WO2000049403A1 - Procede permettant l'identification d'un composant presentant une affinite pour le recepteur de la vitamine d - Google Patents
Procede permettant l'identification d'un composant presentant une affinite pour le recepteur de la vitamine d Download PDFInfo
- Publication number
- WO2000049403A1 WO2000049403A1 PCT/JP2000/000614 JP0000614W WO0049403A1 WO 2000049403 A1 WO2000049403 A1 WO 2000049403A1 JP 0000614 W JP0000614 W JP 0000614W WO 0049403 A1 WO0049403 A1 WO 0049403A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- group
- activity
- vitamin
- hydroxy
- dihydroxy
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/82—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving vitamins or their receptors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/59—Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
Definitions
- the present invention relates to a novel method for screening a vitamin D derivative having few side effects while retaining useful physiological activity, and more specifically, a vitamin D-reactive region (by a vitamin D receptor) of a test compound (A screening method that involves measuring the transcription-promoting activity via vitamin D responsive element (hereinafter referred to as “VDRE”) and the inhibitory activity on the transcriptional regulatory activity of specific transcription factors (others by vitamin D receptor). .
- a screening method that involves measuring the transcription-promoting activity via vitamin D responsive element (hereinafter referred to as “VDRE”) and the inhibitory activity on the transcriptional regulatory activity of specific transcription factors (others by vitamin D receptor).
- VDRE vitamin D responsive element
- the present invention also relates to a compound selected by the above screening method, and a medicament containing the compound.
- active vitamin D 3 derivatives exert physiological effects via vitamin D receptors.
- Bi evening Min D receptor since the small intestine, not only present in bone, kidney, tissue, such as parathyroid, exist in a variety of cells, including immune system cells or malignant tumor cells, active vitamin D 3 Derivatives have various physiological activities such as (1) calcium and bone metabolism regulation; (2) growth inhibition of malignant tumor cells, epidermal cells and epithelial cells; and (3) regulation of immune system cells. It is known to have.
- a protein involved in calcium absorption definitive the small intestine e.g., responsible for calcium ⁇ beam transport within intestinal epithelial cells calbindin -D (Calbindin- D) or by promoting transcription of the gene by binding to VDRE present in the promoter region of the gene (Ca-ATPase etc.) which has the function of transferring the absorbed calcium to the blood vessel side.
- Vitamin D receptor-based gene expression based on such transcription factor activity inhibitory action
- the adjustment mechanism is a Vita Completely different emission D receptor expression regulatory mechanism of gene coupled to V D R E, it has been suggested a mode of action not through binding to V D R E.
- An object of the present invention is to provide a method for screening a vitamin D derivative in which only a blood calcium elevating effect has been reduced or eliminated while maintaining a useful physiological activity.
- Another object of the present invention is to selectively provide a vitamin D derivative in which only a blood calcium elevating effect is reduced or eliminated while maintaining a useful physiological activity by using the above-mentioned screening method.
- Still another object of the present invention is to provide a therapeutic agent for a disease involving the action of a transcription factor whose activity can be inhibited by a vitamin D receptor, including the above-mentioned vitamin D derivative.
- Yet another object of the present invention is to provide a kit for performing the screening method according to the present invention.
- the present inventors have proposed a reporter gene assembly using a reporter gene vector having an AP_1 complex binding site in the promoter region and containing no VDRE, and binding of the NF- ⁇ B family to the promoter region.
- Vitamin D derivative inhibits expression of repo overnight gene without VDRE mediated in repo overnight gene using a repo overnight gene vector that has a site and does not contain any VDRE Was first confirmed.
- Side effect by retaining or enhancing the inhibitory action of other transcription factors by the activated biminmin D receptor, i.e., enhancing the selectivity for the inhibitory action of the transcription factor over that of VDRE-mediated transcription.
- mice lacking the function of the AP-1 complex or the NF- ⁇ B family as transcription factors are known to inhibit osteoclast formation. It can be assumed that a therapeutic effect on osteoporosis can be expected by inhibiting the activity of osteoporosis. Furthermore, the therapeutic effect of activated vitamin D derivatives on osteoporosis is not due to the previously thought mode of action of vitamin D receptor binding to VDRE to promote gene transcription, but to vitamin D receptor. It is thought to be caused by the action of inhibiting the activity of transcription factors such as the AP-1 complex or the NF- / B family.
- such a concept is not limited to vitamin D derivatives, and can be similarly applied to substances having affinity for vitamin D receptors.
- the present inventors have studied on the basis of the new concept described above to develop a screening system for searching for a vitamin D derivative having few side effects while retaining useful physiological activity.
- the transcription promoting activity of Vitamin D derivatives via VD RE is measured by a repo overnight genetic assay using a repo overnight genetic vector with VD RE.
- the inhibitory activity (pharmacological activity) of a transcription factor represented by the inhibitory activity of the AP-1 complex or the NF- / cB family is demonstrated.
- Reporter gene Atsusei using a reporter gene vector containing no, and a reporter gene using a reporter gene vector containing a NF- ⁇ B family binding site in the promoter region and containing no VDRE.
- ⁇ measured at the Tsu Si, 1, 2 5 selectivity for inhibitory activity of a transcription factor than dihydroxyvitamin D 3 is to select a high derivative screening We found grayed experimental system.
- the present invention in a screening method for a compound having an affinity for a vitamin D receptor, the transcription promoting activity of the test compound through the VDRE by the bimin D receptor and the test compound
- the present invention provides a method of measuring the activity of inhibiting a transcription factor by a vitamin D receptor, and selecting a compound having a stronger activity of inhibiting the activity of a transcript than the activity of promoting transcription through VDRE.
- the compound having affinity for the vitamin D receptor is preferably a bimin D derivative.
- preferred specific examples of the transcription factor are the AP-1 complex or the NF- ⁇ B family.
- the transcription promoting activity through VDRE is measured in the repo all-gene Atsushi system.
- the activity of the transcription factor to inhibit the activity is measured in a repo overnight gene access system.
- each of a test compound and a standard compound is measured for the VDRE-mediated transcription promoting activity and the activity inhibiting activity of a transcription factor, and the following formula: (Relative value compared to that of standard compound) (Relative value of transcription promoting activity of test compound through VDRE compared to that of standard compound) Compound satisfying> 1; particularly preferably, the following formula: (Test compound Relative value of the inhibitory effect of the transcription factor on that of the standard compound compared with that of the standard conjugate) / (Relative value of the VDRE-mediated transcription promoting activity of the test compound compared with that of the standard compound) ⁇ 10
- a compound that satisfies is selected as a compound that has a relatively stronger activity of inhibiting the activity of a transcription factor than the activity of promoting transcription via VDRE.
- the standard compound is 1 alpha, a 2 5-dihydroxyvitamin D 3.
- a vitamin D receptor selected by the above-described screening method, characterized in that the activity of inhibiting the activity of a transcription factor is relatively stronger than the activity of promoting transcription via VDRE.
- Compounds having an affinity for the body are provided.
- the selected compound having an affinity for the biminmin D receptor is preferably biminmin. D derivative.
- a disease involving a transcription factor whose activity is inhibited by a vitamin D receptor comprising a compound having an affinity for a vitamin D receptor selected by the screening method of the present invention.
- a non-limiting example of a disease involving a transcription factor whose activity is inhibited by the biminmin D receptor is a metabolic bone disease, especially osteoporosis.
- Preferred specific examples of the transcription factor involved in the disease targeted by the therapeutic agent of the present invention are the AP-1 complex or the NF- / B family.
- the therapeutic agent of the present invention can be specifically used as an activity inhibitor of the AP-1 complex mediated by the vitamin D receptor or an activity inhibitor of the NF- ⁇ family.
- V DR according to the screening method of the present invention.
- the present invention provides a therapeutic agent for osteoporosis comprising, as an active ingredient, a compound having a transcription promoting activity (relative value as compared with that of a standard compound) which is higher than 1).
- the compound has the following general formula (1):
- X represents an oxygen atom or a y-atom
- 1 ⁇ is a saturated or unsaturated aliphatic hydrocarbon group which may be substituted with a hydroxyl group or a protected hydroxyl group, or —C ⁇ R 12 group (formula Wherein R 12 represents an alkyl group, an aryl group or an alkoxy group), ⁇ ⁇ represents — ⁇ R 9 or a hydrogen atom, and R 3 and represent the same or different and represent a hydrogen atom or a protecting group) May be a vitamin D derivative represented by preferable. More preferably, R 2 is at least R 9 .
- 'R ⁇ is a group (2):
- R 5 and R 6 represent a hydrogen atom or a hydroxyl group, but R 6 does not become a hydroxyl group simultaneously with R 3 or R 4.
- .m represents an integer of 14 and n represents 0 to Represents an integer of 2) or group (3):
- R 5 and R 6 are the same or different and represent a hydrogen atom or a hydroxyl group.
- R 7 and R 8 together represent a hydrogen atom or a covalent bond.
- P represents an integer of 1 to 3
- Q represents an integer of 0 to 2). More preferably, is a 3-hydroxy-3-methylbutyl group.
- the 20-position may be in an S configuration or an R configuration.
- vitamin D derivative represented by the general formula (1) examples include 1,3-dihydric oxy-20- (3-hydroxy-3-methylbutylthio) -9,10-secob regna-1,7, 10 (19), 16-tetraene, la, 3) 3-dihydroxy-20 (S)-(3-hydroxy-3-methylbutylthio) -9,10-secop flick ⁇
- FIG. 1 shows the results of screening for transcription promoting activity via VDRE and inhibitory activity for AP-1 complex.
- FIG. 2 shows the results of screening for transcription promoting activity through VDRE and inhibitory activity against NF_ ⁇ B family.
- FIG. 3 is a graph showing the effects of a bimin D derivative (subcutaneous administration) on urinary calcium excretion, blood calcium concentration and bone density.
- FIG. 4 is a graph showing the effect of a bimin D derivative (oral administration) on urinary calcium excretion, blood calcium concentration and bone density.
- FIG. 5 is a graph showing the effects of vitamin D derivatives (oral administration) on blood Ca level, urinary exoxypyridinoline (Dpyr) excretion, bone density, and bone strength.
- the substance to be screened in the method of the present invention is not particularly limited as long as it is a compound having an affinity for the vitamin D receptor, but is generally a vitamin D derivative, particularly a vitamin D 3 derivative, and particularly preferably a vitamin D 3 derivative. it is an active vitamin D 3 derivatives.
- the vitamin D derivative include the vitamin D derivative represented by the general formula (1) described above.
- the saturated aliphatic hydrocarbon group generally represents a linear or branched alkyl group having 1 to 15 carbon atoms, such as a methyl group, an ethyl group, an n-propyl group, and an i-propyl group.
- the unsaturated aliphatic hydrocarbon group generally represents a linear or branched alkenyl group or alkynyl group having 2 to 15 carbon atoms, such as a 2-propenyl group, a 2-butenyl group, 3-butenyl group, 2-pentenyl group, 3-pentenyl group, 4-pentenyl group, 2-hexenyl group, 3-hexenyl group, 4-hexenyl group, 5-hexenyl group, 2-heptenyl group , 3-heptenyl group, 4-heptenyl group, 5-heptenyl group, 6-heptenyl group, 2-propynyl group, 2-butynyl group, 3-butynyl group, 2-pentynyl group, 3-pentynyl group, 4 1-pentynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl, 2-heptynyl, 3-
- a 4-methyl-2-pentynyl group, a 4-ethyl-2-hexynyl group, a 4-methyl-2-pentenyl group, a 4-ethyl-2-hexenyl group and the like are exemplified.
- the saturated or unsaturated aliphatic hydrocarbon group which may be substituted with a hydroxyl group is a group wherein any hydrogen atom of the above-mentioned saturated or unsaturated hydrocarbon group may be substituted with one or more hydroxyl groups.
- the number of substituted hydroxyl groups include 0, 1, 2, 3 and the like, preferably 1 or 2, and more preferably 1. Specific examples include the above-mentioned aliphatic hydrocarbon group, 2-hydroxy-2-methylpropyl group, 3-hydroxy-2-methylpropyl group, 2,3-dihydroxy-2-methylpropyl group, and 2-hydroxy-2-methylpropyl group.
- (n-propyl) —3-nonenyl group 5-hydroxy-6-methyl-2-heptenyl group, 6-hydroxy-6 —methyl-2-heptenyl group, 7-hydroxy-6-methyl-2-heptenyl group, 5, 6— Dihydroxy-6-methyl-2-heptenyl group, 5,7-dihydroxy-6-methyl-2-heptenyl group, 6,7-dihydroxy-6-methyl-2-heptenyl group, 6-ethyl-5-hydroxy-2- Octenyl group, 6-ethyl-6-hydroxy-2-octenyl group, 6-ethyl
- 6-dihydroxy-1 6 _ (n-propyl) 1-3-noninyl group, 5, 7-dihydroxy-6- (n-propyl) 1-3-noninyl group, 6, 7-dihydroxy-6
- (n-propyl) 1-3-noninyl group 5-hydroxy-6-methyl-2_heptynyl group, 6-hydroxy-6-methyl-2-heptynyl group, 7-hydroxy-1-6-methyl-2-heptynyl group , 5,6-dihydroxy-6-methyl-2-heptynyl group, 5,7-dihydroxy-6-methyl-2-heptinyl group, 6,7-dihydroxy-6-methyl-2-heptynyl group, 6-ethylyl group 5-hydroxy-2-octynyl, 6-ethyl-6-hydroxy-2-octynyl, 6-ethyl
- the alkyl group generally means a linear or branched alkyl group having 1 to 15 carbon atoms, preferably 1 to 8 carbon atoms
- the aryl group generally means an alkyl group. It means an aryl group having 6 to 20 carbon atoms, preferably 6 to 14 carbon atoms
- an alkoxy group generally has 1 to 15 carbon atoms, preferably 1 to 8 carbon atoms.
- a chain or branched alkoxy group is meant.
- the protecting group includes an acyl group, a substituted silyl group, a substituted alkyl group, and the like, and is preferably an acyl group or a substituted silyl group.
- acyl group '' means a substituted carbonyl group
- ⁇ substituent of a carbonyl group '' as used herein means a hydrogen atom, a lower alkyl group which may have a substituent, or a substituent.
- the phenyl group is preferably a formyl group, a lower alkyl carboxy group, a phenylcarbonyl group optionally having a substituent, a lower alkyloxycarbonyl group, a phenylalkyloxycarbo group optionally having a substituent. And more preferably a formyl group, an acetyl group, a propionyl group, a butyryl group, a bivaloyl group, a benzoyl group, a methoxycarbonyl group, an ethoxycarbonyl group, a t-butoxycarbonyl group, a benzyloxycarbonyl group, or the like. Show.
- the substituted silyl group means a silyl group substituted by a lower alkyl group which may have one or more substituents or an aryl group which may have a substituent, and is preferably 3-substituted.
- Preferred examples of the substituted silyl group include a trimethylsilyl group, a triethylsilyl group, a triisopropylsilyl group, a t-butyldiphenylsilyl group, and a t-butyldimethylsilyl group.
- the substituted alkyl group refers to an alkyl group substituted with one or more substituents.
- preferred examples of the substituent include an alkyloxy group which may have a substituent and an alkyloxy group which may have a substituent. Examples include good aryl groups, and in particular, an alkyloxy group which may have a substituent.
- Examples of the substituted alkyl group substituted with an alkyloxy group which may have a substituent such as an alkyloxy group include, for example, methoxy In addition to a methyl group and a 2-methoxyethoxymethyl group, a tetrahydropyran-1-yl group and the like can be mentioned.
- substituents examples include a halogen atom, a cyano group, a nitro group, an amino group, a hydroxyl group, an alkyl group, an alkyloxy group, an acyloxy group, and a sulfonyl group.
- the compound wherein X is a zeo atom can be produced, for example, by the method described in JP-A-10-231284.
- the compound which is an active ingredient of the therapeutic agent for osteoporosis of the present invention includes 1,3-dihydroxy 20- (3-hydroxy-3-methylbutylthio) -19,10-secopregna-5,7,10 (19), 16-tetraene, 1 ⁇ , 3 j3-dihydroxy-20 (S) 1- (3-hydroxy-3-methylbutylthio) 1,9,10-secopregna 5,7,10 (19), 16-tetraene, 1 ⁇ , 3 / 3-Dihydroxy-20 (R)-(3-hydroxy_3-methylbutylthio) -1-9,10-secopredana-5,7,10 (19), 16-tetraene, 1 ⁇ , 3/3 —Dihydroxy-1 20 (R) ⁇ (( ⁇ ) —4-Hydroxy-4-methyl-2-pententhio) 1,9,10-Secopredana-5,7,10 (19), 16-Tetraene, 1 ⁇ , 33 —Dihydroxy-1-
- VDRE is a type of regulatory sequence on DNA that activates the expression of downstream genes by the action of a vitamin D receptor bound with a ligand such as a vitamin D derivative. .
- a vitamin D derivative such as a vitamin D derivative.
- hypercalcemia a side effect of vitamin D, is thought to occur through VDRE.
- the DNA base sequence of VDRE may vary depending on the species of organism, and the type of gene to be regulated among the same species of organism, but in the present invention, any VDRE sequence may be used. I do not care.
- VDRE sequence of the mouse osteopontin gene was used for screening in a reporter gene assembly system, but this is only an example of the VDRE sequence.
- Other VDRE sequence for example, rat O stearyl Okaru Shin gene, Hito stearyl Okaru Shin gene, rat calbindin one D 9K gene, human calbindin one D 9K gene, mouse calbindin - D 28K gene, rat 24- Examples include a hydroxylase gene, a human 24-hide mouth xylase gene, and a chicken integrin 33 gene, which can also be used in the method of the present invention.
- a transcription factor generally means a protein factor required for a transcription reaction from DNA to RNA in the nucleus, and in the present invention, specifically recognizes a specific base sequence upstream of a specific gene. Means a factor that controls the expression of that gene by binding to it.
- the type of the transcription factor used in the screening method of the present invention is not particularly limited as long as the activity is inhibited by a vitamin D receptor.
- transcription factors are AP-1 complex, NF- ⁇ — family one, Spl Family 1, Oct family, ATF / CREB family 1, NF—AT family 1, ST AT family 1, Egr family 1, etc., and more preferably used in the following examples in the present specification.
- the AP-1 (activator protein-1) complex is a homodimer of the Jmi family, and is composed of a heterodimer of the Fos family and the Jun family, and binds to the TRE sequence, the AP-1 binding site. Is a factor.
- Jun family c-Jun, JunB, and JunD force The Fos family, c-Fos, FosB, Fra-1, and Fra-2 have been identified.
- Genes having an AP_1 binding site include interleukin-1, 1, interleukin-2, interleukin-1, 5, GM-CSF, TNF-string and other adhesion molecules, and ICAM-1 and other adhesion molecules. Enzymes such as collagenase are known, and reporter gene accessions using the AP-1 binding site of these genes are also available.
- the DNA sequence of the AP-1 binding site may vary depending on the species of the organism and the type of gene to be regulated among the same species of organisms. An arrangement of sites may be used.
- the NF— ⁇ B (nuclear factor- ⁇ ) family 1 is a transcription factor that is composed of a dimer of the Re1 family 1 and binds to the NF— / B binding site ⁇ B sequence.
- NF— / cB p50, NF— ⁇ 52, NF— ⁇ 65 (R e1A) c-R e1 and R e1B have been identified.
- Genes having the NF— / cB binding site include Inle-Ileukin-11, Interleukin-12, Interleukin-16, Interleukin-18, TNF—Human cytoin, ICAM—1
- Adhesion molecules such as VCAM-1 and VCAM-1 are known, and reporter gene assemblies using the NF- ⁇ binding site of these genes are also available.
- the DNA base sequence of the NF- / B binding site may vary depending on the species of the organism and the type of the gene to be regulated among the same species of organism, etc., in the present invention, any NF- ⁇ The sequence of the B binding site may be used.
- the vitamin D receptor is active on transcription factors.
- One feature is to determine whether or not it exhibits a sex-inhibitory effect.
- it may be possible to show an activating effect (activity-promoting effect) instead of an activity-inhibiting effect. Therefore, when such a transcription factor is used, an activity promoting action rather than an activity inhibiting action is measured, which is also within the scope of the present invention.
- the AP-1 complex causes bone destruction by binding to the AP-1 binding site and activating the expression of a gene downstream thereof. Therefore, if the activation of the AP-1 complex can be inhibited by the vitamin D receptor in a state where the vitamin D derivative is bound, it is considered that the expression of the above-mentioned genes that lead to bone destruction can be inhibited. .
- an activator of the expression of a gene that is considered to be involved in the development or progression of any disease such as bone destruction or inflammation is identified, it is possible that the action of the activator can be inhibited by the vitamin D receptor.
- the transcription factor in the present invention is preferably one that is involved in the onset or progression of any disease such as bone destruction or inflammation.
- Measurement of the VDRE-mediated transcription promoting activity and the activity inhibiting activity of transcription factors can be performed by any method known in the art, and the method is not particularly limited.
- the repo overnight gene access method is used.
- the reporter gene assay method is, for example, constructing a vector in which a VD RE sequence, a promoter sequence and a suitable reporter gene are ligated in this order, and a vitamin D receptor expression vector, respectively. After transfection of these vectors simultaneously, the test substance is added, the cells are cultured, and the expression level of the reporter gene in the cells is measured to evaluate the VDRE-mediated transcription promoting activity of the test substance. How to
- the type of host that transfects the vector containing the repo overnight gene is also The present invention is not limited to this, and those skilled in the art can appropriately select a suitable host commonly used in the art.
- Non-limiting examples of host cells include Jurkat in human-derived cells
- the method for transfecting the vector into the host is not particularly limited, and those skilled in the art can appropriately select from methods commonly used in the art.
- Non-limiting examples of the transfusion method include the calcium phosphate method, the DEAE-dextran treatment method, the electro evaporation method, the lipofection method, and the like.
- a reporter gene is a marker gene that is incorporated into DN ⁇ to examine the transcriptional activity of promoters, etc., and is not particularly limited as long as its expression level can be measured. Generally, those that are easy to detect and can be quantified are preferred.
- a gene for an enzyme that catalyzes a color-forming or luminescent reaction is suitable.
- the amount of the enzyme expressed by measuring the degree of color development exhibited by adding a substrate for the color-forming reaction to the cell lysate, That is, the transcription promoting activity can be evaluated.
- the expression level of the reporter gene can also be measured by quantifying the protein with an antibody using the ELISA method or the like.
- reporter genes include the CAT (chloramphenicol acetyltransferase) gene, the Luc0 luciferase) gene, the] 3—Gai (j3-galactosidase) gene, and hGH (secretory human growth). Hormone) gene, SEAP (human secreted alkaline phosphatase) gene, GFP (green fluorescent protein) gene and GUS (3-Dark mouth nidase) gene.
- CAT chloramphenicol acetyltransferase
- Luc0 luciferase the] 3—Gai (j3-galactosidase) gene
- hGH secretory human growth.
- Hormone SEAP (human secreted alkaline phosphatase) gene
- GFP green fluorescent protein
- GUS 3-Dark mouth nidase
- CAT gene as reporter gene
- the base sequence of the regulatory region whose transcriptional activity is to be measured is introduced into the cell by transfection with a reporter gene that connects the upstream of the CAT gene.
- a reporter gene that connects the upstream of the CAT gene.
- a cell extract is prepared after 12 to 72 hours and acetyl C o A and chloramphenicol are added and reacted, and the acetylated chloramphenicol is separated and identified by thin-layer chromatography. That is, in the CAT assay, the transcription activity of the gene is measured as the enzyme activity of acetylating chloramphenic acid.
- Luciferase has the formula:
- luciferase As a repo-even gene, it is possible to evaluate the luciferase expression level by giving a substrate extract and oxygen to the cell extract to cause a luminescence reaction and measuring the degree of luminescence.
- the reporter gene accession method as described above can be performed by a conventional method known to those skilled in the art, for example, described in S. KNordeen, Biotechniques, Vol. 6, pp. 454-456, (1988). it can.
- the reporter gene attachment method can be carried out simply using a reporter gene attachment reagent commercially available from Boehringer Mannheim, Clontech or Promega, and according to the instructions.
- Alternative methods for evaluating the transcription-promoting activity or the activity-inhibiting activity of transcription factors include, for example, the gel shift assay, the run-on assay and the run-of-run assay. Is mentioned.
- the gel shift assay is a simple and effective method for examining the binding factor of DN N.
- the principle is that when DNA is reacted with a DNA-binding factor and then electrophoresed on a non-denaturing polyacrylamide gel, the mobility of the DNA bound to the protein is lower than that of the unbound DNA. Therefore, it is detected using labeled DNA.
- the Riin-0n Atssay method is another method for examining the transcriptional activity of a specific gene.
- transcription synthesis is performed in the tester using nuclei isolated from cells, new synthesis from the transcription start site does not occur, and continuation of the RNA strand that has already started transcription in the cell state However, only a synthesis reaction in which the RNA is elongated is observed. Therefore, in a system using an isolated nucleus, the transcript is labeled with radioisotope, and from the labeled RNA, A gene to be examined is selectively detected by a probe. This makes it possible to measure the transcriptional activity at the time of isolating the nucleus of a specific gene, and to compare and examine the change over time and the relative amount of transcription.
- the Run-0ff Atssey method is also one of the in vitro transcription methods, in which type II DNA is linearized to synthesize a transcript of a fixed length.
- Type ⁇ DNA is obtained by cutting a few hundred bases downstream of the transcription start site with a restriction enzyme.
- the RNA polymerase dissociates from the type II DNA at the cleavage site and the transcription reaction is stopped, so that RNA of a certain length is formed.
- the labeled ribonucleotide is inserted during the reaction, the RNA is labeled, and after electrophoresis, an autoradiogram is prepared to measure the amount of RNA.
- a compound having a relatively stronger activity of inhibiting the activity of a transcription factor than the activity of promoting transcription via VDRE is selected. This is V D
- the inhibitory effect of transcription factor activity is stronger than that of RE-mediated transcription promoting activity, useful physiological activities such as bone mass increase are achieved in places where there is no or weak blood calcium elevation which is a side effect of vitamin D derivatives. It is based on the prediction that it will occur. Therefore, the selection of the selectivity for the activity inhibiting activity of the transcription factor in the screening can be appropriately selected according to the use of the selected compound, and should be limited to a specific value. is not.
- a standard substance can be used as a criterion for evaluating the selectivity for the activity inhibiting effect of a transcription factor.
- the type of the standard substance is not particularly limited, and any substance can be appropriately used. For example, if 1,25-dihydroxyvitamin D 3 is used as a standard substance and a compound having a higher selectivity for inhibiting the activity of a transcription factor than this standard substance is selected, an advantageous compound with less side effects will be searched for. be able to.
- each test substance is measured by measuring the EC50 value or IC50 value of each test substance. It is possible to evaluate the substance's VDRE-mediated transcription promoting activity or transcription factor activity inhibitory effect.
- the selectivity of a transcription factor for inhibiting the activity is expressed by the following formula: [Relative value of the test compound's inhibitory effect on transcription factor activity compared with that of a standard substance (eg, 1,25-dihydroxyvitamin D 3 )] Z [The transcription promoting activity of the test compound via VDRE (Eg, relative to la, 25-dihydroxyvitamin D 3 )]
- the transcription factor is higher than that of the standard (eg, 1 ⁇ , 25-dihydroxyvitamin D 3 ). It can be evaluated as a compound having high selectivity for the activity inhibitory effect of the compound.
- a novel compound having an affinity for the biminmin D receptor selected by the screening method of the present invention is provided.
- Such a compound is useful as a therapeutic agent for a disease associated with the onset or progress of transcription factor activity.
- Examples of diseases in which transcription factor activation is involved in the onset or progression include metabolic bone diseases (eg, osteoporosis, renal osteodystrophy), various inflammations (eg, rheumatoid arthritis, osteoarthritis) , Asthma, arteriosclerosis, organ transplantation, various tumors (for example, colorectal cancer, breast cancer, ATL), diabetes, myocardial infarction and the like.
- metabolic bone diseases eg, osteoporosis, renal osteodystrophy
- various inflammations eg, rheumatoid arthritis, osteoarthritis
- Asthma arteriosclerosis
- organ transplantation for example, colorectal cancer, breast cancer, ATL
- tumors for example, colorectal cancer, breast cancer, ATL
- diabetes myocardial infarction and the like.
- the dosage form is not particularly limited, and may be tablets, capsules, dispersants, solutions, suspensions, It can take any form such as an emulsion.
- the administration route may be oral or parenteral.
- parenteral administration any administration route such as intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, or external use can be used.
- the dose is not particularly limited, and can be appropriately set according to the patient's weight, sex, degree of medical condition, and the like. Generally, the dose is 0.001 ⁇ gZkgZ days to 1000 gZkgZ days, preferably 0.01 g. g / kg / day to 10 Oig / kgZ day, more preferably 0.1 g gZkgZ day to 10 gZk gZ day.
- the number of administrations is not limited, and the above dosage may be administered once a day or divided into several times, and the administration period is several days to several weeks or several weeks to several months. be able to.
- a vector for evaluating the activity inhibitory effect of a transcription factor containing a reporter gene, a VDRE-mediated transcription promoting activity containing a repo overnight gene comprising a vector for evaluating the expression of a vitamin D receptor expression vector, if desired, and a reagent for detecting the product of the repo all-over-one gene.
- one of a vector for evaluating the inhibitory activity of a transcription factor or a vector for evaluating a VDRE-mediated transcription promoting activity can be prepared on host cells cultured under appropriate conditions.
- the vector and the Vitamin D receptor expression vector are transfected simultaneously, the test compound is added, the cells are cultured appropriately, and the cell lysate is collected to prepare a reagent for detecting the reporter gene product. Evaluating the expression level of the reporter gene by using it can facilitate screening of test substances.
- transfection of the bimin D receptor expression vector is not necessarily required.
- the luciferase cassette vector (pXP2; as described in S. Nordeen, Biotechniques, Vol. 6, pp. 454-456, (1988)) was inserted into the promoter region of the human IL-12 gene (p72). +47) was constructed, and a reporter gene vector having an AP-1 binding sequence was constructed using the AP-1 binding sequence (ATGAGTCAG) of the human collagenase (MMP-1) gene. 5 tandem insertions with NF- ⁇ — binding sequence reading
- NF- ⁇ binding sequences CAGAGGGGACTTTTCCGAGA
- human immunoglobin light chain ⁇ gene four NF- ⁇ binding sequences (CAGAGGGGACTTTTCCGAGA) of the human immunoglobin light chain ⁇ gene were inserted in tandem, and used as each reporter gene vector.
- Rat vitamin D receptor expression vector is a rat vitamin D receptor cDNA (James K. B rmester et al., Proc. Natl. Acad. Sci. USA, Vol. 85, pp. 9499-9502, (1998) Used in PSG5 (STRATAGENE).
- Reporter gene having a AP-1 binding sequence or NF-zB binding sequence
- Jurkat cells were cultured in RPMI-1.640 (GIBCO BEL) containing 10% FBS and antibiotics. The culture was started at a density of 5 ⁇ 10 4 ce 11 s ZmL, and the cells were passaged every 3 or 4 days so that the cells were 5 ⁇ 10 ce 11 s ZmL. Conditions of culture is 37 ° C, 5% C0 2 .
- the transfection of the repo overnight gene vector was performed on 3 to 5 ⁇ 10 6 Jurkat cells using solution A (LI POFECT AMINE (GIBCO BRL) 5 L, OPT I-MEM I ( (GIBCO BRL) 0.5 mL) and Solution B (OPT I-MEM I 0.5 mL containing 1 g each of the reporter gene vector and the rat biminmin D receptor expression vector). After mixing, the mixture was left at room temperature for 30 minutes. During that time, the cells were washed twice with serum-free medium.
- Vitamin D derivatives were diluted to a vehicle (RPI-1640 containing 2% ethanol, 10% FBS and antibiotics) to prepare a 20-fold concentration.
- Vehicle was added at 10 / i1 / well).
- the vitamin D derivatives tested were 28 compounds (ie, Compound No. 1 to Compound No. 28) whose structures are shown below.
- 1 ⁇ , 25_dihydroxyvitamin D 3 was used as a standard substance.
- the plate was centrifuged (1500 rpm, 1.5 minutes) to remove the culture supernatant.
- the cells were lysed in a 20-well repo overnight lysis buffer (Report Lys ls Bu ff fer, Promega), and the whole amount was used for Lucifer error assay.
- 100 L of Luciferase assay reagent (Promega) was added to the above cell lysate, and the fluorescence intensity was measured for 5 seconds with a luminoscin RS (Lab systems).
- IC37.5 of each vitamin D derivative based on the measured value of luciferase Values were calculated to evaluate the inhibitory activity against the AP-1 complex and the NF- ⁇ family. 100% of the measured value of the control without adding the derivative? As the transcriptional activity of the -1 complex or the NF- ⁇ family, the dose at which 37.5% inhibition by each derivative occurred was calculated as an IC 37.5 value.
- the resulting I C37 Shows the result of displaying the five values as a percentage against the values of 1 o ;, 25-dihydroxyvitamin D 3 in Table 1 below. “One” in the table indicates that the test was not performed.
- the VDRE-bearing repo gene vector can be used to transform the mouse osteoponten gene VDRE (GGTTCACGAGGTTCA) into the heron / 3-globin mouth motor region (109 / + 10) and CAT (chloramphenicolur).
- a cassette vector (pGCAT; Kato S et al., Cell (1992) ⁇ a 731-742) containing cetyl transferase) was used.
- PCH110 (Pharmacia) was used as the expression vector for the -3-galactosidase used for correcting the transfection efficiency.
- BSM B1uescrivEM13 +: STRATAGENE
- the rat ubimin D receptor expression vector used was a cDNA of the rat ubimin D receptor integrated into pSG5 (STRATAGENE).
- COS-1 cells are in DMEM medium containing 5% FBS and 10 nM insulin In cultured and passaged at a density of 1500 ⁇ 3000 ce 1 1 sZcm 2 every 3 or 4 days. Conditions of culture was 37 ° C, 5% C_ ⁇ 2. For culture of COS-1 cells during repo overnight gene assembly, phenol-free DMEM medium containing 5% DCC-FBS (charcoal-treated FBS) and 10 nM insulin was used. COS-1 cells were seeded on a 6-well plate at a density of 5-8 x 10 4 ce 11 sZl. 75 mL / well, cultured overnight, and transfected with a reporter-one gene vector by the calcium phosphate method. .
- the amount of transfection is 3.33 X gDNA / 35 x L TE solution (0.33 / ig repo overnight gene vector, 0.08 / g rat vitamin D receptor expression vector). , 0. 5 zgpCH110, 2. 42 TE containing gB SM; TE is 1 OmM ris-HCl (pH7.5) , ImMEDTA) was prepared, to which 2MC aC 1 2 5 added, 40 while mixing the gentler / L HB S of the left (28 OmMN a C 5 OmMHEPE S 1. 5mMN a 2 HP0 4) at pressure forte room temperature for 1 hour.
- the cells are washed with 1 mL / well of DMEM medium without phenol red, and then again in DMEM medium without phenol red containing 5% DCC-FBS and 10 nM insulin. 1.
- the vitamin D derivative was added, and after culturing overnight, each well was washed with 2 mL of PBS, and the cells were peeled off in 1 mL of PBS using a cell scraper and collected in a tube. After centrifugation, the cells were suspended in 150 L of 0.25 M Tris-HCl (pH 7.8), and a cell lysate was prepared by freeze-thaw method. Using this cell lysate, a / -galactosidase assay was performed to correct the transfection efficiency, and then the expression level of CAT was measured using a CATELISA kit (Boehringer Mannheim).
- the VDRE-mediated action of each derivative was evaluated by calculating an EC50 value.
- the maximum dose of CAT induced by 25-dihydroxyvitamin D 3 is defined as the standard value of 100%, and the dose that induces the expression of 50% of CAT is the EC50 value of each derivative. It was calculated as
- VDRE-mediated transcription promoting activity and the inhibitory activity on the AP-1 complex or the NF- ⁇ B family were measured for the various vitamin D derivatives described above, and the degree of discrepancy between the two activities of each vitamin D derivative was evaluated. , 25-dihydroxy-bi evening Min 0 3 excellent derivative deviance of both activities as compared yielded more.
- the vertical axis, 1 alpha transcriptional promoting activity mediated VDRE, 25-Jihido Rokishibitamin D show third and EC 50 values as a relative value when the 100% and the horizontal axis, NF-? Kappa B family shed 1 inhibitory activity against one, 25 shown dihydroxy bi evening the IC 37. 5 value of Min D 3 as a relative value is 100%.
- FIGS. 1 and 2 indicate compound numbers (No.).
- the best derivative with respect to the degree of divergence of both activities is the derivative designated as Compound No. 22 (ie, 1 ⁇ , 3 / 3-dihydroxy-20 (R)-(2-ethyl-2-hydroxybutylthio)).
- Compound No. 22 ie, 1 ⁇ , 3 / 3-dihydroxy-20 (R)-(2-ethyl-2-hydroxybutylthio)
- Example 2 Effect of Compound Nos. 22 and 1 and 25-dihydroxyvitamin D on bone loss in osteoporosis model rats (subcutaneous administration)
- Statistical processing was performed using the basic software for statistical analysis (SAS). Unmatched t-tests were used to compare sham-operated (sham) and ovariectomized (OVX) groups, and Dunnett et al. Compared OVX and drug-treated groups or sham and drug-treated groups. The significance level was determined to be less than 5% by multiple comparisons.
- the Ca value and bone density are shown respectively.
- the bone density of each individual was calculated as a ratio (%) assuming that the average bone density of the sham group was 100%.
- both blood Ca and urinary Ca excretion were significantly higher than in the sham and ⁇ groups, and 1 ⁇ , 25-dihydroxybiamine D 3 At the same time, the effect on bone density and the effect of increasing blood Ca and urinary Ca excretion were simultaneously observed.
- d- Urinary Ca excretion, blood Ca level, and bone mineral density of the compound number 22 administration experiment are shown, respectively.
- the bone density of each individual was calculated as a ratio (%) assuming that the average bone density of the sham group was 100%.
- the lumbar vertebrae bone density decreased by about 11%
- the effect of suppressing bone density reduction was observed in the dose range of 0.01 to 0.1 g / kg.
- a significant inhibitory effect was observed at the dose of 0. lx gZkg.
- 1 alpha, 25-unlike dihydroxyvitamin D 3 in the compound No. 22, elevated blood C a value and urinary C a excreted are not observed, effects on activity and C a against the bone density Deviation was observed.
- 0VX significantly reduced bone density reduction, but blood Ca level and urinary Ca excretion Increased significantly in both sham group and 0VX group.
- both 1 alpha-hydroxyvitamin D 3 the same extent or showed more bone density reduction inhibitory effect, unlike the 1-hydroxyvitamin D 3, elevated serum Ca values and urinary Ca excretion does not occur, on bone density 0/00614
- Lumbar vertebral bone density was measured at the second to fourth lumbar vertebrae using a dual X-ray bone mineral density analyzer (DCS-600EX, Aroca).
- the bone strength of the 5th lumbar vertebra was measured with Autograph AG-2000E (Shimadzu Corporation).
- Blood calcium and urinary creatinine were measured by Hitachi Automated Analyzer using statistical analysis basic software (SAS). Comparison of sham group and 0VX group was performed by unpaired t-test, and comparison of 0VX group and compound No. 22 group or sham group and compound No. 22 group was performed by Dunne tt multiple comparison. Less than 5% was considered significant and tested.
- Dpyr urinary exoxypyridinoline
- the screening method of the present invention targets transcription factors (particularly transcription factors whose activation is inhibited via the vitamin D receptor) and can exert an effect on bone without causing hypercalcemia. It becomes possible to search for D derivatives.
- the vitamin D derivative searched by the screening method of the present invention inhibits the activation of a target transcription factor, thereby exerting a therapeutic effect on a disease in which the activation is involved in the onset or progression of the disease state. Can be expected to have.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Physical Education & Sports Medicine (AREA)
- Microbiology (AREA)
- Rheumatology (AREA)
- Biotechnology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IL14472600A IL144726A0 (en) | 1999-02-18 | 2000-02-04 | Method for screening compound having affinity for vitamin d receptor |
KR1020017010500A KR20010093339A (ko) | 1999-02-18 | 2000-02-04 | 비타민 d 수용체에 친화성을 갖는 화합물의 스크리닝법 |
AU23263/00A AU2326300A (en) | 1999-02-18 | 2000-02-04 | Method for screening compound having affinity for vitamin d receptor |
EP00902091A EP1158297A4 (en) | 1999-02-18 | 2000-02-04 | METHOD FOR IDENTIFYING A COMPONENT HAVING AFFINITY FOR THE VITAMIN D RECEPTOR |
CA002362071A CA2362071A1 (en) | 1999-02-18 | 2000-02-04 | Method for screening compound having affinity for vitamin d receptor |
NO20014001A NO20014001L (no) | 1999-02-18 | 2001-08-16 | Fremgangsmåte for screening av en forbindelse som har affinitet for vitamin D reseptor |
HK02102840.6A HK1042337A1 (zh) | 1999-02-18 | 2002-04-15 | 對維他命d受體有親和性的化合物的篩選方法 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP4009099 | 1999-02-18 | ||
JP11/40090 | 1999-02-18 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000049403A1 true WO2000049403A1 (fr) | 2000-08-24 |
Family
ID=12571201
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2000/000614 WO2000049403A1 (fr) | 1999-02-18 | 2000-02-04 | Procede permettant l'identification d'un composant presentant une affinite pour le recepteur de la vitamine d |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP1158297A4 (ja) |
KR (1) | KR20010093339A (ja) |
CN (1) | CN1341213A (ja) |
AU (1) | AU2326300A (ja) |
CA (1) | CA2362071A1 (ja) |
HK (1) | HK1042337A1 (ja) |
IL (1) | IL144726A0 (ja) |
NO (1) | NO20014001L (ja) |
WO (1) | WO2000049403A1 (ja) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102628872A (zh) * | 2012-03-31 | 2012-08-08 | 广州菲康生物技术有限公司 | 25羟基维生素d检测试剂盒及其制备方法 |
CN102692514A (zh) * | 2012-06-21 | 2012-09-26 | 厦门大学 | 血液25-羟基维生素d3腺癌检测试剂盒及其制备方法 |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0184206A2 (en) * | 1984-12-05 | 1986-06-11 | Chugai Seiyaku Kabushiki Kaisha | Vitamin D3 derivatives having a substituent at 2-position |
WO1995031722A1 (en) * | 1994-05-18 | 1995-11-23 | Ligand Pharmaceuticals, Inc. | Screening for cytokine modulators |
WO1998028266A1 (fr) * | 1996-12-20 | 1998-07-02 | Chugai Seiyaku Kabushiki Kaisha | Derives de vitamine d 16-ene |
WO1998039292A1 (fr) * | 1997-03-04 | 1998-09-11 | Kuraray Co., Ltd. | Derives de la vitamine d 20-epi-22(r)-alkyle inferieur-substitue et ameliorants du metabolisme calcique contenant lesdits derives en tant que substances actives |
-
2000
- 2000-02-04 CA CA002362071A patent/CA2362071A1/en not_active Abandoned
- 2000-02-04 EP EP00902091A patent/EP1158297A4/en not_active Withdrawn
- 2000-02-04 IL IL14472600A patent/IL144726A0/xx unknown
- 2000-02-04 KR KR1020017010500A patent/KR20010093339A/ko not_active Application Discontinuation
- 2000-02-04 AU AU23263/00A patent/AU2326300A/en not_active Abandoned
- 2000-02-04 CN CN00803952A patent/CN1341213A/zh active Pending
- 2000-02-04 WO PCT/JP2000/000614 patent/WO2000049403A1/ja not_active Application Discontinuation
-
2001
- 2001-08-16 NO NO20014001A patent/NO20014001L/no not_active Application Discontinuation
-
2002
- 2002-04-15 HK HK02102840.6A patent/HK1042337A1/zh unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0184206A2 (en) * | 1984-12-05 | 1986-06-11 | Chugai Seiyaku Kabushiki Kaisha | Vitamin D3 derivatives having a substituent at 2-position |
WO1995031722A1 (en) * | 1994-05-18 | 1995-11-23 | Ligand Pharmaceuticals, Inc. | Screening for cytokine modulators |
WO1998028266A1 (fr) * | 1996-12-20 | 1998-07-02 | Chugai Seiyaku Kabushiki Kaisha | Derives de vitamine d 16-ene |
WO1998039292A1 (fr) * | 1997-03-04 | 1998-09-11 | Kuraray Co., Ltd. | Derives de la vitamine d 20-epi-22(r)-alkyle inferieur-substitue et ameliorants du metabolisme calcique contenant lesdits derives en tant que substances actives |
Non-Patent Citations (1)
Title |
---|
See also references of EP1158297A4 * |
Also Published As
Publication number | Publication date |
---|---|
NO20014001L (no) | 2001-10-18 |
CN1341213A (zh) | 2002-03-20 |
NO20014001D0 (no) | 2001-08-16 |
HK1042337A1 (zh) | 2002-08-09 |
CA2362071A1 (en) | 2000-08-24 |
KR20010093339A (ko) | 2001-10-27 |
EP1158297A4 (en) | 2002-04-10 |
EP1158297A1 (en) | 2001-11-28 |
AU2326300A (en) | 2000-09-04 |
IL144726A0 (en) | 2002-06-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108245523B (zh) | 作为法尼醇x受体调节剂的胆汁酸的11-羟基衍生物及其氨基酸共轭物 | |
Feldman et al. | Vitamin D and prostate cancer | |
CN102083780B (zh) | 二缩水甘油醚衍生物治疗剂和它们的使用方法 | |
EP3245193B1 (en) | Heterocyclic compounds for cancer imaging and treatment and methods for their use | |
Diesel et al. | Vitamin D3 metabolism in human glioblastoma multiforme: functionality of CYP27B1 splice variants, metabolism of calcidiol, and effect of calcitriol | |
HUT68263A (en) | 20-methyl-substituted vitamin d derivatives, process for their production, pharmaceutical compositions and intermediates | |
JP5036566B2 (ja) | 2−メチレン−19−ノル−(20S−24S)−1α,25−ジヒドロキシビタミン−D2 | |
KR20020028876A (ko) | 스테로이드 유도체 | |
CA3021008A1 (en) | Bisphenol derivatives and their use as androgen receptor activity modulators | |
WO2015031984A1 (en) | Halogenated compounds for cancer imaging and treatment and methods for their use | |
US20090263492A1 (en) | Diagnostic Methods and Genetic Markers for Alzheimer Disease | |
WO2016141458A1 (en) | Bisphenol ether derivatives and methods for using the same | |
Kittaka et al. | Potent 19-norvitamin D analogs for prostate and liver cancer therapy | |
JP5036565B2 (ja) | 2−メチレン−19−ノル−(20S−24エピ)−1α,25−ジヒドロキシビタミン−D2 | |
PT97256A (pt) | Processo para a preparacao de derivados de 24-oxa na serie da vitamina d e de composicoes farmaceuticas que os contem | |
Li et al. | W2476 ameliorates β-cell dysfunction and exerts therapeutic effects in mouse models of diabetes via modulation of the thioredoxin-interacting protein signaling pathway | |
Hussain-Hakimjee et al. | Growth inhibition of carcinogen-transformed MCF-12F breast epithelial cells and hormone-sensitive BT-474 breast cancer cells by 1α-hydroxyvitamin D5 | |
WO2000049403A1 (fr) | Procede permettant l'identification d'un composant presentant une affinite pour le recepteur de la vitamine d | |
Marro et al. | Lack of haptoglobin affects iron transport across duodenum by modulating ferroportin expression | |
US6537980B1 (en) | Vitamin D analogues and their pharmaceutical use | |
Glebocka et al. | New 1α, 25-dihydroxy-19-norvitamin D3 compounds constrained in a single A-ring conformation: synthesis of the analogues by ring-closing metathesis route and their biological evaluation | |
WO2011046200A1 (ja) | 分化誘導因子又はその類縁体を含有する抗炎症剤 | |
JP5789874B2 (ja) | 生活習慣病予防・治療剤 | |
Sutton | The regulation and function of 1, 25-dihydroxyvitamin D (3)-induced genes in osteoblasts | |
CN114778845A (zh) | 药物组合物或食品组合物及评价活性成分体内效果的方法 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 00803952.6 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 23263/00 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2362071 Country of ref document: CA Ref document number: 2362071 Country of ref document: CA Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 144726 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09913404 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1020017010500 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000902091 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1020017010500 Country of ref document: KR |
|
WWP | Wipo information: published in national office |
Ref document number: 2000902091 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000902091 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1020017010500 Country of ref document: KR |