WO2000075300A2

WO2000075300A2 - Methods for manipulating the avian genome

Info

Publication number: WO2000075300A2
Application number: PCT/US2000/040059
Authority: WO
Inventors: Paul A. Ditullio; Karl M. Ebert
Original assignee: Tranxenogen, Inc.
Priority date: 1999-06-04
Filing date: 2000-06-02
Publication date: 2000-12-14
Also published as: WO2000075300A3; AU5789800A; EP1190042A2; NZ516173A; AU777420B2; CA2375441A1; JP2003501083A

Abstract

The invention features a method for introducing a nucleic acid molecule into the genome of an avian species by contacting in vivo a blastodermal cell of a fertilized egg with the nucleic acid molecule, which nucleic acid is not associated with a viral coat protein. The invention also encompasses transgenic avian animals and methods of producing such transgenic animals.

Description

METHODS FOR MANIPULATING THE AVIAN GENOME BACKGROUND OF THE INVENTION

The invention relates to transgemc avian animals

The ability to create transgemc animals form different species has had great impact on both biomedical research and the biotechnology industry Transgemc technology has been applied to both laboratory and domestic species for the study of human disease (see, for example. Synder, B W , et al , Mol Reprod. and Develop 40 419-428 ( 1995)), develop ιmpro\ ed agπcultural livestock (see, for example, Ebert, K M et al , Animal Biotechnology 1 145- 159 ( 1990)), production of pharmaceuticals m milk (see, for review article, Ebert, K M and J P Selgrath. "Changes in Domestic Lπ estock through Genetic Engineering" in

Applications in Mammalian Development. Cold Spnng Harbor Laboratory Press, 1991 )), and xenotransplantation (see, for example, Osman, N , et al , Proc Natl Acad Sci USA 94 14677- 14682 (1997)) However, the basic technique of micro injection used to create many of these transgemc animals is inefficient, costly, and not easily applicable to all species such as the chicken (see, for example, Love, J , et al BioTechnology 12 60-63 (1994))

SUMMARY OF THE INVENTION

The invention features methods of manipulating genomic DNA m avian species and to generate transgemc avian animals A method for introducing a nucleic acid molecule into the genome of an avian species is earned out bv contacting in vivo a blastodermal cell of a fertilized hard shelled egg with the nucleic acid molecule Preferably, the nucleic acid molecule is not associated with a viral coat protem, e g , the nucleic acid is not delivered in a \iral particle The nucleic acid molecule is introduced directly into the germinal disc of the egg To avoid disrupting the germinal disc (or blastoderm) or dispersing the blastodermal cells, the nucleic acid is delivered in a volume that is less than the volume of the germinal disc

(approximately 100 micro ters or less) For example, the volume is greater than 1 microhter and less than 0 5 milliliters and introduction of the nucleic acid does not rupture the area opaca (membrane or sheath surrounding the germinal disc or blastoderm) In preferred embodiments, the nucleic acid is delivered in a volume of 5-100 microhters, more preferably 40-60 microhters. and most preferably. 10-20 microhters To target blastodermal cells, the nucleic acid is delivered directly into the blastoderm or germinal disc and not to an area adjacent to or below the blastoderm The thick albumen around the germinal disc is not removed before, duπng, or after the delivery process The nucleic acid is delivered by passing a needle or microinjection pipet directly through the shell and underlying membrane Little or no air is introduced into the egg, and the hole m the membrane left by the pipet or needle is small and self-sealing Accordingly, the method does not require deposition of an aqueous liquid o\ er the opening of the egg to minimize the inadvertent introduction of air into the egg and does not require sealing the opening of the egg after nucleic acid delivery Optionally, the blastodermal cell is exposed to an electncal current in vivo, e g , by applying an electncal current across the egg

The method is useful to introduce a nucleic acid such as DNA into the genome of any avian species such as a chicken, an ostnch. an emu, a turkeys, a duck, a goose, a quail a parrot, a parakeet, a cockatoo, or a cockatiel to produce therapeutic proteins or to make an avian model for a non-avian, e g , human, disease state For example, the method is used to deliver DNA to blastodermal cells in a fertilized egg of any breed of chicken or any hybπd breed of chicken Chicken breeds include White Leghorn, White Plymouth Rock, Barred Plymouth Rock, Rhode Island Red, New Hampshire and Dark Cornish

Nucleic acid delivery is timed to optimize uptake of the nucleic acid by blastodermal (totipotent) cells and minimize (or eliminate) uptake by cells which have begun to differentiate into vanous tissue types Thus, a blastodermal cell in a fertilized egg is contacted with nucleic acid dunng developmental stage X of the egg Delivery takes place at a time after oviposition but before incubation of the egg (at which time cell division and cell differentiation takes place)

The nucleic acid encodes a polypeptide or antisense molecule For example, the nucleic acid contains a sequence encoding an antibody or fragment thereof The term antibody encompasses an mtact tetramenc antibody (e g , a monoclonal antibody) as well as an immunologically active antibody fragment, e g , a Fab or (Fab)₂ fragment, an engineered single chain F, molecule, a chimeπc molecule (e g , an antibody which contains the binding specificity of one antibody, e g , of munne origin, and the remaining portions of another antibody, e g , of human oπgin Preferably, the antibody or fragment thereof is of human ongm Other polypeptides include an insulin polypeptide (such as a human or porcine insulin polypeptide), a growth hormone polypeptide, a calcitonm polypeptide, or a serum albumin polypeptide For example, the transgemc nucleic acid encodes a porcine single chain insulin polypeptide

-?- To direct transcπption of the transgemc nucleic acid in blastodermal cells of an egg, the nucleic acid construct contains an egg-specific transcπptional regulatory element Transcnptional regulatory sequence is a geneπc term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences to which they are operably linked

Transcπption of the recombinant gene or transgene is under the control of a promoter sequence as well as other transcnptional regulatory sequences For example, an ovalbumin promoter sequence is used to direct expression of a transgene and a regulatory sequences deπved from a chicken lysozvme gene is used to direct equal or equivalent expression of both chains of a transgemc tetrameπc antibody molecule By "promoter" is meant a minimal DNA sequence sufficient to direct transcπption Promoters may be constitutive or inducible, and may be coupled to other regulatory sequences or "elements" which render promoter-dependent gene expression cell-type specific, tissue-specific or mducible by external signals or agents, such elements may be located in the 5' or 3' region of the native gene, or withm an intron A transgene expression construct contains one or more of the following elements a chicken lysozyme or ovalbumin promoter, a chicken lysozyme enhancer, and a matπx attachment region of a chicken lysozyme gene The matπx attachment region (U S Patent No 5, 731, 178, hereby incorporated by reference) preferably includes a region of the chicken lysozyme gene spanning from position -1 1 7 to -8 8 or from position +5 3 to +9 0 One or both sequences are connected to the heavy and/or light chain of a tetrameπc antibody to provide equal or equivalent expression of the two antibody subunits Preferably, the region from -1 1 7 to -8 8 and/or +5 3 to +9 0 of the chicken lysozyme gene is attached to the 5' and/or 3 ' end of a construct with a heavy and light chain antibody coding region each under the control of its own promoter The invention includes a transgene expression cassette in which the heavy and light chain coding regions of an antibody are gated together, each under the direction of its own promoter operably linked to a matπx attachment region By "operably linked" is meant that a coding sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e g , transcnptional activator proteins) are bound to the regulatory sequence(s) The ιn\ ention also encompasses transgemc avian animals The term "transgemc avian animal" refers to a member of an avian species (e g , a chicken) that contains a transferred nucleic acid sequence, including a transferred protem-encoding and/or regulatory sequence, such that the transferred sequence is integrated into a host chromosome As a result of such transfer and integration, the transfeπed sequence may be transmitted through germ cells to the offspπng of a transgemc chicken Thus, transgemc chickens are created by introducing by a method of transfer, new nucleic acid sequences into germ cells A transgemc avian animal is any bird in which one or more, and preferably all of the cells of the animal, includes a transgene The transgene is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, e g , a totipotent blastodermal cell of an avian egg, by way of deliberate genetic manipulation The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule into a blastodermal cell of an avian egg This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA Transgemc avians which include one or more transgenes encoding one or more polypeptides are within the scope of this invention For example, a double or tπple transgemc bird, which includes two or three transgenes can be produced A transgemc avian animal contains a nucleic acid sequence encoding a non-avian antibody polypeptide, e g , a human antibody, in its genome Other transgemc avian animals include those m which the genome has been engineered to contain a nucleic acid sequence encoding a non-avian insulin polypeptide such as a human or porcine insulin polypeptide or one which contains a nucleic acid encoding a calcitomn polypeptide, a growth hormone polypeptide, or a serum albumin polypeptide Preferably, the polypeptides are of human ongin The transgemc avian animals express the transgemc nucleic acid, and the cells of the transgemc animal produce the transgemc polypeptides Accordingly, the invention encompasses an isolated avian cell, e g , an avian blastodermal cell, which contains a transgene encoding an antibody, an insulin, a growth hormone, a serum albumin, or a calcitomn polypeptide The term "isolated" used in reference to a cell means that the cell is substantially free of other cell types or compositions with which it naturally occurs in a tissue of an animal

The nucleic acids described herein are isolated An isolated nucleic acid, e g , an isolated gene, or a fragment thereof, to be transfeπed into a blastodermal cell of an egg is isolated by any of several methods well known to the art For example, the nucleic acid molecules are recombinant and/or have been puπfied from the sequences which flank it in a naturally occurπng state, I e a DNA has been removed from the sequences which are normally adjacent to the fragment, e g , the sequences adjacent to the fragment in the genome in which it naturally occurs Thus, an isolated nucleic acid molecule is produced synthetically, or by treating mRNA deπved from the transcπption of the gene with a reverse transcπptase so as to produce a cDNA, or by the direct isolation of the nucleic acid from cells, bacteπal clones, or from other sources The invention includes sequences which hybπdize under stπngent conditions, with all or part of the sequence reported in a reference sequence and retains a biological function of the reference nucleic acid For example, the nucleic acid may contain one or more sequence modifications m relation to a reference sequence Such modifications may be obtained by mutation, deletion and/or addition of one or more nucleotides compared to the reference sequence Modifications are introduced to alter the activity of the regulatory sequence, e g , to e promoter activity, to suppress a transcπption inhibiting region, to make a constitutive promoter regulatable or vice versa Modification are also made to introduce a restnction site facilitating subsequent cloning steps, or to eliminate the sequences which are not essential to the transcπptional activity Preferably, a modified sequence is at least 70% (more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99%) identical to a reference sequence In the case of a transcnptional regulatory element, the modifications do not substantially alter the transcπption promoter function associated with the reference sequence (or a naturally-occumng lactoferπn promoter sequence) For example, promoter modifications are engineered to avoid the site of initiation of transcπption and the TATA box Modified transcnptional regulatory sequences such as enhancers retain at least 50%, preferably at least 75%, preferably at least 95%, and most preferably 100% of the enhancer activity of the reference sequence Alternatively, the modified sequence directs a level of transcπption that is greater than that of the reference sequence For example, a modified enhancer directs at least 1 10% of the level of transcπption associated with the reference enhancer sequence

Nucleotide and ammo acid compaπsons are earned out using the Lasergene software package (DNASTAR, Inc , Madison, WI) The MegA gn module used was the Clustal V method (Higgins et al , 1989, CABIOS 5(2) 151-153) The parameter used were gap penalty 10, gap length penalty 10 Alternatively, the nucleic acids descnbed herein hybπdize at high stπngency to a strand of DNA having the reference sequence, or the complement thereof and have transcnption regulatory activity Hybπdization is earned out using standard techniques, such as those descπbed in Ausubel et al (Cuπent Protocols in Molecular Biology, John Wiley & Sons, 1989) "High stnngency" refers to nucleic acid hybπdization and wash conditions characteπzed by high temperature and low salt concentration, 1 e, hybπdization at 42 degrees C, and in 50% formamide, a first wash at 65 degrees C, 2X SSC, and 1% SDS, followed by a second wash at 65 degrees C and 0 1 % x SSC Lower stnngency conditions suitable foi detecting DNA sequences having about 50% sequence identity to a reference gene or sequence are detected by, for example, hybndization at 42 degrees C m the absence of formamide, a first wash at 42 degrees C, in 6X SSC, and 1% SDS, and a second wash at 50 degrees C, in 6X SSC, and 1 % SDS Other features and advantages of the invention will be apparent form the descπption and the drawings and from the claims

BRIEF DESCRIPTION OF THE DRAWINGS Fig 1 is a diagram of a fertilized hen's egg Fig 2 is a diagram of a transgene expression cassette DETAILED DESCRIPTION OF THE INVENTION

The avian reproductive system is distinct from mammalian reproductive systems in that the female can store sperm and fertilize a single ovum at a time The new fertilized ovum is large, fragile, and filled with yolk as it enters the reproductive track Early embryonic development occurs in the oviduct as the egg is formed around the ovum As the ovum travels down the reproductive tract, it is surrounded by a protective layer of white albumen followed by an inner membrane and hardened shell before being laid (Fig 1 ) At the time of oviposition, the ovum has matured from a single cell into a blastoderm (also known as the germinal disc) composed of 40-60,000 cells and development aπests until the hen has laid enough eggs and beings to roost In the blastoderm state, all cells are totipotent and equally capable of contπbutmg to the germ line of the developing chick

Oviposition is the time at which the egg is laid In the chicken, oviposition occurs at stage X (a freshly laid egg, about 20 hours of utenne age) The time at which a nucleic acid is introduced into the blastoderm or germinal disc is after oviposition but before incubation of the egg, l e , before the first cell division after the egg is incubated To effectively target blastodermal cells, DNA is therefore introduced into the blastoderm of an egg which has been incubated for 6 hours or less Early stages of development of the egg are indicated by roman numerals, whereas stage of development of an embryonic chick are indicated by arable numerals For example, stage X refers to a stage of development that occurs at about 20 hours uteπne age and is charactenzed by oviposition, whereas stage 10 refers to a stage of embryonic chick development (charactenzed by tissue differentiation) No tissue differentiation has occuπed in stage X of development Accordingly, genetic manipulation occurs before differentiation of blastodermal cells into embryonic tissue

The germinal disc is distinguished from the germinal crescent region in that the germinal disc contains undifferentiated blastodermal cells (at stage X or before), whereas the germinal crescent region appears in the early stages of chick embryo development (I e , stages 3-5 or 9-1 1 of chick embryo development) The cells of the blastoderm are genetically manipulated both in vitro or in vivo using gene delivery techniques and then used to produce transgemc or chimeπc chickens by allowing development in the egg, transfernng to a recipient unfertilized egg, or transferπng to the testes of a steπle rooster for development into spermatogonia The optimum time for transfection is between oviposition and several hours of activation of the egg in order to reduce the number of target cells for transfection

Nucleic acid deln erv and production of transgemc animals

The blastoderm is accessed by cutting or dπlling a small hole in the egg shell (sitting upnght) with a scapel or dnll and gently peeling back the inner membrane to expose the white albumen The blastoderm automatically onents to the top of the yolk and is visualized under light For the production of chimeπc or transgemc chickens, the cells of the blastoderm are transfected in vι\ o by infusing DNA directly into the blastoderm using a synnge and small gauge needle The DNA is naked or complexed with pids or other suitable compounds to facility DNA uptake (e g , DEAE-dextran) If the DNA is naked, the transfection efficiency is increased by passing an electncal current across the blastoderm or whole egg with a device such as a human heart defibπllator If a current is passed across the whole egg, two additional holes are made in the egg shell to expose the inner membrane to the cuπent since the shell will not conduct electπcity

Alternate ely, the blastoderm is removed from the egg and pooled with the cells from several eggs using a small pipet In vitro, DNA uptake by blastodermal cells is facilitated by such techniques as electroporation, DEAE-dextran treatment, calcium phosphate treatment, or pofection Following transfection, the cells are transferred into the germinal disc of an unfertilized egg for development of a transgemc chick or into the testes of a steπle rooster to induce development in spermatogonia and sperm for breeding Chicks produced are tested for the presence of the transgene according to known methods, e g, by the polymerase chain reaction or southern blot analysis

The overall efficiency of the nucleic acid delivery procedure depends on the method and timing of gene delivery Transfection efficiency is optionally increase by methods such as

1 ) subjecting the blastoderm or cells dem ed from the blastoderm to several rounds of transfection 2) adding a selectable marker such as but not limited to an antibiotic gene to the DNA vector and infusing the antibiotic into the yolk or testes following transfection or cell transfer The method is applicable to all birds including, but not limited to, chickens, turkeys ostπches, and geese The cπtical factor for the efficiency of gene delivery is the timing of egg activation in relation to transfection The optimal time to transfect the cells is after oviposition and within six hours of activation (post-mcubation) so that the cells have started to grow but have not undergone a cell division The following are examples of the preferred embodiments of the inventions and specifically related to the production of transgemc chickens for the production of pharmaceuticals m eggs The structure or composition of the transgene has little or no effect on the transfection efficiency of the methods descnbed Prefeπed transgene constructs include those carrying the ovalbumin promoter operatively linked to the human serum albumin gene, human insulin gene, native or modified porcine insulin gene, calcitomn gene, or and gene encoding and antibody vaπable region The invention includes transgemc chickens carrying any of the above mentioned genes directed to expression in the egg Example 1 In vivo nucleic acid delivery

Fertilized eggs are laid and collected (day 1 ) The eggs are shipped at room temperature (umncubated) (day 2) Optionally, the eggs are allowed to site upnght for at least

24 hours (day 3) at room termperature (umncubated) pnor to manipulation for nucleic acid delivery

A fertilized hen's egg was collected and placed in a humidified incubator for between 1 and 6 hours to activate the egg A hole was cut in the egg shell using a dremel and the inner membrane was folded back The egg was placed on a light to visualize the germinal disc which was infused with a hpid/DNA complex The inner membrane was folded into place and the egg sealed with parafilm The egg was placed back into the incubator and allowed to develop to term \ blood sample or inner membrane sample as taken from the resulting chick and tested for the presence of the transgene by the polymerase chain reaction with transgene specific pπmers A mosaic or chimeπc chick is bred to a rooster to produce fully transgemc offspπng Example 2 In vitro DNA delivery of blastodermal cells and transfer of transfected eggs to an unfertilized egg

Ten to twenty fertilized hen's eggs are placed in a humidified incubator for between 1 and 6 hours to activate cell division A hole is cut in the egg shell using a dremel and the inner membrane folded back in order to visualize the blastoderm The blastoderms are removed from the eggs with a large bore pipet tip and combine in a conical tube The yolk is removed by washing with phosphate buffered saline, and the blastoderms collected by centπfugation The cells are dispersed by treatment with collagenase or gentle pipetting and collect by centπfugation The cells are resuspended in serum free media containing 1 -5 g of transgene and allowed to sit at room temperature in an electroporation cuvette The cells are gently resuspended and electroporated at 300-500V and 250-960uF Following transfection, the cells are transferred into the germinal disc of an unfertilized egg by cutting a hole in the egg shell, folding back the inner membrane, and infusing the cells into the disc with a synnge and large gauge needle The egg is sealed and incubated in a humidified incubator to allow development A blood sample is taken from the resulting chick and tested for the presence of the transgene by the polymerase chain reaction with transgene specific pπmers using standard methods

Example 3 In vitro DNA delivery of blastodermal cells and transfer of transfected eggs to rooster testes

Ten to twenty fertilized hen's eggs are placed in a humidified incubator for between 1 and 6 hours to activate cell division A hole is cut in the egg shell using a dremel and the inner membrane folded back in order to visualize the blastoderm The blastoderms are removed from the eggs with a large bore pipet tip and combined in a conical tube The yolk is removed by v ashing with phosphate buffered saline, and the blastoderms collected by centπfugation The cells are suspended m serum free media containing 1 -5 g of transgene and allowed to sit at room temperature in an electroporation cuvette The cells are gently resuspended and electroporated at 300-500V and 250-96υF Following transfection, the cells are transferred into the testes of a sterilized rooster to induce development into spermatogonia. The rooster is monitored for breeding and sperm collected to test for the presence of the transgene. Example 4: Vector Construction

To target expression of insulin to the magnum cells of an egg laying hen, a genomic sequence encoding human insulin was operatively linked to a promoter which directs transcription of a nucleic acid to which it is operably linked in avian eggs. For example, the promoter is a human lactoferrin promoter. The construction of a human lactoferrin expression cassette is described in patent application USSN 09/490,801, the contents of which are hereby incorporated by reference. For example, transcription regulatory elements are derived from a milk specific promoter, e.g., a mammalian lactoferrin gene promoter. The expression cassette contains a promoter region derived from the human lactoferrin gene operably linked to a heterologous sequence. A heterologous sequence is one that does not encode a lactoferrin polypeptide. The promoter region includes at least 20 nucleotides of the nucleotide sequence of SEQ ID NO:l . For example, the promoter region contains nucleotides 1 -154 of SEQ ID NO: 1 or 2.

Table 1 : Human Lactoferrin promoter region

1 CTGGΛrCCTCAAGGAACAAGTAGACCTGGCCGCGGGGAGT

41 GGGGAGGGAAGGGGTGTCTATTGGGCAACAGGGCGGCAAA 81 GCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGCAGAG

121 CCTTCGTTTGCCAAGTCGCCECG-4GACCGCAGACATGAAA 161 GCATGTCTCCGCGGAAAA (SEQ ID NO:l)

BamHl restriction site GGATCC (nucleotides 5-8) and Xhol site (nucleotides 140- 145) are italicized. These restriction sites may be altered, e.g., replaced with other restriction sites or with nucleotides that do not represent restriction enzyme recognition sites. Table 2: Human Lactoferrin promoter region

1 CTNNNNNNTCAAGGAACAAGTAGACCTGGCCGCGGGGAGT 41 GGGGAGGGAAGGGGTGTCTATTGGGCAACAGGGCGGCAAA

81 GCCCTGAATAAAGGGGCGCAGGGC AGGCGCAAGTGCAGAG

121 CCTTCGTTTGCCAAGTCGCNNNNNNACCGCAGACATGAAA

GCATGTCTCCGCGGAAAA (SEQ ID NO:2)

Optionally, the lactoferrin-derived promoter regions described above are linked to the nucleotide sequence of SEQ ID NO:3 (GENBA K™ accession no. S52659).

-10- RECTIFDED SHEET (RULE 91) Table 3 5' Region of human lactoferπn gene

1 cgaggatcat ggctcactgc caccttcatc tcccaggctc aaatggtcct cccactttag 61 cctcccaagt agctgggacc ataggcatac accaccatgc tgggctaatt tttgtatttt 121 ttgtagagat gggggtttcc ctatgaagcc caggctagtc ttgaactcct gggctcaagc

181 gatcctccca tcttggcctc ccaaagtgct gggattacag gcatgagcca ctgtgccctg 241 cctagttact cttgggctaa gttcacatcc atacacacag gatattcttt ctgaggcccc 301 caatgtgtcc cacaggcacc atgctgtatg tgacactccc ctagagatgg atgtttagtt 361 tgcttccaac tgattaatgg catgcagtgg tgcctggaaa catttgtacc tggggtgctg 421 tgtgtcatgg gaatgtattt acgagatgta ttcttagaag cagtattcta gcttttgaat

481 tttaaaatct gacatttatg gcgattgtta aaatgaggtt accatttcct attgaatact 541 atcaacacca aaaaagaaga aggaggagat ggagaaaaaa aagacaaaaa aaaaaaaagt 601 ggtagggcat cttagccata gggcatcttt ctcattggca aataagaaca tggaaccagc 661 cttgggtggt ggccattccc ctctgaggtc cctgtctgtt ttctgggagc tgtattgtgg 721 gtctcagcag ggcagggaga taccccatgg gcagcttgcc tgagactctg ggcagcctct

781 cttttctctg tcagctgtcc ctaggctgct gctgggggtg gtcgggtcat cttttcaact 841 ctcagctcac tgctgagcca aggtgaaagc aaacccacct gccctaactg gctcctaggc 901 accttcaagg tcatctgctg aagaagatag cagtctcaca ggtcaaggcg atcttcaagt 961 aaagaccctc tgctctgtgt cctgccctct agaaggcact gagaccagag ctgggacagg 1021 gctcaggggg ctgcgactcc taggggcttg cagacctagt gggagagaaa gaacatcgca

1081 gcagccaggc agaaccagga caggtgaggt gcaggctggc tttcctctcg cagcgcggtg 1 141 tggagtcctg tcctgcctca gggcttttcg gagcctggat cctcaaggaa caagtagacc 1201 tggccgcggg gagtggggag ggaaggggtg tctattgggc aacagggcgg ggcaaagccc 1261 tgaataaagg ggcgcagggc aggcgcaagt ggcagagcct tcgtttgcca agtcgcctcc 1321 agaccgcaga catgaaactt gtcttcctcg tcctgctgtt cctcggggcc ctcggtgagt

1381 gcaggtgcct gggggcgcga gccgcctgat gggcgtctcc tgcgccctgt ctgctaggcg 1441 ctttggtccc tgtgtccggt tggctgggcg cggggtctct gcgccccgcg gtcccagcgc 1501 ctacagccgg gaggcggccc ggacgcgggg ccagtctctt tcccacatgg ggaggaacag 1561 gagctgggct cctcaagccg gatcggggca cgcctagctc tgctcagagc ttctcaaaag 1621 gcctcccagg cccctgtccc tttgtgtccc gcctaaggat ttggtcccca ttgtattgtg

1681 acatgcgttt tacctgggag gaaagtgagg ctcagagagg gtgagcgact agctcaagga 1741 ccctagtcca gatcctagct cctgcgagga ctgtgagacc ccagcaagac cgagccttta 1801 tgagacttag tttcttcact taaagaaacg gcctaaccat gggtccacag ggttgtgagg 1861 aggagatggg gcattcgcac accttccgtg gcagagggtt gtggaggggt gcggtgctcc 1921 tgatggaacc ctgtgtcaga gggtttgaga gggaaatgtc agccaaacag aaggaaggag

1981 cagaaggaag gaaacaattg tcagttccat aaccaaagta atttctcggg tgctcagagg 2041 gcactcccca gcgctgcaca ttagtgacct aaatgcgtga gtgcgg (SEQ ID NO: 3)

The nucleic acid molecules and constructs descnbed herein are isolated. By "isolated" is meant a nucleic acid molecule that is free of the genes which, m the naturally-occumng genome of the organism, flank the sequence of interest The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a procaryote or eucaryote; or which exists as a separate molecule (e g , a cDNA or a genomic or cDNA fragment produced by PCR or restπction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybπd gene encoding additional polypeptide sequence The term excludes large segments of genomic DNA, e g , such as those present in cosmid clones, which contain a given DNA sequence flanked by one or more other genes which naturally flank it in a naturally-occumng genome Lactofemn-deπved transcπption regulatory sequences, are attached to a nominal promoter (e g , the nominal lactofermn promoter or a heterologous promoter) which in turn is operably linked to a sequence to be transcπbed The heterologous sequence to be transcπbed is a polypeptide-encodmg sequence or antisense sequence When incorporated into a transgemc mammal such as a member of an avian species, the regulatory sequences of the invention operably linked to a polypeptide-encodmg sequence direct production of the encoded polypeptide m avian tissues The lactoferπn-denved regulatory sequence, e g , promoter sequence is positioned 5' to a heterologous nucleic acid sequence, e g , a transgene, in a transcπption unit Portions of the lactofemn-deπved promoter region are tested for their ability to allow tissue-specific and elevated expression of a transgene using assays known in the art, e g , standard reporter gene assays using luciferase, beta-galactosidase, or expression of an antibiotic resistance gene as a detectable marker for transcπption

All or part of one of the nucleotide sequences specified in a reference sequence, e g , SEQ ID NO 1 or 2, its complementary strand or a vanant thereof may be used in to direct transcπption of a heterologous nucleic acid sequence such as a transgene in a transgemc mammal A nucleic acid fragment is a portion of at least 20 continuous nucleotides identical to a portion of length equivalent to one of the reference nucleotide sequences or to its complement

Other promoters which direct transcnption m eggs of an avian animal are known in the art, e g , the chicken ovalbumin promoter (GENBANK™ J00895 or M24999) and the chicken lysozyme promoter (GENBANK™ J00886 or V00429) An expression vector is constructed using a chicken ovalbumin promoter for expression of cloned sequences (Gannon et al , Organisation and sequences at the 5 'end of a cloned complete ovalbumin gene Nature 278 428434, Lai et al , The ovalbumin gene Structural sequence m native chicken DNA are not contiguous Proc Natl Acad Sci USA 75(5) 2205-2209, and Kaye et al , EMBO J 3 1 137-1 144) Other regulatory elements which direct transcnption of transgenes include a nuclear DNA attachment element which mediates elevated and position-independent gene activity (Stief, A , et al , Nature 341 343-345) and an attachment element for stimulation of eucaryotic expression systems (Sippel et al , U S Patent No 5,731, 178) Other promoters useful to direct transcπption of transgenes in eggs include the conalbumin, ovomucoid, and ovotransfemn promoters known in the art For expression in blood or liver tissues, a promoter den\ ed from the chicken beta globm gene is used (Foley et al , Proc Natl Acad Sci USA 91 7252-7256)

Protein or polypeptide products to be expressed by the transgene include human insulin (GENBANK™V00565), human calcitomn (GENBANK™ XI 5943, Broad et al., Nucl Acids Res 17 6999-701 1 ), human serum albumin (GENBANK™ M12523, J04457), and a porcine single chain insulin The nucleic acid sequence of the porcine single chain insulin sequence are shown below in Tables 4 and 5

Table 4 Porcine Single Chain Insulin sequence 1

CTCGAGATGAAAAGATTCGTTAACCAACACTTGTGCGGTTCCCACTTGTTGAAGCT TTGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTACACTCCTAAGGCTGCTAAGGG TATTGTCGAACAATGCTGTACCTCC ATCTGCTCCTTGTACC AATTGGAAAACTACT

GCAACTAGACTCGAG (SEQ ID NO 4)

Table 5 Porcine Single Cham Insulin sequence with lysozyme signal sequence

CTCGAGATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGC

TCTGGGGAAAAGATTCGTTAACCAACACTTGTGCGGTTCCCACTTGTTGAAGCTT TGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTACACTCCTAAGGCTGCTAAGGGT ATTGTCGAACAATGCTGTACCTCCATCTGCTCCTTGTACCAATTGGAAAACTACTG CAACTAGACTCGAG (SEQ ID NO 5, bold type indicates signal sequence)

The invention includes sequences which hybπdize under stπngent conditions, with all or part of the sequence reported in a reference sequence and retains transcnption regulatory function For example, the nucleic acid may contain one or more sequence modifications in relation to a reference sequence Such modifications may be obtained by mutation, deletion and or addition of one or more nucleotides compared to the reference sequence Modifications are introduced to alter the activity of the regulatory sequence, e g , to improve promoter activity, to suppress a transcπption inhibiting region, to make a constitutive promoter regulatable or vice versa Modification are also made to introduce a restπction site facilitating subsequent cloning steps, or to eliminate the sequences which are not essential to the transcnptional activity Preferably, a modified sequence is at least 70% (more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99%) identical to a reference sequence The modifications do not substantially alter the transcπption promoter function associated with the reference sequence (or a naturally- occumng lactoferπn promoter sequence) For example, modifications are engineered to avoid the site of initiation of transcπption and the TATA box.

Example 5 Construction of a lactoferπn expression cassette

A lactoferπn expression cassette was constructed using lactoferπn transcnption regulatory elements. The cassette contained 3Kb of promoter and 7Kb of 3 ' flanking sequence with unique Sail and Notl restπction sites at the 5 ' and 3 'ends, respectively In addition, the vector contained a unique Xhol site for the addition of heterologous coding sequences. The human insulin gene was PCR amplified from human genomic DNA with the pπmers HINF3 (5'GCCCTCGAGGACAGGCTGCATCAGAA3 ' ; (SEQ ID NO:6)) HΓNR3 (5'CTCGGTGCTCGAGGCGGCGGGTGT3\ SEQ ID NO7) cloned into the vector pCR2.1 (Invitrogen, Carlsbad,CA) according to the manufacturer's instructions The gene sequenced using the Amp cycle Sequencing kit (PE Applied Biosystems, Foster City, CA) to confirm that no base mutations had occuπed dunng amplification. The gene was excised from the vector pCR2.1 as and Xhol fragment and cloned into the Xhol site of the human lactofemn expression cassette. The oπentation of the insulin gene was confirmed by restπction analysis and DNA sequencing. The completed vector was designated HL31 and could be excised from the bacteπal backbone as a Sail to Notl fragment Example 6 Preparation of HL31 for Transfection

To remove bacteπal sequences from the vector HL31 , it was digested with Sail and Notl to completion, extracted with phenol/chloroform, chloroform, and fractionated on a 1% Tns Acetate agarose gel The transgene was excised from the gel and electro-eluted in dialysis tubing containing 1 x Tns- Acetate buffer The eluted DNA was transfeπed into an eppendorf tube and precipitated by adding 1/10th volume 3M sodium acetate pH5 2, 2.2 volumes ethanol, and incubating at -20 degrees C for 24 hrs The DNA was collected by centnfugation at 13,000 x g for 10 minutes and resuspended in distilled steπle water The concentration of DNA was estimated by Tris-borate gel electrophoresis against a known quantity of lambda Hmdlll digested standard The DNA was stored at 4 degrees C. Example 7 Production of Chimeπc Transgemc Chickens

Developmental stage X chicken eggs from white leghorn chickens were obtained from a commercial vendor (Charles River/SPAFAS, North Franklin, CT) The eggs were allowed to acclimate for 24 hrs at room temperature prior to transfection to allow the germinal disc blastoderm to orient to the top of the egg. Using a dremel, a l-2cm circular cut was made in eggshell over the air sac region. Before proceeding, the transgene was prepared for injection at the following concentrations; DNA 5-15 ng/ 1, 10-15% phospholipid (Life Technologies, Grand Island, NY), 50% Dulbecco's Modified Eagles media, and the remaining volume with phosphate buffered saline. The DNA/lipid is allowed to stand at room temperature for a minimum of 15minutes prior to injection into the egg.

Just prior to injection, the eggshell was removed to expose the inner shell membrane and allow the visualization of the germinal disc. If the germinal disc could not be visualized a small opening was made in the membrane. Following location of the germinal disc, the DNA/lipid solution was injected directly into the center of the disc. Nucleic acid solutions (construct encoding human insulin) were injected in a volume of 50-100 1 with a lcc syringe and 27 gauge needle or in a volume of 10-20 1 with a microinjection needle attached to a Hamilton syringe. Table 6 shows data from representative experiments. 228 eggs were injected and 26 chicks were hatched (Table 6)

Table 6: Summary of Egg Injection Experiments

Chimensm of the hatched chicks was tested by PCR analysis of genomic DNA isolated from the inner shell membrane (post-hatching), or the liver, kidney, and reproductive organs upon necropsy (Table 7) Out of the 3 chicks tested in expenment 32, 2 showed a strong PCR signal in the inner shell membrane sample Upon maturation, these chicks are bred to confirm germhne transmission of the transgene PCR analysis of necropsy samples (membrane and reproductive organs) taken from 4 chicks deπved from expenments 32 & 33 revealed that 1 out of 4 chicks had detectable levels of the transgene its reproductive organs

Table 7 shows results from a representative analysis of tissue expression of human insulin transgene in chimeπc chickens produced as descnbed above Table 7 PCR analysis of Genomic DNA Isolated from Chimenc Chicks

Marker transgenes such as MT-beta-Gal, and CMV-GFP were also transfected into blastodermal cells in vivo Chicks were produced and tested for tissue expression of the transgene as descnbed above The transgemc DNA was detected in the following tissues which were tested heart, liver, and kidney

These data indicate that the methods and constructs descnbed herein are useful to transfect avian blastodermal cells and to make transgemc avian animals which produce a desired transgemc polypeptide Example 8 Method for the production of tetramenc antibodies

Unlike many pπor art methods for production of transgemc chickens, the methods of the invention do not utilize retroviral particles Many of those methods use non-rephcatmg retroviruses, which contain a gene of interest, to mfect a developing egg This process has several limitations which include a restnction on the size of the gene packaged in the viral coat, and instability of expression from retroviral vectors In addition, retroviral gene delivery is severely limited in its ability to produce high levels of multimeπc proteins since each coding region w ould optimally require its own promoter To circumvent this problem, some researchers have proposed the use of IRES sequences which allow for bicistromc mRNAs, howev er the expression from these types of constructs is generally low unless a selection marker is used

To overcome these drawbacks, a technology was developed which employs in vitro gene delivery methods to the creation of transgemc chimenc chickens This method has the advantage of being able to deliver a transgene of up to 100Kb and allows for high level production of multimeπc proteins such as antibodies The flexibility in vector design allows the construction of transgene similar to those used in the mammary gland expression system which employ full length promoters, genomic coding regions, and 3 'flanking regions The method descnbed herein utilizes the full 8Kb ovalbumin promoter, genomic or cDNA coding regions, and 3 'flanking sequence In addition, high level production of multimenc proteins is made possible because expression of each subumt is directed by its own promoter The transgenes are transfected individually or hgated together to ensure co-integration which greatly facilitates germhne transmission of all subumts (Step 1 and 2 of Fig 2)

To ensure the equal expression of both subumts of the antibody, the transgene is insulated from the effects of the surrounding chromatin structure by including elements such as matπx attachment regions (Step 3 of Fig 2) Unlike pπor art methods which have utilized matπx attachment region, the constructs descnbed herein result in equal expression of multimenc proteins The elements are called A-elements, MAR for matπx attachment regions, SAR, scaffolding attachment regions, DCR for dominant control region, and insulators Other features, objects, and advantages of the invention will be apparent from the descπption and from the claims In the specification and the appended claims, the singular forms include plural references unless the context clearly dictates otherwise Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and publications cited in this specification are incorporated by reference. Other embodiments are within the following claims.

Claims

What is claimed is-

1 A method of introducing a nucleic acid molecule into the genome of an avian species, compπsmg contacting in vivo a blastodermal cell of a fertilized egg with said nucleic acid molecule, wherein said nucleic acid molecule is not associated with a viral coat protem and wherein said nucleic acid molecule is introduced directly into the germinal disc of said egg in a volume of greater than 1 microhter and less than 0.5 milliliters.

2 The method of claim 1, wherein said volume is 5-100 microhters

3 The method of claim 1, wherein said volume is 40-60 microhters.

4. The method of claim 1, wherein said volume is 10-20 microhters

5. The method of claim 1 , wherein said nucleic acid molecule is introduced into said egg in a volume that is less than the volume of the germinal disc.

6 The method of claim 1 , further compπsing exposing said cell to an electncal cuπent in vivo

7 The method of claim 1 , wherein said avian species is selected from the group consisting of a chickens, an ostπch, an emu, a turkeys, a duck, a goose, a quail a paπot, a parakeet, a cockatoo, and a cockatiel

8. The method of claim 1, wherein said avian species is a chicken.

9. The method of claim 8, wherein the breed of said chicken is selected from the group consisting of White Leghorn, White Plymouth Rock, Baπed Plymouth Rock, Rhode Island Red, New Hampshire and Dark Cornish

10. The method of claim 1 , wherein said blastodermal cell is contacted with said nucleic acid duπng developmental stage X of said egg

1 1. The method of claim 1, wherein said blastodermal cell is contacted with said nucleic acid at a time after oviposition but before incubation of said egg.

12. The method of claim 1, wherein said nucleic acid comprises a sequence encoding an antibody or fragment thereof.

13. The method of claim 1, wherein said antibody or fragment thereof is human.

14. The method of claim 1, wherein said nucleic acid comprises a sequence encoding an insulin polypeptide, a growth hormone polypeptide, a calcitonin polypeptide, or a serum albumin polypeptide.

15. The method of claim 14, wherein said insulin polypeptide is a porcine single chain insulin polypeptide.

16. The method of claim 1, wherein said nucleic acid comprises a egg-specific transcnptional regulatory element.

17. The method of claim 16 wherein said regulatory element comprises a matrix attachment region of a chicken lysozyme gene.

18. The method of claim 17, wherein said region comprises a sequence from position - 1 1.7 to -8.8 or from position +5.3 to +9.0 of the chicken lysozyme gene.

19. The method of claim 17, wherein said region is operably linked to a sequence encoding an antibody chain or fragment thereof.

20. The method of claim 17, wherein said region is operably linked to a first sequence encoding an antibody light chain and a second sequence encoding an antibody heavy chain.

21. A transgenic avian animal, the genome of which comprises a nucleic acid sequence encoding a non-avian antibody polypeptide.

22. The animal of claim 21, wherein said sequence encodes a human antibody polypeptide.

23. A transgenic avian animal, the genome of which comprises a nucleic acid sequence encoding a non-avian insulin polypeptide.

24. A transgenic avian animal, the genome of which comprises a nucleic acid encoding a non-avian polypeptide, wherein said polypeptide is selected from the group consisting of a calcitonin polypeptide, a growth hormone polypeptide, and a serum albumin polypeptide.

25. An isolated avian blastodermal cell comprising a transgene encoding an antibody, an insulin, a growth hormone, a serum albumin, or a calcitonin polypeptide.