Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/67—General methods for enhancing the expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/10—Plasmid DNA
  • C12N2800/108—Plasmid DNA episomal vectors

Definitions

• the present invention relates to expression systems for the expression of recombinant DNA in mammalian cells using introns in the expression constructs.
• intron IN of the human ⁇ PY receptor Yl gene has been found to increase considerably the expression of D ⁇ A encoding a number of proteins previously able to be expressed only at very low levels.
• NPY Neuropeptide Y
• PP Pancreatic Polypeptide
• PYY Peptide YY
• NPY consists of 36 amino acids and is the most abundantly expressed member of this group.
• Poiypeptides of the NPY family are involved in the regulation of a wide variety of physiological processes and they exert their functions through a group of heptahelical G-protein coupled receptors.
• Six different NPY receptor subtypes, Yl to y6, have been identified by pharmacological means.
• the cDNA of five NPY receptors have been cloned and shown to encode proteins with limited but significant homologies at the amino acid level.
• the NPY y6 receptor In primates, the NPY y6 receptor is associated with a pseudogene and thus appears to be non-functional. When agonised, receptors in the NPY family are known to suppress induced adenylate cyclase activity and/or increase the concentration of intracellular calcium.
• NPY receptors mediate central as well as peripheral effects e.g. appetite regulation (Y5), adrenal cathecholamine synthesis (Y3) and release (Y2), gastrointestinal motility and secretion (Y4) as well as regulation of cardiovascular homeostasis (Yl and Y2).
• appetite regulation Y5
• adrenal cathecholamine synthesis Y3
• release Y2
• Y4 gastrointestinal motility and secretion
• Yl and Y2 cardiovascular homeostasis
• NPY receptors As a consequence of the central role of NPY receptors in fundamental physiological processes, achieving receptor specificity when developing drugs active on selected members of this family of receptors is a key issue in order to avoid undesired effects.
• the similarity between NPY receptor family members may be as low as 31 % overall homology (between Yl and Y2).
• NPY receptors may be stimulated by the same natural ligands, although with different rank orders of potency on different receptors. It is, therefore, of central importance to have access to pure sources of individual NPY receptors for the purpose of cross-screening.
• hYl cell lines Of the previously reported recombinant hYl cell lines, only one is of human origin (human embryonic kidney (HEK)-293 cells, Herzog et al. 1992) and four are hYl producing Chinese hamster ovary (CHO) cell lines (Herzog et al. 1992, Selbie et al. 1995, Matthews et al. 1997, Mannon and Raymond 1998). None of these cell lines produce sufficient levels of hYl protein to allow assays to be satisfactory performed.
• a transient expression system for hYl has been described that involves preinfection of HeLa cells with human vaccinia viruses followed by transfection of vaccinia virus based hYl expression plasmids (Walker et al. 1993, 1994).
• This system has the drawbacks of involving human viruses and the outcoming transfection efficiency is only about 10%.
• this system provides uncertain data due to low expression levels as published data has later been re-evaluated regarding NPY binding affinity of specific hYl mutants (Munch et al. 1995). Transient but unsatisfactory expression of hYl in COS1 cells (Larhammar et al. 1992) and HEK-293 cells (Tong et al. 1995) has also been reported.
• hYl in cell lines includes use of expression systems such as baculovirus infection of insect cells (Munoz et al. 1995) and hYl expression in E. coli (Herzog et al. 1994, Munch et al. 1995).
• Yl cDNA from other species such as rat and mouse may also be used to produce stable cell lines, since these cDNA can relatively easy be expressed in different mammalian cells
• the present invention relates to expression systems for the expression of recombinant DNA in mammalian cells using introns in the expression.
• intron IV of the human NPY receptor Yl gene has been found to increase considerably the expression of a number of proteins previously able to be expressed only at very low levels.
• the present invention provides an expression system for the expression of recombinant DNA encoding a human NPY receptor, comprising intron IV and functional equivalents thereof, of the human NPY receptor Yl gene.
• the DNA encodes either of human NPY receptor Yl, human NPY receptor Y5, or human K-casein.
• Intron IV and functional equivalents thereof could either be located between the DNA sequences constituting exon 2 and exon 3 of the human NPY receptor Yl gene, or positioned 5' of the DNA encoding the human NPY receptor.
• the said intron is replaced with a chimeric intron.
• an expression system for the production of proteins in transfected cells comprising an expression vector containing intron IN of the human ⁇ PY receptor Yl gene, or functional variants of the said intron.
• the protein is a human NPY receptor, preferably a human NPY receptor Yl, or human NPY receptor Y5.
• the protein is human K-casein.
• the intron is intron IV of the human NPY receptor Yl gene or a chimeric intron.
• the intron is either located between the DNA sequences constituting exon 2 and exon 3 of the human NPY receptor Yl gene, or positioned 5' of the DNA encoding the human NPY Yl receptor.
• the expression system could comprise a mammalian cell.
• the cell is selected from the group consisting of K562 cells, HEK-293 cells, and CHO-cells.
• the expression vector is the pCEP4 expression plasmid, and the expression vector may be selected from the group consisting of the following expression vector constructs: pCEP4-iYl, pCEP4-iYl-HA, pCEP4-5'iYl, pCEP4-31Yl, pCEP4-5'iY5, and pCEP4-5 'i-K-casein. More preferably, the expression vector is either pCEP4-iYl,or pCEP4-5'iYl.
• the expression vector construct is pCEP4-5 -ch- hYl.
• an expression vector for DNA encoding a NPY receptor wherein an intron is arranged so as to increase the level of expression of the DNA above the level of expression measurable in the absence of the intron under the same condition.
• the DNA encoding the NPY receptor is DNA encoding a human NPY receptor, preferably DNA encoding the human NPY receptor Ylor, DNA encoding human NPY receptor Y5.
• the intron is intron IV of the human NPY receptor Yl gene, or functionally variants of the said intron.
• the intron is preferably located between between the DNA sequences constituting exon 2 and exon 3 of the human NPY receptor Y 1 gene , or positioned 5 ' of the DNA encoding the human NPY receptor Y 1.
• the intron is a chimeric intron.
• an expression vector for the production of a NPY receptor wherein an intron is arranged so as to increase the level of production of the NPY receptor above the level of production measurable in the absence of the intron under the same condition.
• the NPY receptor is a human NPY receptor, preferably the human NPY receptor Yl, or the human NPY receptor Y5.
• the intron is intron IN of the human ⁇ PY receptor Yl gene, or functional variants of the said intron.
• the said intron is preferably located between between the D ⁇ A sequences constituting exon 2 and exon 3 of the human ⁇ PY receptor Yl gene, or positioned 5' of the D ⁇ A encoding the human ⁇ PY receptor Yl.
• the said intron is replaced with a chimeric intron.
• a host cell is transfected with an expression vector, said cell preferably being a mammalian host cell, and more preferably a host cell being a K562 cell, a HEK-293-cell, or a CHO cell.
• a further embodiment of the invention relates to a method of producing proteins of interest comprising, (a) providing DNA encoding a protein of interest with an intron, which provides increased production compared to the production measurable under the same conditions in a control method in which the intron is not used;
• the intron is either intron IV of the human NPY receptor Yl gene, or functional variants of the said intron, or a chimeric intron.
• the DNA is encoding either the human NPY receptor Yl, the human NPY receptor Y5, or human K-casein.
• the cell host is a mammalian host cell, and preferably either a K562 cell, a Human Embryonic Kidney-293-EBNAl cell, or a Chinese Hamster Ovary (CHO) cell.
• a further embodiment of the present invention relates to a method of screening compounds for NPY agonist or antagonist activity, comprising contacting the compound with the NPY receptor Yl produced by a method as described above.
• a further embodiment of the present invention relates to the use of intron IV of the human NPY receptor Yl, or functional variants thereof, in a method of enhancing expression of DNA of interest.
• the DNA is preferably selected from the group consisting of DNA encoding: human NPY receptor Yl, human NPY receptor Y5, and human K-casein.
• a further embodiment of the present invention relates to the use of intron IV of the human NPY receptor Yl, or functional variants thereof, in a method of enhancing production of protein of interest.
• the protein is preferably selected from the group consisting of : human NPY receptor Yl, human NPY receptor Y5, and human K-casein.
• hYl is intended to mean human Neuropeptide Y (NPY) receptor Yl and the term “intron IV of the human NPY receptor Yl” is intended to mean the 97 bp endogenous hYl intron spanning the coding sequence of the hYl gene ( Figure 1)
• intron TV of the human NPY receptor Yl. or functional variants thereof and “intron IV of the human NPY receptor Yl gene, or functional variants of the said intron” is intended to mean functional variants of the intron, which retain the expression enhancing activity of the native intron as defined below.
• increased level of expression is defined as the level of expression obtained with an expression system comprising an intron in relation to the level achieved in the absence of the intron under the same conditions.
• the level of increase is preferably at least 2x, more preferably at least lOx, or even more preferably at least lOOx.
• the level of expression of a certain DNA can be measured directly as the amount of the corresponding mRNA obtained or indirectly as the amount of the corresponding protein produced or as the amount of functional protein produced.
• an intron is defined as a DNA sequence comprising both a 3'- splice site and a 5 '-splice site as well an intervening DNA sequence.
• a 3 '-splice site has the sequence AG, and a 5 '-splice site the sequence GT.
• the amino acid sequences of the different human NPY receptors as well as the cDNA and genomic DNA sequences encoding the receptors are available in public databases like, Swiss Prot, EMBL, and GenBank, as exemplified for NPY Yl and NPY Y5 in the Table 1 below.
• the expression vectors according to the present invention can further be modified for the use in, not only mammalian cells, but also other eukaryotic cells, such as yeast cells and insect cells.
• CHO and K562 cell lines HEK-293-EBNA 1 , CHO and K562 cell lines were transiently transfected with the indicated pCEP4 expression vectors that are schematically depicted in Fig. 2.
• Vec-Co indicates transfection with pCEP4 without any cDNA inserted.
• Cells were harvested 72h (HEK-293-EBNA1), 48h (CHO) and 5 days (K562) post transfection and subjected to western blot analysis.
• hYl production is specifically detected using anti-hYl-IC4 antibodies and the ECL detection system.
• hY 1 migrates as high molecular weight complexes on SDS-PAGE, presumably due to multimerisation of the hYl receptor, which give rise to the characteristic hYl specific signal detected on western blot. Bands in the Vec-Co lane represents non-hYl related proteins recognised by the anti-hYl-IC4 antibodies.
• FIGURE 4
• hYl expression vectors (schematically depicted in Fig. 2) were transiently transfeced into CHO and K562 cell lines as described in Fig 3. hYl production was revealed on western blot using hYl-IC4 antibodies and ECL detection system.
• iYl-HA expression vector contain the 27 bp sequence encoding the HA epitope tag inserted into hYl intron IN.
• HEK-293-EBNA1 cells were transiently transfected with the indicated hYl expression vectors that are schematically depicted in Fig 2.
• Cells were harvested 72h post transfection and subjected to Western blot analysis as described in the description.
• hY 1 protein production levels were revealed by anti-hYl-IC4 antibodies and the ECL detection system.
• HEK-293-EBNA1 cells were transiently transfected with the indicated hYl expression vectors that are schematically depicted in Fig 2.
• Cells were harvested 72h post transfection and subjected to Northern blot analysis to reveal hYl mRNA expression (upper panel).
• hYl probed Northern blot filter was stripped and re-probed with b-actin to reveal variations in sample loading (lower panel).
• FIGURE 6 Generation of a stable HEK-293-cell line that produces high levels of hYl
• HEK-293 cells were transfected with pCEP4 or pCEP4-iYl (iYl). Clones that had stably integrated the respective expression construct into the genome were selected by growth in the presence of lOO ⁇ g/ml Hygromycin. A clone (627) expressing high levels of hYl was further characterised and compared to clone 716 (HEK-293 cells stably transfected with pCEP4) and the hY 1 expressing cell lines SKNMC and CHO-hY 1. (A) Western blot of cell lines 716, 627, SKNMC and CHO-hY 1. 200000 cells of each cell line were loaded in each lane and western blot analysis was performed as described in the description.
• hYl protein production levels is revealed by anti-hYl-IC4 antibodies and the ECL detection system.
• B Northern blot analysis of hYl mRNA steady state levels in cell lines 716, 627, SKNMC and CHO-hY 1. 10 ⁇ g of total RNA was loaded in each lane and Northern blot analysis was performed as described in the description. hYl probed filters (upper panel) were stripped and re-probed with ⁇ -actin (lower panel) to reveal differences in sample loading.
• C Specific [ 3 H]-NPY binding of 716, 627 and SKNMC was measured as described in the description.
• D NPY mediated inhibition of forskoline induced cAMP production in 627 and SKNMC cell lines.
• FIGURE 7 hYl intron IV mediated production of K-casein and hY5
• HEK-293-EBNA1 cells were transiently transfected with the indicated K-casein expression vectors that are schematically depicted in Fig 2. Cells were harvested 72h post transfection and subjected to western blot. K-casein protein production levels is revealed by anti-K-casein antibodies and the ECL detection system.
• B HEK-293-EBNA1 cells were transiently transfected with the indicated hY5 expression vectors that are schematically depicted in Fig 2. Cells were harvested 72h post transfection and subjected to western blot analysis as described in the description. hY5 protein production levels were revealed by anti-hY5 antibodies and the ECL detection system as described in the description.
• PCR reactions were performed at a Peltier thermal cycler-200 (SDS) using AmpliTaq, MgCl 2, dNTPs and lOxPCR provided by Perkin Elmer.
• Synthetic oligo nucleotides used as primers were synthesised on a oligo 1000 M DNA synthesiser (Beckman Instruments)
• a typical PCR reaction includes: 5 ng template, 20 pmole each of upstream and downstream primer, lx PCR buffer, 2 mM MgCl 2 , 2.5 mM dNTPs and 2.5 U AmpliTaq in a total volume of 50 ⁇ l and the PCR profile 94°C 4 min, 1 cycle; 94°C 1 min, 40-60°C 1 min depending on the hybridisation temperature of the primers used, 72°C 2 min, 38 cycles; 72°C 7 min, 1 cycle.
• PCR products and successful clonings were determined by DNA sequencing on an ABI Prizm 377 DNA Sequencer (Perkin Elmer). Sequence reactions were performed essentially as recommended in the Thermo Sequenase dye terminator cycle sequencing pre-mix kit (Perkin Elmer). A typical sequence reaction includes: 0.5 ⁇ g plasmid DNA to be sequenced, 10 pmole primer, 4 ⁇ l Big Dye terminator mix (Perkin Elmer), 4 ⁇ l sample buffer in a total volume of 20 ⁇ l. 3. Preparation of total RNA
• Frozen cell pellets (10 10 6 cells) were lysed in 6 ml GITC buffer (236.3g guanidinisothiocyanate, 25mM sodium citrate pH 7.0, 4.03 ml 2-mercaptoethanol to 500 ml with Rnase free water, sterile filtered and stored in aliquots in -20°C). Lysates were carefully added to RNase free SW41-TI tubes containing 4 ml sterile filtered CsCl solution (479.85g cesium chloride, 25mM sodium acetate pH 5.0 and 100 ⁇ M EDTA to 500ml with RNAse free water) followed by ultra centrifugation in SW41-TI swing out rotor at 32 000 rpm 23°C for 20h.
• GITC buffer 236.3g guanidinisothiocyanate, 25mM sodium citrate pH 7.0, 4.03 ml 2-mercaptoethanol to 500 ml with Rnase free water, sterile filtered and stored in
• RNA pellets collected in the bottom of the tube during ultra centrifugation, were dried for 30 min at +4°C before resuspension in 300 ⁇ l RNAsine solution (40U/ ⁇ l RNAsine (Promega), 1 mM DTT in DEPC treated water). RNA were precipitated in 0.3 M sodium acetate and 2.5 volumes of ice cold ethanol at -70°C over night and resuspended in RNAsine solution before loading on a formaldehyde-agarose gel. Typically, 10 10 6 cells resulted in 100-200 ⁇ g total RNA.
• RNA 10 ⁇ g of total cellular RNA was separated on a formaldehyde-agarose gel (lg agarose, 18 ml formaldehyde and 10 ml lOxMOPS (0.2M morpholinopropanesulphonic acid pH 7.0, 50 mM NaAc, 1 mM EDTA pH 8.0) at 120 V for approximately 3h.
• RNA was transferred to filter (Gene Screen Plus, NENTM Life Science Products) essentially as described in Sambrook et al., 1989.
• Filters were baked for 2h in a 80°C owen and prehybridised in 20 ml prehyb solution (5xSSPE (0.75 M NaCI, 50 mM NaH2PO4, 5 mM EDTA, pH 7.4), 50% deionised formamide, 1%SDS. 10% dextran sulphate, Pharmacia) for 5h at 42°C in a hybridisation oven (Hybaid hybridisation oven, Hybaid Limited UK).
• 32 P-labelled hYl and ⁇ -actin probes were synthesised as recommended in the MEGAPRIME DNA labelling kit (Amersham) using ⁇ 32 P-dCTP (100 ⁇ Ci) isotope.
• the 32 P-labelled probe was purified using Pharmacia G-50 column. Purified probe and sheared salmon sperm DNA (2.0 mg, SIGMA) were denatured and added to the prehybridisation solution followed by hybridisation over night at 42°C in a hybridisation oven. Filters were washed twice for 30 min in 2xSSPE (0.30 M NaCI, 20 mM NaH 2 PO 4 , 2 mM EDTA, pH 7.4), 1% SDS, wrapped in plastic and exposed in -80°C for selected time. Filters were stripped in 0.57c SDS stripping buffer (10 min 95°C, 10 min room temperature) before reprobed with ⁇ - actin (Gene Screen Plus, NENTM Life Science Products) as described above.
• Frozen cell pellets were resuspended in IxSDS-PAGE sample buffer (50ml 4x SDS-PAGE sample buffer: 12.5ml 1M TRIS-HC1 pH 6.8, 4g SDS, 20ml Glycerol, 10ml ⁇ mercaptoethanol, 0.2% bromphenolblue) to 8000 cells/ ⁇ l, heated to 70°C for 10 min, vortexed in room temperature with 25 Units of benzonase(Merck)/10 6 cells for 10 min, heated to 70°C for 10 min, vortexed for 10 min and centrifuged for 4 min to remove undissolved cell residues.
• IxSDS-PAGE sample buffer 50ml 4x SDS-PAGE sample buffer: 12.5ml 1M TRIS-HC1 pH 6.8, 4g SDS, 20ml Glycerol, 10ml ⁇ mercaptoethanol, 0.2% bromphenolblue
• Proteins were subsequently transferred to Immobilon P transfer membranes (Millipore) in a trans-blot electroporetic transfer cell (BioRad) for 2.5h at 500 mA and constant cooling in transfer buffert (25 mM Tris, 192 mM Glycine, 20% (v/v) methanol). Filters were stained in filter stain (0.05 % commassie briliant blue in 50% methanol) for 10 seconds and destined in filter destain (50% methanol, 10% acetic acid) to reveal transfer efficiency and putative transfer artefacts.
• transfer buffert 25 mM Tris, 192 mM Glycine, 20% (v/v) methanol.
• Filters were stained in filter stain (0.05 % commassie briliant blue in 50% methanol) for 10 seconds and destined in filter destain (50% methanol, 10% acetic acid) to reveal transfer efficiency and putative transfer artefacts.
• Filters were thereafter dried lh in room temperature followed by blocking in 5% fat free milk in TBS (10 mM Tris, 0.5 M NaCI) for 1.5h and incubation with primary antibody (a-hYl, a-hY5 or a-K-casein diluted to lO ⁇ g/ ⁇ l in ab-dil buffer: 15% fetal bovine serum, 150mM NaCI, 2.5 mM EDTA, 50 mM TRIS pH 7.5, 0.02% azid) over night at +4°C.
• TBS 10 mM Tris, 0.5 M NaCI
• primary antibody a-hYl, a-hY5 or a-K-casein diluted to lO ⁇ g/ ⁇ l in ab-dil buffer: 15% fetal bovine serum, 150mM NaCI, 2.5 mM EDTA, 50 mM TRIS pH 7.5, 0.02% azid
• NPY binding assays were prepared as follows: confluent cells were harvested with versene buffer to retain membrane proteins intact, washed twice in PBS, counted and resuspended in Krebs-Ringer buffer (KR:13.7mM NaCI, 2.7mM KCl, 2.1mM MgCl 2 x6H 2 O, 18 mM CaCl 2 x2H 2 O, 20mM Hepes, pH 7.4) containing 0.2% (w/v) bovine serum albumin (BSA, SIGMA) and 0.025% (w/v) bacitracin (SIGMA) to 10 10 6 cells/ml and stored in -70°C.
• BSA bovine serum albumin
• SIGMA bacitracin
• Binding assay was performed in binding buffer (KR + 0.2% BSA) for lh at 30°C in a total volume of 400 ⁇ l including lmilj. cells, 10 nM [ 3 H]-NPY (Amersham) with or without lOOOnM cold NPY (SIGMA) to reveal total and non-specific binding, respectively. Binding assays were diluted with ice cold KR and filtered through Whatman glass microfibre filters GF/C (25mm) prewetted in 0.3% polyethylenimin(SIGMA)/KR in a Millipore 12 wells filtration equipment.
• the competition binding experiments were performed using a filtration assay and I25 I-PYY (4000 Ci/mmol, Amersham Life Sciences) as the radioligand. 300 000 cells were used in each assay point. The cells were incubated in the absence or presence of 1 ⁇ M unlabelled hPYY to determine the total and non-specific PYY binding. The cells, radioligand, and agonists were diluted in Krebs Ringer buffer (137 mM NaCI, 2.7 mM KCl, 2.1 mM MgCl 2 , 1.8 mM CaCl , 20 mM Hepes; pH 7.4) containing 0.2 % bovine serum albumin (Fraction V, Sigma Aldrich).
• Krebs Ringer buffer 137 mM NaCI, 2.7 mM KCl, 2.1 mM MgCl 2 , 1.8 mM CaCl , 20 mM Hepes; pH 7.4
• bovine serum albumin Fraction V, Sigma Aldrich
• the antagonists were dissolved and diluted in DMSO in concentrations resulting in 1.5 % DMSO in each point.
• the final concentration of the radioligand was 20 pM.
• the antagonist BIBP 3226 is described in Doods et al. 1995.
• the incubation was performed, in 96 well plates, at 30°C for 60 minutes in a total volume of 200 ⁇ l per well.
• the incubation was stopped by rapid filtration through a polyethyleneimine pretreated GF/C filtermat using a Skatron cell harvester.
• the filtermats were washed with ice-cold Krebs Ringer buffer without BSA, dried, and scintillant
• SKNMC cells/well were cultured for 48h in 24 well plates to reach 80% confluence.
• Cells were washed 2 times with 37°C assay buffer (2.5 mM Tris, 2.5 mM HEPES, 140 mM NaCI, 5mM KCl, 1.8 mM CaCl 2 , 0.2% BSA, 4.5 g/1 glukos).
• 37°C assay buffer 2.5 mM Tris, 2.5 mM HEPES, 140 mM NaCI, 5mM KCl, 1.8 mM CaCl 2 , 0.2% BSA, 4.5 g/1 glukos.
• 440 ⁇ l IB MX buffer were added to cells (assay buffer containing 100 ⁇ M isobutylmethylxantine [BMX], SIGMA).
• Samples were resuspended in 500 ⁇ l assay buffer included in the cAMP enzymeimmunoassay system (dual range) kit (Amersham). Samples were further diluted in kit assay buffer (1/100) and 100 ⁇ l of diluted samples was used to measure the cAMP levels exactly as described in the cAMP enzymeimmunoassay system (dual range) kit. Data are expressed as % of forskoline induced cAMP production.
• 627-cells were harvested with versene buffer and 600 000 cells/well were cultured in 24 well plates (precoated with 1% gelatinin in PBS over night) for 24h to reach 70% confluence.
• Cells were serum starved for 12h in 860 ⁇ l medium without serum.
• 100 ⁇ l IMBX was added to give a final concentration of 100 ⁇ M and cells were incubated for 10 min at 37°C.
• Cells were stimulated for 15 min in 37°C by the addition of 20 ⁇ l each of forskoline (SIGMA) and NPY (SIGMA) diluted in serum free medium to give a final concentration of 3 ⁇ M forskoline and 100 or 1000 nM NPY.
• SIGMA forskoline
• NPY NPY
• the experiment was terminated by aspiration of the medium and cells were lysed by the addition of 1.2 ml lysis reagent lb provided by the cAMP enzyme-immunoassay system (dual range) kit. Cells were lysed for 15 min as recommended by the manufacterer and 100 ⁇ l of the cell lysate was used to measure cAMP levels exactly as described in the kit.
• the hYl cDNA was cloned from a lambda gtl 1 brain library, a component of the Quick ScreenTM Human cDNA Library Panel (Clontech), using PCR. Amplification was done in a 50 microliter reaction on a Perkin Elmer DNA Thermal Cycler 480 using AmpliTaq DNA polymerase according to the manufacturer's recommendations (Perkin Elmer). The following PCR primers designed based on the hYl cDNA sequence published by Larhammar et al.
• the inserts were subjected to nucleotide sequence analysis using a Thermo Sequenase dye terminator cycle sequencing pre-mix kit (Amersham) and an ABI Prism 377 DNA Sequencer (Perkin Elmer) according to the manufacturer's recommendations.
• This analysis revealed the unexpected presence of two differently sized hYl cDNAs in the human brain cDNA library. Sequence analysis identified the shorter form as being identical to the previously described human NPY Y 1 cDNA and the slightly longer form as being the same cDNA but with the addition of sequence corresponding to intron IV (abbreviated "i") of the hYl receptor gene. The corresponding plasmid was designated pAM68. Subsequent analysis of cDNA generated from mRNA isolated from various human tissues revealed the ubiquitous co-existence of these two distinct hYl messages. This is in agreement with a previous report (Gullestad et al. 1998).
• the human NPY Y5 receptor (hY5) cDNA (Hu et al.. 1996) was cloned in two parts from a human brain cDNA library by PCR using the following primer pairs:
• hYl expression constructs including 91bp of 5'hYl untranslated sequence (UTR) the pCRTMLI-5'UTR-hYl cloning intermediate were constructed.
• a part of the hYl cDNA, including 91 bp 5' untranslated sequence and the first 300 bp of coding hYl sequence was cloned from la da gtl 1 brain library (Quick ScreenTM Human cDNA Library Panel, Clonetech) using PCR and the hYl specific upstream primer: (5'- CGAAGCTTGGGAATAAGAATAAGCTGAAC -3') and downstream primer (5 ' -ACCCAGTGGTCCATTAATGTGTAGAC AAATGTAAAGG-3 ' ) .
• PCR fragment was purified on low melting agarose and inserted in pCR LI vector (Invitrogen) and the DNA sequence was confirmed.
• This plasmid was designated pAM127.
• hYl cDNA containing the endogenous hYl intron IV located 699 bp into the coding sequence of hYl (hiYl) and 91 bp of hYl 5'UTR (5 'UTR) were subcloned into pCEP4 (Invitrogen) using standard DNA manipulation techniques resulting in the plasmid pAM230. All hYl based expression vectors described below includes the 5'UTR sequence.
• pAM68 hYl cDNA containing the endogenous hYl intron TV in pCRTMH vector as described above
• pAM127 pCRTMLI-5'UTR-hYl as described above
• pCEP4 Invitrogen
• Accl/Accl 3' iYl fragment and the Hindm/Accl vector fragment were isolated on low melting agarose gel and included in a three fragment ligation reaction with HindLU/AccI 5'UTR-hYl fragment isolated from HindLH/AccI digested pAM127 to produce pCRTMLL -5'UTR-iYl (pAM219).
• Hindm/Notl 5'UTR-hiYl fragment isolated from pAM219 were subcloned into HindlLJ/Notl digested pCEP4 to generate the expression vector pCEP4-iYl (pAM223) as depicted in Fig. 2. Successful cloning was confirmed by nucleotide sequencing.
• pCEP4-Yl (pAM289) expression vector was constructed by three fragment ligation of Accl/Notl 3' hYl fragment isolated from Accl/Notl digested pcDN AI/NEO- Y 1 (Herzog et al., 1992), HindLH/AccI 5'UTR-hYl isolated from HindLLI/AccI pAM127 and HindLH/Notl digested pCEP4 vector.
• the pCEP4-Yl expression vector do not contain intron sequences. DNA fragments were isolated on low melting agarose gel before ligation. Successful cloning was confirmed by nucleotide sequencing.
• PCR reactions were performed as described above using the following PCR profile: 94° 4 min, 1 cycle; 94°C 1 min, 50°C 1 min, 72°C 2 min, 5 cycles; 94°C 1 min, 60°C 1 min, 72°C 2 min, 25 cycles; 72°C 7 min, 1 cycle.
• PCR 3 The PCR products from PCR reactions 1 and 2 were purified on low melting agarose gel and the appropriate bands were excised and used as templates in PCR 3 to insert the HA tag into the hYl intron TV. PCR reactions were performed as follows: 2 ⁇ l each of PCR 1 and 2 with the PCR profile profile 94° 4 min, 1 cycle; 94° 1 min, 48° 1 min, 72° 2 min, 6 cycles. 20 pmoles of upstream primer
• pCRTMLI-5'UTR-iYl-HA (pAM222) was constructed by three fragment ligation of Accl/ Accl 3' iYl-HA fragment and Hindm/Accl vector fragment isolated from HindL /AccI digested p AM218 together with Hindm/ Accl 5'UTR-hYl fragment from isolated from Hindm/ Accl digested pAM127.
• Hindm/Notl 5'UTR-iYl-HA fragment from pAM222 were subcloned into Hindm/Notl digested pCEP4 to generate the expression vector pCEP4-iYl-HA (pAM226) as depicted in Fig.2.
• Successful cloning of the final pCEP4-iYl-HA expression vector was confirmed by nucleotide sequencing.
• Preparation Example 7 Generation of pCEP4 based expression constructs pCEP4-5'iYl (5'iYl) and pCEP4-5'i R Yl (5'i R Yl)
• the hY 1 intron TV (97 bp) was amplified by PCR with upstream primer
• pCEP4-5'iYl the hYl intron IN is located 5' of the hYl cD ⁇ A and the splice sites are intact.
• the intron is inserted 5' of the hYl cD ⁇ A as in pCEP4-5'iYl but in the reverse orientation (i R ) rendering the splice sites non-functional.
• D ⁇ A fragments were purified on low melting agarose gels before included in ligation reactions and the D ⁇ A sequence of the introns in the final expression constructs were confirmed by D ⁇ A sequencing.
• Preparation Example 8 Generation of pCEP4 based expression construct pCEP4-3'iYl (3'iYl)
• the hYl intron IN (97 bp) was amplified by PCR with upstream primer #1348
• the 133 bp chimeric intron (donor site from the first intron of the ⁇ -globin gene and the branch and acceptor site from the intron of an immunoglobulin gene) contained in the commercially available pCI-neo vector (Promega) were amplified by PCR using upstream primer #1474 (5'- GGGGTACCGTAAGTATCAAGGTTACAAGACAGG-3') and downstream primer
• the cDNA encoding the hY5 receptor (hY5) was isolated as a 1364 bp HindHI/Sall fragment from the plasmid carrying the cloned hY5 cDNA (pAM 226 described above) and ligated into Hindm/Xhol digested pCEP4 resulting in pCEP4-Y5 expression vector (pAM408). Successful cloning was confirmed by nucleotide sequencing.
• the hYl intron TV was isolated as a Kpnl/Nhel fragment from pCEP4-5'iYl expression vector (pAM386) and introduced into Kpnl Nhel digested pCEP4-Y5 expression vector (pAM408) resulting in pCEP4-5'iY5 expression vector (pAM409) that have the hYl intron TV inserted 5' of the hY5 cDNA. Successful cloning was confirmed by nucleotide sequencing.
• K-casein cDNA was isolated as a 469 bp Sphl BamHI fragment from ⁇ S428, a pUC18 derivative carrying the K-casein cDNA (WO 93/15196).
• the pCEP4- K-casein expression vector (pAM413) was constructed by three fragment ligation of the annealed oligo fragment encoding the 5' of K-casein, the Sphl/BamHI 3' K-casein fragment and Nhel/BamHI digested pCEP4. Successful annealing of oligo nucleotides and the final K-casein expression vector were confirmed by nucleotide sequencing.
• the pCEP4-5'i- ⁇ -casein expression vector (pAM412) was constructed by replacement of hYl cDNA by K-casein cDNA in the pCEP4-5'iYl expression construct (pAM386) by a three fragment ligation including the annealed oligo fragment encoding the 5' of K-casein, the Sphl/BamHI 3' K-casein fragment isolated from pS428 and Nhel/BamHI digested pCEP4-5'iYl (pAM386), (large vector fragment).
• the hYl intron IV is located 5' of the K-casein cDNA.
• a synthetic peptide (CKQASPVAFKKTNNNDDNEKI) corresponding to amino acid residue 365-383 located in the C-terminus of hYl, the 4 th intracellular loop IC4, was made (KJ Ross-Petersen AS, H ⁇ rsholm, Denmark) and a subfraction conjugated to BSA by a cystein residue added to the N-terminus.
• BSA-conjugated peptide Two hundred micrograms of BSA-conjugated peptide was suspended in equal volume of Freund's complete adjuvant and administered to rabbits by s.c. and i.m. injections (AgriSera AB, Vannas, Sweden). Rabbits were boosted with 200 ⁇ g antigen after 2 weeks and then by 100 ⁇ g after 5 and 13 weeks. Boosters were regularly administered every 8 th week. Rabbit sera were continously collected from 2 weeks after the 3 rd injection and antibody titers determined by ELISA. IgG was isolated by chromatography on Protein G Sepharose according to the manufacturers recommendations (Pharmacia, Uppsala, Sweden).
• the hYl antisera was further purified on affinity columns made up of synthetic peptides coupled to a SulfoLink gel (Pierce, Rockford, 11, USA) by their cystein residues.
• the selectivity of the affinity purified polyclonal antisera for hYl was tested on Western blots containing lysates of cells producing recombinant human NPY Yl, Y2 and Y5 receptors, respectively.
• a polyclonal antibody specific for hY5 was made employing the protocol previously described.
• the following synthetic peptide, CLDEYYNKTLATENNTAATRN, corresponding to amino acid residues 5-24 located in the N-terminal domain of hY5 was conjugated to BSA and subsequently used to immunize rabbits.
• the selectivity of the affinity purified polyclonal antisera for hY5 was tested on Western blots containing lysates of cells producing recombinant human NPY Yl, Y2 and Y5 receptors, respectively.
• HEK-293 cells American Tissue Culture Collection CRL-1573
• Chinese hamster ovary cells Kl Chinese hamster ovary cells Kl
• HEK-293-EBNA1 cells Invitrogen
• CHO-hYl Herzog et al, 1992 was grown as described above but in the presense of 250 or 800 ⁇ g/ml G418 (Gibco BRL), respectively.
• SKNMC cells (American Tissue Culture Collection Number HTB-10) were maintained in MEM with Earle's salts, fetal bovine serum (FBS, 10%), penicillin/streptomycin (100 ⁇ g/ml), L-Glutamine (1.25 mM), Na-Pyruvate (1 mM) and non-essential amino acids (1/100, Gibco BRL).
• K562 (American Tissue Culture Collection Number CCL-243) was maintained in RPMI 1640 supplemented with fetal bovine serum (10%), penicillin/streptomycin (lOO ⁇ g/ml) and L-Glutamine (1.25 mM).
• Adherent cells were routinely trypsinated and splitted 1:7 when confluent.
• lx versene buffer lOx stock versene buffer: lg EDTA (diNa), 40g NaCI, lg KCl, 5.75g Na 2 HPO 4 , lg KH 2 PO 4 , lg Glucose (dextrose) dissolved in 500ml dH 2 O, sterile filtered.
• Medium was aspirated and 5 ml versene buffer/75cm 2 culturing flask was added.
• Lipofectin Reagent (LF) (Gibco BRL) was used for transient transfections of HEK-293- EBNAl cells following the manufacter's instructions. In brief, 50% confluent cells were harvested with versene buffer and 6 10 cells in suspension were incubated in 10 cm culturing dishes with 12 ⁇ g DNA of the appropriate expression vectors (see Fig. 2) and 24 ⁇ l LF in 6ml Opti-MEM (Opti-MEM 1 with Glutamax I, Gibco BRL) for 5h at 37°C. Transfection was terminated by addition of 6ml culturing medium containing 20% FBS.
• LF Lipofectin Reagent
• LF Lipofectin Reagent
• K562 cells were transfected by electroporation. 12.5 ⁇ g of the appropriate expression vectors (see Fig. 2), 5 ⁇ g pCMV-EBNAl (Invitrogen) and 25 ⁇ g carrier DNA in a total volume of 66 ⁇ l 0.15M NaCI was mixed with 500 ⁇ l K562 cells (20 10 6 /ml), incubated 5 min in room temperature and electroporated at 360V, 950 uF in a geneZAPPER 450/2500 electroporator (LB I). After electroporation, cells were incubated for 5 min in room temperature and transferred to 8 ml culturing medium for over night incubation.
• a geneZAPPER 450/2500 electroporator LB I
• cells 16h later, cells were recultivated in 25 ml selection medium (growth medium+500ug/ml Hygromycin) to kill untransfected cells and to favour episomal replication of the pCEP4 vectors. After 3 days of selection, live cells were separated from dead by separation on Ficoll-paque (Pharmacia) and recultivated in selection medium. 24h post ficoll separation cells were counted and cell pellets were stored in -70°C for western blot analysis.
• selection medium growth medium+500ug/ml Hygromycin
• DMRLE-C transfection reagent Gibco BRL was used for stable transfection of HEK-293 cells following the manufacters instructions.
• Cells were transfected with empty pCEP4 vector (vec-Co) and with pCEP4-iYl (iYl).
• vec-Co empty pCEP4 vector
• iYl pCEP4-iYl
• Transfection was performed by incubation of adherent cells with 12 ⁇ g DNA and 12 ⁇ l DMRLE-C in 6ml Opti-MEM for 5h at 37°C. Transfection was stopped by addition of 6ml culturing medium containing 20% FBS.
• Mammalian cells were transfected with an expression construct containing the full hY 1 coding sequence including intron TV located in its natural position (construct iYl; Figure 2A).
• the chosen design of this expression construct results in production of both, with respect to intron TV, spliced and non-spliced messenger RNA.
• the hYl intron TV located in its natural position within the hYl DNA contains an in-frame stop codon and would, if translated, encode a truncated hYl -like protein with only five transmembrane domains (5TM).
• Example 23 Expression of full hYl coding sequence including intron TV located in its natural position (construct iYl) in HEK-293-EBNA1. CHO cells and in K562 cells
• the iYl construct was subsequently used to transfect three different mammalian cell lines.
• the Western blots shown in Figure 3 clearly indicate that by including intron TV in the expression construct, a dramatic improvement in hY 1 receptor expression levels could be achieved in HEK-293-EBNA1, CHO as well as in K562 cells.
• the presence of the intron in the human Yl expression construct is likely to mediate high level hYl expression in any cell line.
• Example 26 Chimeric intron mediated production of hYl
• Example 27 Endogenous intron IV-mediated high level hYl receptor production over extended times in HEK-293 cells
• hYl receptors expressed by clone 627 were functional as evidenced by this cell lines ability to bind radiolabeled NPY ( Figure 6C) and to show NPY-induced inhibition of forskolin-stimulated cAMP production ( Figure 6D). As these properties of clone 627 have been maintained over a significant number of passages, our data demonstrate that the concept of intron-mediated hYl expression permits the generation of stable cell lines producing significant amounts of hYl.
• Example 28 hYl receptor Intron IV-mediated production of human K-casein and hY5 receptor
• Example 29 3 '-untranslated sequences It was observed that the 3' untranslated sequences contained in the iYl expression construct influence the hYl expression levels in transiently transfected cells.

Priority Applications (1)

Applications Claiming Priority (2)

Publications (1)

Family

ID=20415221

Family Applications (1)

Country Status (3)

Cited By (3)

Citations (5)

• 1999
  • 1999-04-15 SE SE9901339A patent/SE9901339D0/sv unknown
• 2000
  • 2000-04-14 AU AU43235/00A patent/AU4323500A/en not_active Abandoned
  • 2000-04-14 WO PCT/SE2000/000714 patent/WO2000063404A1/en active Application Filing

Patent Citations (5)

Also Published As

Similar Documents

Legal Events