT at a concentration of 1 pg/ml; and an independent LacZ reporter plasmid, pPGKLacZ, at a concentration of lug/ml, included as a control to monitor transfection efficiency.

CAT reporter gene expression was induced with 10 pM or 50 pM Muristerone A. In control samples, cells received only the carrier ethanol in place of Muristerone A.

ELISA was used to quantify the synthesis of CAT and P-galactosidase enzymes, in extracts of cells forty eight hours after transfection. Account was taken of the variation between experiments, by normalizing the level of CAT enzyme to the level of P-galactosidase enzyme present in the same extract. Fold induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone divided by the normalized values for CAT gene expression in cells transfected with the same plasmid but in the absence of hormone. The average values of three independent .experiments are shown in Figure 1 and the error bars indicate standard error of the mean.

Data shown in Figure 1 indicate that the EcR polypeptide of the L. cuprina ecdysone receptor from Example 3 is biologically active in vivo. CAT induction is observed at both 50 pM and pm steroid (Muristerone with about 30 and 15 fold induction respectively. In view of the in vivo activity of the EcR polypeptide of the L. cupnna ecdysone receptor obtained according to this protocol, potential insecticidal substances acting by interaction with an insect steroid receptor, such as an ecdysone receptor, are screened by addition of the substances to the in vivo assay described herein. Substances are added in an amount from 0.05 pM to 100 pM.

Candidate insecticidal compounds are identified by their ability to modulate the reporter gene expression which results from trans-activation by the EcR polypeptide of the L. cuprina ecdysone receptor.

WO 01/02436 PCT/AU00/00799 EXAMPLE Chimeric EcR polypeptides of insect ecdysone receptors Chimeric ecdysone receptors comprsing regions derived from EcR polypeptides of ecdysone receptors of different species are produced and assayed for enhanced activity. In a particularly preferred embodiment, a chimeric ecdysone receptor is produced using the EcR polypeptides of the D. melanogaster, M. persicae and L. cuprina ecdysone receptors.

In one exemplification of this embodiment, plasmids pSGLD and pSGDL are produced comprising coding regions derived from the EcR.polypeptides of the D. melanogaster and L.

cuprina ecdysone receptors. In plasmid pSGLD, the 5'-end of the open reading frame of the D. melanogastersequence, encoding the N-terminal portion of the EcR polypeptide of the D.

melanogaster ecdysone receptor to the end of the DNA-binding domain of said polypeptide, is fused to the 3'-end of the open reading frame of the L. cuprina sequence, encoding the Cterminal portion of the EcR polypeptide of the L. cuprina ecdysone receptor, from the D domain and hormone-binding domain to the carboxyl terminus. In plasmid pSGDL, the 5'-end of the open reading frame of the L. cuprina sequence, encoding the N-terminal portion of the EcR polypeptide of the L. cuprina ecdysone receptor to the end of the DNA-binding domain of said polypeptide, is fused to the 3'-end of the open reading frame of the D. melanogastersequence, encoding the C-terminal portion of the EcR polypeptide of the D. melanogaster ecdysone receptor, from the D domain and hormone-binding domain to the carboxyl terminus. These plasmids thus encode chimeric EcR polypeptides which form ecdysone receptor variants.

As shown in Figure 2, chimeric EcR polypeptides of L. cuprina and D. melanogasterecdysone receptors, comprising fusion polypeptides between the DNA-binding domains and hormonebinding domains of the base L. cuprina and D. melanogaster polypeptides, exhibit bioactivity when measured in the CAT assay described above. Significant bioactivity of the chimeric EcR polypeptides encoded by plasmids pSGLD and pSGDL, comparable to the bioactivity of the D.

melanogaster base EcR polypeptide, is observed at both 10 pM and 50 pM concentrations of Muristerone A.

WO 01/02436 PCT/AU00/00799 -66- EXAMPLE 11 Isolation and characterisation of a full-length cDNA encoding the EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor The EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone.receptor also functions alone as a USP polypeptide of the L. cuprina juvenile hormone receptor. A cDNA encoding both receptor polypeptide activities was isolated using PCR and hybridisation as follows.

Hybridisation probe preparation A 150 base-pair probe, specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of insect ecdysone receptors or the USP polypeptide subunit of insect juvenile hormone receptors (SEQ ID NO: 21), was isolated by PCR from L. cuprina genomic DNA using the degenerate primers described by Tzertzinis et al. (1994). The PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of TaqI polymerase.

The amplified DNA fragment was sub-cloned into EcoRI and Clal double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and Clal, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band. The nucleotide sequence of the probe was obtained using the USB Sequenase version 2.0 Kit SEQ ID NO: 21).

For probe preparation, the amplified L. cuprina DNA fragment was excised from the vector using EcoRI and Sa/l, gel purified and 32 P-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Adelaide, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the two degenerate primers described by Tzertzinis et al. (1994) (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 10 6 cpm/ml in hybridizations.

Screening of L. cuorina cDNA libraries WO 01/02436 PCT/AU00/00799 -67- The L. cuprina cDNA library described above (Example 6) was screened with the amplified probe as described in Example 6. From one positive plaque, we derived plasmid pLSP4 containing a 3800 bp insert. Sequencing revealed that the 5' portion of pLSP4 encodes the EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor, followed by a long (2.4 kb), apparently untranslated region (UTR). A 2453 bp EcoRI fragment of plasmid pLSP4 was isolated and sub-cloned into pBluescript SK+ (Stratagene), to construct plasmid pBLU1, which contains the full-length cDNA sequence. The nucleotide sequence of the full-length cDNA present in pBLU1 and the amino acid sequence encoded therefor, are set forth herein as SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

The open reading frame (ORF) of SEQ ID NO: 3 encodes a polypeptide comprising 467 amino acids in length. The ATG start codon is located within a very favourable translational start context 5'-GAAAATG-3') having 75% identity to the consensus sequence C/AAAAATG for D. melanogaster mRNA sequences (Cavener et al., 1987). Moreover, the derived amino acid sequence of the L. cuprina EcR partner protein (USP polypeptide) comprises domains A/B, C, D, and E/F that are characteristic of nuclear hormone receptors (Evans, 1988; Forman and Samuels, 1990).

The nucleotide sequences of the untranslated region and coding region of the cDNA contained in plasmid pLSP5, and the amino acid sequence encoded therefor, are set forth herein as SEQ ID NO: 5 and SEQ ID NO:.6, respectively. The nucleotide sequences of the untranslated region and coding region of the cDNA contained in plasmid pLSP12, and the amino acid sequence encoded therefor, are set forth herein as SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

Nucleotide sequence analyses revealed differences in the untranslated regions of pLSP4, and pLSP12, however the coding regions appeared to be identical, suggesting a possible splice variation. This conclusion is supported by the fact that the cDNAs of pLSP4, and pLSP12 contained identical nucleotide sequences within their untranslated regions, however differed by the addition/deletion of sequences. In particular, the 13 nucleotides of all three cDNA clones were identical, as was the nucleotide sequence WO 01/02436 PCT/AU00/00799 -68surrounding the translation start codon 5'-AAAATG-3'). Clone pLSP5 (SEQ ID NO: differed from clone pLSP 4 (SEQ ID NO: 3) in so far as it included an additional 176 bp of untranslated sequence inserted between nucleotides 13 and 14 of pLSP4. Clone pLSP12 (SEQ ID NO: 7) also differed from pLSP4 (SEQ ID NO: 3) in so far as it included an additional 116 bp of untranslated sequence inserted between nucleotides 13 and 14 of pLSP4. Clones (SEQ ID NO: 5) and pLSP12 (SEQ ID NO: 7) differed in so far as pLSP5 included an additional 60 bp of untranslated sequence inserted between nucleotides 13 and 14 of pLSP12.

The ATG start codons of both clones pLSP5 and pLSP12 are within translational start context sequences 5'-CAAAATG-3') having absolute identity to the consensus sequence C/AAAAATG for D. melanogaster mRNA sequences (Cavener et al., 1987).

EXAMPLE 12 Isolation and characterisation of a partial cDNA encoding the EcR partner protein (USP polypeptide)of the M. persicae ecdysone receptor The EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor also functions alone as a USP polypeptide of the M. persicae juvenile hormone receptor. To isolate a partial cDNA encoding both receptor polypeptide activities, a 140 bp probe was amplified from M. persicae genomic DNA, by PCR, using the two degenerate primers described by Tzertzinis et aL.(1994) (see preceding Example). The PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of Taql polymerase.

The amplified DNA fragment was sub-cloned into EcoRI and Clal double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and Clal, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band.

The nucleotide sequence of the insert in the pBluescript SK+ vector was obtained using automated fluorescent dye terminator sequencing (SUPAMAC, Sydney Australia).

WO 01/02436 PCT/AU00/00799 -69- Hybridisation probe preparation and library screening For probe preparation the amplified M. persicae DNA insert was cut out of the pBluescript+ vector with EcoRI and Sa/l, gel purified and 32 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Adelaide, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the degenerate primers described byTzertzinis et a.(1994) (see preceding Example). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations to screen the M. persicae cDNA library as described in Examples 7 and 8.

The positive-hybridising clones were plaque-purified and sequenced using standard procedures as described herein. The nucleotide sequence of the open reading frame of the full-length cDNA encoding the partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor or the USP polypeptide of the M. persicae juvenile hormone receptor is set forth herein as SEQ ID NO: 15. The derived amino acid sequence of this open reading frame is set forth as SEQ ID NO: 16.

EXAMPLE 13 A construct for the baculovirus-directed co-expression of functional ligand-binding regions of the EcR polypeptide:and partner protein (USP polypeptide) of the D.

melanogaster ecdysone receptor A vector was prepared to facilitate the baculovirus-directed co- expression of ligand-binding regions derived from the EcR polypeptide and partner protein (USP polypeptide) of the D.

melanogasterecdysone receptor, the protein products of which associate on co-expression to form a functional hormone-binding complex. The associated proteins are then used in high through-put assays or three-dimensional structural analysis. We have found that the ligandbinding domain, together with most of the linker domain of the EcR polypeptide subunit and of the EcR partner protein (USP polypeptide), are sufficient to associate to form a functional hormone-binding complex.

WO 01/02436 PCT/AU00/00799 1. Isolation of the ligand-bindina region of the EcR polypeptide of the D. melanoaaster ecdvsone receptor.

A Sac I- Hindill fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the Drosophila melanogasterecdysone receptor was excised from a plasmid comprising DNA encoding the complete EcR polypeptide (Koelle et a. 1991). The excised fragment was cloned into Sad Hindlll-digested expression vector pQE31 (Qiagen), to produce the plasmid vector pQE31 DmECR.

2. Construction of a baculovirus expressing the ligand-bindina regions of EcR and USP polypeptides A baculovirus was constructed for the co-expression in insect cells of: a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the D.

melanogaster ecdysone receptor isolated as described at paragraph above; and (ii) a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the D. melanogaster ecdysone receptor.

To produce this baculovirus, a EcoR I Hindlll fragment was excised from pQE31DmECR, said fragment encoding an oligo-His tag, and most of the linker domain, together with all of the ligand-binding domain of EcR polypeptide. This EcoR I Hindll fragment was ligated into EcoR I Hindill cleaved pFastBacDUAL, to produce the plasmid pDmEcR.DUAL. To insert gene sequences specific for the partner protein (USP polypeptide), the Hindll Nsil fragment encoding most of the linker and all of the ligand-binding domain of the partner protein (USP polypeptide) was excised from a full-length cDNA clone in plasmid pZ7-1 (supplied by Vince Henrich) and ligated into Ncol Nsil cleaved pDmEcR.DUAL. A nucleotide sequence encoding a "FLAG" peptide was subsequently incorporated upstream of, and in the same reading frame as, the nucleotide sequence encoding ligand-binding region of the partner protein (USP polypeptide), by ligation into the unique Smal site, thereby producing the plasmid pDmEcR.USP.DUAL. Plasmids containing the FLAG-encoding nucleotide sequence in the correct orientation were selected by nucleotide sequence determination.

WO 01/02436 PCT/AU00/00799 -71- The segment of pDmEcR.USP.DUAL which encodes the tagged ligand-binding region of the EcR polypeptide and partner protein (USP polypeptide) sequences, placed operably under the control of polyhedrin and p10 promoters, respectively, was recombined into a baculovirus genome, by employing the Tn7 transposition system (Luckow et al, (1993). The polypeptide products were then co-expressed in insect Sf21 and Sf9 cells, where they associated into a functional complex.

Expression of the tagged ligand-binding.regions of the EcR polypeptide and partner protein (USP polypeptide) sequences was examined by immunoblot analysis of extracts derived from insect Sf21 cells infected with the recombinant baculovirus, employing antibodies directed against the oligo-His and FLAG tags. This analysis detected bands on immunoblot analysis of approximately the predicted sizes for the expressed tagged ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide).

The protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak). It was further demonstrated that the oligo-His-tagged EcR polypeptide and the FLAG-tagged EcR partner protein (USP polypeptide) bound as a hetero-oligomeric complex to FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, performed using a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the a labelled ecdysone analogue, 3 H] ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos.

In contrast, cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of 3 H] ponasterone A, above background levels. These data indicate correct folding and association of the variant polypeptides comprising the ligandbinding regions of the D. melanogaster EcR polypeptide and D. melanogaster partner protein (USP polypeptide). The correctly-folded and associated complex formed by the truncated EcR polypeptide and truncated EcR partner protein (USP polypeptide), is used for X-ray and NMR structural analysis and for high-throughput screens.

WO 01/02436 PCT/AU00/00799 -72- EXAMPLE 14 Construct for the baculovirus-directed co-expression of functional ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) of the L.

cuprina ecdysone receptor A vector for the baculovirus-directed co- expression of ligand-binding domains derived from the EcR polypeptide and partner protein (USP polypeptide) of the L. cuprina ecdysone receptor was prepared essentially as described in the preceding Example.

1. Isolation of the ligand-binding region of the EcR polypeptide of the L. cuprina ecdysone receptor.

A Sphl Kpnl fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the L. cuprina ecdysone receptor was excised from a cDNA clone encoding the complete EcR polypeptide and cloned into the Sphl Kpnl cleaved expression vector pQE32 (Qiagen), to produce the plasmid pQE32LcEcR.

2. Isolation of the ligand-bindina region of the partner protein (USP polvpeptide) of the L.

cuprina ecdysone receptor.

A DNA fragment encoding most of the linker domain and all of the ligand-binding domain of the partner protein (USP polypeptide) of the L. cuprina ecdysone receptor was sub-cloned to produce the plasmid pBLU1.

3. Construction of a baculovirus expressing the ligand-binding regions of L. cuprina EcR and USP polvpeDtides A baculovirus was constructed for the co-expression in insect cells of: a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the L.

cuprina ecdysone receptor isolated as described at paragraph above; and (ii) a cDNA region comprising a nucleotide sequence which encodes at least the WO 01/02436 PCT/AU00/00799 73 ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the L. cupnna ecdysone receptor isolated as described at paragraph (2) above.

To produce this baculovirus, a EcoR I Pstl fragment derived from plasmid pQE32LcEcR, encoding an oligo-His tag and most of the linker domain together with all of the ligand-binding domain of the L. cuprina EcR polypeptide was ligated into EcoRI- Pstl cleaved pFastBac.DUAL, to produce the plasmid.pLcEcR.DUAL. An Avall-EcoRV fragment, encoding most of the linker and all of the ligand-binding domain of L. cuprina partner protein (USP polypeptide) was excised from plasmid pBLU1 and ligated, together with a "FLAG" encoding sequence into the Pvull site of pLcEcR.DUAL, to produce plasmid pLcEcR.USP.DUAL.

The segment of pLcEcR.USP.DUAL which encodes the tagged ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) sequences, placed operably under the control of polyhedrin and p10 promoters, respectively, was recombined into a baculovirus genome, by employing the Tn7 transposition system (Luckow et al, (1993). The polypeptide products were then co-expressed in insect Sf21 and Sf9 cells, where they associated into a functional complex.

Expression was examined by immunoblot analysis. Antibodies directed against oligo-His and FLAG tags detected bands on immunoblot analysis of approximately the predicted sizes for the expressed EcR and USP polypeptide regions respectively, in extracts from insect Sf21 cells infected with the recombinant baculovirus. The protein detected by anti-oligo-His was greatly enriched utilising a nickel-NTA resin (Qiagen) and the FLAG-labelled protein purified on FLAG M2 Affinity Gel (Kodak). It was also demonstrated by immunoblot analysis that oligo-His-tagged L. cuprina truncated EcR polypeptides and FLAG-tagged L. cuprina truncated EcR partner protein (USP polypeptide) bind as a hetero-oligomeric complex to FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, carried out by a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the tritiated ecdysone analogue, WO 01/02436 PCT/AU00/00799 -74ponasterone A, in cells infected by recombinant virus indicating correct folding and association of the two protein subunits (Figure greater than that of the ecdysone holoreceptor in L.

cuprina embryos. Cells infected by a control virus displayed neither antibody-positive bands on western analysis nor specific binding of tritiated hormone above background.

Expression of the tagged ligand-binding regions of the L cuprina EcR polypeptide and partner protein (USP polypeptide) sequences was examined by immunoblot analysis of extracts derived from insect Sf21 cells infected with the recombinant baculovirus, employing antibodies directed against the oligo-His and FLAG tags. This analysis detected bands on immunoblot analysis of approximately the predicted sizes for the expressed tagged ligand-binding regions of the L.

cuprina EcR polypeptide and partner protein (USP polypeptide).

The protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, performed using a modification of the method of Yund et at (1978), demonstrated a significant increase in the binding of the labelled ecdysone analogue, 3 H] ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos (Figure 3).

In contrast, cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of 3 H] ponasterone A, above background levels.

These data indicate correct folding and association of the variant polypeptides comprising the ligand-binding regions of the L. cuprina EcR polypeptide and L. cuprina partner protein (USP polypeptide). The correctly-folded and associated complex formed by the truncated EcR polypeptide and trucated EcR partner protein (USP polypeptide), is used for X-ray and NMR structural analysis and for high-throughput screens.

WO 01/02436 PCT/AU00/00799 EXAMPLE A construct for the expression of the ligand-binding region of the USP polypeptide of the L. cuprina juvenile hormone receptor The donor plasmid pLcEcR.USP.DUAL (Example 14) was digested with BssHII and Pstl to remove the L. cupnna EcR polypeptide-encoding segment therein, thereby leaving the tagged ligand-binding region of the L. cuprina USP polypeptide-encoding nucleotide sequence. The digested plasmid was blunt-ended using T4 DNA polymerase and Klenow polymerase, isolated by gel purification, and finally re-ligated to produce the plasmid pLcUSP.SINGLE.

To produce recombinant baculovirus capable of expressing the tagged ligand-binding regions of the USP polypeptide, the segment of pLcUSP.SINGLE encoding this polypeptide and the pl0 promoter sequence to which said segment is operably connected, was recombined into a baculovirus genome employing the Tn7 transposition system (Luckow et al., 1993). The polypeptide product is then expressed to form a functional juvenile hormone-binding polypeptide and preferably, a modulator of a juvenile hormone receptor. The correctly-folded truncated USP polypeptide is used for X-ray and NMR structural analysis and for highthroughput screens.

EXAMPLE16 In-vitro Screening for the Detection of Insecticidal Compounds The EcR partner protein (USP polypeptide) of the insect ecdysone receptor and USP polypeptide of the insect juvenile hormone receptor of the present invention, optionally associated with the EcR polypeptides of insect ecdysone receptors of the present invention as described in the preceding Examples, are coupled to pins according to the procedure of Geysen et al. (1987), and reacted with candidate insecticidal compounds, generally at a concentration in the range from about 0.05 pM to about 100 pM of the candidate compound.

The binding of compounds is detected using standard procedures, and compounds having insecticidal activity are identified. Preferably, such compounds exhibit insecticidal activity against a range of insects, including diptera, hemiptera, coleoptera, ants, and moths, amongst c WO 01/02436 PCT/AU00/00799 -76others. More preferably, the compounds will exhibit insecticidal activity against L. cuprina, M.

persicae, D. melanogaster, scale insect, white fly, and leaf hopper, amongst others. In a particularly preferred embodiment, insecticidal compounds are specific to L. cuprina or M.

persicae and close relatives thereof.

EXAMPLE 17 Cloned Myzus persicae EcRIUSP complex binds ponasterone A in vitro.

In vitro-translated Myzus persicae EcR (MpEcR) polypeptide and an in vitro-translated M.persicae USP (MpUSP) polypeptide were produced labelled with [rS]Methionine, using the Promega TNT-Coupled Reticulocyte Lysate System. Each batch of lysate contained 100-200 mg/ml of endogenous proteins (using BSA as a standard). The products were analysed by SDS-PAGE and radioautography. The results confirmed that the cloned cDNAs encode proteins of the sizes predicted from the length of putative open reading frames of the cDNAs present in plasmids pMpEcR and pMpUSP. The yields of EcR and USP were similar as assessed by SDS-PAGE.

In functional assays, DNA plasmids pMpEcR (AGAL Accession No. NM99/04567; 1 mg) or pMpUSP (AGAL Accession No. NM99/04568; 1 mg) or pMpUSP2 (AGAL Accession No.

NM00/12581; 1 mg), which have been constructed using the vector pBK-CMV, and 1 ml of appropriate TNT RNA Polymerase were added to 48 ml of reaction mix which contained TNT Lysate, TNT Reaction Buffer, amino acid mixture, Rnasin Ribonuclease Inhibitor and nuclease-free water in volumes specified in the manufacture fs protocol. In control reactions, a Luciferase T3 control DNA (Promega) was used in place of pMpEcR or pMpUSP. T7 RNA Polymerase was used for transcription of the M. persicae EcR RNA from plasmid pMpEcR, whilst T3 RNA Polymerase was used for transcription of M. persicae USP RNA from the plasmid pMpUSP and the Luciferase T3 control DNA. The reactions were carried out for minutes at 30 0

C.

The control reaction produces 150-500 ng of luciferase per 50 ml reaction.

The ecdysteroid binding activities of an in vitro-translated Myzus persicae EcR (MpEcR) WO 01/02436 PCT/AU00/00799 -77polypeptide and an in vitro-translated complex of the M. persicae EcR and USP polypeptides were produced from the RNAs using the TNT-Coupled Reticulocyte Lysate System (Promega).

The mixtures were stored at -20 0 C overnight.

After thawing the translation products, 15 ml aliquots of the reaction mixture containing M.

persicae EcR and USP polypeptides were combined to promote formation of the EcR/USP complex. For assays of individual proteins, 15 ml of the reaction mixture containing M. persicae EcR polypeptide or 15 ml of the reaction mixture containing M. persicae USP polypeptide was combined with 15 ml of control luciferase protein reaction mixture. Samples were each diluted to 435 ml with EcR40 buffer [40 mM KCI, 25 mM HEPES pH 7.0, 1 mM EDTA, ImM DTT, BSA mg/ml), 10% glycerol] to allow for triplicates in the ligand binding assay. A control reaction (Blank) was established which contained EcR40 buffer only. An aliquot (140 ml) of each diluted sample was incubated with tritiated ponasterone A (DuPont NEN, Batch Number 3281108) at a final concentration of 2.2 nM for 90 min at room temperature. After incubation, the ligand binding reactions were placed on ice. The samples were pipetted onto Whatman GF/C filters and incubated for 30 sec. The filters were then placed on a vacuum sinter, washed with 10 ml buffer and transferred to scintillation vials. After adding 7 ml of InstaGel Plus to each vial, the contents were vortexed and left at room temperature until the filters became transparent. The receptor bound ligand was quantified using a TriCarb 2100TR scintillation counter.

The results depicted in Figure 4 indicate that significantly higher amounts of ponasterone A bind to the complex than to either the USP or EcR polypeptides alone.

EXAMPLE 18 In vivo function of a chimeric L. cuprina ecdysone receptor and a L. cuprina EcR partner protein (USP polypeptide) Construction of plasmid oSGLcUSP A 2453 bp fragment from the 5' end of clone pLSP4.(Example 11), containing nucleotide sequence encoding the L. cuprina EcR partner protein (USP polypeptide), was subcloned into WO 01/02436 PCT/AU00/00799 -78the EcoRI site of the mammalian expression vector pSG5 (Stratagene), to construct pSGLcUSP.

Construction of plasmid pVPLcEcR Plasmid pVPLcEcR was constructed as follows: To construct plasmid pMOD31, plasmid pNLVP16 (a gift from Dr G. Muscat) was digested with Sail and Xbal, and re-ligated using a double-stranded oligonucleotide linker formed by annealing of the following complementary oligonucleotides: 5'-TCGACATATAACTTCGCTGCAGATGCATCCGAGCTCT-3' (SEQ ID NO: 29); and XPS3: 5'-CTAGAGCTCGGATGCATCTGCAGCGAAGTTATATG-3' (SEQ ID NO: The A/B domain of pSGLcEcR was removed from the EcR-encoding cDNA by digestion using the restriction enzymes BamHI and Psfl, and a 263 bp BgllPstl fragment of plasmid pMOD31, containing a VP16 activation domain (Triezenberg et al., 1988), was ligated in its place, to construct plasmid pVPLcEcR. Accordingly, plasmid pVPLcEcR contains nucleotide sequences encoding the ligand binding region of the L. cuprina EcR polypeptide placed operably in connection with the VP16 activation domain.

Transfection of CV1 Cells CV1 cells were cotransfected with plasmid pSGLcUSP or unmodified plasmid pSG5, at 1 pg/ml; (ii) plasmid pVPLcEcR or unmodified plasmid pSG5, at 0.2 pg/ml; (iii) the CAT reporter plasmid p(EcRE) 7 -CAT (Example at 1 pg/ml; and (iv) an independent LacZ reporter plasmid, pPGKLacZ (Example at a concentration of 1 ug/ml, included as a control to monitor transfection efficiency.

For induction experiments, the ecdysone analogue, 1mM ponasterone A was added to cells 6 hours after transfection. In control experiments, cells were treated only with carrier ethanol.

The CAT and P-galactosidase activities present in extracts of cells were measured 48 hours WO 01/02436 PCT/AU00/00799 -79after transfection as described previously (Hannan and Hill, 1997). Variations between experiments were controlled, by normalising the level of CAT to P-galactosidase for each extract.

Data shown in Figure 5 indicate that the L. cuprina EcR partner protein (USP polypeptide) can interact with a chimeric L. cuprina EcR polypeptide to form an ecdysteroid-dependent transcription factor in mammalian cells. Treatment of CV1 cells with ecdysteroid, in particular ImM ponasterone A, induced significant levels of expression of the CAT reporter gene relative to the induction of P-galactosidase gene expression, which indicates transfection efficiency.

When both plasmid pSGLcUSP and plasmid pVPLcEcR were transfected into CV1 cells, a 73-fold induction of CAT reporter gene expression, relative to P-galactosidase gene expression was achieved (column 8 of Figure In contrast, plasmid pVPLcEcR alone produced only a 4-fold induction of CAT gene expression relative to P-galactosidase gene expression (column 4 of Figure This low level of activity is presumably due to formation of an active complex by the chimeric L. cuprina EcR polypeptide and endogenous RXR present in CV1 cells.

Only background CAT reporter gene expression was observed in the absence of exogenous hormone (columns 1, 3, 5 and 7 of Figure and no significant induction of gene expression was observed in the absence of the L. cupina EcR polypeptide (columns 1, 2, 5 and 6 of Figure Overall, these data support the conclusion that the cDNA clone described herein encodes an intact L. cuprina EcR partner protein (USP polypeptide), which is functional in vivo.

EXAMPLE 19 In vivo function of a chimeric EcR polypeptide of the M. persicae ecdysone receptor Plasmids pSGDM and pSGMD both comprise nucleotide sequences encoding chimeric D.

melanogaster and M. persicae ecdysone receptor EcR polypeptides. In particular, plasmid pSGDM comprises a chimeric cDNA sequence consisting of nucleotide sequence encoding the WO 01/02436 PCT/AU00/00799 A/B domain of the D. melanogaster EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the M. persicae EcR polypeptide.

Plasmid pSGMD comprises a chimeric cDNA sequence consisting of nucleotide sequence encoding the A/B domain of the M. persicae EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the D. melanogaster EcR polypeptide.

Construction of plasmid pSGDM cDNA encoding the M. persicae EcR polypeptide in the mammalian expression vector (Stratagene) was digested with Sapl, which cleaves at a unique restriction site very close to the 3' -end of the nucleotide sequence encoding the A/B domain of the protein (Vectorl). Two oligonucleotides A and B, containing Sacll, EcoRV and BamHI restriction sites, were synthesized, purified and annealed to form double stranded DNA (Linkerl) having Sapl compatible sticky ends: A: 5'-TCCAGAACCGCGGATAGATATCTGGGATCCTC-3' (SEQ ID NO: 31); and B: 5'-GGAGAGGATCCCAGATATCTATCCGCGGTTCT-3' (SEQ ID NO: 32) Linkeri was ligated into Vector 1 and the resultant plasmid was digested with EcoRV to produce Vector 2.

A 940 bp EcoRI cDNA fragment encoding the A/B domain of full length D. melanogaster EcR polpypeptide was isolated from plasmid pSGDmEcR and ligated into the EcoRV site in Vector 2, using the linker-primer from the Stratagene cDNA Synthesis Kit, to produce Vector 3. The cDNA sequence encoding the A/B domain of the M. persicae EcR polypeptide was removed from Vector 3 by digestion with Sacll and the truncated plasmid was then religated to produce plasmid pSGDM.

Construction of plasmid pSGMD.

A 2200 bp EcoRI/BamHI cDNA fragment encoding the DNA-binding and ligand-binding domains of the full length D. melanogaster EcR polypeptide was isolated from plasmid pSGDmEcR and end-filled and ligated into the EcoRV site present in Vector 2 (see above), to WO 01/02436 PCT/AU00/00799 -81produce Vector 4. The cDNA encoding the DNA-binding and ligand-binding domains of the M.

persicae EcR polypeptide were then excised from Vector 4 by digestion with BamHI and the truncated plasmid was then religated, to produce plasmid pSGMD.

Biological assays Plasmids pSGDM and pSGMD contain cDNA sequences encoding full-length functional EcR polypeptides, as shown by SDS/PAGE of in vitro translation products, and using biological activity assays carried out in vivo using CHO cells, as follows: 1. Transfection of CHO cells.

CHO cells were co-transfected with a mixture comprising the following plasmids: an expression plasmid selected from the group consisting of pSGDmEcR, pSGMpEcR, pSGDM, pSGMD, and pSG5, wherein each plasmid was at a concentration of 1 pg/ml; and (ii) the CAT reporter plasmid p(EcRE)r-CAT at a concentration of 1 pg/ml.

Transfected cells were incubated for two days at 37 0 C in the presence of absence of 10 pM Muristerone A. In the control samples lacking Muristerone A, ethanol solvent was added to the cells. CAT enzyme activity was assayed by ELISA.

Data presented in Figure 6 show that the modified EcR subunit of the M. persicae ecdysone receptor is biologically active in vivo. The M. persicae EcR polypeptide having an A/B domain derived from D. melanogaster confers ecdysone responsiveness on CAT reporter gene expression in CHO cells, under the control of a promoter sequence containing the D.

melanogaster hsp27 ecdysone response elements present in plasmid p(EcRE) 7

-CAT.

EXAMPLE Co-expression of the ligand binding region of the M. persicae EcR polypeptide and the ligand binding region of the L. cuprina EcR partner protein (USP polypeptide) produces an active heterodimeric complex A vector for the baculovirus-directed co-expression of ligand-binding regions derived from the EcR protein and partner protein (USP polypeptide) of the Myzus persicae ecdysone receptor WO 01/02436 PCT/AU00/00799 -82was prepared in two stages: First, cDNA encoding the linker region (domain D) and ligand-binding domain (domains E and F) of the M. persicae EcR polypeptide was cloned into the multiple cloning site of the plasmid pLcUSP.SINGLE (Example 15), in operable connection with the polyhedrin promoter sequence.

Plasmid pLcUSP.SINGLE contains cDNA encoding linker and ligand binding domain of the L.

cuprina partner protein (USP polypeptide) placed operably in connection with the p10 promoter.

To achieve this end, pLcUSP.SINGLE was. linearised using BamHI and Hindill restriction enzymes, and ligated to a synthetic linker (i.e Linker 1) which was constructed by annealing the following oligonucleotides: Oligonucleotide A: 5'-GATCCATGGGACACCATCACCATCACCATAGGCCTTCCGAACGCGGTGAATTCCGACA-3' (SEQ ID NO: 33); Oligonucleotide B: 5'-AGCTTGTCGGAATTCACCGCGTTCGGAAGGCCTATGGTGATGGTTGGTGTCCCATG-3' (SEQ ID NO: 34).

Linker 1 comprises BamHI and Hindlll sticky ends to facilitate cloning, and internal Stul and EcoRI restriction sites, and nucleotide sequence encoding an oligo-His tag.

A 1.9kb StullSmal cDNA fragment encoding the linker and ligand-binding domain of the M.

persicae EcR polypeptide was subsequently ligated into the Stul restriction site within the Linker 1 sequence, to produce plasmid pMpEcR.LcUSP.DUAL, comprising nucleotide sequences encoding the tagged Linker 1 sequence, and domains D and E and F of the M. persicae EcR polypeptide, and the linker and ligand-binding domains domains D/E/F) of the L. cuprina partner protein (USP polypeptide), placed operably under the control of polyhedrin and promoters, respectively.

Second, plasmid pMpEcR.LcUSP.DUAL was digested with Xmal and Kpnl to excise nucleotide sequence encoding linker and ligand binding domains of the L. cuprina partner protein (USP polypeptide), to produce Vector 1 B.

Linker 2 was constructed by annealing the following oligonucleotides: WO 01/02436 PCT/AU00/00799 -83- Oligonucleotide C: 5'-CCGGGATCTCGAGATGGACTACAAGGACGACGATGACAAGCC-3' (SEQ ID NO: 35); and Oligonucleotide D: 5'-CATGGGCTTGTCATCGTCGTCCTTGTAGTCCATCTCGAGATC-3' (SEQ ID NO: 36).

Linker 2 comprises Xmal and Ncol compatible ends and a "FLAG" encoding sequence.

Linker 2 was ligated to a 1.2kb KpnllNcol DNA fragment in Vector 1 B, encoding the linker and ligand binding domains of the M. persicae partner protein (USP polypeptide), to produce plasmid pMpEcR.USP.DUAL, comprising nucleotide sequences encoding the tagged linker and domains D and E and F of the M. persicae EcR polypeptide, and the linker and ligand-binding domains of the M. persicae partner protein (USP polypeptide), placed operably under the control of polyhedrin and p10 promoters, respectively.

Plasmids pMpEcR.LcUSP.DUAL and pMpEcR.USP.DUAL were sequenced to confirm the presence of the open reading frames.

The segment of pMpEcR.LcUSP.DUAL or pMpEcR.USP.DUAL encoding the chimeric tagged ligand binding regions of the receptor polypeptides was recombined in a baculovirus genome, by employing the Tn7 transposition system (Luckow et al., 1993). The chimeric ligand binding regions of the recombinant ecdysone receptors were then expressed in insect Sf9 cells, where they associated into functional complexes.

Expression of the heterologous M. persicae/L. cuprina ecdysone receptor comprising tagged linker and domains D/E/F of the M. persicae EcR polypeptide and the linker and ligandbinding domains of the L. cuprina EcR partner protein (USP polypeptide)], and expression of the homologous M. persicae ecdysone receptor comprising tagged Linker 2 and domains D/E/F of the M. persicae EcR polypeptide and the linker and ligand-binding domains of the M.

persicae EcR partner protein (USP polypeptide)], was examined by immunoblot analysis of extracts derived from insect Sf9 cells infected with either of the recombinant baculoviruses, employing antibodies directed against the oligo-His and FLAG tags to perform the quantitation.

This analysis detected bands on immunoblot analysis of the predicted sizes for the expressed WO 01/02436 PCT/AU00/00799 -84polypeptides.

Furthermore, binding assays, carried out by a modification of the method of Yund et al.(1978), .demonstrated a highly-significant binding of the tritiated ecdysone analogue, ponasterone A, in cells infected by recombinant viruses (Figure Data presented in Figure 7 indicate correct folding and association of the components of both the heterologous and homologous truncated ecdysone receptors. These data indicate further that it is possible to produce functional heterologous chimeric receptors between the ligand binding regions of EcR polypeptides and EcR partner proteins from different insect species. Those chimeric receptors have different specificities for ecdysteroid compared to their native counterparts.

EXAMPLE 21 In vivo function of a heterodimeric receptor comprising a chimeric M. persicae EcR polypeptide and a recombinant M. persicae EcR partner protein (USP polypeptide To test the function of the isolated cDNA clone encoding the M. persicae EcR partner protein (USP polypeptide), we tested the ability of the expressed polypeptide to complement a chimeric M. persicae EcR polypeptide in CV1 cells.

Briefly, CV1 cells were co transfected with the following plasmid constructs: plasmid pBKMpUSP1, containing the cDNA clone encoding the M. persicae EcR partner protein (USP polypeptide) operably in connection with the CMV promoter in pBK-CMV, at 2 pg/ml; or alternatively, a negative control gene construct, plasmid pBSK+, at 2 pg/ml; and (ii) plasmid pSGDM, comprising a chimeric cDNA sequence consisting of nucleotide sequence encoding the a/B domain of the D. melanogaster EcR polypeptide ligated to nucleotide sequence encoding the DNA-binding, linker, and ligand-binding domains of the M. persicae EcR polypeptide (Example 19), at 1 pg/ml; and (iii) the CAT reporter gene construct, plasmid p(EcRE) 7 -CAT, comprising the CAT reporter gene placed operably under the control of a promoter sequence containing multiple copies of the D. melanogaster hsp27 ecdysone response elements present in plasmid at 1 pg/ml; and WO 01/02436 PCT/AU00/00799 (iv) the -galactosidase reporter gene construct to control for transfection efficiency, designated plasmid pPopNLacZ, and described by Hannan et al. (1993), at 0.5 pg/ml.

For expression, the ecdysone analogue, 10 mM ponasterone a (a gift from Dr Denis Horn), was added to cells 6 hours after transfection, to induce CAT gene expression mediated the chimeric recombinant ecdysone receptor. In control experiments, cells were treated with ethanol in place of ponasterone a. CAT and P-galactosidase enzyme activities were measured in cell extracts 48 hours after transfection, as described previously (Hannan and Hill, 1997). The relative level of CAT/ P-galactosidase for each extract was determined, to normalise the variation in transfection efficiency between samples.

Data presented in Figure 8 indicate that the isolated cDNA encodes a functional M. persicae EcR partner protein (USP polypeptide). When pBKMpUSP1 was co transfected with pSGDM into CV1 cells, a 2.6-fold induction of relative CAT gene expression was observed in the presence of 10 mM ponasterone a, relative to the expression observed using plasmid pSGDM in the absence of pBKMpUSP1. The "background" level of gene expression observed for cells expressing plasmid pSGDM in the absence of pBKMpUSPI is presumably due to formation of an active complex between the chimeric MpEcR polypeptide and the endogenous RXR proteins present in CV1 cells. The induction of CAT expression by ponasterone a for cells transfected with both plasmids pBKMpUSP1 and pSGDM indicates that the expressed M.

persicae EcR partner protein (USP polypeptide) can interact with the chimeric EcR polypeptide, to form an ecdysteroid-dependent transcription factor in mammalian cells. Accordingly, these data indicate that the recombinantly-expressed M. persicae EcR partner protein (USP polypeptide) is functional in vivo.

EXAMPLE 22 Isolation and characterisation of a cDNA encoding the EcR partner protein (USP polypeptide) of the Bemesia tabaci ecdysone receptor Construction and screening of B. tabaci cDNA libraries Two independent B. tabaci cDNA libraries derived from red-eye nymph stage animals were prepared by oligo-dT priming, and cloned into the EcoRI site of the Lambda/Zapll vector WO 01/02436 PCT/AU00/00799 -86- (Stratagene). The titres of the two primary libraries produced were 1.9 x 106 pfu, and 3.15 x 106 pfu. Tests indicated that the insert size range for these libraries was 0.7 kb to 7.6 kb in length.

The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols, to produce final titres of 1.5 x 109 pfu/ml, and 2.5 x 109 pfu/ml.

The prepared cDNA libraries were screened by lifting 500,000 plaques from each amplified cDNA library, in duplicate, onto Hybond N membranes (Amersham), and then hybridizing same under low stringency conditions to radiolabelled probes specified below. In particular, hybridisations were carried out overnight at 37 0 C, in a hybridisation solution comprising 42% formamide; 5 x SSPE solution; 5 x Denhardt's solution; and 0.1% sodium dodecyl sulphate, as described essentially by Ausubel et al, (1992) or Sambrook et al. (1989). The membranes were then washed at 37°C in 2XSSC solution containing 0.1% sodium dodecyl sulphate. Following washing, positive plaques were detected by autoradiography, using XOMAT-AR film (Kodak) for two to three days, at -70 0 C. Positive-hybridising plaques were plaque-purified, rescued as plasmids, and their cDNA inserts analysed by nucleotide sequence determination.

Hybridisation probe preparation The EcR partner protein (USP polypeptide) subunit of the B. tabaci ecdysone receptor also functions in the absence of the EcR polypeptide as a USP polypeptide of the B. tabacijuvenile hormone receptor.

To isolate a cDNA encoding both receptor activities from the B. tabaci cDNA library, a 140 bp probe was amplified from B. tabaci genomic DNA, using two degenerate primers described by Tzertzinis et al. (1994) and in the preceding Examples. The PCR reaction was performed using 1 unit Taql polymerase (Boehringer Mannheim), 1 mM each primer, in a 50 pl reaction volume, essentially under conditions recommended by the manufacturer (Boehringer Mannheim The amplified DNA fragment was sub-cloned into the EcoRI and Clal sites of linearised WO 01/02436 PCT/AU00/00799 -87pBluescript SK+ (Stratagene) vector. The nucleotide sequence of the insert in the pBluescript SK+ vector was obtained using automated fluorescent dye terminator sequencing (Automated DNA Analysis Facility at University of NSW, Sydney Australia) and is set forth herein as SEQ ID NO: 37. This fragment encodes the amino acid sequence set forth in SEQ ID NO: 38.

To prepare a hybridisation probe for screening cDNA libraries, the amplified B. tabaci DNA was released from the pBluescript+ vector by double-digestion using the enzymes EcoRI and Sail, separation by agarose gel electrophoresis, and purification by electro-elution. DNA was subsequently 2 P]-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Adelaide, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the degenerate primers described by Tzertzinis et a.(1994).

Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used as described herein above at in Examples 7 and 8, to screen the B. tabaci cDNA library.

Positive-hybridising clones were plaque-purified and sequenced using standard procedures as described herein.

The nucleotide sequence of one clone was obtained and is set forth herein as SEQ ID NO: 39.

The amino acid sequence of the B. tabaci EcR partner protein (USP polypeptide) is shown in SEQ ID NO: EXAMPLE 23 Cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the B. tabaci ecdysone receptor Hybridisation probe preparation A 101 bp DNA fragment, encoding the DNA-binding domain of the EcR polypeptide subunit of the B. tabaci ecdysone receptor, was amplified from the B. tabaci genome by PCR, by using the degenerate primers Rdna3 (SEQ ID NO: 23) and Rdna4 (SEQ ID NO: 24), essentially as described hereinabove. Briefly, amplification reactions employed Taql DNA polymerase (Boehringer Mannheim) and the following amplification conditions: WO 01/02436 PCT/AU00/00799 -88cycles 1-2: 97 0 C for 2 minutes; 50 0 C for 1 minute; 72 0 C for 1 minute; cycles 3-30: 72 0 C for 7 minutes; and cycle 44: 72 0 C for 7 minutes.

The amplified B. tabaci gene fragment was cloned into pBluescript SK+ (Stratagene), following digestion using the enzymes EcoRI and BamHI, purification of the digested DNA by agarose gel electrophoresis and BresaClean (Bresatec)-purification of the product band, as described herein above.

The nucleotide sequence of the amplified hybridisation probe was obtained using automated fluorescent dye terminator sequencing (Automated DNA Analysis Facility at University of NSW, Sydney Australia), and is set forth herein as SEQ ID NO: 41. The derived amino acid sequence of this gene fragment is provided in SEQ ID NO: 42. There are 16 amino acids in the amino acid sequence of SEQ ID NO: 42 that are conserved in the amino acid sequence of the M.

persicae EcR partner protein (USP polypeptide) set forth herein as SEQ ID NO: 16 (cf. SEQ ID NO: 42 to residues 63 to 95 of SEQ ID NO: 16), suggesting that the amplified probe does encode a part of the B. tabaci EcR partner protein (USP polypeptide).

For probe preparation, the insert was excised from the pBluescript SK+ vector using EcoR1 and BamHI, labelled, and used as described in the preceding Example, to screen the B. tabaci cDNA library.

WO 01/02436 WO 0102436PCT/AUOO/00799 -89-

REFERENCES

1. Amann and Brosius (1985). Gene 4: 183.

2. Ausubel, et a! (1992), Current Protocols in Molecular Biology, Greene/Wiley, New York 3. Bugg, et al (1993) Scientific American, December Issue: pp 60-66.

4. Cavener et al. (1987) Nuci. Acids Res. 15:1353-1 36.

Devereux, et a. (1984). NucI. Acids Res. _12:387-395.

6. Evans (1988) Science, 240: 889-895.

7. Geysen et a! (1987) J. Immunol Methods, 102, 259-274.

8. Greene et al. (1988) Nucleic Acids Res. 15:369.

9. Hannan et al (1993) Gene 130: 233-239 Hollenberd and Evans (1988) CelI5: 899-906.

11. Hollenberg et at(1991) Cell, 67, 59-77.

12. Jones, G and Sharp, P, (1997) Proc. Nat Acad. Sci. USA 94:13499-13503.

13. Kamimura et a! (1996) Comp. Biochem. Physio!. i113 41 -347.

14. Koelle et a! (199 1) Cell, 67~:59-77 Krust et a! (1986) EMBO. 5: 891-897.

16. Luckow et (1993) J. Virol, 67: 4566.

17. McBumney et a! (1991), Nucleic Acids Res., 19, 5755-5761.

18. McPherson, Quirke, P. and Taylor, G.R. (1991) PCR a Practical Approach. IRL Press, Oxford University Press, Oxford, United Kingdom.

19. Needleman and Wunsch (1970) J. Mo!. Bio. 48:443-453.

Potrykus (1990) Biol~echnology 8: 535-542.

21. Riddihough, and Pelham, H. R. (1987), EMBO J. 6, 3729-3734 22. Sambrook et a! (1989), Molecular Cloning: a Laboratory Manual, CSH Lab. Press 23. Segraves and Hogness (1990) Genes Deve!. 4: 204-21 9.

24. Shimatake and Rosenberg (1981) Nature 292: 128 Studier and Moffat (1986) J. Mo!. Biol. 189: 113 26. Thompson,et al., (1994) Nuc!. Acids Res. 22:4673-4680.

27. Tzertzinis et a! (1994) J. Mo!. Biol=, 479-486.

28. Von ltzstein et a! (1993) Nature Vol. 363: 418-423.

29. Yund, et (1978) Proc. Nat. Acad. Sci. USA, 24: 6039-6043.

EDITORIAL NOTE APPLICATION NUMBER 55141/00 The following Sequence Listing pages 1 to 57 are part of the description. The claims pages follow on pages "90" to "108".

WO 01/02436 WO 0102436PCT/AUOO/00799 1- SEQUENCE LISTING <110> COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION (120> NOVEL GENETIC SEQUENCES ENCODING STEROID AND JUVENILE HORMONE RECEPTOR POLYPEPTIDES AND INSECTICIDAL MODALITIES THEREFOR II <130> p: \oper\mro\ecdysone2 .pct <140> International <141> 2000-06-30 application No. PCT/AUOOIXXXXX <150> US 09/346470 <151> 1999-07-01 <160> 42 <170> Patentln Ver. <210> 1 <211> 2274 <212> DNA <213> Lucilia cuprina <220> <221> COS <222> .(2271) <400> 1 atg atq aaa cga cgt tgg tct aat aat ggc Met: Met Lys Arg Arg Trp Ser Asn Asn Gly ggt ttt gcc gct tta aaa Gly Phe Ala Ala Leu Lys atg tta gaa gaa tcc tcc tca gaa gta acc tcc tcc tca Met Leu Glu Glu Ser Ser Ser Glu Val. Thr Ser Ser Ser aat ggt ctg Asn Gly Leu gtc ttg tca tcg gat Val Leu Ser Ser Asp ata aat atg tca-cct tcc tcg ttg gat tra ccc Ile Asn Met Ser Pro Ser Ser Leu Asp Ser Pro 144 gtt tat ggc gat cag gaa atg tgg ctg tgt aac gat tca gct tca tat Val Tyr Gly Asp Gln Glu Met Trp Leu Cys Asn Asp Ser Ala Ser Tyr 55 aat aac agt cat cag cat agt gtt ata act tcg ctg rag ggr tgr ac Asn Asn Ser His Gln His Ser Val Ile Thr Ser Leu Gln Gly Cys Thr WO 01/02436 PCT/AUOO/00799 -2- 70 75 tca tca ttg ccg gcc caa aca acc att ata cct ctg tca get tta ccc 288 Ser Ser Leu Pro Ala Gin Thr Thr Ile Ile Pro Leu Ser Ala Leu Pro 90 aat tce aat aat gcc tcc ctg aat aat caa aat caa aat tat caa aat 336 Asn Ser Asn Asn Ala Ser Leu Asn Asn Gin Asn Gin Asn Tyr Gin Asn 100 105 110 ggt aat tec atg aat aca aat tta tcg gtt aac aca aat eec agt gtt 384 Gly Asn Ser Met Asn Thr Asn Leu Ser Val Asn Thr Asn Asn Ser Val 115 120 125 gga gga ggt gga ggt ggt ggt ggt gta ccc ggt atg act tea ctc eat 432 Gly Gly Giy Gly Gly Giy Giy Giy Val Pro Giy Met Thr Ser Leu Asn 130 135 140 ggt ctg gqt ggt ggt ggt ggc agt caa gtg aat eat cac aat cec agc 480 Giy Leu Giy Giy Gly Gly Giy Ser Gin Vai Asn Asn His Asn His Ser 145 150 155 160 cac aat cat tta cac cac eac agc aac agt aat cac agt eat. ae agt 528 His Asn His Leu His His Asn Ser Asn Ser Asn His Ser Asn Ser Ser 165 170 175 tcc cac cac ace cat ggc cac atg ggt att ggc ggc. ggt ggt ggt ggc 576 Ser His His Thr Asn Giy His Met Giy Ile Giy Gly Gly Giy Gly Gly 180 185 190 tta tcg gte aat att aat ggt ccc aat atc gtt agc eat gcc caa cag 624 Leo Ser Val Asn Ile Asn Gly Pro Asn Ile Val Ser Asn Ala Gin Gin 195 200 205 tta aac tcg tta cag gcc tca caa eat ggc caa gtt att cat gcc aat 672 Leo Asn Ser Leo Gin Ala Ser Gin Asn Giy Gin Vai Ile His Ala Asn 210 215 220 ett ggc att eec agt atc atc agt aat gga tte aat cat cat cec cat 720 Ile Gly Ile His Se Ile Ile Ser Asn Gly Leu Asn His His His His 225 230 235 240 cat cat atg eat aac agt agt atg atg cat cat aca ccc age tct gac 768 His His Met Asn Asn Sec Ser Met Met His His Thr Pro Arg Ser Glu 245 250 255 WO 01/02436 WO 0102436PCT/AUOO/00799 tca gct aat Ser Ala Asn agt ctt aat Ser Leu Asn 275 ata tca tca ggt cgt gat gat ctt tca Ile Ser Ser Gly Arg Asp Asp Leu Ser 265 ccc tcg agc Pro Ser Ser 270 eag aaa etc Lys Lys Ile ggc ttc tca aca Gly Phe Ser Thr gat gct agt gat Asp Ala Ser Asp aaa aaa Lys Lys 290 ggt cct gcg ccc Gly Pro Ala Pro tta caa gag gaa Leu Gin Giu Giu tgt ctg gtg tgt Cys Leu Val Cys get cgg gcg tcc Asp Arg Ala Ser ggt tat cat tat aec gce ctc acc tgt gaa Gly Tyr His Tyr Asn Ala Leu Thr Cys Giu 310 315 cga cgg agt gtt acc aaa eat gcg gtg tat Arg Arg Ser Val Thr Lys Asn Ala Val Tyr 330 335 960 1008 tgt aag ggg ttc Cys Lys Gly Phe tgt aaa ttt Cys Lys Phe cat gcc tgc gee atg gac atg tat atg His Ala Cys Giu Met Asp Met Tyr Met 345 cga cgt aa Arg Arg Lys 350 etg cgg ccg Met Arg Pro 1056 tgt rag gae tgt egg ctg aae Cys Gin Giu Cys Arg Leu Lys 355 tgt ttg gct gtg Cys Leu Ala Val 1104 1152 gaa tgt Giu Cys 370 gtg gtg ccc gae Val Val Pro Glu cag tgt gra atg Gin Cys Ala Met cga cgc gaa aag Arg Arg Giu Lys gre cae aae gag Ala Gin Lys Glu get eea ate cag Asp Lys Ile Gin egt gtg tgt gca Ser Vei Cys Ala 1200 1248 gee att aaa Giu Ile Lys cat cra acg His Pro Thr aeg gee Lys Giu 405 tgt ccg Cys Pro 420 ata ctc get tta Ile Leu Asp Leu ctg tta cct gee Leu Leu Pro Giu 425 ace tgt gee ccg Thr Cys Giu Pro gac ett ttg Asp Ile Leu grt eea tgt cae Ala Lys Cys Gin 430 1296 gct cgt eat ate cct cct tta tcg tec aet cee ttg gca gtt ate tat Ala Arg Asn Ile Pro Pro Leu Ser Tyr Asn Gin Leu Ala Val Ile Tyr 1344 WO 01/02436 PCT/AUOO/00799 -4- 435 440 445 aaa tta ata tgg tat caa gat ggc tac qaa cag cca tcc gag gaa gat 1392 Lys Leu Ile Trp Tyr Gin Asp Gly Tyr Glu Gin Pro Ser Giu Giu Asp 450 455 460 ctc aaa cgt ata atg agt tca ccc gat gaa aat gaa agt caa cac gat 1440 Leu Lys Arg Ile Met Ser Ser Pro Asp Glu Asn Glu Ser Gin His Asp 465 470 475 480 gca tca ttt cgt cat ata aca gaa atc act ata cta aca gta caa tta 1488 Ala Ser Phe Arg His Ile Thr Glu Ile Thr Ile Leu Thr Val Gin Leu 485 490 495 att gtg gaa ttt gcc aag ggt ttg cca gcg ttt acc aaa ata cca caa 1536 Ile Val Giu Phe Ala Lys Gly Leu Pro Ala Phe Thr Lys Ile Pro Gin 500 505 510 gag gat caa ata aca cta tta aag gcc tgc tca tca gaa. gtt atg atg 1584 Glu Asp Gin Ile Thr Leu Leu Lys Ala Cys Ser Ser Glu Val Met Met 515 520 525 ttg cga atg qca cga cgt tac gat cac aat tca gat tcg ata ttc ttt 1632 Leu Arg Met Ala Arg Arg Tyr Asp His Asn Ser Asp Ser Ile Phe Phe 530 535. 540 cc aat aat cga tcg tat acg cgt gac tct tat aaa atg get gge atg 1680 Ala Asn Asn Arq Ser Tyr Thr Arg Asp Ser Tyr Lys Met Ala Gly Met 545 550 555 560 get gat aat att gag gat ctg ctg cat tte tgt ega caa atg tac tcg 1728 Ala Asp Asn Ile Giu Asp Leu Leu His Phe Cys Arg Gin Met Tyr Ser 565 570 575 atg aaa gtg gac aat gtc gaa tat get cta ctc act gee att. gtg atc 1776 Met Lys Val Asp Asn Val Giu Tyr Ala Leu Leu Thr Ala Ile Val Ile 580 585 590 ttt tcc gat egg ecg ggt etc gaa gaa gec gaa eta. gtc gaa geg ata 1824 Phe Ser Asp Arg Pro Gly Leu Giu Glu Ala Glu Leu Val Giu Ala Ile 595 600 605 eaa agt tac tac atc gat aca etc cgc att tac ata ett aat cgc cat 1872 Gin Ser Tyr Tyr Ile Asp Thr Leu Arg Ile Tyr Ile Leu Asn Arg His 610 615 620 WO 01/02436 WO 0102436PCT/AUOO/00799 gqc gat ccc Gly Asp Pro atg agt Met Ser 630 cte gta ttc ttt Leu Val Phe Phe aag ctt etg tca Lys Leu Leu Ser 1920 eta acc gaa ctg Cgt aeg ttg ggc aat Leu Thr Glu Leu Arg Thr Leu Gly Asn 645 aat gcc gaa atg Asn Ala Glu Met 1968 tcg ttg aaa Ser Leu Lys tgg gat gta Trp Asp Val 675 aaa aat egc aaa Lys Asn Arg Lys eca aaa ttc etc Pro Lys Phe Leu gaa gag ate Giu Giu Ile 670 ata eag get Ile Gin Ala 2016 2064 cat gee att cca His Ala Ile Pro tea gtg eag tea Ser Val Gin Ser acc eag Thr Gin 690 geg gaa aag Ala Glu Lys gee gee Ala Ala 695 eag gaa get eag Gin Giu Ala Gin aca aea teg gee Thr Thr Ser Ala 2112 tea gea gee gee ace tca tct tee tee Ser Ala Ala Ala Thr Ser Set Set Set 710 aat ace teg Asn Thr Ser atg gca Met Ala 720 2160 aca tea tee tea Thr Set Ser Ser teg tta teg eea Set Leo Set Pro geg gee tea aea Ala Ala Set Thr 2208 ggt ggt gee Gly Gly Ala gat tat gtt ggc Asp Tyr Val Gly gat atg agt atg Asp Met Set Met agt. tta gta Set Leu Val 750 2256 eaa teg gat aat gea tag Gin Ser Asp Asn Ala 755 <210> 2 <211> 757 <212> PRT <213> Lueija euprina <400> 2 Met Met Lys Arg Arg Trp Set Asn Asn Gly Gly Phe Ala Ala Leu Lys 1 5 10 2274 WO 01/02436 WO 0102436PCT/AUOO/00799 Met Leu Val Leu Val Tyr Asn Asn Ser Ser Asn Ser Gly Asn Gly Gly 130 Gly Leu 145 His Asn Ser His Leu Ser Leu Asn 210 Ile Gly 225 His His Ser Ala Giu Ser Ser Asp Asp Gin His Gin Pro Ala Asn Ala 100 Met Asn Gly Giy Gly Gly Leu His 165 Thr Asn 180 Asn Ile Leu Gin His Ser Asn Asn 245 Ser Ile Ser Giu Asn Met Met Trp 55 Ser Val Thr Thr Leu Asn Asn Leu 120 Gly Giy 135 Gly Ser Asn Ser His Met Gly Pro 200 Ser Gin 215 Ile Ser Ser Met Ser Gly Ser Ser Ser Ser Asn Asp Ser Leu Pro Leu Asn Gin Asn Thr Gly Met 140 Asn Asn 155 Asn His Giy Gly Val Ser Gin Val 220 Leu Asn 235 His Thr Asp Leu Ser Asn Leu Asp Ser Ala Gin Gly Ser Ala Asn Tyr 110 Asn Asn 125 Thr Ser His Asn Ser Asn Gly Gly 190 Asn Ala 205 Ile His His His Pro Arg Ser Pro WO 01/02436 WO 0102436PCT/AUOO/00799 265 Ser Thr Ser Asp Ala 280 Pro Arg Leu Gin Giu 295 Gly Tyr His Tyr Asn 310 Arg Arg Ser Val Thr 330 Ala Cys Glu Met Asp 345 Leu Lys Lys Cys Leu 360 Glu Asn Gin Cys Ala 375 Lys Asp Lys Ile Gin 390 Ile Leu Asp Leu Met 410 Leu Leu Pro Giu Asp 425 Pro Leu Ser Tyr Asn 440 Gin Asp Gly Tyr Giu 455 Ser Ser Pro Asp Giu 470 Ile Thr Glu Ile Thr 490 Lys Giy Leu Pro Ala 270 Val Lys 285 Cys Leu Thr Cys Ala Val Met Arg 350 Gly Met 365 Arg Arg Val Cys Glu Pro Ala Lys 430 Ala Val 445 Ser Glu Ser Gin Thr Val Lys Ile Val Cys Glu Gly 320 Tyr Cys 335 Arg Lys Arg Pro Giu Lys Ala Thr 400 Pro Ser 415 Cys Gin Ile Tyr Glu Asp His Asp 480 Gin Leu 495 Pro Gin Ile Val Glu Phe Phe Thr Lys Ile WO 01/02436 PCT/AUOO/00799 500 505 510 Giu Asp Gin Ile Thr Leu Leu Lys Ala Cys Ser Ser Giu Vai Met Met 515 520 525 Leu Arg Met Ala Arg Arg Tyr Asp His Asn Ser Asp Ser Ile Phe Phe 530 535 540 Ala Asn Asn Arg Ser Tyr Thr Arg Asp Ser Tyr Lys Met Ala Gly Met 545 550 555 560 Ala Asp Asn Ile Giu Asp LeU Leu His Phe Cys Arg Gin Met Tyr Ser 565 570 575 Met Lys Val Asp Asn Val Giu Tyr Ala Leu Leu Thr Ala Ile Val Ile 580 585 590 Phe Ser Asp Arg Pro Gly Leu Giu Giu Ala Glu Leu Val Giu Ala Ile 595 600 605 Gin Ser Tyr Tyr Ile Asp Thr Leu Arg Ile Tyr Ile Leu Asn Arg His 610 615 620 Cys Gly Asp Pro Met Ser Leu Val Phe Phe Ala Lys Leu Leu Ser Ile 625 630 635 640 Leu Thr Giu Leu Arg Thr Leu Gly Asn Gin Asn Aia Giu Met Cys Phe 645 650 655 Ser Leu Lys Leu Lys Asn Arg Lys Leu Pro Lys Phe Leu Giu Giu Ile 660 665 670 Trp Asp Vai His Ala Ile Pro Pro Ser Val Gin Ser His Ile Gin Ala 675 680 685 Thr Gin Ala Giu Lys Ala Ala Gin Giu Ala Gin Ala Thr Thr Ser Ala 690 695 700 Ile Ser Ala Ala Ala Thr Ser Ser Ser Ser Ile Asn Thr Ser Met Ala 705 710 715 720 Thr Ser Ser Ser Ser Ser Leu Ser Pro Ser Ala Ala Ser Thr Pro Asn 725 730 735 Gly Gly Ala Val Asp Tyr Val Gly Thr Asp Met Ser Met Ser Leu Val 740 745 750 WO 01/02436 WO 0102436PCT/AUOO/00799 Gin Ser Asp Asn Ala 755 <210> 3 <211> 2453 <212> DNA <213> Lucilia cuprina.

<220> <221> <222>

CDS

(1417) <400> 3 aattcggcac gagaaa atg gat aac qgc gag caa. gat gct ggg ttc cga ttg 52 Met Asp Asn Giy Glu Gin Asp Ala Gly Phe Arg Leu gca ccg atg tct ccg cag gag ata aag cca. gac att Ala Pro Met Ser Pro Gin Glu Ile Lys Pro Asp Ile tca cta. ctc aat Ser Leu Leu Asn agt cct aat cca Ser Pro Asn Pro gaa aat Glu Asn aat acg agt agt tat tcg ccc aaa cct gga.

Asn Thr Ser Ser Tyr Ser Pro Lys Pro Gly ttt gcc atc gga. ttg cag Phe Ala Ile Giy Leu Gin gca ata aat gca. gtc gct Ala Ile Asn Aia Val Ala gcc gcg aat Ala Ala Asn aat aac caa aat caa atg ttg caa act acg cca cca. caa cag Asn Asn Gin Asn Gin Met Leu Gin Thr Thr Pro Pro Gin Gin cag cag Gin Gin tat cca. cca Tyr Pro Pro cac ccc ctt agt ggt tcg aaa cac ttg His Pro Leu Ser Gly Ser Lys His Leu tgt tcc att Cys Ser Ile tgt gga gac cgc gcc agt gga aaa cat tat ggg gic tac agt tgt gag Cys Gly Asp Arg Ala Ser Gly Lys His Tyr Gly Val Tyr Ser Cys Giu 100 105 ggt tgt aaa Gly Cys Lys 110 ggg ttc ttc Gly Phe Phe aaa cgt acc gta cgc aag Lys Arg Thr Val Arg Lys 115 120 gac ttg aca tat Asp Leu Thr Tyr 388 WO 01/02436 WO 0102436PCT/AUOO/00799 get tgt egt gag gac aga Ala Cys Arg Glu Asp Arg 125 130 cgt tgc cag tat tgt cgt Arg Cys Gin Tyr Cys Arg 145 cgc gaa gcg gtc caa gag Arg Giu Ala Val Gin Giu 160 aga get Arg Ala 175 aat gtg Asn Val 190 cgt gat Arg Asp tct ttg Ser Leu tee atg Ser Met atg gtt Met Val 255 eca cat Pro His 270 get gge Ala Gly ggt get Gly Ala ggt get Gly Ala act ata Thr Ile 210 ggt gat Gly Asp 225 caa eac Gin His aaa caa Lys Gin aca cat Thr His aat gaa Asn Giu 290 aat tgc ASn Cys tat caa Tyr Gin gaa ega Giu Arg gge ggt Gly Gly 180 gge gga Gly Gly 195 gae egc Glu Arg eec gtg Asn Val gac tac Asp Tyr etc tac Leu Tyr 260 ttg cag Leu Gin 275 etg eta Leu Leu att ata Ile Ile aag tgt Lys Cys 150 eaa egt Gin Arg 165 ggt gga Gly Gly gaa gee Glu Asp ate att Ile Ile ttg ccc Leu Pro 230 aea gge Lys Gly 245 eaa atg Gin Met egt gag Arg Glu att gea Ile Ala gat aaa Asp Lys 135 tta get Leu Ala ggt act Gly Thr gga ggt Gly Gly ttt aaa Phe Lys 200 gaa gee Giu Ala 215 ttt ttg Phe Leu gcg gta Ala Val gtt gaa Val Giu get cag Asp Gin 280 aat gtt Asn Val 295 cee ega aat Gin Arg Asn 140 ggc atg aaa Gly Met Lys 155 get get aae Ala Ala Asn 170 ggt ggg gta Gly Gly Val age agt tea Ser Ser Ser caa aag get Gin Lys Ala 220 gtt ggc eec Val Gly Asn 235 eat etc tge His Leu Cys 250 gca cgt cga Ala Arg Arg eta ttg tta Leu LeU Lou tgg tge agt Trp Cys Ser 300 att gag tet etg gat gee gaa tat gee tct ect ggt aeg gte cat gee Ile Giu Ser Leu Asp Ala Giu Tyr Ala Ser Pro Gly Thr Val His Asp 964 WO 01/02436 WO 0102436PCT/AUOO/00799 cgt tca Arg Ser tog tat Ser Tyr gat cgt Asp Arg 355 gat cgc Asp Arg 370 gac ata Asp Ile aaa atc Lys Ile gat gat Asp Asp tcc atc Ser Ile 435 ggc gaa Gly Giu 450 ato tgo Ile Cys -1I1 310 cca gtg cgt cag Pro Val Arg Gin 325 Oat ogo aat agt His Arg Asn Ser 340 ato oto tog gag Ile Leu Ser Giu tog gag ttg tog Ser Giu Leu Ser 37 cgo ggt otg aaa Arg Gly Leu Lys 390 tat goo tgt otg Tyr Ala Cys Leu 405 ggc ogo ttt got Giy Arg Phe Ala 420 agt otc aaa tgt Ser Leu Lys Cys aga goa ttg gag Arg Ala Leu Glu 455 000 oaa oaa Pro Gin Gin 1012 1060 1108 1156 1204 1252 1300 1348 1396 taagaaattt gaaagttgta otaaaataaa 1447 aoacaacatc oaaaggactg tgttgtgaaa tgaatgatga tagagaaatt atttgttggt 1507 gottoaaaga atoaatogtt aaattaaaag gtgatoataa aggooaagoo tgggaagoat 1567 WO 01/02436 PCT/AUOO/00799 -12catataacac aaatggatac gatatttgaa tagtagcaat agttatattc agtctttttt 1627 attttttctt tttttttttt tttgtcaaca ttaatattct tgctctttat gtagattaat 1687 gaaaaacaaa acagaaaaca caacatacac aaagacacat ccatatacat ccaatactga 1747 tagcaaaaat aattgttgaa ttgatggcct tgttggtggt ggctgtgtat ctaagaattt 1807 attccctaaa atttggactt acatttaatt attaagctca taatatgtga ttgagctctt 1867 gctgcatttc cttaaccttt ccacacagtc tccaaaacag tctgttaatg gcgtgaagtg 1927 ataatgatct taagttattt tgcaaaccaa acaaaacgga tgttgaaaaa caaatatata 1987 atttataata atctctacaa atgactttat ttcaataatg acagctgata tttttatatg 2047 tacatgtatt ttagttaaaa tatgccttta aagtgtaaat catatagatt ttacttatat 2107 attatttaaa cattttttat gtttatattg ttttagatct gccttttttc aaaattcaat 2167 acgaatqaat ttaaaagttc aatactttag ttaaataatt tgacaaaaat acttattaca 2227 atatcacgtt taggtttttt ttactccttt actttagtta taaacatgtt tttattgtgt 2287 attatataaa tgaaaactga catacatact aacaaacact tatacataga tatattatac 2347 atacaaacat attaatatat tattaaatat agatatattt tattctgttg aaacaacaaa 2407 aaaaaaaaaa aaaactcgag actagttctc tccctcgtgc cgaatt 2453 <210> 4 <211> 467 <212> PRT <213> Lucilia cuprina <400> 4 Met Asp Asn Gly Glu Gin Asp Ala Gly Phe Arg Leu Ala Pro Met Ser 1 5 10 Pro Gin Giu Ile Lys Pro Asp Ile Ser Leu Leu Asn Giu Asn Asn Thr 25 Ser Ser Tyr Ser Pro Lys Pro Gly Ser Pro Asn Pro Phe Ala Ile Gly 40 WO 01/02436 WO 0102436PCT/AUOO/00799 13 Ala Ile Asn Ala Leu Gin Thr Thr Leu Ser Gly Ser Gly Lys His Tyr 100 Lys Arg Thr Val 115 Asn Cys Ile Ile Tyr Gin Lys Cys 150 GiU Arg Gin Arg 165 Giy Giy Gly Giy 180 Gly Gly Glu Asp 195 Giu Arg Ile Ile Asn VJai Leu Pro 230 Asp Tyr Lys Gly 245 Leu Tyr Gin Met 260 LeU Gin Arg Giu 275 Leu Leu Ile Ala Vai Ala Pro Pro Lys His Gly Val Arq Lys 120 Asp Lys 135 Leu Ala Gly Thr Giy Giy Phe Lys 200 Giu Ala 215 Phe Leu Ala Val Val Giu Asp Gin 280 Asn Val Ala Asn Ala Asn Asn Gin Asn Tyr Pro Cys Gly Gly Cys 110 Ala Cys 125 Arg Cys Arg Giu Ala Arg Ser Asn 190 Leu Arg 205 Giu Ser Asn Ser Gin Met Thr Pro 270 Lys Ala 285 Ile Glu Pro Asn Asp Arg Lys Giy Arg Giu Gin Tyr Ala Val 160 Ala Ala 175 Val Val Asp Leu Leu Ser Met Val 240 Val Asn 255 His Phe Gly Trp Ser Leu WO 01/02436 WO 0102436PCT/AUOO/00799 14 290 Asp Ala G1, 305 Arg Arg Se: Phe Ser Ty: Phe Asp Ar4 Ile Asp Aro 370 Pro Asp 114 385 Glu Lys 114 Gly Asp Asj Arg Ser 114 43! Ile Gly li 450 Pro Ile Cy 465 <210> (211> 1596 <212> DNA 300 His Asp 315 Leu Phe Ala Asn Lys Met Ala Ile 380 Asp Val 395 Cys Arg Leu Arg Leu Phe Ala Giu 460 Ser Phe Asn Gin 335 Val Ser 350 Arg Leu Leu Phe Val Cys Glu His 415 Pro Ala 430 Phe Arg Leu Giu <213> Lucilia cuprina.

<220> <221> CDS <222> (1593) <400> aattcggcac gagtcgacgc gaaaactttt cattcattag tcaaccagaa tatagacatt WO 01/02436 WO 0102436PCT/AUOO/00799 15 ctttgtttgt aaaaaaatct tgtaataatt aaaaatcaat tatcaaaact tatagttaaa tgtattaaat aaagattgtg tgtgacagaa acaaattagt gagatctctt gatacgggaa aatataatca aa atg gat aac ggc gag caa gat gct ggg ttc cga ttg gca Met Asp Asn Gly Glu Gin Asp Ala Gly Phe Arg Leu Ala 1 5 atg tct M1et Ser aat acg Asn Thr atc gga Ile Gly caa sat Gin Asn cca aat Pro Asm gac cgc Asp Arg a ggg Lys Gly cgt gag Arg Glu cag tat Gin Tyr gcg gtc WO 01/02436 WO 0102436PCT/AUOO/00799 16 Glu Ala Val 160 Gin Giu Giu Arg Gin Arg Gly Thr 165 Arg Ala 170 Ala Asn Ala aga gct Arg Ala 175 gct ggt gct ggc ggt ggt gga gga ggt ggt ggt ggg gta agc Ala Giy Ala Giy Gly Gly Gly Gly Gly Gly Gly Gly Val Ser aat gtg gtt ggt gct Asri Val Val Giy Ala 190 cgt gat ctc act ata Arg Asp Leu Thr Ile 210 gga gaa gac ttt Gly Giu Asp Phe ccc agc agt ica Pro Ser Ser Ser gaa cgc atc Glu Arg Ile aac gtg ttg Asn Val Leu att gaa Ile Glu 215 ccc ttt Pro Phe 230 gcc gag caa aag Ala Glu Gin Lys tct ttg agc Ser Leu Ser tcc atg gta Ser Met Val 240 ggt gat Gly Asp 225 ttg cgc gtt Leu Arg Val ggc aac eat Gly Asn Asn 235 ctc tgc cag Leu Cys Gin cae cec gac tac aaa ggc gcg gta Gin His Asp Tyr Lys Gly Ala Val 245 tct cat Ser His 250 951 atg gtt Met Val 255 eec aae cae ctc Asn Lys Gin Leu caa atg gtt gee Gin Met Val Glu tat gca cgt cga ace Tyr Ala Arg Arg Thr 265 cat ttt ace cat His Phe Thr His ceg cgt gag get Gin Arg Giu Asp ata cte ttg tta Ile Leu Leu Leu 999 1047 1095 gct ggc tgg Ala Gly Trp, eat ga Asn Glu 290 ctg cte att Leu Leu Ile gca eat Ala Asn 295 gtt gcc tgg tgc Val Ala Trp Cys gag tct ctg get gcc gee tat gcc tct cct ggt acg gta Glu Ser Leu Asp Ala Giu Tyr Ala Ser Pro Gly Thr Val cat gac ggt His Asp Gly 315 1143 tct ttt ggt Ser Phe Gly 320 cgg cgt tca cca gtg cgt ceg ccc cae caa ctc ttc ctt Arg Arg Ser Pro Val Arg Gin Pro Gin Gin Leu Phe Leu eat cag Asn Gin 335 aat ttc tcg tat Asn Phe Ser Tyr cgc eat agt gct Arg Asn Ser Ala att aeg gcc eat gtt Ile Lys Ala Asn Val 345 1239 WO 01/02436 WO 0102436PCT/AUOO/00799 17tca att ttc gat Ser Ile Phe Asp cgt atc ctc tcg gag ttg agc atC aaa atg Arg Ile Leu Ser Glu Leu Ser Ile Lys Met 355 360 cgc tcg gag ttg tcg tgt ctg aag gca atc Arg Ser Glu Leu Ser Cys Leu Lys'Ala Ile 375 380 1287 1335 cgt ctt aac Arg Leu Asn ctc ttc aat Leu Phe Asn gta tgt cgt Vai Cys Arg 400 atc gat Ile Asp 370 cca gac Pro Asp 385 ata cgc ggt Ile Arg Gly aaa tgt cga gcc Lys Cys Arg Ala gac gtc gag Asp Vai Giu 395 tgc cgc aca Cys Arg Thr 1383 gaa aaa atc tat gcc tgt ctg gac gaa Giu Lys Ile Tyr Ala Cys Leu Asp Giu 405 1431 gaa cat cca ggt gat gat Giu His Pro Gly Asp Asp 415 cgc ttt gct cag cta cta cta agg ttg Arg Phe Ala Gin Leu Leu Leu Arg Leu 425 1479 gca ttg cgt tcc Ala Leu Arg Ser agt ctc aaa tgt Ser Leu Lys Cys gat cat ttg ttt Asp His Leu Phe 1527 1575 ttc cgt tta Phe Arg Leu ttg gaa gct Leu Giu Ala ata ggc Ile Gly 450 gaa aga gca ttg Giu Arg Ala Leu gaa tta att gct Giu Leu Ile Ala cct atc tgc taa Pro Ilie Cys 465 1596 <210> 16 <211> 467 <212> PRT <213> Lucilia cuprina <400> 6 Met Asp Asn Gly Giu Gin Asp Ala Gly Phe Arg Leu Ala Pro Met Ser Asn Asn Thr Pro Gin Giu Ilie Lys Pro Asp Ile Ser Leu Leu Asn Giu WO 01/02436 WO 0102436PCT/AUOO/00799 18.- Ser Ser Leu Gin Gin Met His Pro Ala Ser Phe Phe Asp Arg 130 Cys Arg 145 Gin Giu Gly Ala Gly Ala Thr Ile 210 Gly Asp 225 Gin His Lys Gin Thr His Tyr Ser Pro Ala Ile Asn Leu Gin Thr Leu Ser Gly Gly Lys His 100 Lys Arg Thr 115 Asn Cys Ile Tyr Gin Lys Glu Arg Gin 165 Gly Gly Gly 180 Gly Gly Giu 195 Giu Arg Ile Asn Val Leu Asp Tyr Lys 245 Leu Tyr Gin 260 Leu Gin Arg Lys Pro Gly Ser Pro Asn 40 Ala Val Ala Ala Aia Asn 55 Thr Pro Pro Gin Gin Gin 70 Ser Lys His Leu Cys Ser Tyr Gly Vai Tyr Ser Cys 105 Val Arg Lys Asp Leu Thr 120 Ile Asp Lys Arg Gin Arg 135 Cys Leu Ala Cys Gly Met 150 155 Arg Gly Thr Arg Ala Ala 170 Gly Giy Gly Gly Gly Gly 185 Asp Phe Lys Pro Ser Ser 200 Ile Giu Ala Giu Gin Lys 215 Pro Phe Leu Arg Val Gly 230 235 Gly Ala Val Ser His Leu 250 Met Val Giu Tyr Ala Arg 265 Giu Asp Gin Ile Leu Leu Pro Phe Ala Asn Gin Tyr Ile Cys Giu Gly Tyr Ala 125 Asn Arg 140 Lys Arg Asn Ala Val Ser Ser Leu 205 Ala Giu 220 Asn Asn Cys Gin Arg Thr Leu Lys WO 01/02436 WO 0102436PCT/AUOO/00799 19 Asn Asp 305 Arg Phe Phe Ile Pro 385 Giu Gly Arg 275 Leu Leu Ilie Glu Tyr Ala Ser Pro Val 325 Tyr His Arg 340 Arg Ile Leu 355 Arg Ser Glu Ile Arg Gly Ile Tyr Ala 405 Asp Gly Arg 420 Ile Ser Leu 4235 280 Val Ala Giy Thr Pro Gin Ala Ile 345 Leu Ser 360 Cys Leu Cys Arg Asp Glu Gin Leu 425 Leu Asp 440 285 Ser Ile 300 Asp Giy Phe Leu Asn Val Met Lys 365 Ile Ile 380 Val Glu Arg Thr Arg Leu Phe Phe 445 Giu Gin 460 Ilie Gly Giu Arg Ale Leu 450 Pro Ile Cys 465 <210> 7 <211> 1536 <212> DNA <213> Lucilia cuprina <220> <221> CDS Glu Leu Ile Ala Leu Giu Ala WO 01/02436 WO 0102436PCT/AUOO/00799 20 <222> (133)..(1533) <400> 7 aattcggcac gagaaaatct tgtaataatt aaaaatcaat tatcaaaact tatagttaaa tgtattaaat aaagattgtg tgtgacagaa acaaattagt gagatctctt gatacgggaa 120 aatataatca aa atg gat aac ggc gag caa gat gct ggg ttc cga ttg gca 171 Met Asp Asn Gly Gin Gin Asp Ala Gly Phe Arg Len Ala ccg atg Pro Met ict ccg cag gag ata aag cca gac att tca cta ctc aat gaa Ser Pro Gin Glu Ile Lys Pro Asp Ile Ser Leu Leu Asn Gin aat aat acg agt agt tat tcg ccc aaa cct gga agt cct aat cca Asn Asn Thr Ser Ser Tyr Ser Pro Lys Pro Gly Ser Pro Asn Pro 35 gcc atc gga. ttg cag gca ata aat gca gtc gct gcc gcg aat gcc Ala Ile Gly Len Gin Ala Ile Asn Ala Val Ala Ala Ala Asn Ala 267 aec cee eat caa atg ttg caa act acg cca cca caa cag Asn Gin Asn Gin Met Leu Gin Thr Thr Pro Pro Gin Gin cag cag tat Gin Gin Tyr tcc att tgt Ser Ile Cys cca cca aat Pro Pro Asn cac ccc ctt agt ggt tcg aaa cac ttg His Pro Len Ser Gly Ser Lys His Len gga gac Giy Asp cgc gcc agt gga aaa cat tat ggg gtc tac agt tgt gag ggt Arg Ala Ser Gly Lys His Tyr Gly Vai Tyr Ser Cys Giu Gly aaa ggg ttc ttc Lys Gly Phe Phe cgt acc gte cgc Arg Thr Val Arg gac ttg aca tat Asp Leu Thr Tyr tgt cqt gag gac Cys Arg Gin Asp aat tgc att Asn Cys Ile ata gat Ile Asp 135 aaa cga caa age Lys Arg Gin Arg tgc cag tat Cys Gin T1yr cgt tat caa Arg Tyr Gin eag tgt tta Lys Cys Len 150 gct tgt ggC Ala Cys Giy atg eaa cgc Met Lys Arg 155 WO 01/02436 WO 0102436PCT/AUOO/00799 -21gaa gcg gto Glu Ala Val 160 caa gag gaa cga caa cgt ggt act cgt Gin Glu Glu Arg Gin Arg Gly Thr Arg 165 got aac got Ala Asn Ala aga gct Arg Ala 175 gct ggt gct ggc Ala Gly Ala Gly ggt ggt Gly Gly 1S0 gga gga ggt ggt ggt ggg gta agc Gly Gly Gly Gly Gly Gly Val Ser 185 gtg gtt ggt got ggc gga gaa gac tft Val Val Gly Ala Gly Gly Glu Asp Phe 195 ccc agc agt tca Pro Ser Ser Ser cgt gat ctc: act Arg Asp Leu Thr gaa cgc atc att gaa gcc gag caa aag Giu Arg Ie Ile Glu Ala Glu Gin Lys 215 tot ttg agc: ggt gat aac gtg ttg ccc itt ttg cgc gtt Ser Leu Ser Gly Asp Asn Val Leu Pro Phe Leu Arg Val ggc aac aat Gly Asn Asn 235 ctc tgc cag Leu Cys Gin too atg gta Ser Met Val 240 caa cac gac tac Gin His Asp Tyr ggc gcg gta tct Gly Ala Val Ser atg gtt Met Val 255 aac ass caa ctc Asn Lys Gin Leu caa atg gtt ga Gin Met Val Giu gca cgt cga aca Ala Arg Arg Thr cat ttt aca cat His Phe Thr His got ggc tgg Ala Gly Trp gag tot ctg Giu Ser Leu tot itt ggt Ser Phe Gly 320 ast ga Asn Glu 290 gat gc Asp Ala 305 ttg cag ogt gag gat cag ata cia ttg tta aag Leu Gin Arg Giu Asp Gin Ile Leu Leu Leu Lys 275 280 285 otg ota att gcs aat gtt gcc tgg tgc agi att Leu Leu Ile Ala Asn Val Ala Trp Cys Ser Ile 295 300 gas tat gcc tot cot ggt acg gta cat gao ggt Giu Tyr Ala Ser Pro Gly Thr Val His Asp Gly 987 1035 1083 310 315 cgg ogt tos oca gig ogt cag ccc caa Arg Arg Ser Pro Val Arg Gin Pro Gin 325 oto tic ott Leu Phe Leu aat cag aat tic tog tat oat ogo aat agt got att aag goc aat gtt 17 1179 WO 01/02436 WO 0102436PCT/AUOO/00799 22 Asn Gin Asn Phe Ser Tyr His Arg Asn Ser Ala Ile Lys Ala Asn Val tca att ttc gat cgt atc ctc tcg gag Ser Ile Phe Asp Arg Ile Leu Ser Giu 355 agc atc aaa Ser Ile Lys 1227 cgt ctt aac atc Arg Leu Asn Ile cgc tcg gag ttg Arg Ser Giu Len tgt ctg aag gca Cys Len Lys Ala atc ata Ile Ile 380 1275 ctc ttc aat Len Phe Asn gta tgt cgt Val Cys Arg 400 gaa cat cca Giu His Pro 415 gac ata cgc ggt Asp Ile Arg Gly aaa tgt cga Lys Cys Arg gcc gac gtc gag Ala Asp Val Gin 395 1323 1371 gaa aaa atc Gin Lys Ile tat gcc Tyr Ala 405 tgt ctg gac gaa Cys Leu Asp Giu tgc cgc aca Cys Arg Thr ggt gat gat ggc cgc ttt gct cag Gly Asp Asp Gly Arg Phe Ala Gin 420 cta cta agg ttg Leu Len Arg Leu 1419 gca ttg cgt tcc atc agt ctc aaa tgt Ala Leu Arg Ser Ile Ser Leu Lys Cys 435 gat cat ttg ttt Asp His Len Phe 1467 ttc cgt tta ata Phe Arg Leu Ile gaa aga gca ttg Gin Arg Ala Leu gee tta att gct Gin Leu Ile Ala 1515 ttg gaa gct Len Gin Ala cct atc tgc ta Pro Ile Cys 465 1563 <210> 8 <211> 467 <212> PRT <213> LnCilia cuprina <400> 8 Met Asp Asn Gly Gin Gin Asp Ala Gly Phe Arg Leu Ala Pro Met Ser 1 5 10 Pro Gin Gin Ile Lys Pro Asp Ile Ser Len Len Asn Gin Asn Asn Thr WO 01/02436 PCT/AUOO/00799 -23- 25 Ser Ser Tyr Ser Pro Lys Pro Gly Ser Pro Asn Pro Phe Ala Ile Gly 40 Leu Gin Ala Ile Asn Ala Val Ala Ala Ala Asn Ala Asn Asn Gin Asn 55 Gin Met Leu Gin Thr Thr Pro Pro Gin Gin Gin Gin Tyr Pro Pro Asn 70 75 His Pro Leu Ser Gly Ser Lys His Leu Cys Ser IleCys Gly Asp Arg 90 Ala Ser Gly Lys His Tyr Gly Val Tyr Ser Cys Giu Gly Cys Lys Gly 100 105 110 Phe Phe Lys Arg Thr Val Arg Lys Asp Leu Thr Tyr Ala Cys Arg Glu 115 120 125 Asp Arg Asn Cys Ile Ile Asp Lys Arg Gin Arg Asn Arg Cys Gin Tyr 130 135 140 Cys Arg Tyr Gin Lys Cys Leu Ala Cys Gly Met Lys Arg Glu Ala Val 145 150 155 160 Gin Glu Glu Arg Gin Arg Gly Thr Arg Ala Ala Asn Ala Arg Ala Ala 165 170 175 Gly Ala Giy Gly Gly Gly Gly Gly Gly Gly Gly Val Ser Asn Val Val 180 185 190 Gly Ala Gly Gly Giu Asp Phe Lys Pro Ser Ser Ser Leu Arg Asp Leu 195 200 205 Thr Ile Glu Arg Ilie Ile Glu Ala Giu Gin LYS Ala Giu Ser Leu Ser 210 215 220 Gly Asp Asn Val Leu Pro Phe Leu Arg Val Gly Ashi Asn Ser Met Val 225 230 235 240 Gin His Asp Tyr Lys Gly Ala Val Ser His Leu Cys Gin Met Val Asn 245 250 255 Lys Gin Leu Tyr Gin Met Val Giu Tyr Ala Arg Arg Thr Pro His Phe 260. 265 270 WO 01/02436 WO 0102436PCT/AUOO/00799 24 Thr His Leu Gin Arg Glu Asp 275 Asn Glu Leu Leu Ile Ala Asn 290 295 Asp Ala Giu Tyr Ala Ser Pro 305 310 Arg Arg Ser Pro Val Arg Gin 325 Phe Ser Tyr His Arg Asn Ser 340 Phe Asp Arg Ile Leu Ser Giu 355 Ile Asp Arg Ser Giu Leu Ser 370 375 Pro Asp Ile Arg Gly Leu Lys 385 390 Glu Lys Ile Tyr Ala Cys Leu 405 Giy Asp Asp Giy Arg Phe Ala 420 Arg Ser Ile Ser Leu Lys Cys 435 Ile Gly Giu Arg Ala Leu Giu 450 455 Pro Ile Cys 465 <210> 9 <211> 585 <212> DNA <213> Myzus persicae Gin Ile Leu Leu 280 Vai Ala Trp Cys Gly Thr Val His 315 Pro Gin Gin Leu 330 Ala Ile Lys Ala 345 Leu Ser Ile Lys 360 Cys Leu Lys Ala Cys Arg Ala Asp 395 Asp Giu His Cys 410 Gin Leu.Leu Leu 425 Leu Asp His Leu 440 Giu Leu Ile Ala Glu Gin 460 Leu Glu Ala WO 01/02436 PCT/AUOO/00799 25 <220> <221> CDS <222> <400> 9 gcc att gtt aat gga ttt atc cgc acc att agt Ala Ile Val Asn Gly Phe Ile Arg Thr Ile Ser WO 01/02436 WO 0102436PCT/AUOO/00799 Cys Gly gtg aaa Val Lys tac aaa Tyr Lys 26 Giu Pro Met Ile Met Gly Thr Pro Met Pro Thr Val Pro Tyr 165 170 175 cct. ttg agt tct ctc gtg ccg aat tcg gca cga gtc acg ggt Pro Leu Ser Ser Leu Val Pro Asn Ser Ala Arg Val Thr Gly 180 185 190 ttt Phe 195 <210> <211> 195 <212> PRT <213> Myzus persicae <400> Giu Phe Gly Thr 1 Leu Ile Leu Ile Arg Phe Leu Phe Val Cys Gly Asp Giu Gly Cys Lys Tyr Gin Cys Lys Arg Lys Cys Gin 100 Arg Pro Glu Cys 115 Giu Lys Lys Ala 130 Ile Ser Pro Glu Val Asn Leu Phe 25 Gin Pro 40 Gly Tyr Arg Arg Asn Cys Leu Lys 105 Giu Val 120 Lys Asp Ile Giu Ile Arg Thr Ile Ser Arg Leu Leu Aia Phe Glu Giu Leu Cys Leu Asn Ala Leu Thr Cys Thr Lys Asn Ala Val Asp Met Tyr Met Arg Leu Thr Val Gly Met 110 Ala Vai Lys Arg Lys 125 Lys Pro Asn 140 Pro Thr Giu Met WO 01/02436 WO 0102436PCT/AUOO/00799 -27 145 150 155 160 Cys Gly Glu Pro Met Ile Met Gly Thr Pro Met Pro Thr Val Pro Tyr 165 170 175 Val Lys Pro Leu Ser Ser Leu Val Pro Asn Ser Ala Arg Val Thr Gly 180 185 190 Tyr Lys Phe 195 <210> 11 <211> 208 <212> DNA <213> Myzus persicae <400> 11 catgcctgca ggtcgactct agaggatccc ctcgtccggt taccattaca acgcactcac ctgtgaaggc tgtaagggtt tctttcgacg gagtgttacc aaaaatgcgg tgtattgttg 120 taaatttggt catgcctgcg aaatggacat gtatatgcga cgtaaatgtc aggaatgtag 180 gctgaaaaaa tgtttggctg tgggcatg 208 <210> 12 <211> 436 <212> DNA <213> Myzus persicae <400> 12 catgcggccg gaatgtgtgg tgcccgaaaa ccagtgtgca atgaaacgac gcgaaaagaa agcacaaaaa gagaaggata aaatacagac cagtgtgtgt gcaacggaaa. ttaaaaagga 120 aatactcgat ttaatgacat gtgaaccgcc atcacatcca acgtgtccgc tgttacctga 180 agacattttg gctaaatgtc aagctcgtaa tatacctcct ttatcgtaca atcaattggc 240 agttatatat aaattaatat ggtatcaaga tggctacgaa cagccatccg aggaagatct 300 caaacgtata atgagttcac ccgatgaaaa tgaaagtcaa cacgatgcat catttcgtca 360 tataacagaa atcactatac taacagtaca attaattgtt gaatgtgcca aaggtctagg 420 WO 01/02436 WO 0102436PCT/AUOO/00799 -28gtaccgagct cgaatt <210> 13 <211> 1797 <212> DNA <213> Myzus persicae <220> <221> COS <222> (1)..(1797) <400> 13 atg atg gac cag aaa t Met Met Asp Gin Lys 1 5 gcc gcc ggt atc ggt c Ala Ala Gly Ile Gly C cgt ggc cgt ggc ggc z Arg Gly Arg Gly Gly 9I gtg gtg cag gtg gcc z Val Val Gin Val Ala 1 tcc gac gcc gtc atc cj Ser Asp Ala Val Ile N ccg cag cag caa. gtg Pro Gin Gin Gin Val agc gac atc gct ggc c Ser Asp Ile Ala Gly N 100 ggc ggt Gly Gly 10 gtc ggc Val Gly 25 atc atc Ile Ile agt tac Ser Tyr ccg cca Pro Pro cgc aac Arg Asn ctc agg Leu Arg 105 ggt ggt Gly Gly ggc ctc Gly Leu aaa ccc Lys Pro cac ggc His Gly Giy Gly ggc tgt Gly Cys gtc gct gct Val Ala Ala atg tcg tac Met Ser Tyr cgt agt cct Arg Ser Pro ctg ccg gcg Leu Pro Ala cac ttg ccc His Leu Pro tcc acc ctg Ser Thr Leu ccc gac gat tgg ttg gcc Pro Asp Asp Trp Leu Ala 110 gtc aac tcg ccg ccc gcc tct tcg ccc ggc acg tcg cac ata, tcc tac Val Asn Ser 115 Pro Pro Ala Ser 15120 125 Ile Ser Tyr WO 01/02436 WO 0102436PCT/AUOO/00799 ggc ggc ggt Gly Gly Gly 135 tcg ace aac Ser Tbr Asn aaa gaa gag Lys Glu Glu tcg gat ggg Ser Asp Gly 185 gtc gte aac Val Val Asn 200 gtg ctg aac Val Leu Asn 215 egg tcg tee Arg Ser Ser ggg ttC ttc Gly Phe Phe tac ggc aac Tyr Gly Asn 265 gag tgc egg Glu Cys Arg 280 gtt gta cet Val Val Pro 295 caa cga gaa ggc gge ggt Gly Gly Gly 140 age tac gac Ser Tyr Asp 155 ttg tct ccg Leu Ser Pro 170 ttg aag aag Leu Lys Lys acc tcg gca Thr Ser Ala aac cga cct Asn Arg Pro 220 ggt tac cat Gly Tyr His 235 cgg agg age Arg Arg Ser 250 aat tgc gaa Asn Cys Glu ctg aaa aaa Leu Lys Lys gaa gtt caa Glu Val Gin 300 aaa gat aaa ggc ggt Gly Gly tac agt Tyr Ser aac agc Asn Ser 175 aaa ctc Lys Leu 190 ggc ccc Gly Pro gaa gag Glu Glu aac get Asn Ala acc aag Thr Lys 255 gac atg Asp Met 2*70 ctg ace Leu Thr gea gta Ala Val aat tct WO 01/02436 PCT/AUOO/00799 Arg Lys Glu Lys Lys Ala Gin Arg Giu Lys Asp Lys Pro Asn Ser Thr 305 310 315 320 aca gec att tct cct gaa ata ate aaa ata gaa cct aca gag atg aag 1008 Thr Asp Ile Ser Pro Glu Ile Ile Lys Ile Giu Pro Thr Giu Met Lys 325 330 335 att gaa tgt ggt gaa cca atg ata atg ggc ace cct atg ccg act gta 1056 Ile Giu Cys Giy Giu Pro Met Ile Met Giy Thr Pro Met Pro Thr Val 340 345 350 cct tac gtg aaa cct ttg agt tct gaa caa aaa gaa ctg atc cac cga 1104 Pro Tyr Val Lys Pro Leu Ser Ser Giu Gin Lys Giu Leu Ile His Arg 355 360 365 ctt gtc tat ttc cag get caa tat gaa gct cct agt gee aaa gac atg 1152 Leu Val Tyr Phe Gin Asp Gin Tyr Giu Ala Pro Ser Glu Lys Asp Met 370 375 380 aaa cgt tta aca ata eat aat caa aat atg gat gaa tat gat gaa gaa 1200 Lys Arg Leu Thr Ile Asn Asn Gin Asn Met Asp Giu Tyr Asp Giu Giu 385 390 395 400 aaa caa egt gac acc aca tat cga atc atc act gag atg ace ate ctc 1248 Lys Gin Ser Asp Thr Tbr Tyr Arg Ile Ile Thr Giu Met Thr Ile Leu 405 410 415 ace gtt cee ctg att gtt gag ttt gcc aae cga tta cca ggt ttc gat 1296 Thr Val Gin Leu Ile Vai Gin Phe Aia.Lys Arg Leu Pro Giy Phe Asp 420 425 430 aaa ctt gta aga gaa gat cee atc act tta ctc aeg gct tgc tca egt 1344 Lys Leu Val Arg Glu Asp Gin Ile Thr Leu Leu Lys Aia Cys Ser Ser 435 440 445 gee gct etg etg ttc egg gte gce egg eag tat gec atc acc act gac 1392 Glu Ale Met Met Phe Arg Val Ala Arg Lys Tyr Asp Ile Thr Thr Asp 450 455 460 tca eta gtg ttt gct eac eec cag cce ttt tca gct get tca tat eec 1440 Ser Ile Val Phe Ale Asn Asn Gin Pro Phe Ser Ala Asp Ser Tyr Asn 465 470 475 480 eee gct gge ttg gge get gcc ett gee eec cee ctg tce ttc egt cgg 1488 Lys Aia Gly Leu Gly Asp Ale Ile Gin Asn Gin Leu Ser Phe Ser Arg 485 490 495 WO 01/02436 WO 0102436PCT/AU0O/00799 -31 ttt atg tac aat Phe Met Tyr Asn 500 gcc atc gtc ata Ala Ile Val Ile 515 gtg gag aaa atc Val GiU Lys Ile 530 gat aat cga gac Asp Asn Arg Asp 545 tca gta ctt aca Ser Val Leu Thr tgt atg aca ctg Cys Met Thr Leu 580 gaa ata tgg gat Glu Ile Trp Asp 595 gcc tta Ala Leu 510 gat ggt Asp Gly 525 aaa gct Lys Ala gcg cga Ala Arg aac tct Asn Ser oca ttc Pro Phe 590 1536 1584 1632 1680 1728 1776 1797 <210> 14 <211> 599 <212> PRT <213> Myzus persice <400> 14 Met Met Asp Gin Lys Cys Asp Val Gly Gly Gly Gly Val Ala Ala Ala 1 5 10 Ala Ala Gly Ile Giy Gly Gly Gly Val Gly Giy Leu Met Ser Tyr Asn 25 Arg Gly Arg Gly Gly Thr Glu Val Ile Ile Lys Pro Arg Ser Pro Ala 40 Val Val Gin Val Ala Thr Gly Gly Ser Tyr His Gly Leu Pro Ala Ala WO 01/02436 WO 0102436PCT/AUOO/00799 32 Ser Asp Pro Gin Ser Asp Val Asn Thr Val 130 Tyr Asn 145 Met Ser Ser Gly His Thr Gly Gly 210 Cys Leu 225 Thr Cys Ala Val Met Arg Gly Met 290 Gly His Cys Ser Asp Asp Ser His 125 Gly Gly 140 Asp Pro Pro Pro Lys Lys Ala Ser 205 Pro Pro 220 His Tyr Ser Ile Glu Ile Lys Cys 285 Gin Cys 300 WO 01/02436 PCT/AUOO/00799 -33.

Arg Lys Giu Lys Lys Ala Gin Arg Glu Lys Asp Lys Pro Asn Ser Thr 305 310 315 320 Thr Asp Ile Ser Pro Glu Ile Ile Lys Ile Giu Pro Thr Glu Met Lys 325 330 335 Ile Giu Cys Gly Glu Pro Met Ile Met Gly Thr Pro Met Pro Thr Val 340 345 350 Pro Tyr Val Lys Pro Leu Ser Ser Giu Gin Lys Glu Leu Ile His Arg 355 360 365 Leu Val Tyr Phe Gin Asp Gin Tyr Glu Ala Pro Ser Giu Lys Asp Met 370 375 380 Lys Arg Leu Thr Ile Asn Asn Gin Asn Met Asp Glu Tyr Asp Giu Giu 385 390 395 400 Lys Gin Ser Asp Thr Thr Tyr Arg Ile Ile Thr Glu Met Thr Ile Leu 405 410 415 Thr Val Gin Leu Ile Val Giu Phe Ala Lys Arg Leu Pro Gly Phe Asp 420 425 430 Lys Leu Val Arg Giu Asp Gin Ile Thr Leu Leu Lys Ala Cys Ser Ser 435 440 445 Giu Ala Met Met Phe Arg Val Ala Arg Lys Tyr Asp Ile Thr Thr Asp 450 455 460 Ser Ile Val Phe Aia Asn Asn Gin Pro Phe Ser Ala Asp Ser Tyr Asn 465 470 475 480 Lys Ala Gly Leu Giy Asp Ala Ile Giu Asn Gin Leu Ser Phe Ser Arg 485 490 495 Phe Met Tyr Asn Met Lys Val Asp Asn Ala Giu Tyr Ala Leu Leu Thr 500 505 510 Ala Ile Val Ile Phe Ser Ser Arg Pro Asn Leu Leu Asp Giy Trp Lys 515 520 525 Val Giu Lys Ile Gin Glu Ile Tyr Leu Giu Ser Leu Lys Ala Tyr Val 530 535 540 WO 01/02436 WO 0102436PCT/AUOO/00799 34 Arg Asp Arg Asp Thr Ala Thr Val Arg Tyr Ala Arg Leu Leu 550 555 560 Leu Thr Giu Leu Arg Thr Leu Gly Asn Glu Asn Ser Giu Leu 565 570 575 Thr Leu Lys Leu Lys Asn Arg Val Val Pro Pro Phe Leu Ala 580 585 590 Trp Asp Val Met Pro 595 <210> <211> 1131 <212> DNA <213> myzus persicae <220> <221> CDS <222> (1)..(1131) <400> atg tat tcc aac tcg tac Met Tyr Ser Asn Ser Tyr 1 5 gtc gat cgg aac agt atg Val Asp Arg Asn Ser Met ccg aat tac ccg ccc aac Pro Asn Tyr Pro Pro Asn tcc ata tgc ggc gat cgc Ser Ile Cys Gly Asp Arg tgc gag ggg tgc aaa ggg Cys Glu Gly Cys Lys Gly 70 tca tac gcg tgt cgc gaa Ser Tyr Ala Cys Arg Glu tat tca agt gac Tyr Ser Ser Asp 10 aat tct tgc aac Asn Ser Cys Asn 25 ctc agc ggt tcg Leu Ser Gly Ser gga aaa cat tac Gly Lys His Tyr aaa cgc aca gtg Lys Arg Thr Val aaa tgc atc atc Lys Cys Ile Ile 90 tta tac Leu Tyr caa gac Gin Asp cat ctg His Leu qtc tac Vai Tyr aaa aat Lys Asn aag cgc Lys Arg WO 01/02436 PCT/AUOO/00799 cga aet cgg tgc caa tac tgc agg tat caa aaa tgt ttg acc atg ggc 336 Arg Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys Cys Leu Thr Met Gly 100 105 110 atg aaa aga gaa gct gtg cag gaa. gaa aga caa cgt aca aaa gaa cga 384 Met Lys Arg Giu Ala Val Gin Giu Giu Arg Gin Arg Thr Lys Giu Arg 115 120 125 gat cat aat aac atc gaa gtt gaa ccc acg egc agt tct eat act gat 432 Asp His Asn Asn Ile Giu Val Gin Pro Thr Ser Ser Ser Asn Thr Asp 130 135 140 atg cca gtg gaa ctc eta tta agg gct gag aat aaa gct gat gct ata 480 Met Pro Val Giu Leu Ile Len Arg Ala Glu Asn Lys Ala Asp Ala Ile 145 150 155 160 aag act gee cae cag tat ata gag caa cga cat cot caa cat act gtt 528 Lys Thr Giu Gin Gin Tyr Ile Gin Gin Arg His Pro Gin His Thr Val 165 170 175 ggt got att tgt caa gca act gao aeg cag tte ate caa. ctt gtt gee 576 Gly Ala Ile Cys Gin Ala Thr Asp Lys Gin Leu Ile Gin Leu Val Gin 180 185 190 tgg gcc aeg cat ata ccg cat ttt aaa eat tta cct ota. ggc gat cee 624 Trp Ala Lys His Ile Pro His Phe Lys Asn Leu Pro Leu Gly Asp Gin 195 200 205 gtt tta tta ttg age gct ggt tgg aat gag ttg atg att gca gca ttt 672 Val Leu Leu Leu Arg Ala Gly Trp Asn Giu Leu Met Ile Ala Ala Phe 210 215 220 tcc cat aga toe atc egt gte aaa get ggt ate gtc tta got act gge 720 Ser His Arg Ser Ile Ser Val Lys Asp Gly Ile Val Leu Ale Thr Gly 225 230 235 240 ott act gtt gao age gat toe gct cac caa got ggt gtt gee gct eta 768 Len Thr Vel Asp Arg Asp Ser Ala His Gin Ala Gly Val Gin Ala Ile 245 250 255 ttt get cgt gte otc act gea ctc gtt gct aea atg age get atg ggt 816 Phe Asp Arg Val Leu Thr Gin Len Val Ala Lys Met Arg Asp Met Gly 260 265 270 atg get age aca gag ctt ggc tgt ttg cgt act ett ett Ott ttt eat 864 Met Asp Arg Thr Gin Leu Gly Cys Leu Arg Thr Ile Ile Len Phe Asn WO 01/02436 WO 0102436PCT/AUOO/00799 -36- 275 ggt tca Gly Ser 290 aag gtt Lys Val gaa cct Giu Pro tca att Ser Ile ggc gat Gly Asp 355 tca cat Ser His 370 280 cag tct Gin Ser 295 tta gaa Leu Glu gct aaa Ala Lys tgt ctg Cys Leu gat aca Asp Thr 360 gta gct Val Ala 375 285 gaa gtg caa Glu Val Gin 300 tgt cgt aca Cys Arg Thr 315 ctt Cgg ctt Leu Arg Leu tta ttc ttt Leu Phe Phe atg gaa gtt Met Glu Val 365 912 960 1008 1056 1104 <210> 16 <211> 377 <212> PRT <213> Myzus persicae <400> 16 Met Tyr Ser Asn Ser I1 1 Val Asp Arg Asn Ser I Pro Asn Tyr Pro Pro 7 Ser Ile Cys Gly Asp 1 Cys Giu Gly Cys Lys C Thr Met Tyr Met Asn Asn His Pro Leu 40 Ala Ser Gly 55 Phe Phe Lys Asp Arg Asn Val Ser Lys Tyr Gly Vai Arg WO 01/02436 PCT/AUOO/00799 -37- 70 75 Ser Tyr Ala Cys Arg Giu Giu Asn Lys Cys Ile Ile Asp Lys Arg Gin 90 Arg Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys Cys Leu Thr Met Giy 100 105 110 Met Lys Arg Giu Ala Val Gin Giu Glu Arg Gin Arg Thr Lys Giu Arg 115 120 125 Asp His Asn Asn Ile Giu Vai Giu Pro Thr Ser Ser Ser Asn Thr Asp 130 135 140 Met Pro Vai Giu Leu Ile Leu Arg Ala Giu Asn Lys Ala Asp Ala Ile 145 150 155 160 Lys Thr Giu Gin Gin Tyr Ile Giu Gin Arg His Pro Gin His Thr Vai 165 170 175 Giy Ala Ile Cys Gin Ala Thr Asp Lys Gin Lau Ile Gin Leu Vai Giu 180 185 190 Trp Ala Lys His Ile Pro His Phe Lys Asn Leu Pro Leu Gly Asp Gin 195 200 205 Val Leu Leu Leu Arg Ala Giy Trp Asn Giu Leu Met Ile Ala Ala Phe 210 215 220 Ser His Arg Ser Ile Ser Val Lys Asp Gly Ile Val Len Ala Thr Gly 225 230 235 240 Leu Thr Val Asp Arg Asp Ser Ala His Gin Ala Gly Val Giu Ala Ile 245 250 255 Phe Asp Arg Val Leu Thr Giu Leu Val Ala Lys Met Arg Asp Met Giy 260 265 270 Met Asp Arg Thr Giu Leu Giy Cys Leu Arg Thr Ile Ile Leu Phe Asn 275 280 285 Pro Giy Ser Lys Gly Leu Gin Ser Val Asn Giu Val Gin Val Leu Arg 290 295 300 Asp Lys Val Tyr Val Ala Leu Giu Giu Tyr Cys Arg Thr Thr His Pro 305 310 315 320 WO 01/02436 WO 0102436PCT/AUOO/00799 38 Glu G1u Pro Gly Arg 325 Arg Ser Ile Gly Leu 340 Ile Gly Asp Ser ProI 355 Ser Ser His Asp ValC 370 <210> 17 <211> 1131 <212> DNA <213> Myzus persicae <220> <221> CDS <222> (1)..(1131) <400> 17 atg tat tcc aac tcg t Met Tyr Ser Asn Ser 'I 1 5 gtc gat cgg aac agt Val Asp Arg Asn Ser 1 ccg aat tac ccg ccc e Pro Asn Tyr Pro Pro tcc ata tgc ggc gatC Ser Ile Cys Gly Asp 7 tgc gag ggg tgc aaa c Cys Glu Gly Cys Lys C tca tac gcg tgt cgc c Ser Tyr Ala Cys Arg C ?he Ala Lys Leu ,ys Cys Leu Glu 345 Ele Asp Thr Phe 360 ;ln Val Ala Thr 375 Leu Leu Axg Leu Pro Ser Leu 330 335 His Leu Phe Phe Tyr Lys Leu 350 Leu Met Giu Val Leu Glu Ser 365 tat tca Tyr Ser 10 aat tct Asn Ser 25 ctc agc Leu Ser gga aaa Gly Lys aaa cgc Lys Arg aaa tgc Lys Cys 90 tta tac Leu Tyr caa gac Gin -Asp cat ctg His Leu gtc tac Val Tyr aaa aat Lys Asn aag cgc Lys Arg WO 01/02436 WO 0102436PCT/AUOO/00799 -39tgc agg Cys Arg cag gaa Gin Glu 120 gtt gaa Val Glu 135 tta agg Leu Arg ata gag Ile Glu act gac Thr Asp cat ttt His Phe 200 ggt tgg Gly Trp 215 gta aaa Val Lys tca gct Ser Ala gaa ctc Glu Leu ggc tgt Gly Cys WO 01/02436 WO 0102436PCT/AUOO/00799 275 cca ggt tca Pro Gly Ser 290 gat aag gtt Asp Lys Val 305 gaa gaa cct Glu Glu Pro cgt tca att Arg Ser Ile att ggc gat Ile Gly Asp 355 tct tca cat Ser Ser His 370 <210> 18 <211> 377 <212> PRT <213> Myzus <400> 18 Met Tyr Ser 1 Val Asp Arg Pro Asn Tyr Ser Ile CyS Cys Glu Gly aaa ggt Lys Gly tat gtt Tyr Val gga cga Gly Arg 325 gga tta Gly Leu 340 tcc cca Ser Pro gac gtt Asp Val persicae Asn Ser 5 Asn Ser 1 Pro Pro Gly Asp Cys Lys( aat gaa Asn Giu tat tgt Tyr Cys 315 ctt ctt Leu .Leu 330 cat tta His Leu tta atg Leu M~et 912 960 1008 1056 1104 1131 Tyr Ser Ser Asn Ser Cys 25 Leu Ser Gly Gly Lys His Lys Arg Thr Arg Leu Val Gin Lys His Gly Val Arg Lys WO 01/02436 WO 0102436PCT/AUOO/00799 41 Ser Tyr Arg Asn Met Lys Asp His 130 Met Pro 145 Lys Thr Gly Ala Trp Ala Val Leu 210 Ser His 225 Leu Thr Phe Asp Met Asp Pro Gly 290 Asp Lys 305 Ala Cys Arg Cys 100 Arg Giu 115 Asn Asn VJal Glu Giu Gin Ile Cys 180 Lys His 195 Leu Leu Arg Ser Val Asp Arg Val 260 Arg Thr 275 Ser Lys Val Tyr 70 Arg Giu Gin Tyr Ala Val Ile Giu Leu Ile 150 Gin Tyr 165 Gin Ala Ile Pro Arg Ala Ile Ser 230 Arg Asp 245 Leu Thr Giu Leu Giy Leu Val Ala 310 75 Cys Ile Gin Lys Arg Gin Thr Ser Giu Asn 155 Arg His 170 Gin Leu Asn Leu Giu Leu Gly Ile 235 Gin Ala 250 Ala Lys Arg Thr Asn Giu Tyr Cys 315 Arg Gin Met Gly Giu Arg Thr Asp Ala le 160 Thr Val 175 Val Glu Asp Gln Ala Phe Thr Gly 240 Ala Ile 255 Met Gly Phe Asn Leu Arg His Pro 320 WO 01/02436 PCT/AUOO/00799 -42 Glu Glu Pro Gly Arg Phe Ala Lys Leu Leu Leu Arg Leu Pro Ser Leu 325 330 335 Arg Ser Ile Gly Leu Lys Cys Leu Giu His Leu Phe Phe Tyr Lys Lou 340 345 350 Ile Gly Asp Ser Pro Ile Asp rhr Phe Leu Met Glu Val Lou Giu Ser 355 360 365 Ser Ser His Asp Val Gin Val Ala Thr 370 375 <210> 19 <211> 1242 <212> DNA <213> Myzus persicae <220> <221> CDS <222> (1)..(1239) <400> 19 atg gac ggc acc gaa cga gga tta. aga ttg gac aat aat ctg tct ctg 48 Met Asp Gly Thr Giu Arq Gly Leo Arg Leu Asp Asn Asn Leo Ser Leu 1 5 10 agt tca atg ggt cct cag tcg ccc cta gac ctc aaa cct gac acg gca 96 Ser Ser Met Gly Pro Gin Ser Pro Leu Asp Lou Lys Pro Asp Thr Ala 25 act tta atg gtt aat ttc agt cct ccg gga gct cct cta agt cct gca 144 Thr Leo Met Val Asn Phe Ser Pro Pro Giy Aia Pro Leu Ser Pro Ala 40 gga tta tac agc gtc gat cgg aac agt atg atg aat aat tct tgc aac 192 Giy Lou Tyr Ser Vai Asp Arg Asn Ser Met Met Asn Asn Ser Cys Asn 55 gta caa gac tot ccg aat tac ccg ccc aac cat cca ctc agc ggt tcg 240 Val Gin Asp Ser Pro Asn Tyr Pro Pro Asn His Pro Leu Ser Gly Ser 70 75 aaa cat ctg tgc tcc ata tgc ggc gat cgc gcc agt gga. aaa cat tac 288 Lys His Lou Cys Ser Ile Cys Gly Asp Arg Ala Ser Gly Lys His Tyr WO 01/02436 PCT/AUOO/00799 43 90 gga gtc tac agc tgc gag ggg tgc aaa ggg ttc ttc aaa. cgc aca gtg 336 Gly Val Tyr Ser Cys Glu Gly Cys Lys Gly Phe Phe Lys Arg Thr Val 100 105 110 agg aaa aat ttg tca. tac gcg tgt cgc gaa gaa aac aaa. tgc atc atc 384 Arg Lys Asn Leu Ser Tyr Ala Cys Arg Giu Glu Asn Lys Cys Ile Ile 115 120 125 gac aag cgc caa cga aat cgg tgc caa tac tgc agg tat caa. aaa tgt 432 Asp Lys Arg Gin Arg Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys Cys 130 135 140 ttg acc aig ggc atg aaa aga gaa gct gtg cag gaa gaa aga caa cgt 480 Leu Thr Met Gly Met Lys Arg Glu Ala Val Gin Glu Glu Arg Gin Arg 145 150 155 160 aca. aaa gaa cga. gat cat aat aac aic gaa gtt gaa ccc acg agc agt 528 Thr Lys Glu Arg Asp His Asn Asn Ile Giu Val Giu Pro Thr Ser Ser 165 170 175 tct aat act gat atg cca gtg gaa ctc ata tta agg gct gag aat aaa 576 Ser Asn Thr Asp Met Pro Val Giu Leu Ile Leu Arg Ala Glu Asn Lys 180 185 190 gct gat gct ata aag act gaa caa cag tat ata gag caa. cga cat cct 624 Ala Asp Ala Ile Lys Thr Glu Gin Gin Tyr Ile Glu Gin Arg His Pro 195 200 205 caa cat act gtt ggt gct att tgt caa gca act gac eag cag tta ata 672 Gin His Thr Val Gly Ala Ile Cys Gin Ala Thr Asp Lys Gin Leu Ile 210 215 220 caa. ctt gtt gaa tgg gcc aag cat ata ccg cat ttt aaa. aat tta cct 720 Gin Leu Val Giu Trp Aia Lys His Ile Pro His Phe Lys Asn Leu Pro 225 230 235 240 cta. ggc gat caa. gtt tta tta ttg aga gct ggt tgg aat gag ttg atg 768 Leu Gly Asp Gin Val Leu Leu Leu Arg Ala Gly Trp Asn Giu Leu Met 245 250 255 att gca gca ttt tcc cat aga tca. atc agt gta aaa gat ggt ata gtc 816 Ile Ala Ala Phe Ser His Arg Ser Ile Ser Vai Lys Asp Gly Ile Val 260 265 270 WO 01/02436 WO 1/0436PCT/AULOO/00799 -44 tta gct act gga ctt act gtt Leu Ala Thr Gly Leu Thr Val 275 aga gat tca gct Arg Asp Ser Ala caa gct ggt Gin Ala Gly 864 gtt gaa gct ata. ttt gat cgt gta ctc act gaa VTal Glu Ala Ile Phe Asp Arg Val Leu Thr Glu gtt gct aaa atg Val Ala Lys Met gat atg ggt atg Asp Met Gly Met aga aca gag ctt Arg Thr Glu Leu tgt ttg cgt act Cys Leu Arg Thr att ctt ttt Ile Leu Phe gaa gta ctg Glu Val Leu ace aca cat Thr Thr His 355 aat cca Asn Pro 325 cgt gat Arg Asp 340 ggt tca. aaa ggt Gly Ser Lys Gly cag tct gig aat Gin Ser Val Asn 960 1008 1056 1104 aaq gtt tat gtt gcg tta gaa Lys Val Tyr Val Ala Leu Glu 345 cca gaa gaa cct gga cga ttt gct aa Pro Glu Glu Pro Gly Arg Phe Ala Lys 360 gea tat tgt cgt Glu Tyr Cys Arg 350 cta ctt ctt cgg Leu Leu Leu Arg 365 gaa cat tta ttc Glu His Leu Phe ctt cct Leu Pro 370 tca tta cgt tca Ser Leu Arg Ser gga tta aaa tgt Gly Leu Lys Cys 1152 1200 tat aaa ctt at Tyr Lys Len Tie gat tcc cca att Asp Ser Pro Tie aca ttt tta atq Thr Phe Leu Met gtt ctc. gae tca Val Leu Glu Ser tca cat gac gtt Ser His Asp Val gta gct aca tga Val Ala Thr 1242 <210> <211> 413 <212> PRT <213> Myzus persicae <400> Met Asp Gly Thr Glu Arg Gly Leu Arg Leu Asp Asn Asn Leu Ser Leu 1 WO 01/02436 WO 0102436PCT/AUOO/00799 45 Gin Ser Phe Ser Asp Arg Asn Tyr Ile Cys Gin Gly Tyr Ala Asn Arg 135 Lys Arg 150 His Asn Pro Vai Thr Gin Ala Ile 215 Ala Lys 230 Len Leu His Arg Lys Pro Pro Leu Asn Asn Pro Leu Ser Gly Phe Lys Asn Lys 125 Arg Tyr 1*20 Gin Gin Giu Pro Arg Ala 190 Ile Giu Thr Asp 220 His Phe 235 Gly Trp, Val Lys WO 01/02436 WO 0102436PCT/AUOO/00799 -46 260 265 270 Leu Ala Thr Gly Leu Thr Val Asp Arg Asp Set Ala His Gin Ala Gly 275 280 285 Val Glu Ala Ilie Phe Asp Arg Val Leu Thr Glu Leu Val Ala Lys Met 290 295 300 Arg Asp Met Gly Met Asp Arg Thr Glu Leu Gly Cys Leu Arg Thr Ile 305 310 315 320 Ile Leu Phe Asn Pro Gly Ser Lys Gly Lau Gin Ser Val Asn Glu Val 325 330 335 Glu Val Leu Arg Asp Lys Val Tyr Val Ala Leu Glu Glu Tyr Cys Arg 340 345 350 Thr Thr His Pro Giu Glu Pro Gly Arg Phe Ala Lys Leu Leu Leu Arg 355 360 365 Leu Pro Ser Leu Arg Ser Ile Gly Leu Lys Cys Leu Glu His Leu Phe 370 375 380 Phe Tyr Lys Leu Ile Gly Asp Ser Pro Ile Asp Thr Phe Leu Net Glu 385 390 395 400 Val Leu Giu Ser Ser Set His Asp Val Gin Val Ala Thr 405 410 <210> 21 <211> 150 <212> DNA <213> Lucilia cuprina.

<220> <221> COS <222> <400> 21 aattctgc gaa gga tgc aag gga. ttc ttc aaa cgt acc gta cgc aag gac Giu Gly Cys Lys Gly Phe Phe Lys Arg Thr Vai Arg Lys Asp 1 5 ttg aca tat gct tgt cgt gag gac aga aat tgc att eta gat aaa cga 98 Leu Thr Tyr Ala Cys Arg Glu Asp Arg Asn Cys Ile Ile Asp Lys Arg 20 25 WO 01/02436 WO 0102436PCT/AUOO/00799 -47 caa aga aat cgt tgc cag tat tgt cgc tac caa aag tgatcgatac cgtcga 150 Gin Arg Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys <210> 22 <211> 42 <212> PRT <213> Lucilia cuprina <400> 22 Glu Giy Cys Lys Gly Phe Phe Lys Arg Thr Val Arg Lys Asp Leu Thr 1 5 10 Tyr Ala Cys Arg Giu Asp Arg Asn Cys Ile Ile Asp Lys Arg Gin Arg 25 Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 23 cggaattccg cctcnggnta ycaytayaay gc 32 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:priier <400> 24 cgcggatccr cactcctgac actttcgyct ca 32 <210> <211> 23 <212> DNA WO 01/02436 PCT/AU00/00799 -48- <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> gcctcggggt atcactataa cgc 23 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 26 gcactcctga cactttcgtc tea 23 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 27 tcgtccggtt accattacaa cgc 23 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 28 tagacctttg gcraaytcna caat 24 <210> 29 <211> 37 WO 01/02436 PCT/AUOO/00799 -49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 29 tcgacatata acttcgctgc agatgcatcc gagctct 37 <210> <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> ctagagctcg gatgcatctg cagcgaagtt atatg <210> 31 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 31 tccagaaccg cggatagata tctgggatcc tc 32 <210> 32 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 32 ggagaggatc ccagatatct atccgcggtt ct 32 <210> 33 WO 01/02436 WO 0102436PCT/AUOO/00799 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 33 gatccatggg acaccatcac catcaccata ggccttccga acgcggtgaa ttccgaca 58 <210> 34 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 34 agcttgtcgg aattcaccgc gttcggaagg cctatggtga tggtgatggt. gtcccatg 58 <210> <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonuclectide <400> ccgggatctc gagat~gact acaaqgacga cgatgacaag cc 42 <210> 36 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:oligonucleotide <400> 36 catgggcttg tcatcgtcgt ccttgtagtc catctcgaga tc 42 WO 01/02436 WO 0102436PCT/AUOO/00799 -51 <210> 37 <211> 91 <212> DNA <213> Bemisia tabaci <220> <221> CDS <222> (91) <400> 37 c aag agg aca gtt egg aaa. gac ttg tct tat get tgc cgt gaa gaa aag 49 Lys Arg Thr Val Arg Lys Asp Leu Ser Tyr Ala Cys Arg Glu Glu Lys 1 5 10 aac tgt ctg att gat aag agg caa agg aat cga tgt caa tat 91 Asn Cys Leu Ile Asp Lys Arg Gin Arg Asn Arg Cys Gin Tyr 25 <210> 38 <211> <212> PRT <213> Bemisia tabaci <400> 38 Lys Arg Thr Val Arg Lys Asp Leu Ser Tyr Ala Cys Arg Giu Glu Lys 1 5 10 Asn Cys Leu Ile Asp Lys Arg Gin Arg Asn Arg Cys Gin Tyr 25 <210> 39 <211> 1491 <212> DNA <213> Bemisia tabaci <220> <221> CDS <222> (1488) <400> 39 atg agt gaa aaa gaa aat gaa gca aaa aag att aaa ett gat tee tet 48 Met Ser Glu Lys Giu Asn Glu Ala Lys Lys Ile Lys Leu Asp Ser Ser 1 5 10 ggt att ggt eta ata gaa tea tee gee tct aae gga get ate atg ttg 9 96 WO 01/02436 PCT/AUOO/00799 -52- Gly Ile Gly Ile Ile Giu Ser Ser Giu Ser Asn Gly Ala Ile M~et Leu 25 aac gat tct aca tct aat tgt cca tca cct tca. cca tct cgt gtg gtt 144 Asn Asp Ser Thr Ser Asn Cys Pro Ser Pro Ser Pro Ser Arg Val Val 40 cat ata. cgg aat gtt ccc ata gaa gct act gaa. aat gat gtt ctc agt 192 His Ile Arg Asn Val Pro Ile Giu Ala Thr Giu Asn Asp Val Leu Ser 55 att ggt act cca ttt ggt gag atc acc aat gtt ctt ttg gtg aga. gga 240 Ile Giy Thr Pro Phe Gly Gu Ile Thr Asn .Vai Leu.Leu Vtal Arg Gly 70 75 aaa ggt caa gcc ttc tta gag ttt gtt gac tca ttc tct gct caa caa 288 Lys Giy Gin Ala Phe Leu Giu Phe Val Asp Ser Phe Ser Ala Gin Gin 90 atg gtt aac tgt tgg tct gat Cct aec aac tca. ccg atg caa ctt tgt 336 Met Val Asn Cys Trp Ser Asp Pro Asn Asn Ser Pro Met Gin Leu Cys 100 105 110 att cgg gga aga caa gta tgt gtc cag ttt tca aag cac aaa gaa ctt 384 Ile Arg Gly Arg Gin Val Cys Val Gin Phe Ser Lys His Lys Giu Leu 115 120 125 aaa. aaa tct ctt ott gga aca aat gct ggt tca gac agc agc tat caa 432 Lys Lys Ser Leu Leu Gly Thr Asn Ala Gly Ser. Asp Ser Sar Tyr Gin 130 135 140 agi aca tot cot oaa aat agt aga cat ata ago aac ggt gat tct gtt 480 Ser Thr Ser Pro Gin Asn Ser Arg His Ile Ser Asn Giy Asp Ser Val 145 150 155 160 gga gca agt tcc gtt ttc tct aat cca aat cat oct ita ago gga tca 528 Gly Ala Ser Ser Val Phe Ser Asn Pro Asn His Pro Leo Ser Gly Ser 165 170 175 aaa cat ctc tgt tct att tgt ggt gat cga gcc tot ggg aaa cat tat 576 Lys His Leu Cys Ser Ile Cys Gly Asp Arg Ala Ser Gly Lys His Tyr 180 185 190 ggt gtt tac agt tgt gaa gga tgt aaa gga itt itt aaa agg act gtt 624 Gly Val Tyr Ser Cys Giu Gly cys Lys Gly Phe Phe Lys Arg Thr Val 195 200 205 WO 01/02436 WO 0102436PCT/AUOO/00799 -53cgt aaa gat Arg Lys Asp 210 ttg tct tat Leu Ser Tyr tgt cgg gaa gaa Cys Arg Giu Glu gat tgt atc ata Asp CYS Ile Ile aga cga caa agg Arg Arg Gin Arg agg tgt caa tac Arg Cys Gin Tyr aga tat cag aaa Arg Tyr Gin Lys ctc gct atg gga Leu Ala Met Gly aaa aga gaa gcc Lys Arg Glu Ala caa gaa gaa aga Gin Giu Giu Arg eat aaa gee Asn Lys Giu aat gat atg Asn Asp Met 275 agt gaa aac gag Ser Giu Asn Giu gaa agt aca Giu Ser Thr cct atc gea aga Pro Ile Giu Arg ctg gaa gct gaa Leu Glu Ala Giu agt aac tca cag Ser Asn Ser Gin 270 tta cga gtg gaa Leu Arg Val Glu 285 agt gat atc tgt Ser Asp Ile Cys cct aag Pro Lys 290 aat gaa gac ata Asn Glu Asp Ile tct cga gat ccc Ser Arg Asp Pro gcg gca gat cga Ala Ala Asp Arg ctt tac caa tta Leu Tyr Gin Leu gaa tgg gct aag Giu Trp Ala Lys 912 960 1008 1056 att cct cat ttc acc: Ile Pro His Phe Thr 325 aaa tca gga tgg eat Lys Ser Gly Trp Asn 340 gag tta ccc gtt gaa Giu Leu Pro Val Giu 330 gat caa gtt att Asp Gin Val Ile gag ctt ctc Glu Leu Leu att gre Ile Ala 345 ggc ttt tct cat cgt tca Gly Phe Ser His Arg Ser 350 atg tca gtt aaa get ggt etc etg Met Ser Val Lys Asp Gly Ile Met 355 360 tte grc act ggt Leu Ala Thr Gly ttg gtt gtt cat Leu Val Vai His 365 ttt gat cgc gtg Phe Asp Arg Val 1104 age aac Arg Asn 370 tgt gct cat caa gcg ggt gta ggt gct Cys Ala His Gin Ala Giy Val Gly Ala 375 1152 tte act gaa tta gtg gct aaa atg aga gae atg aaa atg gac: aaa act 10 1200 WO 01/02436 WO 0102436PCT/AUOO/00799 54 Arg Glu Met Lys Met Leu Thr Glu Leu Val Ala Lys Met 385 390 Asp Lys Thr 395 400 tct att Ser Ile caa gtt Gin Val tgt aga Cys Mig 440 ctt cgt Leu Arg 455 tta ttt Leu Phe tta ttt aat ccc Leu Phe Asn Pro 410 aat tta cgt gaa.

Asn Leu Arg Glu act tat cct gat Thr Tyr Pro Asp 445 cct gcc tta cgg Pro Ala Leu Arg 460 ttc aaa ttg gtt.

Phe Lys Leu Val 475 1248 1296 1344 1392 1440 1488 tct att gac agt ttc ttg ttg rcc atg tta gaa tct aat tca gac tca Se Ile Asp Set Phe 485 tag <210> <211> 496 <212> PRT <213> Bemisia tabac: <400> Met Ser Glu Lys Glu 1 5 Gly Ile Gly Ile Ile Asn Asp Ser Thr Ser His Ile Arg Asn Val Leu Leu Ser Met Leu Glu 490 Ser Asn Ser Asp Ser 495 Asn Giu Ala Lys Lye Ile Lys Leu Asp Ser Set 10 Giu Ser Ser Giu Ser Asn Gly Ala Ile Met Leu 25 Asn Cys Pro Ser Pro Ser Pro Ser Arg Val Val 40 Pro Ile Glu Ala Thr Giu Asn Asp Val Leu Ser 55 WO 01/02436 WO 0102436PCT/AUOO/00799 55 Ile Gly Lys Gly Met Val Ile Arg Lys Lys 130 Ser Thr 145 Gly Ala Lys His Gly Val Arg Lys 210 Asp Arg 225 Leu Ala Asn Lys Asn Asp Val Leu Ser Phe Ser Pro Ser Lys Ser Asp 140 Ser Asn 155 His Pro Ala Ser Phe Phe Glu Arg 220 Cys Arg 235 Gin Glu Ser Thr Ala Glu Pro Val 300 Pro Lys Asn Glu Asp Ile Asp 290 295 Ser Arg Asp Ser Asp Ile Cys WO 01/02436 PCT/AUOO/00799 -56- Gin Ala Ala Asp Arg Gin Len Tyr Gin Leu Ile Giu Trp Ala Lys His 305 310 315 320 Ile Pro His Phe Thr Gin Len Pro Val Giu Asp Gin Val Ile Leu Len 325 330 335 Lys Ser Gly Trp Asn Giu Len Leu Ile Ala Gly Phe Ser His Arg Ser 340 345 350 Met Ser Val Lys Asp Gly Ile Met Leu Ala Thr Gly Leu Vai Val His 355 360 365 Arg Asn Cys Ala His Gin Ala Gly Val Giy Aia Ile Phe Asp Arg Val 370 375 380 Leu Thr Glu Len Val Ala Lys Met Arg Gin Met Lys Met Asp Lys Thr 385 390 395 400 Gin Len Gly Cys Len Arg Ser Ile Val Len Phe Asn Pro Gin Ala Lys 405 410 415 Gly Len Lys Ser Thr Gin Gin Val Giu Asn Len Arg Gin Lys Val Tyr 420 425 430 Ala le Len Giu Giu Tyr Cys Arg Gin Thr Tyr Pro Asp Gin Ser Giy 435 440 445 Arg Phe Ala Lys Leu Leu Leu Arg Len Pro Ala Len Arg Ser Ile Giy 450 455 460 Len Lys Cys Len Gin His Leu Phe Phe Phe Lys Leu Val Gly Asn Thr 465 470 475 480 Ser Ile Asp Ser Phe Leu Leu Ser Met Leu Gin Ser Asn Ser Asp Ser 485 490 495 <210> 41 <211> 101 <212> DNA <213> Bemisia tabaci <220> <221> CDS <222> WO 01/02436 WO 0102436PCT/AUOO/00799 -57- <400> 41 c ctc acc tgc gaa ggc tgc aag ggc ttc ttc cgt cgg agc atc acc aag 49 Leu Thr Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ser Ile Thr Lys aat gcc gtc tac cag tgt aaa tat gga Asn Ala Val Tyr Gin Cys Lys Tyr Gly 25 aat aat tgt gaa Asn Asn Cys Glu atc gac atg Ile Asp Met tac a Tyr <210> 42 <211> 33 <212> PRT <213> Bemisia tabaci <400> 42 Leu Thr Cys Giu Gly Cys Lys Gly Phe Phe Arg Arg Ser Ile Thr Lys 1 5 10 Asn Ala Val Tyr Gin Cys Lys Tyr Gly Asn Asn Cys Glu Ile Asp Met 25

Claims

1. An isolated nucleic acid molecule encoding a member selected from the group consisting of: L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide set forth in SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8; (ii) L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence encoded by the DNA of L. cuprina contained in the plasmid deposited under AGAL Accession No. NM99/04565; (iii) M. persicae ecdysteroid receptor EcR polypeptide set forth in SEQ ID NO: 14; (iv) M. persicae ecdysteroid receptor EcR polypeptide sequence encoded by the DNA of M. persicae contained in the plasmid deposited under AGAL Accession No. NM99/04567; M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: (vi) M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence encoded by the DNA of M. persicae contained in the plasmid deposited under AGAL Accession No. NM99/04568 or AGAL Accession No. NM00/12581; (vii) insect ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide having at least about 90% identity to the B. tabacai ecdysteroid receptor partner protein (USP polypeptide) fragment set forth in SEQ ID NO: 38 or at least about 80% identity to the B. tabacai ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: (viii) insect ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide having at least about 80% identity to the B. AMENDED SHEET tPEA/AU /AU00/00799 P:PEMaoRCim M.PmCTAUOO 00799d.l IS My 200.1.do. llM., 2001 Rea~ced 14 May 2001 -91- tabacai ecdysteroid receptor partner protein (USP polypeptide) sequence encoded by the DNA of B. tabacai contained in the plasmid deposited under AGAL Accession No. NM00/12580; (ix) B. tabacai ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide encoded by nucleic acid that is capable of hybridizing under at least moderate stringency conditions to the DNA of B. tabacai contained in the plasmid deposited under AGAL Accession No. NM00/12580; B. tabacai ecdysteroid receptor EcR polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 42; (xi) B. tabacai ecdysteroid receptor EcR polypeptide encoded by nucleic acid that hybridizes under at least moderate stringency conditions to the complement of SEQ ID NO: 41; (xii) an amino acid sequence consisting of the ligand binding region of any one of to said ligand binding region comprising at least the hormone binding domain and/or a part of the linker domain of any one of to (xi); and (xiii) a fusion polypeptide between the ligand binding region of an ecdysteroid EcR polypeptide and the ligand binding region of an ecdysteroid partner protein (USP polypeptide) wherein at least one of said ligand binding regions comprises at least the hormone binding domain and/or a part of the linker domain of any one of to (xi).

2. The isolated nucleic acid molecule according to claim 1 wherein the ligand binding region comprises a linker domain of said EcR polypeptide or partner protein (USP polypeptide).

3. The isolated nucleic acid molecule according to claim 1 wherein the ligand binding region comprises a hormone binding domain of said EcR polypeptide or partner protein (USP polypeptide). AME- D SHEE IPAME D SHEETU IPEA/AU PCT/AUOO/00799 P:APER~MROCl1.mIPCT AU, aIW cli iI IS M 2001.doc-ll 2001 RecQiy d 14 Mity 2001 -92-

4. The isolated nucleic acid molecule according to claim 1 wherein the ligand binding region comprises at least a part of the linker domain and all of the hormone binding domain of said EcR polypeptide or partner protein (USP polypeptide). The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of the M persicae ecdysteroid receptor EcR polypeptide of SEQ ID NO 14.

6. The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of a B. tabacai ecdysteroid receptor EcR polypeptide, said EcR polypeptide comprising the amino acid sequence of SEQ ID NO 42 or encoded by nucleic acid that hybridizes under at least moderate stringency conditions to the complement of SEQ ID NO: 41.

7. The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of the L. cuprina ecdysteroid receptor partner protein (USP polypeptide) comprising an amino acid sequence selected from the group consisting of SEQ ID NO 4, SEQ ID NO 6 and SEQ ID NO: 8

8. The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of a B. tabacai ecdysteroid receptor partner protein (USP polypeptide) comprising the amino acid sequence set forth in SEQ ID NO:

9. The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of the M. persicae ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: 16. AMENDED SHF=-r IPEA/A',! I PCT/AU00/00799 P:OPER\MRO\Claim~\T AU m99 cWimr a M 2001.dol I Ma. ,2001 Received 14 May 2001 -93- The isolated nucleic acid molecule according to any one of claims 1 to 4 wherein the ligand binding region is the ligand binding region of the M. persicae ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: 18.

11. An isolated nucleic acid molecule comprising a sequence selected from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17; SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, the sequence of the L. cuprina DNA contained in the plasmid deposited under AGAL Accession No. NM99/04565, the sequence of the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04567, the sequence of the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04568, the sequence of the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM00/12581, the sequence of the B. tabacai DNA contained in the plasmid deposited under AGAL Accession No. NM00/12580, a sequence having at least 80% identity to SEQ ID NO: 37, a sequence having at least 60% identity to SEQ ID NO: 39, a sequence having at least 90% identity to SEQ ID NO: 41, a sequence having at least about identity to the B. tabacai DNA contained in the plasmid deposited under AGAL Accession No. NM00/12580, and a sequence of B. tabacai that hybridizes under moderate stringency conditions to the B. tabacai DNA contained in the plasmid deposited under AGAL Accession No. NM00/12580 or to the complement of SEQ ID NO: 37 or SEQ ID NO: 39 or SEQ ID NO: 41.

12. An isolated nucleic acid molecule encoding L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide or the ligand binding region of said polypeptide, said nucleic acid comprising a nucleotide sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7; and AMENDED SHEET IPEA/Ai.' PCT/AU00/00799 P:OPERMRO\Cimi\PCT AUWC )79cli ams aI 2 My 01M..do -I 21 Received 14 May 2001 -94- (ii) the sequence of the L. cuprina DNA contained in the plasmid deposited under AGAL Accession No. NM99/04565.

13. An isolated nucleic acid molecule encoding M. persicae ecdysteroid receptor EcR polypeptide or the ligand binding region of said polypeptide, said nucleic acid comprising a nucleotide sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 13; and (ii) the sequence of the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04567.

14. An isolated nucleic acid molecule encoding M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide or the ligand binding region of said polypeptide, said nucleic acid comprising a nucleotide sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19; and (ii) the sequence of the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04568 or AGAL Accession No. NM00/12581. An isolated nucleic acid molecule encoding B. tabacai ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor or the ligand binding region of said polypeptide, said nucleic acid comprising a nucleotide sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 37 or SEQ ID NO: 39; and (ii) the sequence of the B. tabacai DNA contained in the plasmid deposited under AGAL Accession No. NM00/12580. AMENDED SHEET IPEA/AU PCT/AU00/00799 P:\OPE\MRROC.aiWCTAUr M m nl9 an IAM.y 201.dc-IIM, 2 Received 14 May 2001

16. An isolated nucleic acid molecule encoding B. tabacai ecdysteroid receptor EcR polypeptide or the ligand binding region of said polypeptide, said nucleic acid comprising the sequence set forth in SEQ ID NO: 41.

17. A method of identifying nucleic acid encoding an insect ecdysteroid receptor polypeptide comprising: hybridizing genomic DNA, mRNA or cDNA of an insect with a hybridization- effective amount of one or more hybridization probes selected from the group consisting of: a probe comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41; a probe comprising at least 10 contiguous nucleotides in length from cDNA contained in the plasmid deposited under AGAL Accession No. NM00/12580; a probe comprising at least 10 contiguous nucleotides from residues 1 to about 450 of SEQ ID NO: 13; and a probe comprising at least 10 contiguous nucleotides of SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 that does not include a nucleotides 192 to 323 of SEQ ID NO: 15; and a probe having a sequence complementary to any one of to and (ii) detecting the hybridization.

18. The method of claim 17 wherein the step of detecting the hybridization comprises detecting a reporter molecule that is covalently bound to the probe.

19. A method of identifying nucleic acid encoding an insect ecdysteroid receptor polypeptide comprising: AMENDED SHEET IPE-/AU PCT/AU00/00799 Received 14 May 2001 P:\OPR\MRO\CirP CT AU0 0)799 s0l In lM y I 2001 .doc. I Mly, 2001 -96- annealing to genomic DNA, mRNA or cDNA one or more PCR primers selected from the group consisting of: a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41; a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in the plasmid deposited under AGAL Accession No. NM00/12580; a primer comprising at least 10 contiguous nucleotides from residues 1 to about 450 of SEQ ID NO: 13; and a primer comprising at least 10 contiguous nucleotides of SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 that does not include a nucleotides 192 to 323 of SEQ ID NO: 15; and a primer having a sequence complementary to any one of to and (ii) amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction. A method of identifying nucleic acid that encodes an insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide comprising: amplifying nucleic acid using one or more PCR primers selected from the group consisting of: a primer comprising at least 10 contiguous nucleotides in length from a nucleotide sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, and SEQ ID NO: 41; a primer comprising at least 10 contiguous nucleotides in length from cDNA contained in the plasmid deposited under AGAL Accession No. NM00/12580; AMENDED SHE-r- 1P EA"I PCT/AU00/00799 P:oPERMRO\Cm WCT AUUW (,799 wit MW I Received 14 May 2001 -97- a primer comprising at least 10 contiguous nucleotides from residues 1 to about 450 of SEQ ID NO: 13; and a primer comprising at least 10 contiguous nucleotides of SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 that does not include a nucleotides 192 to 323 of SEQ ID NO: (ii) hybridizing the amplified nucleic acid to genomic DNA, mRNA or cDNA of an insect; and (iii) detecting the hybridization.

21. The method of claim 20 wherein detecting the hybridization comprises detecting a reporter molecule that is covalently bound to the amplified nucleic acid.

22. The method according to any one of claims 17 to 21 further comprising isolating the identified nucleic acid molecule.

23. A gene construct comprising the isolated nucleic acid molecule according to any one of claims 1 to 16 operably linked to a promoter sequence.

24. The gene construct according to claim 23 wherein the promoter is selected from the group consisting of SV40 promoter, MMTV promoter, polyhedron promoter and promoter. A recombinant or isolated polypeptide comprising an amino acid sequence selected from the group consisting of: L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8; (ii) L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence encoded by the DNA of L. AMENDED SHEET IPELJ PCT/AU00/00799 P:\OPERRMRO\Cuml\PCTAUO 00799 clim at, May2001.d-ll 21 Received 14 May 2001 -98- cuprina contained in the plasmid deposited under AGAL Accession No. NM99/04565; (iii) M. persicae ecdysteroid receptor EcR polypeptide sequence set forth in SEQ ID NO: 14; (iv) M. persicae ecdysteroid receptor EcR polypeptide sequence encoded by the DNA of M. persicae contained in the plasmid deposited under AGAL Accession No. NM99/04567; M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: (vi) sequence of the M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence encoded by the DNA of M. persicae contained in the plasmid deposited under AGAL Accession No. NM99/04568 or AGAL Accession No. NM00/12581; (vii) insect ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide sequence having at least about 90% identity to the B. tabacai ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: 38 or at least about 80% identity to the B. tabacai ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: (viii) insect ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide having at least about 80% identity to the B. tabacai ecdysteroid receptor partner protein (USP polypeptide) sequence encoded by the DNA of B. tabacai contained in the plasmid deposited under AGAL Accession No. NM00/12580; (ix) B. tabacai ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide encoded by nucleic acid that is capable of hybridizing under at least moderate stringency conditions to the DNA of B. tabacai contained in the plasmid deposited under AGAL Accession No. NM00/12580; AMENDED .HEE, 1PEA.-' PCT/AU00/00799 P:\OPER\ROCamnPC AUL a007d m5mut IlM q1 May wlO.lac-l, I ceived 14 May 2001 -99- B. tabacai ecdysteroid receptor EcR polypeptide comprising the B. tabacai sequence set forth in SEQ ID NO: 42; (xi) B. tabacai ecdysteroid receptor EcR polypeptide encoded by nucleic acid that hybridizes under at least moderate stringency conditions to the complement of SEQ ID NO: 41; (xii) the ligand binding region of any one of to said ligand binding region comprising at least the hormone binding domain and/or a part of the linker domain of any one of to and (xiii) a fusion polypeptide between the ligand binding region of an ecdysteroid EcR polypeptide and the ligand binding region of an ecdysteroid partner protein (USP polypeptide) wherein at least one of said ligand binding regions comprises at least the hormone binding domain and/or a part of the linker domain of any one of to (xi).

26. The isolated or recombinant polypeptide according to claim 25 wherein the ligand binding region comprises a linker domain of said EcR polypeptide or partner protein (USP polypeptide).

27. The isolated or recombinant polypeptide according to claim 25 wherein the ligand binding region comprises a hormone binding domain of said EcR polypeptide or partner protein (USP polypeptide).

28. The isolated or recombinant polypeptide according to claim 25 wherein the ligand binding region comprises at least a part of the linker domain and all of the hormone binding domain of said EcR polypeptide or partner protein (USP polypeptide).

29. The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of the M. persicae ecdysteroid receptor EcR polypeptide of SEQ ID NO: 14. AMENDED SHEET IPEA/A I PCT/AU00/00799 P: oPERMRO\CJ.ai n C AUM 007c"ir ,m is My 20l. Io Ma,, 201 d 14 May 2001 -100- The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of a B. tabacai ecdysteroid receptor EcR polypeptide comprising the amino acid sequence of SEQ ID NO 42 or encoded by nucleic acid that hybridizes under at least moderate stringency conditions to the complement of SEQ ID NO: 41.

31. The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of the L. cuprina ecdysteroid receptor partner protein (USP polypeptide) comprising an amino acid sequence selected from the group consisting of SEQ ID NO 4, SEQ ID NO 6, and SEQ ID NO: 8.

32. The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of a B. tabacai ecdysteroid receptor partner protein (USP polypeptide) comprising the amino acid sequence set forth in SEQ ID NO:

33. The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of the M. persicae ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: 16.

34. The isolated or recombinant polypeptide according to any one of claims 25 to 28 wherein the ligand binding region is the ligand binding region of the M. persicae ecdysteroid receptor partner protein (USP polypeptide) set forth in SEQ ID NO: 18. A recombinant or isolated L. cuprina ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide or the ligand binding region of said polypeptide comprising an amino acid sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8; AMENDED SHEEi IPEAJAi0 PCT/AU00/00799 Received 14 May 2001 P:AOPERMRO\CIimiPCT AUwo 00799 dim 1 Moi 2001.de-ll May. 2001 101 (ii) the sequence of the ligand binding region of and (iii) the sequence encoded by the L. cuprina DNA contained in the plasmid deposited under AGAL Accession No. NM99/04565.

36. A recombinant or isolated M. persicae ecdysteroid EcR polypeptide or the ligand binding region of said polypeptide comprising an amino acid sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 14; (ii) the sequence of the ligand binding region of and (iii) the sequence encoded by the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04567.

37. A recombinant or isolated M. persicae ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide or the ligand binding region of said polypeptide comprising an amino acid sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: (ii) the sequence of the ligand binding region of and (iii) the sequence encoded by the M. persicae DNA contained in the plasmid deposited under AGAL Accession No. NM99/04568 or AGAL Accession No. NM00/12581.

38. A recombinant or isolated B. tabacai ecdysteroid receptor partner protein (USP polypeptide) or juvenile hormone receptor polypeptide or the ligand binding region of said polypeptide comprising an amino acid sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: (ii) the sequence of the ligand binding region of and AMENDEr% IPEAt PCT/AU00/00799 Received 14 May 2001 P:\OPER\MRO \CbiimlPCT ALO0 00799 cl a 15 My 200.doo-l I My, 2001 -102- (iii) the sequence encoded by the B. tabacai DNA contained in the plasmid deposited under AGAL Accession No. NM00/12580.

39. A recombinant or isolated B. tabacai ecdysteroid receptor EcR polypeptide or the ligand binding region of said polypeptide comprising an amino acid sequence selected from the group consisting of: a sequence comprising the sequence set forth in SEQ ID NO: 42; and (ii) the sequence of the ligand binding region of A cell comprising the isolated nucleic acid molecule according to any one of claims 1 to 16 or the gene construct according to claim 23 or 24.

41. The cell according to claim 40 being a prokaryotic or eukaryotic cell.

42. The cell according to claim 41, wherein the eukaryotic cell is an insect cell or a mammalian cell.

43. The cell according to claim 42 wherein the insect is Spodoptera frugiperda or the mammalian cell is a CHO cell.

44. A cell that expresses the isolated or recombinant polypeptide according to any one of claims 25 to 39. The cell according to claim 44, being an insect cell or a mammalian cell.

46. The cell according to claim 45 wherein the insect cell is derived from Spodoptera frugiperda or the mammalian cell is a CHO cell.

47. A method of identifying a modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression comprising: AMENDED SHEET IPEA/AU PCT/AU00/00799 Received 14 May 2001 P: OPERMRO CIaims\PC AUOO (0799 cla u a 1 May 2001.do-I I May. 2001 -103- assaying the expression of a reporter gene in the presence of the recombinant or isolated polypeptide according to any one of claims 25 to 39 and a potential modulator; (ii) assaying the expression of the reporter gene in the presence of the recombinant or isolated polypeptide according to any one of claims 25 to 39 and without said potential modulator; and (iii) comparing expression of the reporter gene at and (ii), wherein expression of said reporter gene is effected by the binding of said polypeptide to a steroid response element (SRE) or a promoter sequence comprising said SRE, and wherein a different level of expression at (iii) indicates that said potential modulator is a modulator of steroid receptor-mediated gene expression.

48. The method according to claim 47, wherein the SRE is the hsp27 ecdysone response element or the 13 bp core palindrome thereof.

49. The method according to claim 47, wherein the promoter is the SV40 promoter, MMTV promoter, p10 promoter or polyhedron promoter. The method according to any one of claims 47 to 49, wherein the reporter gene is the CAT gene or the P-galactosidase gene.

51. The method of claim 47 wherein the modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression is a steroid receptor antagonist or juvenile hormone receptor antagonist.

52. The method of claim 47 wherein the modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression is a steroid receptor agonist or juvenile hormone receptor agonist. AMENDED SHEET PFA/IAU PCT/AU00/00799 Received 14 May 2001 P.:oPER1MRO\Clai i PCT AUOU 00799 c;lati am l May o0l.oa-1I1 May, 2001 -104-

53. The method of claim 51 or 52, wherein the agonist or antagonist is a synthetic chemical that mimics the structure of a ligand of said receptor, thereby modulating binding of said ligand to said receptor.

54. The method of claim 53, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an ecdysteroid receptor or juvenile hormone receptor. A method of identifying a potential insecticidal compound comprising: assaying the binding directly or indirectly of the recombinant or isolated polypeptide according to any one of claims 25 to 39 to a steroid response element (SRE) to which said polypeptide binds, in the presence of a candidate compound; (ii) assaying the binding directly or indirectly of the recombinant or isolated polypeptide according to any one of claims 25 to 39 to a steroid response element (SRE) to which said polypeptide binds, in the absence of said candidate compound; and (iii) comparing the binding assayed at and wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.

56. The method according to claim 55, wherein the binding is assayed indirectly by determining the level of expression of a reporter gene which is placed operably under the control of the steroid response element (SRE) to which the isolated or recombinant polypeptide binds or a promoter sequence comprising said SRE.

57. The method according to claim 56, wherein the SRE is the hsp27 ecdysone response element or the 13 bp core palindrome thereof. AMENDED SHEEF IPEAli PCT/AU00/00799 Received 14 May 2001 P:AOPER\MRO.Cbli\PCT AUo 007"99 cium Is 1 My 2001.doc-I3M5I ei -105-

58. The method according to claim 56, wherein the promoter is the SV40 promoter, MMTV promoter, p10 promoter or polyhedron promoter.

59. The method according to any one of claims 56 to 58, wherein the reporter gene is the CAT gene or the P-galactosidase gene. The method according to any one of claims 55 to 59, wherein the potential insecticidal compound is an insect steroid receptor antagonist or insect juvenile hormone receptor antagonist.

61. The method according to any one of claims 55 to 59, wherein the potential insecticidal compound is an insect steroid receptor agonist or insect juvenile hormone receptor agonist.

62. The method of claim 60 or 61, wherein the agonist or antagonist is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or a juvenile hormone receptor, thereby modulating binding of said ligand to said receptor.

63. The method of claim 62, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor.

64. A method of identifying a candidate insecticidally-active agent comprising: expressing the recombinant or isolated polypeptide of claim 25 wherein said polypeptide is an EcR polypeptide or a ligand binding region comprising at least the hormone binding domain and a part of the linker region of said EcR polypeptide, optionally in association with the partner protein (USP polypeptide) of an insect ecdysteroid receptor or the ligand- binding region thereof so as to form a functional hormone-binding complex; VAMENDED SHEET IPEA/AU PCT/AU00/00799 PAOPERMROCmCTaA Ma 20 2001 Received 14 May 2001 P:\OPER\MRO\CbimiP'CT AUW OOT99 claims u a 15 Ma2y M .iloc-l I Mly. 2001 -106- (ii) purifying or precipitating the EcR polypeptide or ligand binding region or hormone binding complex; (iii) determining the three-dimensional structure of the ligand binding domain of the polypeptide or complex; and (iv) identifying a compound that binds to or associates with the three- dimensional structure of the ligand binding region, wherein said compound represents a candidate insecticidally-active agent. The method of claim 64, wherein the candidate insecticidally-active agent is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or a juvenile hormone receptor, thereby modulating binding of said ligand to said receptor.

66. The method of claim 65, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor.

67. A method of identifying a candidate insecticidally-active agent comprising: expressing the recombinant or isolated polypeptide of claim 25 wherein said polypeptide is a partner protein (USP polypeptide) or a ligand binding region comprising at least the hormone binding domain and a part of the linker region of said partner protein (USP polypeptide), optionally in association with the EcR polypeptide of an insect ecdysteroid receptor or the ligand-binding region thereof so as to form a functional hormone- binding complex; (ii) purifying or precipitating the partner protein (USP polypeptide) or ligand binding region or hormone binding complex; (iii) determining the three-dimensional structure of the ligand binding domain of the polypeptide or complex; and AMENDED SHEET dAUi r (iv) identifying a compound that binds to or associates with the three-dimensional structure of the ligand binding region, wherein said compound represents a candidate insecticidally-active agent.

68. The method of claim 67, wherein the candidate insecticidally-active agent is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or an insect juvenile hormone receptor, thereby modulating binding of said ligand to said receptor.

69. The method of claim 68, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid gylcoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor. A method of identifying a synthetic compound having insecticidal activity comprising contacting the recombinant or isolated polypeptide according to any one of claims 25 to 39 with said compound for a time and under conditions sufficient for binding to occur and detecting said binding using a detection means, wherein the occurrence of binding is indicative of potential insecticidal activity of the compound.

71. A hormone-binding complex that binds an insect ecdysteroid or binds a synthetic chemical that mimics the structure of said ecdysteroid, wherein said hormone-binding complex comprises: the ligand-binding region of an ecdysteroid receptor partner protein (USP polypeptide) according to any one of claims 25 to 28 or any one of claims 31 to 35 or claim 37 or 38; and (ii) the EcR polypeptide of an insect ecdysteroid receptor or the ligand binding region thereof.

72. A hormone-binding complex that binds an insect ecdysteroid or binds a synthetic chemical the mimics the structure of said ecdysteroid, wherein said hormone-binding complex comprises: the ligand-binding region of an EcR polypeptide according to any one of claims 25 to 30 or claim 36 or 39; and S* (ii) the ecdysteroid receptor partner protein (USP polypeptide) of an insect ecdysteroid receptor or the ligand-binding region thereof. 0 141599500 108

73. A hormone-binding complex that binds an insect ecdysteroid or binds a synthetic chemical that mimics the structure of said ecdysteroid, wherein said complex comprises: the ligand binding region of an EcR polypeptide according to any one of claims 25 to 30 or claim 36 or 39; and (ii) the ligand binding region of an ecdysteroid receptor partner (USP polypeptide) according to any one of claims 25 to 28 or any one of claims 31 to 35 or claim 37 or 38. o::ot 141599500