AU737769B2 - Novel genetic sequences encoding steroid and juvenile hormone receptor polypeptides and insecticidal modalities therefor - Google Patents

Description

WO 99/36520 PCT/AU99/00033 -1- NOVEL GENETIC SEQUENCES ENCODING STEROID AND JUVENILE HORMONE RECEPTOR POLYPEPTIDES AND INSECTICIDAL MODALITIES THEREFOR FIELD OF THE INVENTION The present invention relates generally to novel genetic sequences encoding receptor polypeptides and insecticidal modalities therefor, which insecticidal modalities are based upon non-polypeptide insect hormones and their receptors. More specifically, the present invention provides isolated nucleic acid molecules encoding polypeptides comprising functional steroid hormone and juvenile hormone receptors, in particular isolated nucleic acid molecules which encode polypeptides comprising the Lucilia cuprina and Myzus persicae ecdysone receptors and juvenile hormone receptors. In a particularly preferred embodiment, the present invention relates to isolated nucleic acid molecules which encode the L. cuprina and M. persicae EcR polypeptide subunits and EcR partner protein (USP polypeptide) subunits which form functional heterodimeric ecdysone receptor, and to the L. cuprina and M. persicae USP polypeptide of the juvenile hormone receptor. The present invention further relates to the production of functional recombinant insect receptors and recombinant polypeptide subunits thereof and derivatives and analogues thereof. The present invention further relates to the uses of the recombinant receptor and isolated nucleic acid molecules of the present invention in the regulation of gene expression. The present invention further relates to screening systems and methods of identifying insecticidally-active agents which are capable of agonising or antagonising insect receptor function, such as molecules and/or ligands which associate with steroid receptors or juvenile hormone receptors so as to modify the affinity of said receptors for their cognate cis-acting response elements (eg. insect steroid response elements, juvenile hormone response elements) in the genes which they regulate, or alternatively or in addition, which modify the affinity of said receptors for their cellular stimuli (eg. insect steroids or juvenile hormones) or analogues thereof, or alternatively or in addition, which act as insecticides by virtue of their ability to agonise or antagonise the activity of insect hormones, such as by mimicry of a ligand which binds to said receptor or a ligand-binding region thereof. The invention further extends to such compounds and/or ligands.

S

GENERAL

This specification contains nucleotide and amino acid sequence information prepared using the programme Patentln Version 2.0, presented herein after the bibliography. Each nucleotide WO 99/36520 PCT/AU99/00033 -2or amino acid sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier <210>1, <210>2, etc). The length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide and amino acid sequences referred to in the specification are defined by the information provided in numeric indicator field <400> followed by the sequence identifier (eg. <400>1, <400>2, etc).

The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.

Bibliographic details of the publications referred to in this specification are collected at the end of the description.

As used herein the term "derived from" shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, WO 99/36520 PCT/AU99/00033 -3individually or collectively, and any and all combinations or any two or more of said steps or features.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

BACKGROUND TO THE INVENTION International Patent Application No W091/13167 (applicant, The Board of Trustees of Leyland Stanford University, and hereinafter referred to as W091/13167) describes the identification, characterization, expression and uses of insect steroid receptors and DNA sequences encoding same and, in particular, the identification, characterization, expression and uses of the steroid receptor of the common fruit fly, Drosophila melanogaster.

It has been found by the present inventors that the limited homology between the D.

melanogaster steroid receptor-encoding gene sequences and the steroid receptor -encoding sequences derived from other insects, in particular those derived from diptera such as the Australian sheep blowfly L. cuprina, hemiptera such as aphids, scale insects and leaf hoppers, coleoptera, neuroptera, lepidoptera, and ants, as well as from helminths and protozoa, prevents the routine isolation of DNA sequences encoding steroid receptors and/or juvenile hormone receptors from these latter-mentioned organisms.

Moreover, the present inventors have discovered that the D. melanogaster steroid receptor described in W091/13167 is temperature-sensitive, showing reduced activity at temperatures above 30°C, such as at temperatures about 37°C, particularly at low concentrations of the receptor. Accordingly, the D. melanogaster steroid receptor described in W091/13167 is of limited utility at physiological temperatures applicable to animal or bacterial cells. Moreover, wherein it is desirable to produce a biologically-active steroid receptor using in vivo or in situ expression systems, which expression systems routinely utilise cells or tissues in the temperature range of about 28°C to about 42°C, the D. melanogaster steroid receptor is also WO 99/36520 PCT/AU99/00033 -4of limited utility.

In work leading up to the present invention, the present inventors developed a novel screening protocol, involving the utilisation of highly-degenerate oligonucleotide probes and primers derived from the amino acid sequences of the DNA-binding domains of the D. melanogaster and Chironomus tentans ecdysone receptor polypeptides, to identify nucleotide sequences encoding novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides. The present inventors have further identified specific regions within these novel polypeptides which are suitable for use in preparing a surprising range of novel steroid receptor polypeptide derivatives and insect juvenile hormone receptor polypeptide derivatives.

The novel steroid receptor polypeptides and novel insect juvenile hormone receptor polypeptides of the present invention, and derivative polypeptides thereof, and assembled steroid receptors and insect juvenile hormone receptors derived from said polypeptides and derivatives, and nucleic acid molecules encoding same as exemplified herein, provide the means for developing a wide range of insecticidally-active agents, as well as methods for the regulated production of bioactive molecules. In particular, the present invention provides the means for developing specific ligands which bind to and either agonise or antagonise the steroid receptors and/or juvenile hormone receptors and/or polypeptide subunits thereof as described herein, thereby functioning as highly-specific insecticides, offering significant commercial and environmental benefits.

The present inventors have been surprisingly successful in characterizing the ecdysone receptor and juvenile hormone receptor derived from insects of the orders Diptera and Hemiptera, and polypeptide components thereof and functional derivatives of said polypeptides and receptors, particularly in light of the extreme difficulties in dealing with these organisms.

The nature of these molecules was unknown prior to the present invention.

The various aspects of this invention overcome the problems associated with Drosophila ecdysone receptors which lack thermal stability. Moreover, those aspects of the invention pertaining to methods of screening for insecticidally active agents do not involve competition assays which are generally complex, and often inaccurate or difficult to calibrate.

WO 99/36520 PCT/AU99/00033 SUMMARY OF THE INVENTION One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the list comprising EcR polypeptide of an steroid receptor, the partner protein (USP polypeptide) of an steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to any one of the amino acid sequences set forth in <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14.

In an alternative embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said nucleotide sequence is selected from the list comprising: a nucleotide sequence having at least 40% identity to any one of the nucleotide sequences set forth in <400>1, <400>3, <400>5, <400>9, <400>11 or <400>13 or a complementary nucleotide sequence thereto; (ii) a nucleotide sequence that is capable of hybridising under at least low stringency conditions to any one of the nucleotide sequences set forth in <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11 or <400>13 or to a complementary nucleotide sequence thereto; and (iii) a nucleotide sequence that is amplifiable by PCR using a nucleic acid primer sequence set forth in any one of <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor polypeptide and comprises the nucleotide sequence set forth in <400>1 or a complementary nucleotide sequence thereto.

WO 99/36520 PCT/AU99/00033 -6- In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor S polypeptide and comprises the nucleotide sequence set forth in <400>3 or <400>13 or a complementary nucleotide sequence thereto.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor polypeptide and comprises the nucleotide sequence set forth in <400>5 or <400>7 or <400>8 or <400>9 or a complementary nucleotide sequence thereto.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide and comprises the nucleotide sequence set forth in <400>11 or a complementary nucleotide sequence thereto.

A second aspect of the present invention provides a method of identifying an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide comprising the steps of: hybridising genomic DNA, mRNA or cDNA with a hybridisation-effective amount of one or more probes selected from the list comprising: probes comprising at least 10 contiguous nucleotides in length derived from any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, <400>13, <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20 or a complementary nucleotide sequence thereto; and hybridisation probes comprising the nucleotide sequences set forth in any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, or <400>13 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof which is at least 40% identical to said sequence or complement; and (ii) detecting the hybridisation.

WO 99/36520 PCT/AU99/00033 -7- In an alternative embodiment, the inventive method comprises the steps of: annealing one or more PCR primers comprising at least 10 contiguous nucleotides in length derived from any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, <400>13, <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20 or a complementary nucleotide sequence thereto, to genomic DNA, mRNA or cDNA; and (ii) amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction.

In a further alternative embodiment, the inventive method comprises the steps of: amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction using one or more PCR primers comprising at least 10 contiguous nucleotides in length derived from any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, <400>13, <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20 or a complementary nucleotide sequence thereto; hybridising the amplified nucleotide sequence to genomic DNA, mRNA or cDNA with a hybridisation-effective amount of one or more probes selected from the list comprising: probes comprising at least 10 contiguous nucleotides in length derived from any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, <400>13, <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20 or a complementary nucleotide sequence thereto; and hybridisation probes comprising the nucleotide sequences set forth in any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, or <400>13 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof which is at least 40% identical to said sequence or complement; and (iii) detecting the hybridisation.

A third aspect of the present invention provides a genetic construct comprising the subject WO 99/36520 PCT/AU99/00033 -8isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence. Preferably, the subject nucleic acid molecule is in an expressible format, such that it is possible to produce a recombinant polypeptide therefrom.

Accordingly, a fourth aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the list comprising EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to any one of the amino acid sequences set forth in <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14; wherein said polypeptide is substantially free of naturally-associated insect cell components.

A fifth aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.

In a preferred embodiment, the cell of the present invention expresses the polypeptide encoded by the nucleic acid molecule.

In a preferred embodiment, the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said reporter molecule.

WO 99/36520 PCT/AU99/00033 -9- In a further aspect of this invention, there is provided an animal (such as a mammal), microorganism, plant or aquatic organism, containing one or more cells as mentioned above.

A further aspect of the present invention provides a method of identifying a modulator of insect steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene expression comprising: assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and a potential modulator; and (ii) assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and without said potential modulator; and (ii) comparing expression of the reporter gene in the presence of the potential modulator to the expression of a reporter gene in the absence of the potential modulator, wherein said reporter gene is placed operably under the control of a steroid response element (SRE) to which said insect steroid receptor binds or a promoter sequence comprising said

SRE.

A still further aspect of the invention provides a method of identifying a potential insecticidal compound comprising: assaying the binding directly or indirectly of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE) to which said insect steroid receptor binds, in the presence of a candidate compound; and (ii) assaying the binding directly or indirectly of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE) to which said insect steroid receptor binds, in the absence of said candidate compound; and (ii) comparing the binding assayed at and wherein a difference in the level WO 99/36520 PCT/AU99/00033 of binding indicates that the candidate compound possesses potential insecticidal activity.

A still further aspect of the invention provides a method of identifying a candidate insecticidallyactive agent comprising the steps of: a) expressing an EcR polypeptide of a steroid receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR partner protein (USP polypeptide) of a steroid receptor or ligand binding domain thereof, optionally in association with an insect steroid or analogue thereof so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

A still further aspect of the invention provides a method of identifying a candidate insecticidallyactive agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

In another aspect this invention relates to a method or assay for screening insecticidally active WO 99/36520 PCT/AU99/00033 11 compounds which comprises reacting a candidate insecticidal compound with a steroid receptor polypeptide or fragment thereof encompassing the ligand binding domain, or complex thereof with a partner protein or a fragment thereof which encompasses the ligand binding domain, and detecting binding or absence of binding of said compound so as to determine insecticidal activity.

A still further aspect of the invention provides a synthetic compound which interacts with the three dimensional structure of a polypeptide or protein selected from the list comprising: an EcR polypeptide of a steroid receptor or a fragment thereof; (ii) an EcR partner protein (USP polypeptide) of a steroid receptor or a fragment thereof; (iii) a USP polypeptide of a juvenile hormone receptor; and (iv) a functional receptor or protein complex formed by association of and (ii), wherein said compound is capable of binding to said polypeptide or protein to agonise or antagonise the binding activity or bioactivity thereof.

Preferably, the synthetic compounds are derived from the three dimensional structure of insect steroid receptor(s) or juvenile hormone receptor(s) which compounds bind to said receptor(s) and have the effect of either inactivating the receptor(s) or potentiating the activity of the receptor(s). More preferably, the compounds mimic the three-dimensional structure of a ligand which binds to the receptor(s) and more preferably, mimic the three-dimensional structure of a ligand which binds to the ligand-binding region of said receptor(s).

In a still further aspect of this invention, there is provided a screening system for insecticidally active agents comprising a nucleotide sequence encoding a steroid receptor or a fragment thereof, and a nucleotide sequence encoding a partner protein or a fragment thereof which associates with the receptor so as to confer enhanced affinity for insect steroid response elements, enhanced affinity for insect steroids or analogues thereof, or insecticidally active agents and/or thermostability or enhanced thermostability of said receptor, which receptor and partner protein is capable of binding to a candidate insecticidally active agent to form an activated complex, and a nucleic acid sequence encoding a bioactive molecule or a reporter WO 99/36520 PCT/AU99/00033 12molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence, wherein on exposure to said agent expression of the bioactive molecule or reporter molecule correlates with insecticidal activity.

In another aspect of this invention, there is provided a method for the regulated production of a bioactive molecule or a reporter molecule in a cell, said method comprising the steps of introducing into said cell: a) a nucleotide sequence encoding a steroid receptor or a fragment thereof which is capable of binding an insect steroid or analogue thereof, to form an activated complex; and b) a nucleotide sequence encoding said bioactive molecule or reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex regulates transcription of the nucleic acid sequence encoding said bioactive molecule or reporter molecule, wherein exposing the cell to an insect steroid or analogue thereof regulates expression of the bioactive molecule or reporter molecule.

SUMMARY OF SEQUENCE LISTING <400>1: The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the L. cuprina ecdysone receptor and amino acid sequence therefor.

<400>2: The amino acid sequence of the EcR polypeptide subunit of the L. cuprina ecdysone receptor.

<400>3: The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor and/or which encodes the USP polypeptide subunit of the L. cuprina juvenile hormone receptor, and amino acid sequence therefor.

<400>4: The amino acid sequence of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor and/or the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor.

PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/1299 Received 21 December 1999 -13 <400>5: The nucleotide sequence of a cDNA molecule which encodes part of the EcR polypeptide subunit of the M. persicae ecdysbne receptor and amino acid sequence therefor.

<400>6: The amino acid sequence of a part of the EcR polypeptide subunit of the M.

persicae ecdysone receptor.

<400>7: The nucleotide sequence of the EcR probe 1 which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the EcR polypeptide subunit of the M. persicae ecdysone receptor.

<400>8: The nucleotide sequence of the EcR probe 2 sequence which is specific for genetic sequences encoding the EcR polypeptide subunit of aphid ecdysone receptors, in particular the EcR polypeptide subunit of the M. persicae ecdysone receptor.

<400>9: The nucleotide sequence of the open reading frame of a cDNA molecule which encodes the EcR polypeptide subunit of the M. persicae ecdysone receptor and amino acid sequence therefor.

<400>10: The amino acid sequence of the EcR polypeptide subunit of the M. persicae ecdysone receptor.

<400>11: The nucleotide sequence of a 140 base-pair cDNA molecule which encodes part of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor and/or which encodes part of the USP polypeptide subunit of the M. persicae juvenile hormone receptor, and amino acid sequence therefor.

<400>12: The amino acid sequence of a fragment_of the EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor and/or a fragment of the amino acid sequence of the USP polypeptide subunit of the M. persicae juvenile hormone receptor.

<400>13: The nucleotide sequence of a 150 base-pair probe which is specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor and/or the USP polypeptide subunit of the L.

cuprina juvenile hormone receptor, and amino acid sequence therefor.

00>14: The amino acid sequence encoded by the nucleotide sequence of <400>13, AMENDED

SHEET

IPEA/AU

WO 99/36520 PCT/AU99/00033 -14- <400>15: <400>16: <400>17: <400>18: <400>19: <400>20: comprising amino acid residues 108-149 of the EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor and/or amino acid residues 108-149 of the amino acid sequence of the USP polypeptide subunit of the L. cuprina juvenile hormone receptor set forth herein as <400>4.

The nucleotide sequence of the degenerate primer Rdna3.

The nucleotide sequence of the degenerate primer Rdna4.

The nucleotide sequence of the primer Mdnal.

The nucleotide sequence of the primer Mdna2.

The nucleotide sequence of the primer AP1.

The nucleotide sequence of the degenerate primer AP2.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graphical representation showing function of the EcR polypeptide subunit of the L. cuprina ecdysone receptor in vivo. CHO cells were cotransfected with: one of the following expression plasmids: pSGDmEcR, pSGLcEcR, or the parental expression plasmid pSG5 as a control, at 1 pg/ml; plasmid p(EcRE) 7 -CAT (1 pg/ml); and an independent reporter plasmid pPGKLacZ, at 1 pg/ml.

CAT expression was induced with Muristerone A at either 10 pM or 50 pM while control cells received only the carrier ethanol. ELISA kits were used to quantify the synthesis of CAT and p-galactosidase in extracts of cells forty eight hours after transfection. The level of CAT was normalized to the level of P-galactosidase in the same extract. Fold-induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone, relative to the normalized values for CAT gene expression in cells transfected with the same plasmid, but in the absence of hormone. The average values of three independent experiments are shown and the error bars indicate standard error of the mean.

Figure 2 is a copy of a graphical representation showing the activity of plasmid pSGLD and pSGDL, containing chimeric EcR polypeptide subunits of insect ecdysone receptors, WO 99/36520 PCT/AU99/00033 produced as described in the Examples. Cotransfection assays were performed as described in the Examples using plasmids pSGLD and pSGDL and the CAT reporter plasmid p(EcRE) 7 -CAT (lug/ml) and an independent reporter, pPGKLacZ at 1 pg/ml each. CAT/b-Gal refers to CAT reporter activity expressed as a percentage relative to p-galactosidase activity produced by the internal control reporter, pPGKLacZ.

Figure 3 is a copy of a graphical representation showing the binding activity in extracts of Sf9 and Sf21 cells containing a baculvirus expressing LcEcRDEF and LcUSPDEF, as described in the Examples. Control cells contained baculovirus expressing p-galactosidase and CAT only.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS One aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the list comprising EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to any one of the amino acid sequences set forth in <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14.

Accordingly, the isolated nucleic acid molecule of the invention may comprise a fragment of a nucleotide sequence encoding a full-length receptor polypeptide.

It is to be understood that a "fragment" of a nucleotide sequence encoding an EcR polypeptide subunit of a steroid receptor or an EcR partner protein (USP polypeptide) of a steroid receptor or a USP polypeptide of a juvenile hormone receptor, refers to a nucleotide sequence encoding a part or fragment of such a receptor which is capable of binding or associating with an insect steroid or an analogue thereof, or a candidate insecticidally active compound.

WO 99/36520 PCT/AU99/00033 -16- Fragments of a nucleotide sequence would generally comprise in excess of twenty contiguous nucleotides derived from the base sequence and may encode one or more domains of a functional insect steroid receptor or juvenile hormone receptor.

Preferably, the isolated nucleic acid molecule of the invention encodes an ecdysteroid receptor polypeptide. Those skilled in the art are aware that ecdysteroid receptors derived from insects are heterodimeric receptors comprising an EcR polypeptide subunit and an EcR partner protein (USP polypeptide) (see also Jones and Sharp, 1997). In this regard, the present inventors have discovered that the USP polypeptide of the insect juvenile hormone receptor is structurally-identical to the EcR partner protein of the ecdysteroid receptor of the present invention, however juvenile hormone receptors comprise monomers or multimers of the USP polypeptide acting without the EcR polypeptide subunit that is present in the ecdysteroid receptors. Accordingly, the present invention extends equally to nucleotide sequences encoding polypeptides of both the ecdysteroid receptors and polypeptides of the juvenile hormone receptors of insects.

More preferably, the isolated nucleic acid molecule of the invention encodes an ecdysteroid receptor that is modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.

The isolated nucleic acid molecule of the invention may be derived from any organism that contains steroid receptors that are responsive to ecdysteroids or ecdysteroid-like compounds or juvenile hormones, or analogues of such receptor-ligands. Accordingly, the present invention is not to be limited in any of its embodiments to the particular source of the subject nucleic acid, or polypeptide encoded therefor.

Preferably, the isolated nucleic acid molecule of the invention is derived from insects, helminths (nematodes, cestodes, trematodes), protozoa, and ants, amongst others.

More preferably, the isolated nucleic acid molecule of the invention is derived from an insect selected from the list comprising diptera, hemiptera, coleoptera, neuroptera, lepitdoptera and WO 99/36520 PCT/AU99/00033 -17ants, amongst others. Still more preferably, the isolated nucleic acid molecule of the present invention is derived from aphids, scale insects, leaf hoppers, white fly, and blowflies such as S sheep blowflies.

The present invention does not extend to amino acid sequences comprising the complete EcR polypeptide subunit of the D. melanogaster ecdysone receptor as described in W091/13167, or to nucleotide sequences encoding same. However, this exclusion is made on the understanding that the present invention does encompass chimeric genes and fusion proteins which include the D. melanogaster nucleotide and amino acid sequences, respectively.

In a particularly preferred embodiment, the isolated nucleic acid molecule of the present invention is derived from the aphid M. persicae or alternatively, from the Australian sheep blowfly, L. cuprina.

The ecdysteroid receptor is preferably modulated by one or more of the steroids ecdysone, ponasterone A, or muristerone, or an analogue of an ecdysteroid.

As used herein, the term "analogue of an ecdysteroid" shall be taken to indicate any compound that binds to one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, which binds to the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, which binds to a bioactive derivative or analogue of said polypeptides or holoreceptor. The term "analogue of an ecdysteroid" shall further be taken to indicate any compound that modulates the bioactivity of one or more polypeptide subunits of an ecdysteroid receptor or the heterodimeric holoreceptor comprising same or alternatively or in addition, that modulates the bioactivity of the USP polypeptide of a juvenile hormone receptor or alternatively or in addition, that modulates the bioactivity of a bioactive derivative or analogue of said polypeptides or holoreceptor.

The present invention is not to be limited in scope to the specific L. cuprina and M. persicae nucleotide and amino acid sequences set forth in the accompanying Sequence Listing and WO 99/36520 PCT/AU99/00033 -18persons skilled in the art will readily be able to identify additional related sequences from other sources using art-recognised procedures, for example using nucleic acid hybridisation and/or polymerase chain reaction essentially as described by Ausubel et al. (1992) and/or McPherson et al. (1991) and/or Sambrook et al (1989).

Accordingly, the present invention clearly encompasses isolated nucleic acid molecules which encode or are complementary to isolated nucleic acid molecules which encode the subject EcR polypeptide of a steroid receptor or fragments thereof, and/or the subject EcR partner proteins (USP polypeptide) of a steroid receptor and/or the subject USP polypeptide of a juvenile hormone receptor, in addition to derivatives, fragments and analogues thereof which comprise-amino acid sequences having at least 40% identity to the amino acid sequences set forth in any one of <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14.

Preferably, the percentage similarity to any one of <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14 is at least about 60%, more preferably at least about 80%, even more preferably at least about In determining whether or not two amino acid sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences will arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity or similarity between two or more amino acid sequences shall be taken to refer to the number of identical and similar residues respectively, between said sequences as determined using any standard algorithm known to those skilled in the art. For example, amino acid sequence identities or similarities may be calculated using the GAP programme and/or aligned using the PILEUP programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984). The GAP programme utilizes the algorithm of Needleman and Wunsch (1970) to maximise the number of identical/similar residues and to minimise the number and/or length of sequence gaps in the alignment. Alternatively or in addition, wherein more than two amino acid sequences are being compared, the ClustalW WO 99/36520 PCT/AU99/00033 19programme of Thompson et al (1994) is used.

S In an alternative embodiment, the isolated nucleic acid molecule of the invention encodes or is complementary to an isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a fragment thereof, or a partner protein (USP) or a fragment thereof, which at least comprises an amino acid sequence which is substantially identical to any one of <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14.

As used herein, the term "substantially identical" or similar term shall be taken to include any sequence which is at least about 95% identical to a stated nucleotide sequence or amino acid sequence, including any homologue, analogue or derivative of said stated nucleotide sequence or amino acid sequence.

Those skilled in the art will be aware that variants of the nucleotide sequences sequence set forth in any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13, which variants encode EcR polypeptides of insect steroid receptors or fragments thereof or EcR partner proteins (USP polypeptides) or fragments thereof, or USP polypeptides of insect juvenile hormone receptors, may be isolated by hybridization under low stringency conditions as exemplified herein.

Such variants include any genomic sequences, cDNA sequences mRNA or other isolated nucleic acid molecules derived from the nucleic acid molecules exemplified herein by the Sequence Listing. Additional variants are not excluded.

In a particularly preferred embodiment of the invention, the variant nucleotide sequences encode a fragment of the EcR polypeptide of the insect steroid receptor or a fragment of the EcR partner protein (USP polypeptide) of the insect steroid receptor or a fragment of the USP polypeptide of the insect juvenile hormone receptor.

Preferred fragments of the subject polypeptides include one or more regions or domains which are involved in the interaction or association between the monomeric polypeptide subunits of WO 99/36520 PCT/AU99/00033 a multimeric receptor and/or which are involved in the interaction or association between (i) a cognate steroid or receptor ligand or cis-acting DNA sequence; and (ii) said monomeric polypeptide subunits or the receptor per se. In a particularly preferred embodiment, the fragments comprise the DNA-binding domain, linker domain (domain D) or a part thereof, or ligand-binding domain (eg. hormone-binding domain) of a steroid receptor polypeptide or juvenile hormone receptor polypeptide or receptor holoenzyme. As exemplified herein, wherein biological activity of the L. cuprina ecdysone receptor is required, it is preferably to include at least a ligand-binding region comprising the ligand-binding domain and at least a part of the linker domain of the EcR polypeptide subunit, optionally in association with a ligand-binding region comprising at least the ligand-binding domain and at least a part of the linker domain of the EcR partner protein (USP polypeptide) subunit of said receptor. Additional fragments are not excluded.

Homologues, analogues and derivatives of the nucleotide sequences exemplified herein may be isolated by hybridising same under at least low stringency conditions and preferably under at least medium stringency conditions, to the nucleic acid molecule set forth in any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 or to a complementary strand thereof. More preferably, the isolated nucleic acid molecule according to this aspect of the invention is capable of hybridising under at least high stringency conditions to the nucleic acid molecule set forth in any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 or to a complementary strand thereof.

For the purposes of defining the level of stringency, a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0.1% SDS at 28 0 C or alternatively, as exemplified herein. Generally, the stringency is increased by reducing the r: concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridisation and/or wash. A medium stringency comprises a hybridisation and/or a wash carried out in 0.2xSSC-2xSSC buffer, 0.1% SDS at 42 0 C to 65 0 C, while a high stringency comprises a hybridisation and/or a wash carried out in 0.1xSSC-0.2xSSC buffer, 0.1% SDS at a temperature of at least 55°C. Conditions for hybridisations and washes are well understood by one normally skilled in the art. For the purposes of further WO 99/36520 PCT/AU99/00033 -21clarification only, reference to the parameters affecting hybridisation between nucleic acid molecules is found in Ausubel et al. (1992), which is herein incorporated by reference.

In an even more preferred embodiment of the invention, a hybridising nucleic acid molecule further comprises a sequence of nucleotides which is at least 40% identical to at least contiguous nucleotides, preferably at least 50 contiguous nucleotides and more preferably at least 100 contiguous nucleotides, derived from any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 or a complementary strand thereof.

In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).

In an alternative embodiment, nucleotide sequences encoding EcR polypeptide subunits of insect steroid receptors or fragments thereof and/or EcR partner proteins (USP polypeptides) of insect steroid receptor or fragments thereof, or USP polypeptides of insect juvenile hormone receptor polypeptides, are amplified in the polymerase chain reaction. According to this embodiment, one or two or more nucleic acid "primer molecules" derived from a nucleotide sequence exemplified herein as <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 or a complementary strand thereof, are annealed or hybridized to a nucleic acid "template molecule" which at least comprises a nucleotide sequence encoding a related genetic sequence or a functional part thereof, and nucleic acid molecule copies of the template molecule are amplified enzymatically using a thermostable DNA polymerase enzyme, WO 99/36520 PCT/AU99/00033 -22such as Taql polymerase or Pfu polymerase, amongst others.

More particularly, one of the primer molecules comprises contiguous nucleotides derived from any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 and another of said primers comprises contiguous nucleotides complementary to <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13, subject to the proviso that the first and second primers are not complementary to each other.

In a preferred embodiment, each nucleic acid primer molecule is at least 10 nucleotides in length, more preferably at least 20 nucleotides in length, even more preferably at least nucleotides in length, still more preferably at least 40 nucleotides in length and even still more preferably at least 50 nucleotides in length.

Furthermore, the nucleic acid primer molecules consists of a combination of any of the nucleotides adenine, cytidine, guanine, thymidine, or inosine, or functional analogues or derivatives thereof which are at least capable of being incorporated into a polynucleotide molecule without having an inhibitory effect on the hybridisation of said primer to the template molecule in the environment in which it is used.

Furthermore, one or both of the nucleic acid primer molecules may be contained in an aqueous mixture of other nucleic acid primer molecules, for example a mixture of degenerate primer sequences which vary from each other by one or more nucleotide substitutions or deletions. Alternatively, one or both of the nucleic acid primer molecules may be in a substantially pure form.

In a particularly preferred embodiment exemplified herein, two primer nucleotide sequences are used to amplify related sequences, said primers comprising the nucleotide seqeunces as set forth in any one of <400>15 to <400>20 inclusive. Even more preferably, the primers are used in the combination of (i)<400>15 and <400>16; or (ii) <400>17 and <400>18; or (iii) <400>19 and <400>20.

WO 99/36520 PCT/AU99/00033 -23- The nucleic acid template molecule may be in a recombinant form, in a virus particle, insect cell, bacteriophage particle, yeast cell, animal cell, or a plant cell. Preferably, the nucleic acid S template molecule is derived from an insect species.

Those skilled in the art will be aware that there are many known variations of the basic polymerase chain reaction procedure. Such variations are discussed, for example, in McPherson et al (1991). The present invention extends to the use of all such variations in the isolation of variant insect steroid receptor-encoding genes or fragments thereof, and/or variant partner protein-encoding genes or fragments thereof to those exemplified herein.

The isolated nucleic acid molecule of the present invention, including those sequences exemplified herein and any variants thereof, may be cloned into a plasmid or bacteriophage molecule, for example to facilitate the preparation of primer molecules or hybridisation probes or for the production of recombinant gene products. Methods for the production of such recombinant plasmids, cosmids, bacteriophage molecules or other recombinant molecules are well-known to those of ordinary skill in the art and can be accomplished without undue experimentation. Accordingly, the invention further extends to any recombinant plasmid, bacteriophage, cosmid or other recombinant molecule comprising the nucleotide sequence set forth in any one of <400>1 or <400>3 or <400>5 or <400>7 or <400>8 or <400>9 or <400>11 or <400>13 or <400>15 to <400>20, or a complementary sequence, homologue, analogue or derivative thereof.

The nucleic acid molecule of the present invention is also useful for developing genetic constructs which comprise and preferably, express, the EcR polypeptide subunit of the insect steroid receptor and/or the EcR partner protein (USP polypeptide) of the steroid receptor and/or the USP polypeptide of the juvenile hormone receptor, thereby providing for the production of the recombinant polypeptides in isolated cells or transformed tissues.

Accordingly, a further aspect of the present invention provides a genetic construct comprising the subject isolated nucleic acid molecule encoding the insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide, operably linked to a promoter sequence. Preferably, WO 99/36520 PCT/AU99/00033 -24the subject nucleic acid molecule is in an expressible format, such that it is possible to produce a recombinant polypeptide therefrom.

Reference herein to a "promoter" is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation in a eukaryotic cell, with or without a CCAAT box sequence or alternatively, the Pribnow box required for accurate expression in prokaryotic cells.

Promoters may be cell, tissue, organ or system specific, or may be non-specific. Using specific promoters, the expression of a bioactive agent or other polypeptide encoded by a structural gene to which the promoter is operably connected may be targeted to a desired cellular site. For example, in transgenic animals such as sheep, it can be envisaged that cells of the transgenic animal may contain a gene encoding a steroid receptor, preferably a steroid receptor linked to an epidermal specific promoter and a separate gene encoding, for example, epidermal growth factor (EGF) which is functionally linked to one or more insect hormone response elements and may or may not also be linked to epidermal specific promoter elements. On administration of the appropriate insect steroid hormone to the transgenic animal, the activated complex between the insect steroid receptor and insect steroid may bind to the one or more insect steroid hormone response element thereby inducing EGF production solely in epidermal cells which may give rise to defleecing. It is to be understood that this aspect of the invention is independent of the degree of thermostability of the insect steroid receptor The same principal applies to expression of any bioactive molecule or reporter molecule in a specific cell type which is regulated by a transactivating complex between a steroid receptor complex and an appropriate insect steroid.

In the present context, the term "promoter" is also used to describe a synthetic or fusion molecule, or derivative which confers, activates or enhances expression in a cell in response to an external stimulus. Accordingly, the promoter may include further regulatory elements (i.e.

upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner. Preferred WO 99/36520 PCT/AU99/00033 promoters may contain copies of one or more specific regulatory elements, in particular steroid responsive elements (SREs) or hormone-responsive elements (HREs), to further enhance expression and/or to alter the spatial expression and/or temporal expression pattern.

Reference herein to the term "steroid response element" shall be taken to refers to one or more cis-acting nucleotide sequences present in a naturally-occurring or synthetic or recombinant gene the expression of which is regulated by an insect steroid, such as an ecdysteroid, for example ecdysone or ponasterone A, wherein said regulation of expression results from an direct or indirect interaction between a steroid receptor and said cis-acting nucleotide sequence response element. Exemplary insect steroid hormone response elements include the ecdysone response element hsp27 (EcRE) and any other nucleotide sequence which is capable of binding ecdysteroid receptors or polypeptide subunits thereof or fragments or analogies thereof (such as associated with E75, E74 or other Drosophila early genes), as described for example by Riddihough and Pelham (1987).

For example, an SRE or a plurality of such elements may be operably linked to a promoter such as the polyhedron promoter, p10 promoter, MMTV promoter or SV40 promoter, to make transcription of a structural gene to which said promoter is operably connected responsive to the presence of a steroid bound to the insect receptor (which may act as a transcription factor).

One or more insect SREs may be located within a promoter, and may replace sequences within a selected promoter which confer responsiveness to hormones or other agents which regulate promoter activity. Where response elements are different they may lead to preferential binding of different insect steroids or analogues thereof such that a promoter may be differentially regulated.

Particularly preferred SREs according to this embodiment include, but are not limited to, the hsp27 ecdysone response element described by Riddihough and Pelham (1987) or the 13 base-pair palindromic core contained therein.

A promoter is usually, but not necessarily, positioned upstream or of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter WO 99/36520 PCT/AU99/00033 -26are usually positioned within 2 kb of the start site of transcription of the gene.

Placing a gene or isolated nucleic acid molecule operably under the control of a promoter sequence means positioning said gene or isolated nucleic acid molecule such that its expression is controlled by the promoter sequence. Promoters are generally positioned (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.

Those skilled in the art will recognise that the choice of promoter will depend upon the nature of the cell being transformed and when expression is required. Furthermore, it is well-known in the art that the promoter sequence used in the expression vector will also vary depending upon the level of expression required and whether expression is intended to be constitutive or regulated.

For expression in eukaryotic cells, the genetic construct generally comprises, in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate expression of said nucleic acid molecule. The promoter may be derived from a genomic clone which normally encodes the expressed protein or alternatively, it may be a heterologous promoter derived from another genetic source. Promoter sequences suitable for expression of genes in eukaryotic cells are well-known in the art.

Suitable promoters for use in eukaryotic expression vectors include those capable of regulating expression in mammalian cells, insect cells such as Sf9 or Sf21. (Spodoptera frugiperda) cells, WO 99/36520 PCT/AU99/00033 -27yeast cells and plant cells. Preferred promoters for expression in eukaryotic cells include the promoter, MMTV promoter, polyhedron promoter, the SV40 early promoter and the cytomegalovirus (CMV- IE) promoter, promoters derived from immunoglobulin-producing cells (see, United States Patent No 4,663,281), polyoma virus promoters, and the LTR from various retroviruses (such as murine leukemia virus, murine or Rous sarcoma virus and HIV), amongst others See, Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, New York, 1983, which is incorporated herein by reference). Examples of other expression control sequences are enhancers or promoters derived from viruses, such as SV40, Adenovirus, Bovine Papilloma Virus, and the like.

Wherein the expression vector is intended for the production of recombinant protein, the promoter is further selected such that it is capable of regulating expression in a cell which is capable of performing any post-translational modification to the polypeptide which may be required for the subject recombinant polypeptide to be functional, such as N-linked glycosylation. Cells suitable for such purposes may be readily determined by those skilled in the art. By way of exemplification, Chinese hamster ovary (CHO) cells may be employed to carry out the N-terminal glycosylation and signal sequence cleavage of a recombinant polypeptide produced therein. Alternatively, a baculovirus expression vector such as the pFastBac vector supplied by GibcoBRL may be used to express recombinant polypeptides in Sf9 (Spodoptera frugiperda) cells, following standard protocols.

Numerous expression vectors suitable for the present purpose have been described and are readily available. The expression vector may be based upon the pcDNA3 vector distributed by Medos Company Pty Ltd, Victoria, Australia, which comprises the CMV promoter and BGH terminator sequences for regulating expression of the recombinant polypeptide of the invention c in a eukaryotic cell, when isolated nucleic acid sequences encoding same are inserted, in the sense orientation relative to the CMV promoter, into the multiple cloning site of said vector.

Alternatively, the SG5 expression vector of Greene et al. (1988), supplied by Stratagene, or the pQE series of vectors supplied by Qiagen are particularly useful for such purposes, as exemplified herein.

WO 99/36520 PCT/AU99/00033 -28- Examples of eukaryotic cells contemplated herein to be suitable for expression include mammalian, yeast, insect, plant cells or cell lines such as COS, VERO, HeLa, mouse C127, S Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK), MDCK, sf21 (insect) or Sf9 (insect) cell lines. Such cell lines are readily available to those skilled in the art.

The prerequisite for expression in prokaryotic cells such as Escherichia coli is the use of a strong promoter with an effective ribosome binding site. Typical promoters suitable for expression in bacterial cells such as E. coli include, but are not limited to, the lacz promoter, temperature-sensitive AL or A, promoters, T7 promoter or the IPTG-inducible tac promoter. A number of other vector systems for expressing the nucleic acid molecule of the invention in E.coli are well-known in the art and are described for example in Ausubel et al (1992).

Numerous vectors having suitable promoter sequences for expression in bacteria have been described, such as for example, pKC30 (k:Shimatake and Rosenberg, 1981), pKK173-3 (tac: Amann and Brosius, 1985), pET-3 (T7: Studier and Moffat, 1986) or the pQE series of expression vectors (Qiagen, CA), amongst others.

Suitable prokaryotic cells include corynebacterium, salmonella, Escherichia coli, Bacillus sp.

and Pseudomonas sp, amongst others. Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1992).

The genetic constructs described herein may further comprise genetic sequences corresponding to a bacterial origin of replication and/or a selectable marker gene such as an antibiotic-resistance gene, suitable for the maintenance and replication of said genetic construct in a prokaryotic or eukaryotic cell, tissue or organism. Such sequences are wellknown in the art.

Selectable marker genes include genes which when expressed are capable of conferring resistance on a cell to a compound which would, absent expression of said selectable marker gene, prevent or slow cell proliferation or result in cell death. Preferred selectable marker WO 99/36520 PCT/AU99/00033 -29genes contemplated herein include, but are not limited to antibiotic-resistance genes such as those conferring resistance to ampicillin, Claforan, gentamycin, G-418, hygromycin, rifampicin, kanamycin, neomycin, spectinomycin, tetracycline or a derivative or related compound thereof or any other compound which may be toxic to a cell.

The origin of replication or a selectable marker gene will be spatially-separated from those genetic sequences which encode the recombinant receptor polypeptide or fusion polypeptide comprising same.

Preferably, the genetic constructs of the invention, including any expression vectors, are capable of introduction into, and expression in, an in vitro cell culture, or for introduction into, with or without integration into the genome of a cultured cell, cell line and/or transgenic animal.

A further aspect of the invention provides a cell comprising the subject isolated nucleic acid molecule which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide.

As used herein, the word "cell" shall be taken to refer to a single cell, or a cell lysate, or a tissue, organ or whole organism comprising same, including a tissue, organ or whole organism comprising a clonal group of cells or a heterogenous mixture of cell types, which may be a prokaryotic or eukaryotic cell as described supra.

In a preferred embodiment, the cell of the present invention expresses the isolated or recombinant polypeptide encoded by the nucleic acid molecule.

In a preferred embodiment, the cell expresses a steroid receptor polypeptide or a fragment thereof which receptor is capable of binding to an insect steroid or analogue thereof or a candidate insecticidally active agent to form an activated complex, and comprises a nucleic acid sequence encoding a bioactive molecule or a reporter molecule operably linked to one or more insect steroid response elements which on binding of the said activated complex promotes transcription of the nucleic acid sequence, wherein said cell on exposure to insect WO 99/36520 PCT/AU99/00033 steroid or an analogue thereof, regulates expression of said bioactive molecule or allows detection of said reporter molecule.

To produce the cells of the invention, host cells are transfected or co-transfected or transformed with nucleotide sequences containing the DNA segments of interest (for example, the insect steroid receptor gene, the recombinant steroid response elements, or both) by wellknown methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas lipofection or calcium phosphate treatment are often used for other cellular hosts. See, generally, Sambrook et al, (1989); Ausubel et al, (1992); and Potrykus (1990). Other transformation techniques include electroporation, DEAE-dextran, microprojectile bombardment, lipofection, microinjection, and others.

As used herein, the term "transformed cell" is meant to also include the progeny of a transformed cell.

In a further aspect of this invention, there is provided an animal (such as a mammal or insect), microorganism, plant or aquatic organism, containing one or more cells as mentioned above.

Reference to plants, microorganisms and aquatic organisms includes any such organisms.

In this embodiment of the invention, it is to be appreciated that administration of an insect steroid or an analogue thereof to an organism will induce expression of the desired bioactive molecule, such as a polypeptide, with attendant advantages. For example, an induced protein may have a therapeutic effect ameliorating a disease state or preventing susceptibility to disease or may modify in some way the phenotype of an organism to produce a desired effect.

S In humans, for example, cell transplants (such as liver cells) may under the action of insect steroids, produce desirable hormones such as insulin, growth hormone, growth factors and the like.

A further aspect of the invention provides a recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide derived from an insect WO 99/36520 PCT/AU99/00033 -31 or a bioactive derivative or analogue thereof, wherein said polypeptide: is selected from the list comprising EcR polypeptide of a steroid receptor, the partner protein (USP polypeptide) of a steroid receptor and the USP polypeptide of a juvenile hormone receptor; and (ii) comprises an amino acid sequence that is at least 40% identical to any one of the amino acid sequences set forth in <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14; wherein said polypeptide is substantially free of naturally-associated insect cell components.

Reference herein to "substantially free of naturally associated insect cell components" refers to at least 80% purity, preferably more than 90% purity, and more preferably more than purity. Normally, purity is measured on a polyacrylamide gel with homogeneity determined by staining of protein bonds. Alternatively, high resolution may be necessary using HPLC or similar means. For most purposes, a simple chromatography column or polyacrylamide gel may be used to determine purity. A protein which is chemically synthesized or synthesized in a cell system different from an insect cell from which it naturally originates would be free of naturally-associated insect cell components.

The present invention clearly provides for the isolation of EcR polypeptide subunits and EcR partner protein (USP polypeptide) subunits of ecdysteroid receptors and USP polypeptides of juvenile hormone receptors, from various organisms of the class Insecta, as described supra, in addition to protozoa and helminth sources.

Insect steroid receptors are characterized by functional ligand-binding domains, and DNAbinding domains, both of which interact to effect a change in the regulatory state of a gene S operably linked to the DNA-binding site of the holoreceptor or a polypeptide or polypeptide fragment thereof. Thus, insect steroid receptors seem to be ligand-responsive transcription factors. Additionally, insect steroid receptors generally contain a DNA-binding domain (Domain and a ligand-binding domain (Domain separated and flanked by additional domains as identified by Krust et al (1986). The C domain preferably comprises a zinc-finger DNA-binding domain which is usually hydrophilic, having high cysteine, lysine and arginine WO 99/36520 PCT/AU99/00033 -32content. The E domain preferably comprises hydrophobic amino acid residues and is further characterized by regions El, E2 and E3. The ligand-binding domain of the members of the insect steroid receptor superfamily is typically carboxyl-proximal, relative to a DNA-binding domain (Evans,1988). The entire ligand-binding domain is typically between about 200 and 250 amino acids but is potentially shorter. This domain has the subregions of high homology, designated the El, E2 and E3 regions which may be collectively referred to as the "E region".

Amino acid residues proximal to the C domain comprise a region initially defined as separate A and B domains. Region D separates the more conserved domains C and E. Region D typically has a hydrophilic region whose predicted secondary structure is rich in turns and coils.

The F region is carboxy promixal to the E region (see, Krust et al, supra).

The receptor polypeptides of the present invention exhibit at least a ligand-binding domain, as characterized by sequence homology to regions El, E2 and E3. The ligand-binding domains of the present invention are typically characterized by having significant homology in sequence and structure to these three regions. Fragments of insect steroid receptors and partner proteins capable of binding insect steroids, and candidate insecticidally active compounds comprise an E-region or a sufficient portion of the E-region to allow binding.

Preferably, the recombinant or isolated EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor as described herein is thermostable.

By "thermostable" is meant that a stated integer does not exhibit reduced activity at bacterial, plant or animal physiological temperatures above about 28"C or above about 30 0 C. The thermostability of insect steroid hormone receptors also refers to the capacity of such c receptors to bind to ligand-binding domains or regions and/or to transactivate genes linked to insect steroid hormone response elements at bacterial, plant or animal physiological temperatures above about 28°C or above about The present invention clearly extends to variants of said polypeptides, as described supra. The polypeptide may be substantially free of naturally associated insect cell components, or may WO 99/36520 PCT/AU99/00033 -33be in combination with a partner protein which associates with the insect steroid receptor so as to confer enhanced affinity for insect steroid response elements, enhanced affinity for insect steroids or analogues thereof. For Example, the amino acid sequences exemplified herein may be varied by the deletion, substitution or insertion of one or more amino acids.

In one embodiment, amino acids of a polypeptide exemplified herein may be replaced by other amino acids having similar properties, for example hydrophobicity, hydrophilicity, hydrophobic moment, charge or antigenicity, and so on.

Substitutions encompass amino acid alterations in which an amino acid of the base polypeptide is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as "conservative", in which case an amino acid residue contained in the base polypeptide is replaced with another naturally-occurring amino acid of similar character, for example Gly-Ala, Val,-+lle*-Leu, Asp-Glu, Lys+-Arg, Asn-GIn or Phe-*Trp-*Tyr.

Substitutions encompassed by the present invention may also be "non-conservative", in which an amino acid residue which is present in the base polypeptide is substituted with an amino acid having different properties, such as a naturally-occurring amino acid from a different group (eg. substituted a charged or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid.

Those skilled in the art will be aware that several means are available for producing variants of the exemplified EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone a receptor, when provided with the nucleotide sequence of the nucleic acid molecule which encodes said polypeptide, for example site-directed mutagenesis of DNA and polymerase chain reaction utilising mutagenised oligonucleotide primers, amongst others.

Such polypeptide variants which are capable of binding insect steroids clearly form part of the present invention. Assays to determine such binding may be carried out according to PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/12/99 Received 21 December 1999 -34procedures well known in the art.

One such variant polypeptide encompassed by the present invention comprises an "in-frame" fusion polypeptide between different regions of different insect receptor polypeptides.As exemplified herein, the present inventors have discovered that, by producing synthetic genes in which various domains of a base insect steroid receptor-encoding nucleotide sequence derived from a first source are interchanged or substituted with similar sequences derived from a second source (referred to as "domain swapping"), it is possible to modify the bioactivity of the insect steroid receptor encoded therefor. For example, the biological activity of the EcR polypeptide of the L. cuprina or M. persicae ecdysone receptor exemplified herein may be modulated by replacing portions of its C-terminal or N-terminal sequences with the equivalent domains from the EcR polypeptide of the D. melanogaster ecdysone receptor or alternatively, by swapping regions of the EcR polypeptides of the L. cuprina and M. persicae ecdysone receptors per se.

As a further refinement, such changes in biological function can similarly be effected by making specific changes addition, substitution or deletion) to only those amino-acids within each domain that are critical for determining the relevant catalytic function (eg. ligand-binding activity, DNA binding site affinity, etc), such as by site-directed mutagenesis.

According to this embodiment, there is provided a synthetic EcR polypeptide subunit of a steroid receptor, and/or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, and/or a synthetic USP polypeptide of a juvenile hormone receptor, or an analogue or derivative of said synthetic polypeptides, wherein said synthetic polypeptides comprise an amino acid sequence which has the following properties: it differs in amino acid sequence or exhibits different biological properties to a naturally-occurring EcR polypeptide subunit of a steroid receptor, and/or a naturallyoccurring EcR partner protein (USP polypeptide) subunit of a steroid receptor, and/or a naturally-occurring USP polypeptide of a juvenile hormone receptor; T RI (ii) it comprises a first sequence of amino acids which are at least about 40% identical to a part of any one of <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14 -o AMENDED

SHEET

IPEA/AU

WO 99/36520 PCT/AU99/00033 linked covalently to a second sequence of amino acids derived from an EcR polypeptide subunit of a steroid receptor, EcR partner protein (USP polypeptide) subunit of a steroid receptor, or USP polypeptide of a juvenile hormone receptor, wherein said first and second sequences are derived from different genomic sources.

Preferably, the first sequence of amino acids is derived from the EcR polypeptide subunit of a steroid receptor, more preferably from the EcR polypeptide of the L. cuprina or M. persicae ecdysone receptor, and even more preferably from the the EcR polypeptide of the L. cuprina ecdysone receptor.

In one embodiment, the synthetic EcR polypeptide subunit of a steroid receptor, and/or a synthetic EcR partner protein (USP polypeptide) subunit of a steroid receptor, and/or a synthetic USP polypeptide of a juvenile hormone receptor comprises a fusion polypeptide in which the ligand-binding regions of any one of <400>2, <400>4, <400>6, <400>10, <400>12 or <400>14 are replaced, in-frame, by the ligand-binding region of a different receptor polypeptide.

In a particularly preferred embodiment, 5'-end of the open reading frame of a first nucleotide sequence, encoding the N-terminal portion of the EcR polypeptide of a first ecdysteroid receptor to the end of the DNA-binding domain of said polypeptide, is fused in-frame, to the 3'-end of the open reading frame of a second nucleotide sequence, encoding the C-terminal portion of the EcR polypeptide of a second ecdysteroid receptor, from the D domain and hormone-binding domain to the carboxyl terminus.

Accordingly, the present invention extends to any variants of the insect receptor polypeptides referred to herein and genetic sequences encoding same, wherein said variants are derived from a receptor polypeptide as described herein and exhibit demonstrable ligand-binding activity, and either comprises an amino acid sequence which differs from a naturally-occurring receptor polypeptide, or exhibit bioogical activity.

As with other aspects of the invention, the variants described herein may be produced as WO 99/36520 PCT/AU99/00033 -36recombinant polypeptides or in transgenic organisms, once the subject synthetic genes are introduced into a suitable host cell and expressed therein.

In an alternative embodiment, the recombinant receptor polypeptide of the invention is produced as an "in-frame" fusion polypeptide with a second polypeptide, for example a detectable reporter polypeptide such as p-galactosidase, P-glucuronidase, luciferase or other enzyme, or a FLAG peptide, hapten peptide such as a poly-lysine or poly-histidine or other polypeptide molecule.

By "in-frame" means that a nucleotide sequence which encodes a first polypeptide is placed cloned or ligated) in the same open reading frame adjacent to a nucleotide sequence which encodes a second polypeptide with no intervening stop codons there between, such that when the ligated nucleic acid molecule is expressed, a single fusion polypeptide is produced which comprises a sequence of amino acids corresponding to the summation of the individual amino acid sequences of the first and second polypeptides.

In order to produce a fusion polypeptide, the nucleic acid molecule which encodes the polypeptide of the invention, or an analogue or derivative thereof, is cloned adjacent to a second nucleic acid molecule encoding the second polypeptide, optionally separated by a spacer nucleic acid molecule which encodes one or more amino acids (eg: poly-lysine or poly histidine, amongst others), such that the first coding region and the second coding region are in the same open reading frame, with no intervening stop codons between the two coding regions. When translated, the polypeptide thus produced comprises a fusion between the polypeptide products of the first and second coding regions. Wherein a spacer nucleic acid molecule is utilised in the genetic construct, it may be desirable for said spacer to at least p encode an amino acid sequence which is cleavable to assist in separation of the fused polypeptide products of the first and second coding regions, for example a thrombin cleavage site.

A genetic construct which encodes a fusion polypeptide further comprises at least one start codon and one stop codon, capable of being recognised by the cell's translational machinery WO 99/36520 PCT/AU99/00033 -37in which expression is intended.

Preferably, a genetic construct which encodes a fusion polypeptide may be further modified to include a genetic sequence which encodes a targeting signal placed in-frame with the coding region of the nucleotide sequence encoding the fusion polypeptide, to target the expressed recombinant polypeptide to the extracellular matrix or other cell compartment. More preferably, the genetic sequence encoding targeting signal is placed in-frame at the terminus or the 3'-terminus, but most preferably at the 5'-terminus, of the coding region of the nucleotide sequence which encodes the fusion polypeptide.

Methods for the production of a fusion polypeptide are well-known to those skilled in the art.

The recombinant EcR polypeptide subunit of the insect steroid receptor or EcR partner protein (USP polypeptide) subunit of the steroid receptor or USP polypeptide of the juvenile hormone receptor may be purified by standard techniques, such as column chromatography (using various matrices which interact with the protein products, such as ion exchange matrices, hydrophobic matrices and the like), affinity chromatography utilizing antibodies specific for the protein or other ligands such as dyes or insect steroids which bind to the protein.

Wherein the recombinant polypeptide is expressed as a fusion polypeptide, it is also possible to purify the fusion polypeptide based upon its properties (eg size, solubility, charge etc).

Alternatively, the fusion polypeptide may be purified based upon the properties of the nonreceptor moiety of said fusion polypeptide, for example substrate affinity. Once purified, the fusion polypeptide may be cleaved to release the intact polypeptide of the invention.

Alternatively, proteins may be synthesized by standard protein synthetic techniques as are well known in the art.

In a preferred embodiment, the recombinant or isolated polypeptides of the invention are provided as a precipitate or crystallized by standard techniques, preferably for X-ray crystal structure determination.

WO 99/36520 PCT/AU99/00033 -38- The three-dimensional structure of the polypeptide of the invention or a holoreceptor comprising same or a fragment of said polypeptide or holoreceptor is particularly useful for identifying candidate insecticidal agents which mimic ligands that bind to said threedimensional structure and/or modulate the ability of insect steroids to bind thereto and activate the receptor (see, for example, Von Itzstein et al., 1993; and Bugg et al., 1993).

According to this embodiment, the EcR polypeptides of the invention or ligand binding domains thereof, or their complexes with EcR partner proteins or ligand binding domains thereof, which confer enhanced affinity for insect steroid response elements or partner proteins (USP polypeptides) or ligands, are particularly useful to model the three-dimensional structure of the receptor ligand-binding region. In this manner, insecticidal compounds may be produced which bind to, or otherwise interact with, the ligand-binding region of the receptor and/or preferably interfere with ligand binding. In the same way, compounds may be developed which have a potentiated interaction with the insect steroid receptor over and above that of the physiological insect steroid which binds to the receptor.

Accordingly, a still further aspect of the invention provides a method of identifying a candidate insecticidally-active agent comprising the steps of: a) expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the complex; c) determining the three-dimensional structure of the ligand binding domain of the complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

Standard procedures are used to determine the three dimensional structure of the receptor polypeptides of the invention, for example using X-ray crystallography and/or nuclear magnetic WO 99/36520 PCT/AU99/00033 -39resonance analysis (see, for example, Bugg et al., 1993; Von Itstein et al., 1993).

Insecticidally-active agents contemplated herein include synthetic chemicals that mimic one or more ligands of the holoreceptor or its polypeptide subunit, or the ligand-binding region of said holoreceptor or subunit, thereby modulating binding of steroids to said holoreceptor or subunit. Preferred insecticidally-active agents include bisacylhydrazines, iridoid glycosides or other non-steroidal modulators of ecdysteroid receptors or insect juvenile hormone receptors.

Additionally, because the EcR partner protein (USP polypeptide) subunits of insect steroid receptors, and the USP polypeptides of insect juvenile hormone receptors, bind insect juvenile hormones, a sesquiterpenoid group of ligands that regulate developmental transitions in insects (see Jones and Sharp,1997), compounds which interfere with the binding of juvenile hormone are also candidate insecticides.

A further aspect of the present invention provides a method of identifying a modulator of insect steroid receptor-mediated gene expression or insect juvenile hormone receptor-mediated gene expression comprising: assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and a potential modulator; and (ii) assaying the expression of a reporter gene in the presence of a recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention and without said potential modulator; and (ii) comparing expression of the reporter gene in the presence of the potential modulator to the expression of a reporter gene in the absence of the potential modulator, 7 wherein said reporter gene is placed operably under the control of a steroid response element (SRE) to which said insect steroid receptor binds or a promoter sequence comprising said

SRE.

In the present context, a "modulator" is a compound or molecule that agonises or antagonises the binding properties and/or biological activity of a receptor polypeptide or holoreceptor.

WO 99/36520 PCT/AU99/00033 Preferred modulators according to this embodiment include those synthetic compounds that are suitable for use as insecticidally-active agents described supra.

The reporter gene may be any gene, the expression of which may be monitored or assayed readily. Preferably, the reporter gene is a structural gene that encodes a peptide, polypeptide or enzyme that is assayed readily by enzymic or immunological means, for example the Pgalactosidase, P-glucuronidase, luciferase or chloramphenicol acetyltransferase (CAT) genes.

Alternatively, the reporter gene may be a gene which encodes an immunologically-detectable protein, for example a FLAG peptide, poly-lysine peptide or poly-histidine peptide.

Standard methods are used to assay the expression of the reporter gene.

This embodiment of the invention may be applied directly to the identification of potential insecticidally-active compounds or alternatively, modified for such purposes by assaying for the binding (direct or indirect) of the recombinant or isolated insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide of the invention to a steroid response element (SRE), rather than by assaying for reporter gene expression. According to this alternative embodiment, the binding assayed in the presence or absence of a potential insecticidally-active compound is compared, wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.

In addition, substances may be screened for insecticidal activity by assessing their ability to bind, in vivo or in vitro, to the intact ecdysone receptor or alternatively, the ligand-binding regions of the EcR polypeptide subunit of the ecdysone receptor (eg. <400>2 and/or <400>6 and/or <400>10) and/or the EcR partner protein USP polypeptide) of the ecdysone receptor (eg. <400>4 and/or <400>12 and/or <400>14). Competition assays involving the native insect steroid may be employed to assess insecticidal activity.

The performance of this embodiment may, for example, involve binding the insect steroid receptor polypeptide to a support such as a plurality of polymeric pins, whereafter the polypeptide resident on the plurality of pins is brought into contact with candidate insecticidal WO 99/36520 PCT/AU99/00033 -41molecules for screening. The molecules being screened may be isotopically labelled so as to permit ready detection of binding. Alternatively, reporter molecules may be utilized which bind to the insect steroid receptor candidate molecule complex. Alternatively, compounds for screening may be bound to a solid support, such as a plurality of pins which are then reacted with the thermostable insect steroid receptor or complex with a partner protein. Binding may, for example, be determined again by isotopic-labelling of the receptor, or by antibody detection or use of another reporting agent.

In an alternative embodiment, insecticidally-active agent are identified using rational drug design, by expressing a USP polypeptide of a juvenile hormone receptor or a fragment thereof which includes the ligand-binding region, optionally in association with an EcR polypeptide of a steroid receptor or ligand binding domain thereof, and optionally in association with an insect steroid or analogue thereof, so as to form a complex, determining the three-dimensional structure of the ligand binding domain of the complex, and identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding domain, wherein said compounds represent candidate insecticidally-active agents.

The methods described herein for identifying modulators of gene expression and insecticidal compounds, may be performed using prokaryotic or eukaryotic cells, cell lysates or aqueous solutions.

A further aspect of this invention accordingly relates to synthetic compounds derived from the three dimensional structure of EcR polypeptides and/or EcR partner protein (USP polypeptide) subunits of insect steroid receptors, or fragments thereof, or insect steroid receptors or fragments thereof, or USP polypeptides of insect juvenile hormone receptors or fragments thereof, which compounds are capable of binding to said receptors which have the effects of either inactivating the receptors (and thus acting as antagonists) or potentiating the activity of the receptor.

By "derived from" it is meant that the compounds are based on the three dimensional structure of the aforementioned proteins, that is, synthesized to bind, associate or interfere with insect WO 99/36520 PCT/AU99/00033 -42steroid binding or juvenile hormone binding.

The compounds may bind strongly or irreversibly to the ligand binding site or another region of the receptor or USP and act as agonists or antagonists of insect steroids, or juvenile hormone binding, or otherwise interfere with the binding of ligand, such that ecdysteroids or juvenile hormones. Such compounds would have potent insecticidal activity given the key role of insect steroids, or juvenile hormone, in insect physiology and biochemistry. Such compounds would also possess a unique specificity.

This invention is also described with reference to the following non-limiting examples.

EXAMPLE 1 Construction of a plasmid (pSV40-EcR) expressing the EcR polypeptide subunit of the D. melanogaster ecdysone receptor A 3110 base-pair Fspl-Hindlll fragment was excised from a cDNA encoding the EcR polypeptide subunit of the D. melanogasterecdysone receptor (Koelle et al.,1991), the excised sequence comprising the complete 2634 base pair coding region and 214 base pairs of leader sequence and 258 base pairs of untranslated sequence. The fragment was ligated into the BamH1 site of the expression plasmid pSG5 (Greene et al, 1988) to produce the expression plasmid pSV40-EcR, wherein expression of the EcR polypeptide subunit of the Drosophila melanogaster ecdysone receptor is placed operably under the control of the promoter sequence.

EXAMPLE 2 Construction of the reporter plasmid p(EcRE) 7

-CAT

The reporter plasmid p(EcRE) 7 -CAT was constructed by insertion of seven copies of the hsp27 ecdysone response element, containing a central 13 base pair palindromic ecdysone response element (EcRE), derived from the hsp27 gene (Riddihough and Pelham, 1987) into the Hindlll WO 99/36520 PCT/AU99/00033 -43site of the plasmid pMMTV-CAT (Hollenberg and Evans, 1988), 93 base pairs upstream of the transcription start site of the MMTV promoter, thereby operably connecting expression of the chloramphenicol acetyltransferase structural gene to regulation by an insect receptor which binds to the hsp27 ecdysone response element.

EXAMPLE 3 Cell Culture and Transient Transfection Chinese hamster ovary (CHO) cells were maintained in 50% Dubbecco's modified Eagle's medium (DMEM) and 50% Hamm F12 nutrient mixture (GIBCO) supplemented with foetal bovine serum. Transfection was carried out by the DNA-calcium phosphate coprecipitation method (Ausubel et al, 1992). One day before transfection with the plasmids described in Examples 1 and/or 2, or other expression plasmids, CHO cells were plated out at 5 8 x 105 cells per 6 cm diameter culture dish in the above DMEM/F12 medium. Three hours before the addition of the DNA-calcium phosphate co-precipitate, the cells were washed with phosphate buffered saline (PBS; Sambrook et al., 1989) and cultured in fresh DMEM plus foetal bovine serum. The cells were incubated in the presence of the co-precipitate for eighteen hours before excess DNA was removed by washing with PBS. The cells were then cultured for another day in DMEM/F12 supplemented with 10% foetal bovine serum with or without added ponasterone A (PNA), before harvesting. Cells were washed with PBS, harvested by mechanical scraping in 0.25 M Tris-HCI (pH and disrupted by three freezethaw cycles.

All transfections included, in addition to expression and reporter plasmids, a P-galactosidaseexpressing plasmid designated pPgK-LacZ (McBurney et al, 1991), which served as an internal control for the efficiency of transfection, and pUC18 DNA in an amount sufficient to produce 10 pg total DNA per culture dish.

The chloramphenicol acetyltransferase (CAT) and 1-galactosidase activities encoded by the reporter genes present in the reporter plasmids were assayed as described in Sambrook et al, (1989). Cells that were co-transfected with p(EcRE) 7 -CAT and pSV40-EcR clearly showed WO 99/36520 PCT/AU99/00033 -44induction of CAT activity in the presence of PNA, showing 50 units of activity. Controls showed negligible activity.

We have observed that the ecdysone receptor can lead to stimulation of expression from an ecdysone responsive promoter in some cell types, for example in CHO cells, but not in CV-1 cells. Whilst not being bound by any theory or mode of action, this may reflect a cell-type specific distribution of at least one other transcription factor essential for ecdysone responsiveness. To determine cell types suitable for expressing reporter genes under the control of the steroid receptor of the present invention, the cell-type specificity of ecdysoneresponsive gene expression is assayed in cell-free transcription lysates derived from several target cell lines. Additionally, by fractionating and/or isolating the nuclear proteins of cell lines that express the reporter genes and supplementing lysates derived from non-expressing cell lines with such nuclear protein fractions or isolated proteins, any essential auxiliary factors are defined and the genes encoding them cloned. Co-transfection of the receptor-encoding genes with genes encoding such auxiliary factors removes limitations imposed by cell-type restricted ecdysone responsiveness.

EXAMPLE 4 Testing the Effect of temperature on transient expression To determine whether the D. melanogaster ecdysone receptor polypeptide is stable at physiological temperatures above about 30"C, CHO cells were transfected as described in Example 3, with the plasmid pSV40-EcR and the reporter plasmid p(EcRE) 7 -CAT in the presence of PNA, at 30 0 C and 37*C.

Briefly, CHO cells were plated out at 37°C sixteen to twenty hours before transfection. After washing away the DNA, the cells were cultured for two hours in fresh medium with or without hormone and the dishes divided into duplicate sets. One set was cultured for another day at 37°C before harvesting for CAT and 1-galactosidase assays. The other set was cultured for three days at 30 0 C before assaying enzyme activities. Results indicated a reduction in the WO 99/36520 PCT/AU99/00033 fold-induction of gene expression regulated by the D. melanogaster ecdysone receptor polypeptide at 37"C, compared to the fold-induction at 30 0 C, as shown in Table 1.

Attempted screening of an L. cuprina genomic DNA library to isolate genes encoding the EcR polypeptide subunit of the L. cuprina ecdysone receptor A 627 bp Eco Kpn I fragment encompassing the DNA-binding domain of the EcR polypeptide subunit of the D. melanogaster ecdysone receptor was isolated, radioactively labelled and used to screen a L. cuprina genomic library constructed in bacteriophage lambda (prepared by CSIRO, division of Entomology, Canberra, Australia). In the first round of screening, twentyfour regions of the plates showed potential positive hybridization to the D. melanogaster probe.

However, second-round screening of these 24 first round positive plaques failed to yield any plaque giving a reproducible positive signal when hybridized to the D. melanogaster probe.

TABLE 1 PNA Fold-induction of (pg/dish) (pM) expression 370C 20 14X 100 59X 54X 20 8X 26X 100 47X 33X 0.1 20 1.6X 100 9.0X 39X WO 99/36520 PCT/AU99/00033 -46- EXAMPLE 6 Cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the L. cuprina ecdysone receptor Rationale for amplification primer design The nucleotide sequences of the primers Rdna3 (400>15) and Rdna4 (<400>16) were derived from the amino acid sequence conserved between the DNA-binding domains of the EcR polypeptide subunits of the D. melanogaster and C. tentans ecdysone receptors. However, amino acid sequences homologous to two other members of the steroid receptor superfamily of D. melanogaster, Drosophila hormone receptor 3 (DHR3; Koelle, et al., 1991) and Drosophila early gene (E75; Segraves and Hogness, 1990) were excluded from the primer designs, to reduce the possibility of amplifying the L. cuprina homologues of genes encoding DHR3 and/or E75 by PCR.

Amplification primers and PCR conditions A 105 base pair DNA fragment, encoding the DNA-binding domain of the EcR polypeptide subunit of the L. cuprina ecdysone receptor, was amplified from the L. cuprina genome by PCR, by using the following degenerate primers: Rdna3 (32mer with EcoRI site): 3' <400>15); and Rdna4 (32mer with BamHI site): 3' <400>16).

Amplification 'reactions employed Taql DNA polymerase (Promega) and the following amplification conditions: cycle 1: 97 0 C/5 minutes, 50*C hold; add polymerase 50 0 C/5 minutes; cycles 2-3: 72*C/3 minutes, 94 0 C/1 minute, 50 0 C/1 minute; cycles 4-43: 72*C/3 minutes, 94 0 C//1 minute, 55"C/1 minute; cycle 44: 72*C/10 minutes.

WO 99/36520 PCT/AU99/00033 -47- To facilitate cloning of the amplified fragments for use as hybridisation probes, the 5' end of primer Rdna3 contained an EcoRI site and the 5' end of primer Rdna4 contained a BamHI site.

The amplified L. cuprina gene fragments were cloned into pBluescript SK+, following digestion using the enzymes EcoRI and BamHI, purification of the digested DNA by agarose gel electrophoresis and electro elution of the product band.

Hybridisation probe preparation For probe preparation, the insert was cut out of the pBluescript SK+ vector using EcoR1 and BamHI, and 32 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Adelaide, Australia) essentially according to the manufacturer's instructions, except that random primers were replaced with the specific primers Rdna3 and Rdna4 (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations.

Construction and screening of L. cuprina cDNA libraries Two independent L. cuprina cDNA libraries derived from late third instar L. cuprina larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/Zapll vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols.

Both cDNA libraries generated are superior to existing L. cuprina libraries in terms of their phage titre pfu/ml) and insert sizes (0.5 4 kbp in both cases). In particular, the primary oligo-dT primed library comprised 4.7 x 106 pfu, whilst the amplified oligo-dT primed library comprised 7.5 x 1010 pfu/ml; the primary random-primed library comprised 1.3 x 106 pfu, whilst the amplified random-primed library comprised 3.4 x 101' pfu/ml.

The prepared cDNA libraries were screened by lifting 500,000 plaques from each library in duplicate on to Hybond N membranes (Amersham) and hybridizing same under low stringency conditions to the 32 P-labelled amplification product produced using the primers Rdna3 and Rdna4 (see above). In particular, hybridisations were performed for twenty four hours at 37°C in a hybridisation solution comprising 42% formamide; 5 x SSPE solution; 5 x Denhardt's WO 99/36520 PCT/AU99/00033 -48solution; and 0.1% sodium dodecyl sulphate, as described essentially by Ausubel et al, (1992) and/or Sambrook et al. (1989). The membranes were then washed at 37"C in 2XSSC solution containing 0.1% sodium dodecyl sulphate. Following washing, positive plaques were detected by autoradiography, using XOMAT-AR film (Kodak) for two to three days, at -70 0

C.

Two positive-hybridising plaques were obtained from screening of the random-primed library (containing cDNA inserts comprising 561 base pairs and 1600 base pairs in length, respectively), and one positive-hybridising plaque was obtained from the screening of the oligo-dT primed library (containing a cDNA insert comprising approximately 3400 base pairs in length). pBluescript phagemids containing cDNA inserts were excised in vivo from these positive plaques using the Exassist Helper Phage system (Stratagene).

The nucleotide sequences of the isolated cDNA clones were obtained using the USB Sequenase Version 2.5 Kit. Sequence data obtained indicated that the 561 bp and 1600 bp cDNAs encode amino acid sequences comprising the important DNA-binding domain and the hormone-binding domain of the EcR polypeptide subunit of the L. cuprina ecdysone receptor, whilst the 3400 bp cDNA comprises an entire 2274 bp open reading frame encoding the EcR polypeptide subunit of the L. cuprina ecdysone receptor. Accordingly, the 3400 bp cDNA is a full-length cDNA clone. The nucleotide sequence of the open reading frame and 3'untranslated region is set forth herein as <400> 1. The derived amino acid sequence of the EcR polypeptide subunit of the L. cuprina ecdysone receptor encoded by this open reading frame is set out in <400> 2.

EXAMPLE 7 First attempt at cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the M. persicae ecdysone receptor Direct screening of a M. persicae cDNA library was not effective in isolating a full-length cDNA encoding the EcR polypeptide of the M. persicae ecdysone receptor.

WO 99/36520 PCT/AU99/00033 -49- DNA encoding the DNA-binding domain of the EcR polypeptide of the M. persicae ecdysone receptor was isolated successfully, by amplification as described in Example 6 for the amplification of the homologous L. cuprina fragment. The amplified DNA was cloned into pBluescript SK+ and the nucleotide sequence of the cloned insert was obtained using the USB Sequenase version 2.0 Kit, as described in Example 6.

Based upon the nucleotide sequence of the amplified DNA fragment, two authentic primers were synthesized as follows: Mdnal (23mer): GCCTCGGGGTATCACTATAACGC <400>17); and Mdna2 (23mer): GCACTCCTGACACTTTCGTCTCA <400>18).

Hybridisation probe preparation For M. persicae probe preparation, the amplified 105 bp DNA insert was excised from the pBluescript SK+ vector using EcoRI and BamHI, and 32 P-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Adelaide, Australia) essentially according to the manufacturers instructions, except that random primers were replaced with the specific primers Mdnal and Mdna2 (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations.

Construction and screening of M. persicae cDNA libraries: Two independent M. persicae cDNA libraries derived from late third instar M. persicae larvae were prepared by random priming and oligo-dT priming respectively, and cloned into the EcoRI site of the Lambda/Zapll vector (Stratagene). The primary libraries generated were subsequently amplified according to the manufacturer's instructions, using standard protocols.

Both cDNA libraries generated are superior to existing M. persicae libraries in terms of their phage titre pfu/ml) and insert sizes (0.5 4 kbp in both cases). In particular, the primary oligo-dT-primed library comprised 1 x 107 pfu, whilst the amplified oligo-dT primed library comprised 1 x 1010 pfu/ml; the primary random-primed library comprised 1 x 106 pfu, whilst the WO 99/36520 PCT/AU99/00033 amplified random-primed library comprised 2 x 1011 pfu/ml.

Additionally, a further cDNA library was produced in the Lambda ZAP Express insertion vector (Stratagene). To produce this library, cDNA derived from late third instar M. persicae larvae was prepared by oligo-dT priming and cloned directionally into EcoRI-Xhol digested vector DNA. The primary library comprised 1 x 106 pfu, whilst the amplified oligo-dT primed library comprised 1 x 109 pfu/ml, with insert sizes in the range 0.5 >4 kbp.

The random-primed M. persicae cDNA phage library was screened as described in Example 6, using the M. persicae hybridisation probe prepared as described above.

A single positive-hybridising plaque was isolated and sequenced according to standard procedures. The nucleotide sequence of this clone is set forth herein as <400>5. This cDNA clone comprises a 585bp protein-encoding sequence which encodes the DNA-binding domain of a EcR polypeptide of a putative M. persicae ecdysone receptor. The amino acid sequence encoded by this partial cDNA clone is set forth herein as <400> 6.

EXAMPLE 8 Second attempt at cloning and characterization of a cDNA molecule encoding the EcR polypeptide of the M. persicaeecdysone receptor Hybridisation probe preparation Further hybridisation probes specific for the EcR polypeptide of the M. persicae ecdysone receptor were generated using PCR from the Lambda ZAPII oligo dT-primed library using primers AP1 and AP2. The forward primer AP1 was designed to anneal to nucleotide sequences of the partial cDNA (<400>5) encoding part of the first zinc finger motif present in the DNA-binding domain. The reverse primer, AP2, was adapted from degenerate primers designed to anneal to nucleotide sequences complementary to those encoding an EcR ligand binding domain (Kamimura et al., 1996). The nucleotide sequences of primers AP1 and AP2 are as follows: WO 99/36520 PCT/AU99/00033 -51 Primer AP1: TCGTCCGGTTACCATTACAACGC (<400>19); and Primer AP2: TAGACCITTGGC(A/G)AA(C/T)TC(A/G/C/T)ACAAT -3'(<400>20) The PCR reaction mixture contained 4 pl of each primer (50 pm/pl), 5 pl of deoxynucleotide triphosphate mix (2mM), 1 pl of aphid oligo dT primed Lambda ZAPII cDNA library, 1 pl of recombinant Pfu DNA Polymerase (5 units/pI, Stratagene®), 5 pl of 10x Pfu buffer (Stratagene®) and 30 pl of MilliQ water. The Pfu polymerase was used in this reaction because it possesses proof-reading activity, which reduces the possibility of misincorporation of nucleotides. The PCR conditions included 42 cycles, each cycle comprising annealing at 55C, extension at 72 0 C and melting at 94 0

C.

The major amplification product obtained in this reaction was gel-purified, kinased and ligated into the Smal site of pUC18.

To screen M. persicae cDNA libraries, the cloned amplification product was digested to generate two non-overlapping probes, designated "EcR probe 1" <400>7) and "EcR probe 2" <400>8). In this regard, digestion of the cloned product with Sphl produced a DNA fragment comprising a nucleotide sequence specific for a region encoding the DNAbinding domain (EcR probe 1; <400> whilst digestion with Sphl/EcoRI produced a DNA fragment comprising a nucleotide sequence having homology to a region encoding a putative linker domain, designated domain D, and the 5'-end of a putative hormone-binding domain, present in the EcR polypeptide of the insect ecdysone receptors (EcR probe 2, <400> 8).

EcR probe 1 and EcR probe 2 were labelled with [a- 32 P]dATP in a reaction catalysed by Klenow fragment. All reagents were components of a GIGAprime DNA labelling kit (BresaGen Limited, Adelaide, Australia), except that the random primers were replaced with specific oligonucleotides synthetisezed to be complementary to the ends of EcR probe 1 and EcR probe 2.

Screening of M. persicae cDNA libraries 480,000 plaques from the oligo dT primed Lambda Zap Express cDNA library (Example 7) WO 99/36520 PCT/AU99/00033 -52were screened as described above, using EcR probe 1. This approach yielded about 300 positive clones. Positive-hybridising clones were pooled and rescreened separately using EcR probe 1 and EcR probe 2, on duplicate lifts. Only four plaques were identified which hybridised to both probes. One of these was found by sequencing to contain a full-length cDNA encoding the EcR polypeptide of the M. persicae ecdysone receptor. The nucleotide sequence of the open reading'frame of this cDNA is set forth herein as <400> 9. The derived amino acid sequence of the EcR polypeptide subunit of the M. persicae ecdysone receptor encoded by this open reading frame is set out in <400> EXAMPLE 9 In vivo function of recombinant EcR polypeptides of the L. cuprina ecdysone receptor Construction of plasmid pF3 Plasmid pF3 was constructed in four steps as follows: First, plasmid p5S1, comprising the full-length cDNA encoding the EcR polypeptide of the L.

cuprina ecdysone receptor was digested with Earl and a 3' Earl cDNA fragment thus generated, encoding the C-terminal end of the EcR polypeptide of the L. cuprina ecdysone receptor, was end-filled and sub-cloned into the Hindll site of pUC19, to construct plasmid pEAR. In plasmid pEAR, the 3' end of the cDNA was oriented towards the Kpnl site of the pUC19 vector.

Second, plasmid p5S1 was also digested separately with: Apol and Pstl, to isolate the 5' end of the cDNA as a 179 bp fragment (fragment A); Pstl and Spel, to isolate a 1650 bp cDNA fragment (fragment and Spel and Bglll, to isolate a 203 bp fragment (fragment C).

Third, plasmid pEAR was digested with BgllI and Kpnl, to isolate the 3' end of the cloned cDNA fragment therein as a 313 bp fragment (fragment D).

Fourth, DNA fragments A, B, C and D were each isolated by agarose electrophoresis and WO 99/36520 PCT/AU99/00033 -53ligated together into pBluescriptSK+, which had been digested with EcoRI and Kpnl, to produce plasmid pF3.

Plasmid pF3 thus contains the complete open reading frame of the cDNA encoding the EcR polypeptide of the L. cuprina ecdysone receptor, as a 2368 bp fragment located between two BamHI sites.

Construction of plasmid pSGLcEcR and Dlasmid pLcK8 Plasmid pSGLcEcR was constructed by cloning the 2368 bp BamHI fragment from pF3, into the BamHI site of the mammalian expression vector pSG5 (Stratagene). Plasmid pLcK8 is a clone of-pSGLcEcR.

Construction of olasmid pSGDmEcR Plasmid pSGDmEcR is identical to plasmid pSV40-EcR (Example 1) comprising the EcR polypeptide of the D. melanogaster ecdysone receptor placed operably under control of the promoter.

Transfection of CHO cells CHO cells were co-transfected with a mixture comprising the following DNAs, lysed and assayed for CAT and p-galactosidase enzyme activity, as. described in the preceding Examples: one of the expression plasmids designated pSGDmEcR, or pSGLcEcR, or the parental expression plasmid pSG5 as a negative control, at a concentration of 1 pg/ml; and the CAT reporter plasmid p(EcRE) 5 CAT at a concentration of 1 pg/ml; and an independent LacZ reporter plasmid, pPGKLacZ, at a concentration of lug/ml, included as a control to monitor transfection efficiency.

CAT reporter gene expression was induced with 10 pM or 50 pM Muristerone A. In control samples, cells received only the carrier ethanol in place of Muristerone A.

ELISA was used to quantify the synthesis of CAT and P-galactosidase enzymes, in extracts WO 99/36520 PCT/AU99/00033 -54of cells forty eight hours after transfection. Account was taken of the variation between experiments, by normalizing the level of CAT enzyme to the level of P-galactosidase enzyme present in the same extract. Fold induction represents the normalized values for CAT gene expression in cells transfected with pSGDmEcR, pSGLcEcR or pSG5 in the presence of hormone divided by the normalized values for CAT gene expression in cells transfected with the same plasmid but in the absence of hormone. The average values of three independent experiments are shown in Figure 1 and the error bars indicate standard error of the mean.

Data shown in figure 1 indicate that the EcR polypeptide of the L. cuprina ecdysone receptor from Example 3 is biologically active in vivo. CAT induction is observed at both 50 pM and pm steroid (Muristerone with about 30 and 15 fold induction respectively. In view of the in vivo activity of the EcR polypeptide of the L. cuprina ecdysone receptor obtained according to this protocol, potential insecticidal substances acting by interaction with an insect steroid receptor, such as an ecdysone receptor, are screened by addition of the substances to the in vivo assay described herein. Substances are added in an amount from 0.05 pM to 100 pM.

Candidate insecticidal compounds are identified by their ability to modulate the reporter gene expression which results from trans-activation by the EcR polypeptide of the L. cuprina ecdysone receptor.

EXAMPLE Chimeric EcR polypeptides of insect ecdysone receptors Chimeric ecdysone receptors comprsing regions derived from EcR polypeptides of ecdysone receptors of different species are produced and assayed for enhanced activity. In a particularly preferred embodiment, a chimeric ecdysone receptor is produced using the EcR polypeptides of the D. melanogaster, M. persicae and L. cuprina ecdysone receptors.

In one exemplification of this embodiment, plasmids pSGLD and pSGDL are produced comprising coding regions derived from the EcR polypeptides of the D. melanogaster and L.

cuprina ecdysone receptors. In plasmid pSGLD, the 5'-end of the open reading frame of the D. melanogaster sequence, encoding the N-terminal portion of the EcR polypeptide of the D.

melanogaster ecdysone receptor to the end of the DNA-binding domain of said polypeptide, WO 99/36520 PCT/AU99/00033 is fused to the 3'-end of the open reading frame of the L. cuprina sequence, encoding the Cterminal portion of the EcR polypeptide of the L. cuprina ecdysone receptor, from the D domain and hormone-binding domain to the carboxyl terminus. In plasmid pSGDL, the 5'-end of the open reading frame of the L. cuprina sequence, encoding the N-terminal portion of the EcR polypeptide of the L. cuprina ecdysone receptor to the end of the DNA-binding domain of said polypeptide, is fused to the 3'-end of the open reading frame of the D. melanogaster sequence, encoding the C-terminal portion of the EcR polypeptide of the D. melanogaster ecdysone receptor, from the D domain and hormone-binding domain to the carboxyl terminus.

These plasmids thus encode chimeric EcR polypeptides which form ecdysone receptor variants.

As shown in Figure 2, chimeric EcR polypeptides of L. cuprina and D. melanogaster ecdysone receptors, comprising fusion polypeptides between the DNA-binding domains and hormonebinding domains of the base L. cuprina and D. melanogaster polypeptides, exhibit bioactivity when measured in the CAT assay described above. Significant bioactivity of the chimeric EcR polypeptides encoded by plasmids pSGLD and pSGDL, comparable to the bioactivity of the D. melanogaster base EcR polypeptide, is observed at both 10 pM and 50 pM concentrations of Muristerone A.

EXAMPLE 11 Isolation and characterisation of a full-length cDNA encoding the EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor The EcR partner protein (USP polypeptide) subunit of the L. cuprina ecdysone receptor also functions alone as a USP polypeptide of the L. cuprina juvenile hormone receptor. A cDNA encoding both receptor polypeptide activities was isolated using PCR and hybridisation as follows.

Hybridisation probe preparation A 150 base-pair probe, specific for genetic sequences encoding the EcR partner protein (USP polypeptide) subunit of insect ecdysone receptors and/or the USP polypeptide subunit of insect juvenile hormone receptors (<400>13), was isolated by PCR from L. cuprina genomic WO 99/36520 PCT/AU99/00033 -56- DNA using the degenerate primers described by Tzertzinis et al. (1994). The PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of i Taql polymerase.

The amplified DNA fragment was sub-cloned into EcoRI and Clal double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and Clal, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band. The nucleotide sequence of the probe was obtained using the USB Sequenase version 2.0 Kit <400> 13).

For probe preparation, the amplified L. cuprina DNA fragment was excised from the vector using EcoRI and Sail, gel purified and 3 2 P-labelled using the GIGAprime DNA Labelling Kit (BresaGen Limited, Adelaide, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the two degenerate primers described by Tzertzinis et al. (1994) (see above). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations.

Screening of L. cuorina cDNA libraries The L. cuprina cDNA library described above (Example 6) was screened with the amplified probe as described in Example 6. The nucleotide sequence of the full-length open reading frame of this cDNA molecule and amino acid sequence therefor, are set forth herein as <400> 3 and <400> 4, respectively.

EXAMPLE12 Isolation and characterisation of a partial cDNA encoding the EcR partner protein (USP polypeptide)of the M. persicae ecdysone receptor The EcR partner protein (USP polypeptide) subunit of the M. persicae ecdysone receptor also functions alone as a USP polypeptide of the M. persicae juvenile hormone receptor. To isolate WO 99/36520 PCT/AU99/00033 -57a partial cDNA encoding both receptor polypeptide activities, a 140 bp probe was amplified from M. persicae genomic DNA, by PCR, using the two degenerate primers described by Tzertzinis et a.(1994) (see preceding Example). The PCR reaction conditions were as described in Example 6, except that Pfu polymerase was used in place of Taql polymerase.

The amplified DNA fragment was sub-cloned into EcoRI and Clal double-digested pBluescript SK+ vector (Stratagene), after double-digestion of the fragment using the enzymes EcoRI and Clal, purification of the amplified fragment by agarose gel electrophoresis, and electro elution of the product band.

The nucleotide sequence of the insert in the pBluescript SK+ vector was obtained using automated fluorescent dye terminator sequencing (SUPAMAC, Sydney Australia) and is set forth herein as <400> 11. The derived amino acid sequence of this partial gene fragment is set forth as <400>12.

Hybridisation probe preparation and library screening For probe preparation the amplified M. persicae DNA insert was cut out of the pBluescript+ vector with EcoRI and Sail, gel purified and 32 P-labelled using the GIGAprime DNA Labelling Kit (Bresatec Limited, Adelaide, Australia) essentially according to the manufacturer's instructions except that random primers were replaced with the degenerate primers described by Tzertzinis et a/.(1994) (see preceding Example). Unincorporated label was removed by size exclusion chromatography over Biogel-P60 (Biorad Ltd, Sydney, Australia). The probe was used at 106 cpm/ml in hybridizations to screen the M. persicae cDNA library as described in Examples 7 and 8.

The positive-hybridising clones are plaque-purified and sequenced using standard procedures as described herein.

PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT 21/12/99 Received 21 December 1999 -58- EXAMPLE 13 A construct for the baculovirus-directed co-expression of functional ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) of the D.

melanogaster ecdysone receptor A vector was prepared to facilitate the baculovirus-directed co- expression of ligand-binding regions derived from the EcR polypeptide and partner protein (USP polypeptide) of the D.

melanogasterecdysone receptor, the protein products of which associate on co-expression to form a functional hormone-binding complex. The associated proteins are then used in high through-put assays or three-dimensional structural analysis. We have found that the ligandbinding domain, together with most of the linker domain of the EcR polypeptide subunit and of the EcR partner protein (USP polypeptide), are ssufficient to associate to form a functional hormone-binding complex.

1. Isolation of the ligand-binding region of the EcR polypeptide of the D. melanoaaster ecdysone receptor.

A Sac I- Hindlll fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the Drosophila melanogaster ecdysone receptor was excised from a plasmid comprising DNA encoding the complete EcR polypeptide (Koelle et al. 1991). The excised fragment was cloned into Sad Hindlll-digested expression vector pQE31(Qiagen), to produce the plasmid vector pQE31DmECR.

2. Construction of a baculovirus expressing the ligand-binding regions of EcR and USP polvyeptides A baculovirus was constructed for the co-expression in insect cells of: a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the D.

melanogaster ecdysone receptor isolated as described at paragraph above; and (ii) a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the D. melanogaster ecdysone receptor.

AMENDED

SHEET

IPEA/AU

WO 99/36520 PCT/AU99/00033 -59- To produce this baculovirus, a EcoR I Hindlll fragment was excised from pQE31DmECR, said fragment encoding an oligo-His tag, and most of the linker domain, together with all of the ligand-binding domain of EcR polypeptide. This EcoR I Hindlll fragment was ligated into EcoR I Hindlll cleaved pFastBacDUAL, to produce the plasmid pDmEcR.DUAL. To insert gene sequences specific for the partner protein (USP polypeptide), the Hindll Nsil fragment encoding most of the linker and all of the ligand-binding domain of the partner protein (USP polypeptide) was excised from a full-length cDNA clone in plasmid pZ7-1 (supplied by Vince Henrich) and ligated into Ncol Nsl cleaved pDmEcR.DUAL. A nucleotide sequence encoding a "FLAG" peptide was subsequently incorporated upstream of, and in the same reading frame as, the nucleotide sequence encoding the linker and ligand-binding regions of the partner protein (USP polypeptide), by ligation into the unique Smal site, thereby producing the plasmid pDmEcR.USP.DUAL. Plasmids containing the FLAG-encoding nucleotide sequence in the correct orientation were selected by nucleotide sequence determination.

The segment of pDmEcR.USP.DUAL which encodes the tagged linker and ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) sequences, placed operably under the control of polyhedrin and p10 promoters, respectively, was recombined into a baculovirus genome, by employing the Tn7 transposition system (Luckow et al, (1993). The polypeptide products were then co-expressed in insect Sf21 and Sf9 cells, where they associated into a functional complex.

Expression of the tagged linker and ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) sequences was examined by immunoblot analysis of extracts derived from insect Sf21 cells infected with the recombinant baculovirus, employing antibodies directed against the oligo-His and FLAG tags. This analysis detected bands on immunoblot analysis of approximately the predicted sizes for the expressed tagged linker and ligandbinding regions of the EcR polypeptide and partner protein (USP polypeptide).

The protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak). It was further demonstrated that the oligo-His-tagged EcR polypeptide and the PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT 21/19 Received 21 December 1999 FLAG-tagged EcR partner protein (USP polypeptide) bound as a hetero-oligomeric complex to FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, performed using a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the a labelled ecdysone analogue, 3 H]ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos. In contrast, cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of 3 H] ponasterone A, above background levels. These data indicate correct folding and association of the variant polypeptides comprising the linker and ligand-binding regions of the D. melanogaster EcR polypeptide and D. melanogaster partner protein (USP polypeptide). The correctly-folded and associated complex formed by the truncated Ecr polypeptide and trucated EcR partner protein (USP polypeptide), is used for X-ray and NMR structural analysis and for high-throughput screens.

EXAMPLE 14 Construct for the baculovirus-directed co-expression of functional ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) of the L.

cuprina ecdysone receptor A vector for the baculovirus-directed co- expression of ligand-binding regions derived from the EcR polypeptide and partner protein (USP polypeptide) of the L. cuprina ecdysone receptor was prepared essentially as described in the preceding Example.

1. Isolation of the ligand-binding region of the EcR polypeptide of the L. cuorina ecdysone receptor.

A Sphl Kpnl fragment encoding most of the linker (domain D) and all of the ligand-binding domain (domains E and F) of the EcR polypeptide of the L. cuprina ecdysone receptor was excised from a cDNA clone encoding the complete EcR polypeptide and cloned into the Sphl -Kpnl cleaved expression vector pQE32 (Qiagen), to produce the plasmid pQE32LcEcR.

LU

AMENDED

SHEET

IPEA/AU

PCT/AU99/00033 P:\OPER\MROECDYSONE.PC- 21/1299 Received 21 December 1999 -61- 2. Construction of a baculovirus expressing the ligand-binding regions of L. cuprina EcR and USP polypeptides A baculovirus was constructed for the co-expression in insect cells of: a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the EcR polypeptide of the L.

cuprina ecdysone receptor isolated as described at paragraph above; and (ii) a cDNA region comprising a nucleotide sequence which encodes at least the ligand-binding domain and much of the linker domain of the partner protein (USP polypeptide) of the L. cuprina ecdysone receptor.

To produce this baculovirus, a EcoR I Pstl fragment derived from plasmid pQE32LcEcR, encoding an oligo-His tag and most of the linker domain together with all of the ligand-binding domain of the L. cuprina EcR polypeptide was ligated into EcoRI- Pstl cleaved pFastBac.DUAL, to produce the plasmid pLcEcR.DUAL. An Avall-EcoRV fragment, encoding most of the linker and all of the ligand-binding domain of L. cuprina partner protein (USP polypeptide) was excised from plasmid pBLU1, containing the cDNA encoding the full-length L. cuprina partner protein (USP polypeptide), and ligated, together with a "FLAG"-encoding sequence into the Pvull site of pLcEcR.DUAL, to produce plasmid pLcEcR.USP.DUAL.

The segment of pLcEcR.USP.DUAL which encodes the tagged linker and ligand-binding regions of the EcR polypeptide and partner protein (USP polypeptide) sequences, placed operably under the control of polyhedrin and p10 promoters, respectively, was recombined into a baculovirus genome, by employing the Tn7 transposition system (Luckow et al, (1993). The polypeptide products were then co-expressed in insect Sf21 and Sf9 cells, where they associated into a functional complex.

CC-

ANT O AMENDED SHEET

IPEA/AU

WO 99/36520 PCT/AU99/00033 -62- Expression was examined by immunobiot analysis. Antibodies directed against oligo-His and FLAG tags detected bands on immunoblot analysis of approximately the predicted sizes for the expressed EcR and USP polypeptide regions respectively, in extracts from insect Sf21 cells infected with the recombinant baculovirus. The protein detected by anti-oligo-His was greatly enriched utilising a nickel-NTA resin (Qiagen) and the FLAG-labelled protein purified on FLAG M2 Affinity Gel (Kodak). It was also demonstrated by immunoblot analysis that oligo- His-tagged L. cupina truncated EcR polypeptides and FLAG-tagged L. cuprina truncated EcR partner protein (USP polypeptide) bind as a hetero-oligomeric complex to FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, carried out by a modification of the method of Yund et al (1978), demonstrated a highly-significant increase in the binding of the tritiated ecdysone analogue, ponasterone A, in cells infected by recombinant virus indicating correct folding and association of the two protein subunits (Figure greater than that of the ecdysone holoreceptor in L.

cuprina embryos. Cells infected by a control virus displayed neither antibody-positive bands on western analysis nor specific binding of tritiated hormone above background.

Expression of the tagged linker and ligand-binding regions of the L. cuprina EcR polypeptide and partner protein (USP polypeptide) sequences was examined by immunoblot analysis of extracts derived from insect Sf21 cells infected with the recombinant baculovirus, employing antibodies directed against the oligo-His and FLAG tags. This analysis detected bands on immunoblot analysis of approximately the predicted sizes for the expressed tagged linker and ligand-binding regions of the L. cuprina EcR polypeptide and partner protein (USP polypeptide).

The protein detected by anti-oligo-His-antibodies was enriched by affinity purification on nickel- NTA resin (Qiagen), and the FLAG-labelled protein was affinity-purified using FLAG M2 Affinity Gel (Kodak).

Furthermore, binding assays, performed using a modification of the method of Yund et al (1978), demonstrated a significant increase in the binding of the labelled ecdysone analogue, WO 99/36520 PCT/AU99/00033 -63- [3H] ponasterone A, in cells infected by the recombinant baculovirus, compared to the binding observed for the naturally-occurring ecdysone holoreceptor in L. cuprina embryos (Figure 3).

In contrast, cells infected by a control virus displayed neither antibody-positive bands on western analysis, nor specific binding of [3H] ponasterone A, above background levels.

These data indicate correct folding and association of the variant polypeptides comprising the linker and ligand-binding regions of the L. cuprina EcR polypeptide and L. cuprina partner protein (USP polypeptide). The correctly-folded and associated complex formed by the truncated Ecr polypeptide and trucated EcR partner protein (USP polypeptide), is used for Xray and NMR structural analysis and for high-throughput screens.

EXAMPLE A construct for the expression of the ligand-binding region of the USP polypeptide of the L. cuprina juvenile hormone receptor The donor plasmid pLcEcR.USP.DUAL (Example 14) was digested with BssHII and Pstl to remove the L. cuprina EcR polypeptide-encoding segment therein, thereby leaving the tagged linker and ligand-binding regions of the L. cuprina USP polypeptide-encoding nucleotide sequence. The digested plasmid was blunt-ended using T4 DNA polymerase and Klenow polymerase, isolated by gel purification, and finally re-ligated to produce the plasmid pLc.USP.SINGLE.

To produce recombinant baculovirus capable of expressing the tagged linker and ligandbinding regions of the USP polypeptide, the segment of pLc.USP.SINGLE encoding this 2 polypeptide and the p10 promoter sequence to which said segment is operably connected, is recombined into a baculovirus genome employing the Tn7 transposition system (Luckow et al., 1993). The polypeptide product is then expressed to form a functional juvenile hormonebinding polypeptide and preferably, a modulator of a juvenile hormone receptor. The correctlyfolded truncated USP polypeptide is used for X-ray and NMR structural analysis and for highthroughput screens.

WO 99/36520 PCT/AU99/00033 -64- EXAMPLE 16 In-vitro Screening for the Detection of Insecticidal Compounds The EcR partner protein (USP polypeptide) of the insect ecdysone receptor and USP polypeptide of the insect juvenile hormone receptor of the present invention, optionally associated with the EcR polypeptides of insect ecdysone receptors of the present invention as described in the preceding Examples, are coupled to pins according to the procedure of Geysen et al. (1987), and reacted with candidate insecticidal compounds, generally at a concentration in the range from about 0.05 pM to about 100 pM of the candidate compound.

The binding of compounds is detected using standard procedures, and compounds having insecticidal activity are identified. Preferably, such compounds exhibit insecticidal activity against a range of insects, including diptera, hemiptera, coleoptera, ants, and moths, amongst others. More preferably, the compounds will exhibit insecticidal activity against L. cuprina, M.

persicae, D. melanogaster, scale insect, white fly, and leaf hopper, amongst others. In a particularly preferred embodiment, insecticidal compounds are specific to L. cuprina and/or M.

persicae and close relatives thereof.

WO 99/36520 PCT/AU99/00033

REFERENCES

1. Amann and Brosius (1985).Gene 40: 183.

2. Ausubel, et al (1992), Current Protocols in Molecular Biology, Greene/Wiley, New York 3. Bugg, et al (1993) Scientific American, December Issue: pp 60-66.

4. Devereux, et al. (1984). Nucl. Acids Res. 12:387-395.

Evans (1988) Science, 240: 889-895.

6. Geysen et al (1987) J. Immunol Methods, 102, 259-274.

7. Greene et al. (1988) Nucleic Acids Res. 15:369.

8. Hollenberd and Evans (1988) Cell 55: 899-906.

9. Hollenberg et al (1991) Cell, 67, 59-77.

Jones, G and Sharp, P, (1997) Proc. Nat. Acad. Sci. USA 94:13499-13503.

11. Kamimura et al (1996) Comp. Biochem. Physiol. 113. 341-347.

12. Koelle et al (1991) Cell, 67:59-77 13. Krust et al (1986) EMBO. 5: 891-897.

14. Luckow et al, (1993) J. Virol, 67: 4566.

McBurney et al (1991), Nucleic Acids Res., 19, 5755-5761.

16. McPherson, Quirke, P. and Taylor, G.R. (1991) PCR A Practical Approach. IRL Press, Oxford University Press, Oxford, United Kingdom.

17. Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453.

18. Potrykus (1990) Bio/Technology 8: 535-542.

19. Riddihough, and Pelham, H. R. (1987), EMBO 6, 3729-3734 Sambrook et al (1989), Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory Press 21. Segraves and Hogness (1990) Genes Devel. 4: 204-219.

22. Shimatake and Rosenberg (1981) Nature 292: 128 23. Studier and Moffat (1986) J. Mol. Biol. 189:113 24. Thompson,et al., (1994) Nucl. Acids Res. 22:4673-4680.

Tzertzinis et al (1994) J. Mol. Biol. 258, 479-486.

26. Von Itzstein et al (1993) Nature Vol. 363: 418-423.

27. Yund, et al. (1978) Proc. Nat. Acad. Sci. USA, 24: 6039-6043.

EDITORIAL NOTE FOR APPLICATION NO. 21429/99 THE FOLLOWING SEQUENCE LISTING, PAGES 1-36, IS BEFORE THE CLAIMS PAGE, NO.66 WO 99/36520 WO 9936520PCT/AU99/00033 -1I- SEQUENCE LISTING <110> COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION <120> NOVEL GENETIC SEQUENCES ENCODING STEROID AND JUVENILE HORMONE RECEPTOR POLYPEPTIDES AND INSECTICIDAL MODALITIES THEREFOR <130> 2136323/MRO <140> <141> <150> <151> PCT INTERNATIONAL 199 9-01-15 AU PP1536 1998-01-15 <160> 2 <170> P <210> 1 <211> 2 <212> D <213> L <220> <221> C <222>( 0 atentln Ver. 274

NA

ucilia cuprina

DS

1) (2271) <400> 1 atg atg aaa cga cgt tgg tct aat aat ggc ggt ttt gcc gct tta aaa 48 Met Met Lys Arg Arg Trp Ser Asn Asn Gly Gly Phe Ala Ala Leu Lys 1 5 10 atg tta gaa gaa tcc tcc tca gaa gta acc tcc tcc tca aat ggt ctg 96 WO 99/36520 WO 9936520PCT/AU99/00033 Met Leu Glu Glu Ser Ser Ser Giu Val.

25 Thr Scr Ser Ser Asn Gly Leu gtc ttg Val Leu tcg gat ata aat Ser Asp Ile Asn atg tca Met Ser cct tcc tcg Pro Ser Ser ttg gat tca ccc 144 Leu Asp Ser Pro gtt tat ggc gat cag gaa Val Tyr Gly Asp Gin Glu tgg ctg tgt aac Trp Leu Cys Asn tca gct tca tat 192 Ser Ala Ser Tyr aac agt Asn Ser cat cag His Gin agt gtt ata act Ser Vai Ile Thr ctg cag ggc tgc Leu Gin Gly Cys acc 240 Thr tca tca ttg ccg Ser Scr Leu Pro caa aca acc att Gin Thr Thr Ile cct ctg tca gct tta ccc 288 Pro Leu Ser Ala Leu Pro aat tcc aat Asn Ser Asn gcc tcc ctg aat Ala Ser Leu Asn caa aat caa aat Gin Asn Gin Asn tat caa aat 336 Tyr Gin Asn ggt aat tcc Gly Asn Ser 115 atg aat aca aat tta Met Asn Thr Asn Leu 120 tcg gtt Ser Val aac aca Asn Thr aac agt gtt 384 Asn Ser Val gga. gga ggt gga ggt ggt ggt ggt gta ccc ggt atg Gly Gly Gly Giy Gly Gly Giy Giy Val Pro Gly Met 130 135 140 act tca ctc aat 432 Thr Ser Leu Asn WO 99/36520 WO 9936520PCT/AU99/00033 ggt ctg ggt ggt ggt ggt ggc agt caa gtg aat aat cac aat cac agc 480 Gly Leu Gly Gly 145 Gly Gly Gly Ser Gin Val Asn 150 155 Asn His Asn His cac aat cat tta His Asn His Leu tcc cac cac aca Ser His His Thr 180 cac aac agc aac His Asn Ser Asn aat cac agt Asn His Ser aat agc agt 528 Asn Ser Ser 175 ggt ggt ggc 576 Gly Gly Gly 1.90 ggc cac atg Gly His Met att ggc ggc ggt Ile Gly Gly Gly tta tcg Leu Ser sat att Asn Ile sat ggt Asn Gly sat atc gtt agc Asn Ile Val Ser gcc caa Ala Gin cag 624 Gin tta aac Leu Asn 210 tcg tta cag gcc Ser Leu Gin Ala caa. aat Gin Asn ggc caa Giy Gin att cat gcc aat 672 Ile His Ala Asn ggc att cac agt Gly Ile His Ser atc agt aat gga Ile Ser Ass Gly aat cat cat cac Asn His His His cat 720 His 240 cat cat atg aat His His Met Asn agt agt atg atg Ser Ser Met Met cat cat aca ccc aga tct gaa 768 His His Thr Pro Arg Ser Giu 250 255 gat gat ctt tca ccc tcg agc 816 Asp Asp Leu Ser Pro Ser Ser tca gct aat tcc Ser Ala Ass Ser ata tca tca ggt cgt Ile Ser Ser Giy Arg WO 99/36520 WO 9936520PCT/AU99/00033 -4- 260 agt ctt Ser Leu ggc ttc tca aca Gly Phe Ser Thr gat gct agt gat Asp Ala Ser Asp aag aaa atc 864 Lys Lys Ile aaa aaa Lys Lys 290 ggt gat Gly Asp 305 ggt cct gcg ccc Gly Pro Ala Pro cgt tta.

Arg Leu 295 caa gag gaa Gin Glu Glu ctg Leu 300 tgt ctg gtg tgt 912 Cys Leu Val Cys cgg gcg tcc Arg Ala Ser tat cat tat aac Tyr His Tyr Asn ctc acc tgt gaa Leu Thr Cys Giu ggC 960 Gly 320tgt 1008 Cys tgt aag ggg ttc Cys Lys Gly Phe cga cgg agt gtt Arg Arg Ser Val aaa aat gcg gtg tat Lys Asn Ala Val Tyr 335 tgt aaa ttt Cys Lys Phe cat gcc His Ala tgc gaa Cys Glu gac atg tat atg Asp Met Tyr Met cga cgt Arg Arg 350 aaa 1056 Lys tgt cag Cys Gin tgt agg ctg aaa Cys Arg Leu Ly~s aaa tgt ttg gct gtg Lys Cys Leu Ala Val ggc atg cgg Gly Met Arg ccg 1104 Pro gaa tgt Giu Cys 370 gtg gtg ccc gaa aac Val Val Pro Giu Asn 375 cag tgt gca atg aaa Gin Cys Ala Met Lys 380 cga. cgc gaa aag 1152 Arg Arg Glu Lys WO 99/36520 WO 9936520PCT/AU99/00033 gca caa aaa gag Ala Gin Lys Giu aag gat aaa ata Lys Asp Lys Ile cag acc Gin Thr 395 agt gtg tgt Ser Val Cys gca acg 1200 Ala Thr 400 cca tca 1248 Pro Ser gaa att aaa aag Giu Ile Lys Lys ata ctc gat tta Ile Leu Asp Leu atg aca tgt gaa. ccg Met Thr Cys Giu Pro cat cca acg His Pro Thr ccg ctg tta cct Pro Leu Leu Pro gac att ttg gct Asp Ile Leu Ala tgt caa 1296 Cys Gin gct cgt Ala Arg ata cct cct tta Ile Pro Pro Leu tcg tac aat caa ttg Ser Tyr Asn Gin Leu gca gtt ata tat 1344 Ala Val Ile Tyr 445 aaa tta Lys Leu 450 ata tgg tat caa gat Ile Trp Tyr Gin Asp ggc tac gaa cag Gly Tyr Giu Gin cca tcc Pro Ser 460 gag gaa gat 1392 Glu Giu Asp aaa cgt ata atg Lys Arg Ile Met agt tca Ser Ser 470 ata aca Ile Thr ccc gat gaa Pro Asp Giu gaa agt caa cac Giu Ser Gin His gat 1440 Asp 480 tta 1488 Leu qca tca ttt cgt Ala Ser Phe Arg gaa atc Giu Ile ata cta aca gta caa Ile Leu Thr Val Gin 495 att gtg gaa ttt Ile Val Giu Phe 500 gcc aag ggt ttg cca Ala Lys Gly Leu Pro 505 gcg ttt Ala Phe acc aaa ata cca caa 1536 Thr Lys Ile Pro Gin 510 PAOPER'MRO\2 429-99 s .d.24IOM) -6gag gat caa ata aca cta tta aag Giu Asp Gin 51~5 Ile Thr Leu Leu gcc tgc tca tca Ala Cys Ser Ser gaa. gtt atg atg Giu Val Met Met 525 tcg ata ttc ttt Ser Ile Phe Phe 1584 1632 ttg cga Leu Arg 530 atg gca cga cgt Met Ala Arg Arg gat cac aat tca Asp His Asn Ser gcc Ala 545 aat aat cga tcg Asn Asn Arg Ser acg cgt gac tct Thr Arg Asp Ser aaa atg gct ggc Lys Met Ala Gly 1680 1728 gct gat aat att Ala Asp Asn Ile gat ctg ctg cat Asp Leu Leu His tgt cga caa atg Cys Arg Gin Met tac tcg Tyr Ser 575 atg aaa gtg Met Lys Val ttt tcc gat Phe Ser Asp 595 aat gtc gaa tat Asn Val Giu Tyr cta ctc act gcc Leu Leu Thr Ala att gtg atc Ile Val Ile 590 1776 1824 cgg ccg ggt ctc Arg Pro Gly Leu gaa gcc gaa cta gtc gaa gcg ata Giu Ala Giu Leu Val Giu Ala Ile 25 caa agt Gin Ser 610 tac tac atc gat Tyr Tyr Ile Asp ctc cgc att tac Leu Arg Ile Tyr ctt aat cgc cat Leu Asn Arg His 1872 1920 tgc Cys 625 ggc gat ccc atg Gly Asp Pro Met ctc gta ttc ttt Leu Val Phe Phe aag ctt ctg tca Lys Leu Leu Ser WO 99/36520 WO 9936520PCT/AU99/00033 -7eta acc gaa ctg Leu Thr Glu Leu aeg ttg ggc aat Thr Leu Gly Asn aat gcc gaa atg Asn Ala Glu Met ttc 1968 Phe tcg ttg aaa Ser Leu Lys aaa aat egc aaa Lys Asn Arg Lys cca aaa ttc etc Pro Lys Phe Leu gag atc 2016 Giu Ile tgg gat Trp Asp cat gcc att cea His Ala Ile Pro tca gtg cag tca Ser Val Gin Ser ata cag gct 2064 Ile Gin Ala acc cag Thr Gin 690 att tca Ile Ser 705 gcg gaa aag gcc Aia Giu Lys Aia cag gaa get cag gca Gin Giu Ala Gin Ala 700 aca aca tcg gcc 2112 Thr Thr Ser Ala gca gcc gcc Ala Ala Ala tea tct tcc tcc Ser Ser Ser Ser ata aat Ile Asn 715 acc tcg atg Thr Ser Met gca 2160 Ala 720 aca tea tee tea Thr Ser Ser Ser ggt ggt gce gte Gly Giy Ala Vai 740 tca teg Ser Ser 725 gat tat Asp Tyr tta teg eea Leu Ser Pro gtt gge ace Val Gly Thr 745 geg gee Ala Ala tea aca eec aat 2208 Ser Thr Pro Asn 735 gat atg agt atg agt tta gta 2256 Asp Met Ser Met Ser Leu Val 750 eaa teg gat aat gca tag Gin Ser Asp Asn Ala 755 2274 WO 99/36520 WO 9936520PCT/AU99/00033 -8- <210> 2 <211> 7' <212> P1 <213> Li 57 icilia cuprina <400> 2 Met Met Lys Arg Arg Trp Ser Asn Asn 1 5 Gly Gly Phe Ala Ala 10 Leu Lys Met Leu Giu Val Leu Ser Giu Ser Ser Ser Giu Val Thr Ser Ser Ser Asn Gly Leu 25 Ser Pro Ser Ser Leu Asp Ser Pro Ser Asp Ile Asn Val Tyr so Gly Asp Gin Giu Met 55 Trp, Leu Cys Asn Asp Ser Ala Ser Tyr Asn Asn Ser His Gin His Ser 70 Val Ile Thr Ser Leu Gin Gly Cys Thr 75 Pro Leu Ser Ala Leu Pro Ser Ser Leu Pro Ala Gin Thr Thr Ile Asn Ser Asn Asn 100 Ala Ser Leu Asn Asn 105 Gin Asn Gin Asn Tyr Gin Asn 110 Val Asn Thr Asn Asn Ser Val 125 Gly Asn Ser Met Asn Thr Asn Leu Ser WO 99/36520 WO 9936520PCT/AU99/00033 -9- Gly Gly Gly Gly Gly Gly 130 Gly 145 Leu Gly Gly Gly Gly 150 Gly Gly Val Pro Gly Met Thr Ser Leu Asn 135 140 Gly Ser Gin Val Asn Asn His Asn His Ser 155 160 Asn Ser Asn Ser Asn His Ser Asn Ser Ser 170 175 His Asn His Leu His His 165 Ser His His Thr Asn Gly His Met Gly Ile Gly Gly Gly 180 185 Gly Gly Gly 190 Leu Ser Val Asn Ile Asn Giy 195 Pro Asn Ile Val Ser 200 Asn Ala Gin Gin 205 Ile His Aia Asn Leu Asn 210 Ser Leu Gin Ala Gin Asn Giy Gin Val 220 Ile Gly Ile His Ser Ile 225 230 His His Met Asn Asn Ser 245 Ile Ser Asn Gly Leu 235 Ser Met Met His His 250 Asn His His His His 240 Thr Pro Arg Ser Giu 255 Ser Ala Asn Ser Ile Ser Ser Gly 260 Ser Leu Asn Gly Phe Ser Thr Ser 275 280 Arg Asp Asp Leu Ser 265 Asp Ala Ser Asp Val 285 Pro Ser Ser 270 Lys Lys Ile Lys Lys Gly Pro Ala Pro Arg Leu Gin Giu Giu Leu Cys Leu Val Cys WO 99/36520 WO 9936520PCT/AU99/00033 290 Gly Asp Arg Ala Ser 305 Gly Tyr His Tyr Asn 310 Ala Leu Thr Cys Giu Gly 315 320 Lys Asn Ala Val Tyr Cys 335 Cys Lys Gly Phe Arg Arg Ser Val Cys Lys Phe Gly 340 Cys Gin Giu Cys 355 His Ala Cys Glu Arg Leu Lys Lys 360 Met Asp Met Tyr Met Arg Arg Lys 345 350 Cys Leu Ala Val Gly Met Arg Pro 365 Glu Cys Val Val Pro Giu Asn Gin Cys Ala Met 370 375 Lys Arg Arg Glu Lys 380 Ser Val Cys Ala Thr 400 Ala Gin Lys Giu Lys Asp Lys Ile Gin 390 Ile Leu Asp Leu Met 410 Giu Ile Lys Lys Thr Cys Giu Pro Pro Ser 415 His Pro Thr Cys 420 Pro Leu Leu Pro Glu Asp 425 Ile Leu Ala Lys Cys Gin 430 Val Ile Tyr Ala Arg Asn Ile Pro Pro Leu Ser Tyr Asn Gin Leu Ala 435 440 445 Lys Leu Ile Trp Tyr Gin Asp Gly Tyr Giu Gin Pro Ser Giu Giu Asp 450 455 460 WO 99/36520 WO 9936520PCT/AU99/00033 11 Leu Lys Arg Ile Met Ser Ser Pro Asp Glu 465 470 Ala Ser Phe Arg His Ile Thr Giu Ile Thr 485 490 Asn Giu Ser Gin His Asp 475 480 Ile Leu Thr Vai Gin Leu 495 Ile Val Glu Glu Asp Gin 515 Phe Ala Lys Gly Leu 500 Ile Thr Leu Leu Lys 520 Pro Ala Phe Thr Lys 505 Aia Cys Ser Ser Giu 525 Ile Pro Gin 510 Val Met Met Leu Arg 530 Ala Asn 545 Met Ala Arg Arg Tyr Asp 535 His Asn Ser Asp Ser Ile Phe Phe 540 Asn Arg Ser Tyr Thr Arg Asp Ser 550 Tyr Lys Met Ala Gly 555 Ala Asp Asn Ile Asp Leu Leu His Cys Arg Gin Met Tyr Ser 575 Met Lys Val Phe Ser Asp 595 Gin Ser Tyr 610 Asp Asn Val Giu Tyr Ala 580 585 Arg Pro Gly Leu Giu Giu 600 Leu Leu Thr Ala Ile Val Ile 590 Ala Giu Leu Val Glu Ala Ile 605 Tyr Ile Asp Thr Leu Arg Ile Tyr Ile Leu Asn Arg His 615 620 WO 99/36520 WO 9936520PCT/AU99/00033 -12- Cys Gly Asp Pro Met Ser Leu Val Phe Phe Ala Lys Leu Leu Ser Ile 625 630 635 640 Leu Thr Giu Leu Arg Thr Leu Gly Asn Gin Asn Ala Glu Met Cys Phe 645 650 655 Ser Leu Lys Leu Lys Asn Arg Lys Leu Pro Lys Phe Leu 660 665 His Ala Ile Pro Pro Ser Val Gin Ser His 680 68S Giu Giu Ile 670 Ile Gin Ala Trp Asp Thr Gin 690 Ala Giu Lys Ala Ala Ala Ala Thr 710 Ala Gin Giu Ala Gin Ala 695 700 Ser Ser Ser Ser Ile Asn 715 Thr Thr Ser Ala Thr Ser Met Ala 720 Ile Ser 705 Thr Ser Ser Ser Ser Ser 725 Leu Ser Pro Ser Ala Ala Ser Thr Pro Asn 730 735 Gly Gly Ala Val Asp Tyr Val Gly Thr Asp Met Ser Met Ser Leu Val 740 745 750 Gin Ser Asp Asn Ala 755 <210> 3 <211> 1377 <212> DNA <213> Lucilia cuprina WO 99/36520 WO 9936520PCT/AU99/00033 13 <220> <221> CDS <222> (1374) <400> 3 atg gat aac ggc g, Met Asp Asn Gly G 1 caa. gat gct ggg Gin Asp Ala Gly ttc cga ttg gca ccg atg tct 48 Phe Arg Leu Ala Pro Met Ser -1Iu ccg cag gag Pro Gin Giu agt agt tat Ser Ser Tyr aag cca, gac att Lys Pro Asp Ile cta. ctc aat gaa.

Leu Leu Asn Giu aat aat acg 96 Asn Asn Thr gcc atc gga 144 Ala Ile Gly tcg ccc aaa. cct Ser Pro Lys Pro agt cct aat cca, ttt Ser Pro Asn Pro Phe ttg cag Leu Gin gca ata.

Ala Ile aat gca Asn Ala gct gcc gcg aat Ala Ala Ala Asn cca caa cag cag Pro Gin Gin Gin 75 gcc aat Ala Asn cag tat Gin Tyr aac caa aat 192 Asn Gin Asn cca cca. aat 240 Pro Pro Asn atg ttg caa act Met Leu Gin Thr acg cca Thr Pro cac ccc ctt agt ggt His Pro Leu Ser Gly gcc agt gga aaa cat Ala Ser Giy Lys His tcg aaa cac ttg Ser Lys His Leu tat ggg gtc tac Tyr Gly Val Tyr tgt tCC Cys Ser 90 agt tgt Ser Cys att tgt gga Ile Cys Gly gag ggt tgt Giu Gly Cys gac cgc 288 Asp Arg aaa ggg 336 Lys Gly WO 99/36520 WO 9936520PCT/AU99/00033 14 ttc ttC Phe Phe aaa cgt acc gta cgc Lys Arg Thr Val Arg 115 gac ttg aca tat Asp Leu Thr Tyr gct tgt cgt gag 384 Ala Cys Arg Giu 125 cgt tgc cag tat 432 Arg Cys Gin Tyr gac aga Asp Arg 130 aat tge aet ata Asn Cys Ile Ile aaa cga caa aga Lys Arg Gin Arg cgt tat caa aag Arg Tyr Gin Lys tta gct Leu Ala tgt ggc Cys Giy aaa cgc gaa gcg Lys Arg Giu Ala gtc 480 Vai 160 caa gag gaa cga caa Gin Giu Giu Arg Gin 165 cgt ggt act cgt get Arg Giy Thr Arg Ala 170 gct aac gct aga Aia Asn Ala Arg gct gct 528 Ala Ala 175 gtg gtt 576 Vai Val ggt get gge Giy Aia Gly ggt ggt Giy Gly 180 gga gga ggt Gly Gly Gly ggt ggg gta agc Giy Gly Val Ser ggt get Gly Ala ggc gga gaa gac ttt aaa Gly Gly Giu Asp Phe Lys 195 200 gaa cgc atc att gaa gcc Giu Arg Ile Ile Giu Ala 215 ccc agc agt tca Pro Ser Ser Ser gag caa aag gct Glu Gin Lys Ala 220 cgt gat etc 624 Arg Asp Leu act ata Thr Ile 210 gaa tct ttg age 672 Giu Ser Leu Ser ggt gat aac gtg ttg ccc ttt ttg cgc gtt ggc aac aat tcc atg gta 720 WO 99/36520 WO 9936520PCT/AU99/00033 15 Gly Asp Asn Val Leu 225 Pro Phe Leu Arg Val 230 ggc gcg gta tct cat Gly Ala Vai Ser His Gly Asn Asn Ser Met 235 Val 240 aac 768 Asn caa cac gac tac Gin His Asp Tyr ctc tgc cag atg Leu Cys Gin Met aaa caa ctc Lys Gin Leu caa atg gtt gaa Gin Met Val Giu tat gca Tyr Ala 265 cgt cga aca Arg Arg Thr cat ttt 816 His Phe aca cat Thr His cag cgt gag gat Gin Arg Giu Asp ata cta ttg tta Ile Leu Leu Leu gct ggc tgg 864 Ala Gly Trp aat gaa Asn Giu 290 ctg cta att gca Leu Leu Ile Ala gtt gcc tgg tgc Val Ala Trp Cys att gag tct ctg 912 Ile Giu Ser Leu gcc gaa tat gcc Ala Giu Tyr Ala tct cct ggt acg gta Ser Pro Gly Thr Val gac ggt tct ttt Asp Gly Ser Phe ggt 960 Gly 320 aat 1008 Asn cgg cgt tca cca Arg Arg Ser Pro cgt cag Arg Gin ccc caa caa Pro Gin Gin 330 ctc ttc ctt aat Leu Phe Leu Asn ttc tcg tat cat Phe Ser Tyr His 340 cgc aat agt gct att aag gcc aat gtt gtt Arg Asn Ser Ala Ile Lys Ala Asn Val Val 345 350 tca att 1056 Ser Ile WO 99/36520 WO 9936520PCT/AU99/00033 -16ttc gat Phe Asp atc ctc tcg gag Ile Leu Ser Glu agc atc aaa atg Ser Ile Lys Met cgt ctt aac 1104 Arg Leu Asn atc gat Ile Asp 370 cgc tcg gag ttg Arg Ser Giu Leu tgt ctg aag gca Cys Leu Lys Ala ata ctc ttc aat 1152 Ile Leu Phe Asn cca gac ata cgc ggt Pro Asp Ile Arg Gly 385 gaa aaa atc tat gcc Glu Lys Ile Tyr Ala 405 aaa tgt cga gcc Lys Cys Arg Ala gtc gag gta tgt Val Glu Val Cys cgt 1200 Arg 400 cca 1248 Pro tgt ctg gac gaa Cys Leu Asp Giu tgc cgc aca gaa Cys Arg Thr Giu ggt gat gat Gly Asp Asp cgc ttt gct cag Arg Phe Ala Gin cta cta agg ttg Leu Leu Arg Leu gca ttg 1296 Ala Leu ctt cca Leu Pro atc tca aat gtc leSer Asn Val Ile Ile Cys Phe Pro 445 ccg ttt Pro Phe aat 1344 Asn agg cga Arg Arg 450 aag agc att gga gga Lys Ser Ile Gly Gly 455 att aat tgc tga Ile Asn Cys 1377 210> 4 <211:> 458 WO 99/36520 WO 9936520PCT/AU99/00033 <212> PRT <213> Lucilia cuprina <400> 4 Met Asp Asn Gly Giu Gin Asp Ala Gly Phe Arg Leu Ala Pro Met Ser 1 5 10 Pro Gin Giu Ile Lys Pro Asp Ile Ser Leu Leu Asn Glu 25 Asn Asn Thr Ser Ser Tyr Ser Pro Lys Pro Leu Gin Ala Ile Asn Ala Val 55 Gly Ser Pro Asn Pro Phe Ala Ile Giy 40 Ala Ala Ala Asn Ala Asn Asn Gin Asn Gin Met Leu Gin Thr Thr 70 His Pro Leu Ser Giy Ser Pro Pro Gin Gin Gin Gin 1 75 Tyr Pro Pro Asn Lys His Leu Cys Ser Ile Cys Gly 90 Asp Arg Aia Ser Giy Lys His Tyr Gly Val Tyr Ser Cys Giu Gly Cys Lys Gly 100 105 110 Phe Phe Lys Arg Thr Vai Arg Lys Asp Leu Thr Tyr Ala 115 120 125 Asp Arg Asn Cys Ile Ile Asp Lys Arg Gin Arg Asn Arg 130 135 140 Cys Arg Glu Cys Gin Tyr WO 99/36520 WO 9936520PCT/AU99/00033 18- Cys Arg Tlyr Gin Lys Cys Leu Ala Cys Gly 145 150 Gin Glu Giu Arg Gin Arg Gly Thr Arg Ala 165 170 Met Lys Arg Giu Ala Val 155 160 Ala Asn Ala Arg Ala Ala 175 Gly Ala Gly Gly Ala Gly 195 Gly Gly Gly Gly Gly 180 Gly Giu Asp Phe Lys 200 Gly Gly Val Ser Asn Val Val 190 Arg Asp Leu Pro Ser Ser Ser Thr Ile 210 Gly Asp 225 Glu Arg Ile Ilie Giu Ala 215 Giu Gin Lys Ala 220 Glu Ser Leu Ser Asn Val Leu Pro Phe Leu Arg Val Gly Asn 230 235 Asn Ser Met Val 240 Gin His Asp Tyr Lys Gly Ala Vai Ser 245 His Leu Cys Gin Met 250 Val Asn 255 Lys Gin Leu Thr His Leu 275 Gin Met Val Giu Ala Arg Arg Thr Pro His Phe 270 Ala Gly Trp Gin Arg Giu Asp Gin 280 Leu Ile Ala Asn Val 295 Ile Leu Leu Leu Lys 285 Asn Giu Leu 290 Ala Trp Cys Ser Ilie Giu Ser Leu 300 Asp Ala Giu Tyr Ala Ser Pro Gly Thr Val His Asp Gly Ser Phe Gly WO 99/36520 WO 9936520PCT/AU99/00033 19 Arg Arg Ser Pro Val 325 Phe Ser Tyr His Arg 340 Arg Gin Pro Gin Asn Ser Ala Ile 345 Gin Leu Phe Leu Asn Gin Asn 330 335 Lys Ala Asn Val Val Ser Ile 350 Phe Asp Arg 355 Ile Asp Arg 370 Ile Leu Ser Giu Leu Ser 360 Ile Lys Met Lys Arg Leu Asn 365 Ser Giu Leu Ser Cys Leu Lys Aia 375 Ile Ile Leu Phe Asn 380 Val Giu Vai Cys Arg 400 Pro Asp Ile Arg Giy 385 Leu Lys Cys Arg Aia 390 Giu Lys Ile Tyr Cys Leu Asp Giu His Cys Arg Thr Giu His Pro Giy Asp Asp Gly 420 Leu Pro Ser Ile Arg Phe Ala Gin Leu Leu 425 Leu Arg Leu Pro Aia Leu 430 Ser Asn Vai Ser Ile Ile Cys Phe Pro Pro Phe Asn 440 445 Arg Arg Lys Ser Ile Giy Giy Ile Asn Cys 450 455 WO 99/36520 WO 9936520PCT/AU99/00033 20 <210> <211> 585 <212> DNA <213> Myzus persicae <220> <221> <222>

CDS

(585) <400> gaa ttc ggc acg Glu Phe Gly Thr 1 agc gcc att gtt aat Ser Ala Ile Val Asn 5 gga ttt atc cgc acc Gly Phe Ile Arg Thr 10 att agt 48 Ile Ser gcc ttc 96 Ala Phe ttg atc cti Leu Ile Leu itt ctt cit cii Phe Leu Leu Leu cit tgg agg ttg Leu Trp Arg Leu cgg ttc Arg Phe ttg ttt ata ict gaa Leu Phe Ile Ser Glu cca cci ccc gaa Pro Pro Pro Glu ctg tgc ctg 144 Leu Cys Leu gig tgt Val Cys ggc gac cgg tcg Gly Asp Arg Ser ggt tac cat tac Gly Tyr His Tyr gct ctc Ala Leu aca tgc 192 Thr Cys gaa Glu gga tgc aag ggg ttc Gly Cys Lys Gly Phe tic cgg Phe Arg agg agc atc Arg Ser Ile 75 acc aag aac gcc gig 240 Thr Lys Asn Ala Val tac cag tgc aag tac ggc aac aat igc gaa aic gac atg tac aig agg 288 WO 99/36520 WO 9936520PCT/AU99/00033 -21 Tyr Gin Cys Lys Tyr Giy Asn Asn Cys Giu Ile Asp Met Tyr Met Arg 90 cgg aag tgc Arg Lys Cys gag tgc cgg etg Giu Cys Arg Leu aaa tgc ctg acc: Lys Cys Leu Thr gtc ggc atg 336 Vai Giy Met 110 agg ect Arg Pro tgt gtt gta cct Cys Vai Val Pro gtt caa tge gca Val Gin Cys Aia gta Val 125 aaa aga aag 384 Lys Arg Lys gag aaa Giu Lys 130 aaa get caa ega Lys Aia Gin Arg aaa gat aaa eca Lys Asp Lys Pro aat Asn 140 tet act aca gac 432 Ser Thr Thr Asp tet ect Ser Pro gaa ata Glu Ile aaa ata gaa cet Lys Ile Giu Pro gag atg aag att Glu Met Lys Ile gaa 480 Glu 160 tgt ggt gaa eca Cys Gly Giu Pro ata atg ggc aca Ile Met Gly Thr atg ccg act gta Met Pro Thr Val ect tac 528 Pro Tyr 175 acg ggt 576 Thr Giy gtg aaa cet ttg Val Lys Pro Leu 180 agt tct etc gtg ceg Ser Ser Leu Vai Pro 185 aat teg gea ega gte Asn Ser Ala Arg Vai 190 tac aaa ttt Tyr Lys Phe 195 WO 99/36520 PTA9/03 PCT/AU99/00033 -22 <210> 6 <211> 195 <212> PRT <213> Myzus persicae <400> 6 Glu Phe Giy Thr Ser Ala Ile Val Asn Gly Phe Ile Arg Thr Ile Ser Leu Ile Leu Ile Phe Leu Leu Leu Phe Leu Trp Arg Leu Leu Ala Phe 25 Arg Phe Leu Phe Ile Ser Glu Gin Pro Pro Pro Giu Glu Leu Cys Leu 40 Vai Cys Gly Asp Arg Ser Giu Gly Cys Lys Gly Phe Tyr Gin Cys Lys Tyr Gly Ser Gly Tyr His Tyr 55 Asn Ala Leu Thr Cys Phe Arg Arg Ser Asn Asn Cys Giu 90 Thr Lys Asn Ala Ile Asp Met Tyr Met Arg Cys Leu Thr Val Gly Met 110 Arg Lys Cys Gin Glu 100 Cys Arg Leu Lys Lys 105 Arg Pro Glu Cys Val Val Pro Glu Val Gin Cys Ala Val Lys Arg Lys 115 120 125 WO 99/36520 WO 9936520PCT/AU99/00033 23 Giu Lys Lys Ala Gin Arg Giu Lys Asp Lys Pro Asn Ser Thr Thr Asp 130 135 140 Ile Ser Pro Gu Ile Ile Lys Ile Glu Pro Thr Giu Met Lys Ile Glu 145 150 155 160 Cys Gliy Giu Pro Met Ile Met Gly Thr Pro Met Pro Thr Val Pro Tyr 165 170 175 Val Lys Pro Leu Ser Ser Leu Val Pro Asn Ser Ala Arg Val Thr Gly 180 185 190 Tyr Lys Phe 195 <210> 7 <211> 208 <212> DNA <213> Myzus persicae <400> 7 catgcctgca ggtcgactct agaggatccc ctcgtccggt taccattaca acgcactcac ctgtgaaggc tgtaagggtt tctttcgacg gagtgttacc aaaaatgcgg tgtattgttg 120 taaatttggt catgcctgcg aaatggacat gtatatgcga cgtaaatgtc aggaatgtag 180 gctgaaaaaa tgtttggctg tgggcatg WO 99/36520 WO 9936520PCT/AU99/00033 24 <210> 8 <211> 436 <212> DNA <213> Myzus persicae <400> 8 catgcggccg gaatgtgtgg tgcccgaaaa ccagtgtgca atgaaacgac gcgaaaagaa agcacaaaaa gagaaggata aaatacagac cagtgtgtgt gcaacggaaa ttaaaaagga 120 aatactcgat ttaatgacat gtgaaccgcc atcacatcca acgtgtccgc tgttacctga 180 agacattttg gctaaatgtc aagctcgtaa tatacctcct ttatcgtaca atcaattggc 240 agttatatat aaattaatat ggtatcaaga tggctacgaa cagccatccg aggaagatct 300 caaacgtata atgagttcac ccgatgaaaa tgaaagtcaa cacgatgcat catttcgtca 360 tataacagaa atcactatac taacagtaca attaattgtt gaatgtgcca aaggtctagg 420 gtaccgagct cgaatt <210> 9 <211> 1353 <212> DNA <213> Myzus persicae <220> <221> CDS <222> (1350) WO 99/36520 WO 9936520PCT/AU99/00033 <400> 9 atg tcg acc aac Met Ser Thr Asn agc tac gac ccg tac Ser Tyr Asp Pro Tyr agt ccg atg agt gga Ser Pro Met Ser Gly atc 48 Ile gtc aaa gaa Val Lys Glu gag ttg tct ccg cca Giu Leu Ser Pro Pro aac agc ctg tcg gga Asn Ser Leu Ser Gly agc agc 96 Ser Ser cat tcg His Ser gat ggg ttg aag aag Asp Gly Leu Lys Lys aaa ctc aac cac Lys Leu Asn His ccc tcg acc 144 Pro Ser Thr ggt Gly gtc aac acc tcg Val Asn Thr Ser tcg ggc ccc ggg Ser Gly Pro Gly ggc gtt ggt ggc 192 Gly Val Gly Gly aat gtg ctg aac aac Asn Val Leu Asn Asn 65 gac cgg tcg tcc ggt Asp Arg Ser Ser Gly cct ccc gaa gag Pro Pro Giu Glu tgc ctg gtg tgt Cys Leu Val Cys ggC 240 Gly tac cat tac aac gct Tyr His Tyr Asn Ala 90 ctc aca tgc gaa gga tgc 288 Leu Thr Cys Glu Gly Cys aag ggg ttc Lys Gly Phe aag tac ggc Lys Tyr Gly ttc cgg Phe Arg 100 aac aat Asn Asn agg agc atc Arg Ser Ile acc aag Thr Lys aac gcc gtg Asn Ala Val tac cag tgc 336 Tyr Gin Cys 110 cgg aag tgc 384 Arg Lys Cys tgc gaa atc Cys Glu Ile gac atg Asp Met tac at~g agg Tyr Met Arg WO 99/36520 WO 9936520PCT/AU99/00033 26 115 125 cag gag Gin Giu 130 tgc cgg ctg aaa Cys Arg Leu Lys tgc ctg acc gtc Cys Leu Thr Val ggc atg agg cct gaa 432 Gly Met Arg Pro Glu 140 gtt gta cct gaa Val Val Pro Giu caa tgc gca gta Gin Cys Ala Val aga aag gag aaa Arg Lys Glu Lys aaa 480 Lys 160 cct 528 Pro gct caa cga gaa Ala Gin Arg Giu gat aaa Asp Lys cca aat Pro Asn act aca gac att Thr Thr Asp Ile gaa ata ata Glu Ile Ile aaa ata Lys Ile 180 gaa cct aca Giu Pro Thr atg aag att gaa Met Lys Ile Glu ggt gaa 576 Gly Glu cca atg Pro met atg ggc aca cct Met Gly Thr Pro ccg act gta cct Pro Thr Val Pro gtg aaa Val Lys cct 624 Pro ttg agt ict gaa Leu Ser Ser Giu 210 caa aaa Gin Lys ctg atc cac cga Leu Ile His Arg gtc tat ttc cag 672 Val Tyr Phe Gin caa tat Gin Tyr gaa gct cct Giu Ala Pro 230 agt gaa aaa gac atg Ser Glu Lys Asp Met 235 aaa cgt tta aca ata 720 Lys Arg Leu Thr Ile 240 aat aat caa aat atg gat gaa tat gat gaa gaa aaa caa agt gac acc 768 WO 99/36520 WO 9936520PCT/AU99/00033 27 Asn Asn Gin Asn Met Asp Giu Tyr Asp 245 Giu Glu Lys Gin Ser 250 Asp Thr 255 aca tat cga Thr Tyr Arg atc act gag atg Ile Thr Giu Met ata ctc aca gtt Ile Leu Thr Val ctg att 816 Leu Ile gtt gag Val Giu gcc aaa cga tta Ala Lys Arg Leu ggt ttc gat aaa Giy Phe Asp Lys gta aga gaa 864 Vai Arg Giu gat caa Asp Gin 290 atc act tta ctc aag Ile Thr Leu Leu Lys 295 gct tgc tca agt Ala Cys Ser Ser gct atg atg ttc 912 Aia Met Met Phe gta gca agg aag Vai Ala Arg Lys tat gac Tyr Asp 310 atc acc act Ile Thr Thr tca ata Ser Ile gtg ttt Val Phe aac aac cag cca Asn Asn Gin Pro tca gct gat tca Ser Ala Asp Ser aac aaa gct gga ttg Asn Lys Ala Giy Leu 335 gct 960 Ala 320 gga 1008 Giy atg 1056 Met ttt 1104 Phe gat gcc att Asp Ala Ile aag gtg gat Lys Val Asp 355 aac caa ctg tca Asn Gin Leu Ser agt cgg ttt atg Ser Arg Phe Met tac aat Tyr Asn 350 gtc ata Vai Ile aac gca Asn Ala gaa tat gcc Giu Tyr Ala 360 tta ttg Leu Leu acc gcc atc Thr Ala Ile 365 WO 99/36520 WO 9936520PCT/AU99/00033 -28tcg agt agg cca aat tta.

Ser Ser Arg Pro Asn Leu 370 gaa ate tac eta gag tcc Giu Ile Tyr Leu Glu Ser cta gat ggt tgg Leu Asp Giy Trp 375 aaa gtg gag aaa ate caa 1i52 Lys Val Giu Lys Ile Gin 380 tta aaa get tat Leu Lys Ala Tyr gat aat cga gac Asp Asn Arg Asp cgt 1200 Arg 400 gac aca gca act Asp Thr Ala Thr cga tat gcg cga, Arg Tyr Ala Arg etc tea gta. ctt aca gaa 1248 Leu Ser Val Leu Thr Glu 415 ttg cgc aca Leu Arg Thr ggc aat gaa aac Giy Asn Giu Asn gag cta tgt atg Giu Leu Cys Met ctg aaa 1296 Leu Lys etg aaa Leu Lys aga gta gta eec cca Arg Val Val Pro Pro 440 ttc ttg gce gaa ata Phe Leu Ala Glu Ile 445 tgg gat Trp Asp gte 1344 Val atg eca tag Met Pro 450 1353 <210> <211> <212> <213> 450

PRT

Myzus persicae <400> WO 99/36520 29 Met Ser Thr Asn Ser Tyr Asp Pro Tyr Ser Pro Met Ser Giy PCT/AU99/00033 Lys Ile Val Lys Giu Giu Leu Ser Pro Pro Asn Ser Leu Ser Gly 25 Vai Ser Ser Pro Ser Thr His Ser Asp Gly Leu Lys Lys Lys Lys Leu Asn His Gly Val so Val Asn Thr Ser Ala Ser Gly Pro Gly Giy Gly Val Gly Gly Asn Val Leu Asn Asn Arg Pro Pro Giu Glu Leu Cys 70 75 Leu Val Cys Gly Asp Arg Ser Ser Gly Tyr His Tyr Asn as Ala Leu Thr Cys Giu 90 Gly Cys Lys Gly Phe Phe Arg Arg Ser Ile 100 Asn Asn Cys Glu Ile 120 Lys Asn Ala Val Tyr Gin Cys 110 Arg Lys Cys Lys Tyr Gly 11s Asp Met Tyr Met Arg 125 Leu Thr Vai Gly Met 140 Gin Glu 130 Cys Arg Leu Lys Lys Cys 135 Arg Pro Glu Cys Vai Val Pro Giu Val Gln Cys Ala Val Lys Arg Lys Glu Lys Lys 145 150 155 160 Ala Gln Arg Glu Lys Asp Lys Pro Asn Ser Thr Thr Asp Ile Ser Pro WO 99/36520 WO 9936520PCT/AU99/00033 165 Giu Ile Ile Lys Ile Giu Pro Thr 180 Pro Met Ile Met Gly Thr Pro Met 195 200 Giu Met Lys Ile Giu Cys Gly Giu 185 190 Pro Thr Val Pro Tyr Val Lys Pro 205 Leu Ser 210 Ser Giu Gin Lys Giu Leu Ile His Arg Leu Val Tyr Phe Gin 215 220 Ser Giu Lys Asp Met Lys Arg Leu Thr Ile 235 240 Gin Tyr Giu Ala Pro 230 Asn Asn Gin Asn met Asp 245 Giu Tyr Asp Giu Giu Lys Gin Ser Asp Thr 250 255 Thr Tyr Arg Vai Giu Phe 275 Ile Ile Thr Giu Met Thr Ile Leu Thr Val Gin Leu Ile 260 265 270 Ala Lys Arg Leu Pro Gly Phe Asp Lys Leu Val Arg Giu 280 285 Asp Gin 290 Arg Val 305 Ile Thr Leu Leu Lys 295 Aia Arg Lys Tyr Asp 310 Aia Cys Ser Ser Giu Ala Met Met Phe 30Q0 Ile Thr Thr Asp Ser Ilie Vai Phe Ala 315 320 Asn Asn Gin Pro Phe Ser Ala Asp Ser Tyr Asn Lys Ala Gly Leu Gly 325 330 335 WO 99/36520 WO 9936520PCT/AU99/00033 -31 Asp Ala Ile Glu Asn Gin Leu Ser Phe Ser Arg Phe Met Tyr Asn Met 340 345 350 Lys Val Asp Asn Ala Glu Tyr 355 Ala Leu Leu Thr Ala 360 Ile Val Ile Phe 365 Glu Lys Ile Gin Ser Ser 370 Arg Pro Asn Leu Asp Gly Trp Lys Glu Ile 385 Tyr Leu Giu Ser 390 Leu Lys Ala Tyr Val 395 Asp Asn Arg Asp Arg 400 Asp Thr Ala Thr Val Arg Tyr Ala Arg 405 Leu Arg Thr Leu Gly Asn Giu Asn Ser 420 425 Leu Lys Asn Arg Val Vai Pro Pro Phe 435 440 Leu Leu Ser Vai Leu Thr Glu 410 415 Giu Leu Cys Met Thr Leu Lys 430 Leu Ala Glu Ile Trp Asp Val 445 Met Pro 450 <210> 11 <211> 140 <212> DNA <213> Myzus persicae WO 99/36520 WO 9936520PCT/AU99/00033 32 <220> <221> CDS <222> (134) <400> 11 aattctgc gag gga tgc aag gga ttc ttc aaa cgc aca. gtg agg aaa aat Giu Gly Cys Lys Giy Phe Phe Lys Arg Thr Vai Arg Lys Asn ttg tca tac gcg tgt cgc gaa gaa aac aaa Leu Ser Tyr Ala Cys Arg Giu Giu Asn Lys tgc atc atc gac aag Cys Ile Ile Asp Lys caa aaa tgatcg Gin Lys cgc 98 Arg 140 caa cga aat cgg tgc caa tac tgc agc tac Gin Arg Asn Arg Cys Gin Tyr Cys Ser Tyr <210> <211> <212> <213> 12 42

PRT

Myzus persicae <400> 12 Giu Gly Cys Lys Gly Phe Phe Lys Arg Thr Val Arg Lys Asn Leu Ser 1 5 10 Tyr Ala Cys Arg Glu Giu Asn Lys Cys Ile Ile Asp Lys Arg Gin Arg 25 WO 99/36520 WO 9936520PCT/AU99/00033 -33- Asn Arg Cys Gin Tyr Cys Ser Tyr Gin Lys <210> <211> <212> <213> <220> <221>;- <222> 13 150

DNA

Lucilia cuprina

CDS

<400> 13 aattctgc gaa gga tgc aag gga ttc ttc aaa cgt acc gta cgc aag gac Giu Gly Cys Lys Gly Phe Phe Lys Arg Thr Val Arg Lys Asp ttg aca tat gct tgt Leu Thr Tyr Ala Cys cgt gag gac aga aat tgc att ata gat aaa cga 98 Arg Glu Asp Arg Asn Cys Ile Ile Asp Lys Arg 20 25 cag tat tgt cgc tac caa aag tgatcgatac cgtcga 150 Gin Tyr Cys Arg Tyr Gin Lys caa aga aat cgt tgc Gin Arg Asn Arg Cys <210> 14 <211> 42 <212> PRT <213> Luciiia cuprina WO 99/36520 WO 9936520PCT/AU99/00033 -34 <400> 14 Glu Gly Cys Lys Gly Phe Phe Lys Arg Thr Val Arg Lys Asp Leu. Thr 1 5 10 Tyr Ala Cys Arg Giu Asp Arg Asn Cys Ile Ile Asp Lys Arg Gin Arg 25 Asn Arg Cys Gin Tyr Cys Arg Tyr Gin Lys <210> <211> <212> <213> <220> <223> 32

DNA

Artificiai Sequence Description of Artificial Sequence:primer <400> cggaattccg cctctggtta ycaytayaay gc 32 <210> <211> <212> <213> 16 32

DNA

Artificial Sequence <220> <223> Description of Artificial Sequence:primer WO 99/36520 WO 9936520PCT/AU99/00033 35 <400> 16 cgcggatccr cactcctgac actttcgyct ca <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 17 gcctcggggt atcactataa cgc <210> <211> <212> <213> <220> <223> 18 23

DNA

Artificial Sequence Description of Artificial Sequence:primer <400> 18 gcactcctga cactttcgtc tca <210> 19 <211> 23 <212> DNA WO 99/36520 WO 9936520PCT/AU99/00033 36 <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> 19 tcgtccggtt accattacaa cgc 23 <210> <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:primer <400> tagacctttg gcraaytcna caat

Claims (61)

1. An isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide is selected from the group consisting of: a polypeptide comprising the ligand binding region of an EcR polypeptide of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 2 or <400>10 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; (ii) a polypeptide comprising the ligand binding region of a partner protein (USP polypeptide) of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 4 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; (iii) a fusion polypeptide between and (ii); (iv) the partner protein (USP polypeptide) of a steroid receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; the USP polypeptide of a juvenile hormone receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400>12; and (vi) the EcR polypeptide of a steroid receptor having greater than 80% identity to any one of <400> 6 or <400>10.

2. The isolated nucleic acid molecule according to claim 1, wherein the steroid receptor is an ecdysteroid receptor.

3. The isolated nucleic acid molecule according to claim 2, wherein the ecdysteroid 0 receptor is an insect ecdysone receptor. T O AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/1299 Received 21 December 1999 -67-

4. The isolated nucleic acid molecule according to claim 3, wherein the insect is selected from the list comprising dipteran, hemipteran, coleopteran, lepidopteran, and neuropteran insects and ants. The isolated nucleic acid molecule according to claim 4, wherein the hemipteran insect is Myzus persicae or a close relative thereof.

6. The isolated nucleic acid molecule according to claim 5, wherein the insect steroid receptor polypeptide comprises an EcR polypeptide of the M. persicae ecdysone receptor having the amino acid sequence set forth in <400>6 or <400>10 or a bioactive analogue or derivative thereof.

7. The isolated nucleic acid molecule according to claim 6 wherein the bioactive analogue or derivative comprises a ligand binding region which comprises at least of domain E and a part of domain D of <400>10, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex.

8. The isolated nucleic acid molecule according to claim 5, wherein the insect steroid receptor polypeptide comprises an EcR partner protein (USP polypeptide) of the M. persicae ecdysone receptor or a USP polypeptide of the M. persicae juvenile hormone receptor having or including the amino acid sequence set forth in <400>12 or a bioactive analogue or derivative thereof.

9. The isolated nucleic acid molecule according to claim 5, wherein the dipteran insect is L. cuprina or a close relative thereof and wherein the insect steroid receptor polypeptide comprises a ligand binding region consisting at least of domain E and a part of domain D of <400> 2, wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex. AMENDED SHEET IPEA/AU PCT/AU99/00033 Received 21 December 1999 P:\OPER\MRO\ECDYSONE.PCT 21/12/99 -68- The isolated nucleic acid molecule according to claim 5, wherein the dipteran insect is L. cuprina or a close relative thereof and wherein the insect steroid receptor polypeptide comprises an EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor or a USP polypeptide of the L. cuprina juvenile hormone receptor comprising the amino acid sequence set forth in <400>4 or <400>14 or a bioactive analogue or derivative thereof.

11. The isolated nucleic acid molecule according to claim 10 wherein the bioactive analogue or derivative comprises a ligand binding region which region comprises at least domain E and a part of domain D of <400> 4, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex.

12. An isolated nucleic acid molecule comprising a nucleotide sequence which encodes or is complementary to a sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said nucleotide sequence is selected from the group consisting of: a nucleotide sequence having at least 80% identity to any one of the nucleotide sequences set forth in <400> 3, <400> 5 or <400> 9 or at least 90% identity to <400> 11 or a complementary nucleotide sequence thereto; (ii) a nucleotide sequence that is capable of hybridising under high stringency conditions to any one of the nucleotide sequences set forth in <400> 3, <400> <400> 9 or <400> 11 or to a complementary nucleotide sequence thereto; (iii) a nucleotide sequence that is amplifiable by PCR using a nucleic acid primer sequence set forth in any one of <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20; (iv) a nucleotide sequence fragment of any one of <400> 1, <400> 5 or <400> 9 that encodes a polypeptide comprising the ligand binding region of an EcR polypeptide of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 2 or <400> 10, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPERMRO\ECDYSONE.PCT 211299 Received 21 December 1999 -69- a nucleotide sequence fragment of <400> 3 that encodes a polypeptide comprising the ligand binding region of a partner protein (USP polypeptide) of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 4, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; and (vi) a fusion molecule between (iv) and

13. An isolated nucleic acid molecule which encodes an insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide and comprises the nucleotide sequence set forth in <400>3 or <400>13 or a complementary nucleotide sequence thereto.

14. An isolated nucleic acid molecule which encodes an insect steroid receptor polypeptide and comprises the nucleotide sequence set forth in <400>5 or <400>7 or <400>8 or <400>9 or a complementary nucleotide sequence thereto. An isolated nucleic acid molecule which encodes an insect steroid receptor polypeptide or a juvenile hormone receptor polypeptide and comprises the nucleotide sequence set forth in <400>11 or a complementary nucleotide sequence thereto.

16. A method of identifying the isolated nucleic acid molecule according to any one of claims 1 to 15, comprising the steps of: hybridising genomic DNA, mRNA oLcDNA derived from an insect cell, tissue or organ with a hybridisation-effective amount of one or more hybridisation probes comprising the nucleotide sequences set forth in any one of <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, or <400>13 or a complementary nucleotide sequence thereto; and (ii) detecting the hybridisation.

17. The method of claim 16 wherein the step of detecting the hybridisation comprises etecting a reporter molecule that is covalently bound to the probe. AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT-21/12/99 Received 21 December 1999

18. A method of identifying the isolated nucleic acid molecule according to any one of claims 1 to 15, comprising the steps of: amplifying a nucleotide sequence which encodes a steroid receptor polypeptide or a juvenile hormone receptor polypeptide in a polymerase chain reaction using one or more PCR primers comprising at least 10 contiguous nucleotides in length derived from any one of <400>1, <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, <400>13, <400>15, <400>16, <400>17, <400>18, <400>19 or <400>20 or a complementary nucleotide sequence thereto; (ii) hybridising the amplified nucleotide sequence to genomic DNA, mRNA or cDNA with a hybridisation-effective amount of one or more hybridisation probes comprising the nucleotide sequences set forth in any one of <400>3, <400>5, <400>7, <400>8, <400>9, <400>11, or <400>13 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof which is at least 40% identical to said sequence or complement; and (iii) detecting the hybridisation.

19. The method of claim 18 wherein the step of detecting the hybridisation comprises detecting a reporter molecule that is covalently bound to the probe. The method according to any one of claims 16 to 19, further comprising the step of isolating the identified nucleic acid molecule.

21. A genetic construct comprising the isolated nucleic acid molecule according to any one of claims 1 to 15 operably linked to a promoter sequence.

22. The genetic construct according to claim 21, wherein the promoter is the SV40, MMTV, polyhedron or p10 promoter.

23. A recombinant or isolated polypeptide comprising a steroid receptor polypeptide or juvenile hormone receptor polypeptide or a bioactive derivative or analogue thereof, wherein said polypeptide is selected from the group consisting of: AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONEPC- 21/12/99 Received 21 December 1999 -71 a polypeptide comprising the ligand binding region of an EcR polypeptide of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 2 or <400> 10 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; (ii) a polypeptide comprising the ligand binding region of a partner protein (USP polypeptide) of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 4 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; (iii) a fusion polypeptide between and (ii); (iv) the partner protein (USP polypeptide) of a steroid receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; the USP polypeptide of a juvenile hormone receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; and (vi) the EcR polypeptide of a steroid receptor having greater than 80% identity to any one of <400> 6 or <400>

24. The recombinant or isolated polypeptide according to claim 23, wherein the steroid receptor is an ecdysteroid receptor. The recombinant or isolated polypeptide according to claim 24, wherein the ecdysteroid receptor is an insect ecdysone receptor.

26. The recombinant or isolated polypeptide according to claim 25, wherein the insect is selected from the list comprising dipteran, hemipteran, coleopteran, lepidopteran, and neuropteran insects and ants. 27,. The recombinant or isolated polypeptide according to claim 26, wherein the hemipteran Li;: AMENDED SHEET IPEA/AU PCT/AU99/00033 P:%OPER\MRO\ECDYSONEPCT 21/1299 Received 21 December 1999 -72- insect is Myzus persicae or a close relative thereof.

28. The recombinant or isolated polypeptide according to claim 27, wherein the insect ecdysone receptor comprises an EcR polypeptide of the M. persicae ecdysone receptor having the amino acid sequence set forth in <400>6 or <400>10 or a bioactive analogue or derivative thereof.

29. The recombinant or isolated polypeptide according to claim 28 wherein the bioactive analogue or derivative comprises a ligand binding region which region comprises at least domain E and a part of domain D of <400>10, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex. The recombinant or isolated polypeptide according to claim 26, wherein the insect ecdysone receptor comprises an EcR partner protein (USP polypeptide) of the M. persicae ecdysone receptor or a USP polypeptide of the M. persicae juvenile hormone receptor having or including the amino acid sequence set forth in <400>12 or a bioactive analogue or derivative thereof.

31. The recombinant or isolated polypeptide according to claim 26, wherein the dipteran insect is L. cuprina or a close relative thereof and wherein the insect steroid receptor polypeptide comprises a ligand binding region which comprises at least domain E and a part of domain D of <400> 2, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex.

32. The recombinant or isolated polypeptide according to claim 26, wherein the dipteran insect is L. cuprina or a close relative thereof and wherein the insect steroid receptor polypeptide comprises an EcR partner protein (USP polypeptide) of the L. cuprina ecdysone receptor or a USP polypeptide of the L. cuprina juvenile hormone receptor comprising the mino acid sequence set forth in <400>4 or <400>14 or a bioactive analogue or derivative AMENDED SHEET (PEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/1299 Received 21 December 1999 -73- thereof.

33. The recombinant or isolated polypeptide according to claim 32 wherein the bioactive analogue or derivative comprises a ligand binding region which region comprises at least domain E and a part of domain D of <400> 4, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex. The isolated or recombinant polypeptide according to any one of claims 23 to 33, which polypeptide binds to an insect steroid or juvenile hormone or analogue thereof or to an insecticidally-active agent to form a complex.

36. The isolated or recombinant polypeptide according to claim 35, wherein the complex modulates the expression of a gene which is operably connected to a promoter sequence or steroid response element sequence to which said polypeptide binds.

37. A cell comprising the nucleic acid molecule according to any one of claims 1 to 15 or the genetic construct according to claims 21 or 22.

38. The cell according to claim 37 being a prokaryotic or eukaryotic cell.

39. The cell according to claim 38, wherein the eukaryotic cell is an insect cell or a mammalian cell. The cell according to claim 39 wherein the insect is Spodoptera frugiperda or the mammalian cell is a CHO cell.

41. A cell which expresses the isolated or recombinant polypeptide according to any one of claims 23 to 36.

42. The cell according to claim 41, being an insect cell or a mammalian cell. AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/1299 Received 21 December 1999 -74-

43. The cell according to claim 42 wherein the insect cell is derived from Spodoptera frugiperda or the mammalian cell is a CHO cell.

44. A method of identifying a modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression comprising: assaying the expression of a reporter gene in the presence of the recombinant or isolated polypeptide according to any one of claims 23 to 36 and a potential modulator; and (ii) assaying the expression of the reporter gene in the presence of the recombinant or isolated polypeptide according to any one of claims 23 to 36 and without said potential modulator; and (ii) comparing expression of the reporter gene in the presence of the potential modulator to the expression of a reporter gene in the absence of the potential modulator, wherein said reporter gene is placed operably under the control of a steroid response element (SRE) to which said steroid receptor binds or a promoter sequence comprising said SRE. The method according to claim 44, wherein the SRE is the hsp27 ecdysone response element or the 13 bp core palindromic sequence thereof.

46. The method according to claim 44, wherein the promoter is the SV40 promoter, MMTV promoter, p10 promoter or polyhedron promoter.

47. The method according to any one of claims 44 to 46, wherein the reporter gene is the CAT gene or the 13-galactosidase gene.

48. The method of claim 44 wherein the modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression is a steroid receptor antagonist or juvenile hormone receptor antagonist. 9. The method of claim 44 wherein the modulator of steroid receptor-mediated gene AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONEPCr 21/1299 Received 21 December 1999 expression or juvenile hormone receptor-mediated gene expression is a steroid receptor agonist or juvenile hormone receptor agonist. The method of claims 48 or 49, wherein the modulator of steroid receptor-mediated gene expression or juvenile hormone receptor-mediated gene expression is a synthetic chemical that mimics the structure of a ligand of said receptor, thereby modulating binding of said ligand to said receptor.

51. The method of claim 50, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an ecdysteroid receptor or juvenile hormone receptor.

52. A method of identifying a potential insecticidal compound comprising: assaying the binding directly or indirectly of the recombinant or isolated polypeptide according to any one of claims 23 to 36 to a steroid response element (SRE) to which said polypeptide binds, in the presence of a candidate compound; and (ii) assaying the binding directly or indirectly of the recombinant or isolated polypeptide according to any one of claims 23 to 36 to a steroid response element (SRE) to which said polypeptide binds, in the absence of said candidate compound; and (ii) comparing the binding assayed at and wherein a difference in the level of binding indicates that the candidate compound possesses potential insecticidal activity.

53. The method according to claim 52, wherein the binding is assayed indirectly by determining the level of expression of a reporter gene which is placed operably under the control of the steroid response element (SRE) to which the isolated or recombinant polypeptide binds or a promoter sequence comprising said SRE.

54. The method according to claim 53, wherein the SRE is the hsp27 ecdysone response element or the 13 bp core palindromic sequence thereof. AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MROXECDYSONE.PCT 21/12199 Received 21 December 1999 -76- The method according to claim 53, wherein the promoter is the SV40 promoter, MMTV promoter, p10 promoter or polyhedron promoter.

56. The method according to any one of claims 52 to 55, wherein the reporter gene is the CAT gene or the 1-galactosidase gene.

57. The method according to any one of claims 52 to 56, wherein the potential insecticidal compound is an insect steroid receptor antagonist or insect juvenile hormone receptor antagonist.

58. The method according to any one of claims 52 to 56, wherein the potential insecticidal compound is an insect steroid receptor agonist or insect juvenile hormone receptor agonist.

59. The method of claims 57 or 58, wherein the agonist or antagonist is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or a juvenile hormone receptor, thereby modulating binding of said ligand to said receptor. The method of claim 60, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor.

61. A method of identifying a candidate insecticidally-active agent comprising the steps of: a) expressing a polypeptide selected from the group consisting of: a polypeptide comprising the ligand binding region of an EcR polypeptide of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 2 or <400>10 or an amino acid sequence that is at least identical thereto, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; and AMEND,2E. SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT-2m2/9 Received 21 December 1999 -77- (ii) an EcR polypeptide of a steroid receptor having greater than 80% identity to any one of <400> 6 or <400>10, optionally in association with an EcR partner protein (USP polypeptide) of an insect steroid receptor or ligand binding region thereof, and/or an insect steroid or analogue thereof so as to form a complex; b) purifying or precipitating the polypeptide or complex; c) determining the three-dimensional structure of the ligand binding domain of the polypeptide or complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding region, wherein said compounds represent candidate insecticidally-active agents.

62. The method of claim 61, wherein the candidate insecticidally-active agent is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or a juvenile hormone receptor, thereby modulating binding of said ligand to said receptor.

63. The method of claim 62, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor.

64. A method of identifying a candidate insecticidally-active agent comprising: a) expressing a polypeptide selected from the group consisting of: a polypeptide comprising the ligand binding region of a partner protein (USP polypeptide) of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 4 or an amino acid sequence that is at least identical thereto, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/2/99 Received 21 December 1999 -78- (ii) the partner protein (USP polypeptide) of a steroid receptor having greater than 80% identity to <400> 4 and/or greater than 90% identity to <400> 12; and (iii) the USP polypeptide of a juvenile hormone receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; optionally in association with an EcR polypeptide of an insect steroid receptor or ligand binding region thereof, and/or an insect steroid or analogue thereof, so as to form a complex; b) purifying or precipitating the polypeptide or complex; c) determining the three-dimensional structure of the ligand binding domain of the polypeptide or complex; and d) identifying compounds which bind to or associate with the three-dimensional structure of the ligand binding region, wherein said compounds represent candidate insecticidally-active agents. The method of claim 64, wherein the candidate insecticidally-active agent is a synthetic chemical that mimics the structure of a ligand of an insect steroid receptor or an insect juvenile hormone receptor, thereby modulating binding of said ligand to said receptor.

66. The method of claim 65, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor.

67. A synthetic compound which interacts with the three dimensional structure of a polypeptide or protein selected from the group consisting of: a polypeptide comprising the ligand binding region of an EcR polypeptide of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 2 or <400>10 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the partner protein (USP polypeptide) of a steroid receptor or the ligand-binding region thereof to AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT-2112/99 Received 21 December 1999 -79- form a functional hormone-binding complex; (ii) a polypeptide comprising the ligand binding region of a partner protein (USP polypeptide) of a steroid receptor which region comprises at least domain E and a part of domain D of <400> 4 or an amino acid sequence that is at least 40% identical thereto, and wherein said ligand binding region is capable of associating with the EcR polypeptide of a steroid receptor or the ligand-binding region thereof to form a functional hormone-binding complex; (iii) a fusion polypeptide between and (ii); (iv) the partner protein (USP polypeptide) of a steroid receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; the USP polypeptide of a juvenile hormone receptor having greater than identity to <400> 4 and/or greater than 90% identity to <400> 12; (vi) the EcR polypeptide of a steroid receptor having greater than 80% identity to any one of <400> 6 or <400>10, and (vii) a functional receptor or protein complex formed by an association between a member selected from the group consisting of: any one or more of said ,EcR polypeptides or said ligand binding regions of an EcR polypeptide; and (ii) any one or more of said EcR partner proteins or said ligand-binding regions of a partner protein, wherein said compound is capable of binding to said polypeptide or protein to agonise or antagonise the binding activity or bioactivity thereof.

68. The synthetic compound of claim 67, wherein said compound mimics the structure of a and of a steroid receptor or a juvenile hormone receptor. AMENDED SHEET IPEA/AU PCT/AU99/00033 P:\OPER\MRO\ECDYSONE.PCT- 21/1299 Received 21 December 1999

69. The synthetic compound of claim 68, wherein the synthetic chemical is a bisacylhydrazine insecticide, iridoid glycoside or other non-steroidal modulator of an insect ecdysteroid receptor or insect juvenile hormone receptor. The recombinant or isolated polypeptide according to claim 23, wherein the bioactive derivative or analogue comprises a fusion polypeptide comprising an amino acid sequence which: differs from a naturally-occurring EcR polypeptide subunit of a steroid receptor, and/or a naturally-occurring EcR partner protein (USP polypeptide) subunit of a steroid receptor, and/or a naturally-occurring USP polypeptide of a juvenile hormone receptor; and (ii) comprises a first sequence of amino acids derived from a polypeptide selected from any one of or (ii) or (iv) or or (vi) linked covalently to a second sequence of amino acids derived from an EcR polypeptide subunit of a steroid receptor, EcR partner protein (USP polypeptide) subunit of a steroid receptor, or USP polypeptide of a juvenile hormone receptor, wherein said first and second sequences are derived from different genomic sources and subject to the proviso that said first sequence is not when said second sequence is (ii).

71. The recombinant or isolated polypeptide according to claim 70, wherein the first sequence comprises an amino acid sequence from the N-terminus to the end of the DNA- binding domain and wherein the second sequence comprises an amino acid sequence from the D domain through the hormone-binding domainqo the carboxyl terminus.

72. The recombinant or isolated polypeptide according to claim 70, wherein the first sequence of amino acids is derived from L. cuprina or M. persicae.

73. The recombinant or isolated polypeptide according to claim 70, wherein the second sequence of amino acids is derived from D. melanogaster.

74. A method of identifying a synthetic compound for insecticidal activity comprising AMENDED SHEET IPEA/AU PCT/AU99/00033 Received 21 December 1999 P:\OPER\MRO\ECDYSONE.PCT -21/12/99 -81 contacting the recombinant or isolated polypeptide according to any one of claims 23 to 36 with said compound for a time and under conditions sufficient for binding to occur and detecting said binding using a detection means, wherein the occurrence of binding is indicative of potential insecticidal activity of the compound. The method of claim 74, further comprising assaying for binding of the compound to the polypeptide in the presence of a native insect steroid and comparing the binding obtained therefrom with the binding obtained in the absence of said steroid.

76. The method according to claims 74 or 75, wherein the polypeptide is immobilised on a solid support.

77. The method according to claim 76, wherein the solid support comprises one or more polymeric pins.

78. The method according to any one of claims 74 to 77, wherein the detection means comprises a reporter molecule that binds to the compound being screened.

79. The method of claim 78, wherein the reporter molecule is a radioactive label or antibody molecule. AMENDED SHEET IPEA/AU